Recombinant virus made with viral vector and human tumour gene supressor, its application

FIELD: medicine.

SUBSTANCE: recombinant virus containing human gene p53, its application, manufacture method and pharmaceutical composition are offered.

EFFECT: invention can be used for gene therapy in human malignant neoplasm treatment and prevention.

8 cl, 14 dwg, 7 ex

 

The scope of the present invention

The present invention relates to genetic engineering, in particular recombination gene tumor suppressor of human p53 and the adenovirus vector.

Background of the present invention

Currently, acute studies (along with the development of techniques of molecular biology, in particular the improvement of methods of genetic engineering) is gene therapy with regard to malignant tumors. For clinical trials of gene therapy are currently allowed more than 600 programs. Some of these programs have demonstrated positive results that indicate a promising future.

Used in gene therapy vector to apply directly for the treatment of diseases is impossible. On the other hand, genes that can be used to treat diseases, are only likely curative effect, since it is directly implemented in the target cell, and then to implement them in the expression of protein is a very complex task to perform. In order to create the effect of potential therapeutic genes, first of all it is necessary that the vector was connected with the target gene, then using transfection make specified gene in target cells, after which the target gene will be able to penetrate into acikladi and implement them in the expression of the protein. Therefore, the goal of gene therapy is the construction of recombinant DNA for therapeutic gene and gene vector.

The usual way of recombination cassette (group linked loci) of expression of a target gene with its vector is homologous recombination in eukaryotic cells, which is a very difficult and monotonous process. However, the above problem can solve using for homologous recombination and construction of recombinant vectors for prokaryotic cells.

Bottleneck genetic engineering is the lack of specific, targeted and efficient vectors for gene transfer. Currently in research on gene therapy are two kinds of vectors, including viral and non-viral vector. Standard viral vectors include adenovirus vector, the vector associated adeno - and retrovirus. The most standard is the vector of adenovirus. The main advantages are: high speed transfection, the relative safety and ease of use, ability to serve as a carrier of large fragments of the gene, the ability to cook high, suitable for industrial production titers of virus particles, as well as the ability to infect cells not only in the phase of division, but also in other phases. However, the disadvantages of this ve the Torah are the lack of specific infections and the lack of production of antigenicity. Therefore, the goal of gene therapy requires a review of adenovirus vector. The present study shows that the foreign gene carried by the vector is an adenovirus, an area deletions in E1 and E3, may cause long-term expression of the protein and the reduction of antigenicity. The retrovirus vector capable of transferring a foreign gene and integrated into the genome of target cells, realizing thus a stable and long-lasting gene expression. Retrovirus has the following disadvantages: low titer reproduction in vitro, the low efficiency of transfection, infection of cells only in the phase of division, as well as random recombination with the chromosome of potentially carcinogenic activity. Other viral and non-viral vector used in the transformation of the gene, also have different advantages and disadvantages.

Summary of the present invention

The purpose of the present invention is the recombination of potentially therapeutic genes and their vectors, while having the recombinant vector virus and gene tumor suppressor person. This recombinant is capable of amplificates and distributed in cells, specially created by genetic engineering, and it can realize the expression of the protein directly into eukaryotic cells, after which the specified recombinant can be used for sovan for the prevention and/or treatment of tumors.

The aim of the present invention is the provision of a method of implementation of this recombination and its application in obtaining medicinal products intended for the prevention and treatment of tumors.

The present invention provides a recombinant vector virus and gene tumor suppressor person. Specified recombinant constructed by the method of cloning DNA using the vector virus and cassette gene expression of tumor suppressor person. The resulting product is a recombinant, which can amplificates and distributed in cells, specially created by genetic engineering, and it can also be the expression of protein gene tumor suppressor in eukaryotic cells.

The recombinant vector can be either a DNA virus or RNA virus. The preferred vector is an adenovirus, or an associated vector containing the sequence of the adenovirus vector. The most preferred adenovirus vector.

Gene is a tumor suppressor person can be any gene is a tumor suppressor, the most preferred gene p53.

Recombinant associated with the vector and the genome of adenovirus p53, defined as a recombinant p53 adenovirus having the following sequence:

The right end of the adenovirus

2848- the left end of the adenovirus 5, in which:

1) the right end of the adenovirus 5 and the left end of the adenovirus 5 describes the complete sequence of the adenovirus 5 (Genbank No: NC_001406);

2) 1-70: right shoulder adenovirus (70 base is located at the position 3328 sequence of the gene of adenovirus 5);

3) 71-523: long terminal repeat (DCT) (promoter) of the rous sarcoma virus (RSV);

4) 524-655: 5' noncoding region;

5) 656-1837: a sequence encoding a gene p53;

6) 1838-2733: 3' untranslated region (end of polyadenine (poly A) starts from a position 2298);

7) 2734-2848: left shoulder adenovirus (base 2734 is located at 452 position sequence of the gene of adenovirus 5).

Cassette gene expression recombinant is a specific sequence, composed of the promoter-RCD-polyadenine, in which the rising region of the cassette does not contain any promoter eukaryotic cells, prokaryotic promoter cells or the promoter of the virus and its downward region contains polyadenine (poly A) any eukaryotic cells.

The recombinant DNA of the present invention was prepared as follows. The method of homologous recombination in prokaryotic cells was obtained recombinant vector virus. First homologous recombination adenovirus with plasmid pGT-1 (including insertRow the installed terminal repeats of adenovirus at both ends) in E. coli was constructed recombinant pGT-2. Then homologous recombination pGT-2 with artificial sequence right shoulder adenovirus /promoter-RCD-paladinos/ left shoulder of adenovirus in E. coli was constructed recombinant pGT-3. Finally, after discarding sequences of prokaryotic plasmids obtained recombinant p53 adenovirus. For this process used the endonuclease Pacl.

Long terminal repeats (DCT) both ends of adenovirus was amplified as described above for the polymerase chain reaction (PCR) and introduced respectively the sites of the restriction enzyme Pacl. Both pieces of DCT cloned into the vector pUC18, receiving recombinant sequence pGT-1. Then built pGT-1 with adenovirus 5 was subjected to transfection into E. coli. After that the gene of adenovirus 5 was re-homologous combined with pGT-1. The positive clone of the virus amplified, subjected to pre-screening according to PCR and then analyzed using restriction enzymes. In the end, was obtained recombinantly vector pGT-2, containing the full sequence of the gene of adenovirus 5.

Gene is a tumor suppressor of human p53 was amplified by PCR, using as primers 5' ATGGCAGAGAGGAGGTTGAC and 5' TATCCGTCCA. After that, the full sequence of the gene p53 (including noncoding sequences 5' and 3') cloned in the vector pC19 and confirmed its structure by DNA sequencing. Then the sequence of the long terminal repeat of rous sarcoma virus (containing the promoter sequence), and the RA sequence of BGH and E1 sequence of adenovirus was amplified by the method of chain reaction. On one side of each of the above sequences attached linker sequence and spent confirmation by DNA sequencing. In a subsequent PCR reaction sequence DCT and the sequence RA were attached to the 5'- and 3'-ends of p53, respectively. Region E1 adenovirus, as well as its rising sequence were attached to the outside of p53, and thus was built the cassette gene expression of p53 (see figure 1).

E. coli BJ5183 subjected joint transfection using a recombinant vector pGT-2 and the gene expression cassette, which was homologous recombination. After that amplified positive clones, held a screening PCR and confirmed by reaction with a restriction enzyme. The resulting vector was pGT-3, which contained the largest portion of the sequence of adenovirus 5 (region E1 and the ascending part of the sequence have been replaced by a cassette of p53 expression). Recombinant vector pGT-3 was linearizable using Pacl, and the sequence beginning with pUC18, was omitted. After that, pGT-3 using the Ali for transfection of 293 cells (canned SiBiono Company, room store E-393). Recombinant condensed into cells and received the p53 gene is a tumor suppressor person, which includes acting in CIS-position sequence of the promoter of the long terminal repeats of adenovirus. The resulting recombinant p53 adenovirus had a high rate of transfection, it was easy to carry out a number of operations and he was controlled by a single promoter.

Recombinant adenovirus p53 had the following characteristics:

It was built using adenovirus vector and cassette synthetic gene p53.

1. Structure: it is a live recombinant adenovirus that is different from other chemically synthesized drugs, herbs and medicines, obtained by genetic engineering. Specified recombinant has high biological activity, it can produce the expression directly in vivo and possesses efficiency, high from a clinical point of view. The adenovirus may be a carrier of large gene fragment, it has a high rate of transfection, it can be obtained in the form of particles of the virus to high titer, and is characterized by a very wide range of hosts, also proved its high security. The immunogenicity of the adenovirus vector was significantly reduced, especially after the modifications, thus,the gene target is easy to stabilize and subject expression in vivo. In the cassette synthetic gene expression gene expression of p53 was monitored directly using a single promoter of adenovirus vector; added signal polyA tail, and thus was built the cassette is intact expression.

2. Application: the recombinant p53 adenovirus is an anticancer drug with a wide spectrum. It can be used for treatment of many malignant tumors. Phase II clinical trials showed that he has, in particular, a significant therapeutic effect in squamous carcinomas of the head and neck, and the breast cancer. Recombinant p53 adenovirus is particularly effective to prevent the recurrence of neoplastic processes. Phase I clinical trials, and observation within 3 years after surgery showed that the recombinant, playing the role of tumor vaccine prevented postoperative recurrence in patients with cancer of the larynx.

Specified recombinant can also be made in the form of drugs for intravenous injection, arterial injection, intratumoral injection, intramuscular and subcutaneous injection, and injection into the pleural effusion or ascites.

Recombinant p53 adenovirus of the present invention may be used is, first of all, for the transfection of specific cells, created by genetic engineering. After that, these cells were grown, they were concentrated, dissolved and purified, resulting in a was obtained clinically pure recombinant p53 adenovirus for intratumoral injection.

293 cells used in the present invention (ACTS CRL-1573, 32nd generation purchased from ATS June 13, 1997), was subjected to screening against the epithelial cells of the kidney of a human embryo, transformed with adenovirus 5 (Ad 5) DNA and containing 11% of the genome (including EA) with 5'-end Ad 5. These cells were highly permissive to infection with adenovirus, as well as permissive for the growth of adenovirus.

On stage I clinical trials indicated recombinant p53 adenovirus was used for 12 patients with laryngeal cancer middle and late degree. Later 31-36 month after this treatment the patients seen again. The results showed that the use of this recombinant adenovirus was extremely safe. None of the 12 patients, no recurrence was observed. At the present time within 3 years survived only 44% of these patients, and the frequency of postoperative recurrence for 6-12 months was 20%. Clinical trials conducted for the present invention showed that recombin the HT can be used not only in the treatment of neoplasms, but also to prevent them. Phase II clinical trials are conducted continuously since 2001. The effect of the treatment was very promising. Shown in Fig.9-13 the results show that the recombinant of the present invention was also effective for the treatment of those patients who were unresponsive to conventional therapies (chemotherapy and radiotherapy).

The main contribution of the present invention is the advantage of gene suppressor p53 tumor of the person who is able to suppress many cell neoplasms. Specified gene was cloned into the adenovirus E1, which helps p53 gene to infect tumor tissue, and which was administered by injection into the tumor. Then gene suppressor was subjected to expression in the form of the p53 protein that can inhibit the growth of the tumor tissue or even destroy tumor cells. The present invention also provides a method of obtaining the specified product recombination adenovirus p53, which solves the problem caused by the instability of p53 protein in vitro (half-life = 20 min).

Recombinant adenovirus p53 gene transfers-suppressor p53 tumor-man and spends his expression directly in tumor cells, while this solves the problem that the recombinant product of genetic engineering (here it is a protein of p53) is not able to solve in vitro. When used for Le is placed neoplasms of adenovirus and adeno-associated virus protein p53 can continuously and with high efficiency to carry out the expression in vivo. Moreover, changes of the protein at the molecular level (including phosphorylation, conformation and polymerization) is similar to eukaryotic cells. Recombinant p53 adenovirus of the present invention can be used as a mediator of p53 gene expression in eukaryotic cells by direct injection of the indicated recombinant in the tumor, the patient is effectively used as a source for the production of p53 protein as a factor of the tumor suppressor. In this way the human body was successfully introduced foreign gene p53, and allowed its high level of expression in tumor tissue. This makes it possible gene therapy of tumors and other diseases.

Detailed description of drawings

Figure 1 schematically depicts the process of constructing recombinant p53 adenovirus.

Figure 2 shows a sequence diagram of operations according to the Protocol of the experiment for obtaining recombinant p53 adenovirus.

Figure 3 shows the result of agarose gel electrophoresis of the product of amplification of recombinant p53 adenovirus according to PCR after migration; as matrix used p53 cDNA, and primers sequence 5' CZECHATHEART' and 5 CAAGCAGCAG'. The obtained result confirms the stability of recombinant p53 adenovirus. Number 1 shows On The To the marker; figures 2, 3, 4 - results of PCR for p53 cDNA.

Figure 4 shows the result of agarose gel electrophoresis of the product of amplification of virus DNA (p53, 2750bp)obtained from cells previously infected for 36 h with recombinant p53 adenovirus (canned SiBiono Company, storage room No-1). Figure 1 labeled DNA marker; figures 2, 3, 4 - results of PCR for p53 adenovirus.

Figure 5 shows the results of Western blotting (method for the determination of the desired protein in a complex protein mixture) lysate of cells hep-2 and H1299 after these cells were infected with recombinant p53 adenovirus for 36 hours Figure 1 is the protein marker; figures 2-3 - negative regulation, respectively, cells Hep-2 and H1299 cells not infected SBN-1; 4-5, respectively cells Hep-2 and H1299 cells infected with SBN-1.

6 is a curve showing the effect of lysis of various doses of recombinant p53 adenovirus in cells Hep-2. H cells (cultural tablet on 6 cells). Cells were stained blue phenolic dye and count the cells died after infection SBN-1 (MOI, multiplicity of infection was 0, 1, 10, 50, 100 and 150).

7 is a curve showing the inhibition of cells Hep-2 recombinant p53 adenovirus. Cells were stained blue phenolic dye and count the cells died after infection with 100 SBN-1 24, 48, 72, 96 h).

On Fig shows micrographs of cells Hep-2 after 36 h after they were infected with recombinant p53 adenovirus. 1 - control; 2 - MOI 200; 3 - MOI 150; 4 - MOI 100; 5 - MOI 50; 6 - MOI 10; 7 - GFP virus MOI 200; 8 - GFP virus MOI 150;

Fig.9 (photo) presents the results of computer tomography, describing the clinical effects of recombinant p53 adenovirus in processing them in the case of cancer of the nasopharynx (phase II). The left photo is the reflection before treatment, and right after it (the tumor has decreased by 87%, marked necrosis).

Figure 10 (photo) presents the results of radiography (figa and b) and computed tomography (figa and In describing the clinical effect of recombinant p53 adenovirus in processing them in the case of lung cancer (phase II). The left pictures (figa and (C) reflect the picture before processing, while the right (figv and D) after treatment with recombinant p53 adenovirus in 1 month.

11 (photo) presents the results of computer tomography, describing the clinical effects of recombinant p53 adenovirus in processing them in the case of thyroid cancer (phase II). The left photo is the reflection before treatment (tumor size 22.5 cm2pressed to the trachea), and right after treatment for 1 month. Marked reduction of the tumor to 11.7 cm2(48%).

Fig (photo) presents the results of computer tomography, opisyvayuscii the clinical effect of recombinant p53 adenovirus in processing them in case of carcinoma of the neck (phase II). The left photo is the reflection before treatment (tumor size of 30 cm2), and right after treatment for 1 month. The tumor decreased to 3.8 cm2(91%), and then disappeared.

Fig (photo) presents the results of computer tomography, describing the clinical effects of recombinant p53 adenovirus in processing them in the case of esophageal cancer (phase II). The left photo is the reflection before treatment (tumor size 10.5 cm2), and right after treatment for 1 month. Marked reduction of the tumor to 7.0 cm (29%).

Detailed description of the variants of the present invention

Listed below are further disclosure of the present invention. However, its practical application is not limited to these options.

Experiment 1:

Construction and characterization of recombinant p53 adenovirus according to figure 1 and figure 2.

1. Based on published full length sequence of p53 cDNA was developed 2 primer:

These primers were: 5 ATGGCAGAGAGGAGGTTGAC and 5' TATCCGTCCA. To both ends were attached sequence linkers. Gene p53 man amplified by the polymerase chain reaction using as a template cDNA HeLa cells. Experimental conditions were as follows:

In the first cycle denaturation of DNA was carried out for 4 is in at 94°C, hybridization was performed 1 min at 58°C and then for 2 min at 72°C was carried out rectification. In each of the subsequent cycles denaturation of DNA was carried out for 1 min at 94°C, hybridization was performed 1 min at 58°C and then for 2 min at 72°C was carried out rectification. The total number of such cycles is 30. The result is a large number of fragments of the gene p53. After that analyzed the specified gene, we used the agarose gel electrophoresis. The full sequence of p53 gene were extracted from the gel, spent clearing, then cut with restriction enzymes (restriction enzyme) and introduced into the vector pUC19, which was cut with the same enzyme. Received then the fragment sequenced. Did sequence analysis of the coding region (gene), and the predicted amino acid sequence was represented by a sequence of GenBank ACE HM. In conclusion, the specified fragment was digested with restrictase and again collected.

2. On the polymerase chain reaction amplified a sequence of long terminal repeat (DCT) and the sequence of RA. Primers were, respectively:

5' TTTGGATTGT,

5' GGCATCGACTAGCAG;

5' TZARAATH TGHTGGVG,

5' CCTCTGGATC.

Linker serial is a major was attached to the primers 5' and 3 sootvetstvenno. The sequence of DCT and RA were amplified in the above-described conditions. Amplificatoare fragments were purified and their structure confirmed by sequencing.

3. Sequence E1 adenovirus was amplified separately by the polymerase chain reaction, a process performed in the above-described conditions. With both ends of the primers were joined sites restitute for Bam HI and Eco RI, respectively. After amplification of these fragments were subjected to sequencing.

4. Spent the connection of one fragment with stage 1 and two fragments from stage 2 by the polymerase chain reaction. Experimental conditions were the same as described above. As a result, the quality of the product received DCT-p53-RA. The obtained sequence was subjected to sequencing.

5. Fragment from the stage 3 and DCT-p53-RA joined using T4 DNA ligase. The resulting sequence was cassette p53 gene.

6. According to the polymerase chain reaction were amplified sequence of the inverted terminal repeat (ICP), the process is conducted in the same experimental conditions as described above. The fragments obtained by sequencing, and cloned into the vector pUC18. The result was obtained recombinant vector pGT-1.

7. E.coil BJ5183 and natural DNA of adenovirus 5(ATCC-VR-5, adenovirus 75, title: 10(6,75) TCID (50)/ml) was subjected compatible with the Noah of cotransfection, using recombinantly vector pGT-1. After soaking for 30 min at 4°C experienced transfection of bacteria within 50 were subjected to heat shock at 42°C and then kept at 4°C for 1 min In conclusion, bacteria are introduced into 1 ml of LB medium, and spent incubation for 1 h Then recombinante bacteria were placed in a medium of agar containing ampicillin, and incubated it for 24 hours using aseptic toothpicks gathered a single clone and put it to 24 h incubation in a container containing the LB medium. Extraction of plasmids was carried out by standard methods and implemented them screening the enzymatic splitting of Pacl. Positive clones were pGT-2 (containing the full sequence of the Ad5).

8. E.coil BJ5183 and cassette p53 gene was subjected to joint cotransfection using recombinantly vector pGT-2. Methods incubation, pre-screening and determination of parameters was carried out as described above. Positive clones were pGT-3, which contains the full sequence of adenovirus and embedded cassette expression of p53 gene. After these clones were linearized using Pacl, the sequence of the vector, starting with pUC18, was thrown.

9. Positive linear plasmids were purified using CsCl, and then they were used for transfection of 293 cells used is for this CaCl 2. After 7 days cells were collected and held them centrifugation, the process was carried out for 15 minutes at a rotational speed of 1000 revolutions/min, the Resulting supernatant was discarded. The cells three times were subjected to lysis at 37°C and at -80°C. Again held centrifugation (30 min, a rotational speed of 4000 rpm). Precipitation was omitted. Cells infected supernatant was subjected to lysis as described above. The resulting supernatant was centrifugally using CsCl for 16 h at 4°C, the speed was 60000 rpm Zone recombinant adenovirus were extracted using a needle No. 7. Contributed DNA fragment together with a buffer N1H and dialyzed for 4 h at 4°C, the process was performed in a dialysis bag Spectra MW6000. The obtained DNA solution sterilized, and passing it through a 0.25 μm filter, and then Packed and stored at -80°C. part of the resulting product was used in the analysis of belascoaran (method of calculation antibody productive cells in vitro and in fixing the titer of virus particles.

10. Test of recombinant adenovirus on the stability of the structure. As a result of several reproductions received the genomic DNA of the virus. The DNA fragments amplified according to the PCR, with both ends of p53 as a primer used 5' CZECHATHEART and 5' CAAGCAGCAG. Figure 3 p is Evegeny the results of agarose gel electrophoresis. Shoulders of adenovirus from both sides of recombinant adenovirus p53 were designed as primers: 5' TTTTTTTTTTTTT and 5 CAT CHARCTERISTIC. The results of the polymerase chain reaction is shown in figure 4. The above data indicate that the structure of the recombinant adenovirus p53 after a large number of reproductions was stable.

11. Test on the expression of p53 gene in cells of the ner-2 and H1299. Cells ner-2 and H1299 were subjected to standard lysis after a period of 36 h was carried out transfection of recombinant p53. Figure 5 shows the results of the Western blot for antibodies specific against p53 protein.

12. The influence of duration and dose of recombinant adenovirus p53 transfection of cells ner-2 and H1299 within 36 h after infection was carried out cells ner-2 and H1299 the recombinant adenovirus p53. The study drew attention to the different effects of recombinant DNA on the cytolysis of cells of the ner-2 and H1299 at a different dosage of the indicated recombinant and different duration of infection. Cells were stained blue phenolic dye and count the dead cells. The results obtained are shown in Fig.6 and Fig.7.

Experiment 2:

The effect of cytolysis recombinant p53 adenovirus in tumor cells:

cells ner-2 was subjected to transfection, recombinant adenovirus p53 standard is the first method.

In each group of cells count was conducted in the same way. Cells were divided into the following groups: 1 - control of the reference group; 2 - MOI (multiplicity of infection) 200; 3 - MOI 150; 4 - MOI 100; 5 - MOI 50; 6 - MOI 10; 7 - GFP virus MOI 200; 8 - GFP virus MOI 150. Cells were incubated 36 h after transfection. The effect of cytolysis recombinant p53 adenovirus in tumor cells could be observed under a microscope at a multiplicity of infection constituting not more than 50. This effect increased with increasing dosage. Under the microscope it was observed shrinkage of the cells and their staining. The results are shown in Fig.

Experiment 3:

Clinical effects of recombinant adenovirus p53 (cancer of the nasopharynx).

Figure 9 shows that the recombinant adenovirus p53 was used in clinical trials in a number of hospitals designated by the Department for food and medicines. This drawing represents the results of computed tomography of a patient with cancer of the nasopharynx before and after treatment using recombinant adenovirus p53. The left photo is the reflection before treatment, and right after it (the tumor has decreased by 87%, marked necrosis). In clinical trials involved more than 60 patients with phase II of the specified diseases. The clinical effect of treatment was significant.

Experiment 4:

Clinical effects of recombinant adenovirus p53 (lung cancer). Figure 10 presents the results of clinical trials of recombinant p53 adenovirus for the treatment of lung cancer (phase II). Participating in this experiment the woman had adenocarcinoma of the lung, pleural effusion in the left breast, liver metastases, bone and brain. After repeated extraction and sessions of chemotherapy pleural effusions reappeared in large numbers. However, after treatment with recombinant adenovirus p53 within 1 month of pleural effusion in this patient completely disappeared.

Experiment 5:

Clinical effects of recombinant adenovirus p53 (cancer of the thyroid gland).

Figure 11 shows the clinical effect of recombinant p53 adenovirus when processing them in the case of thyroid cancer (phase II). Participating in a clinical trial, the patient had thyroid cancer, renewed after 1 year after surgery. In the right upper narrow part of the cancer had metastasized lymph, which were diagnosed as poorly differentiated squamous cell cancer. 1 year later after treatment with radiotherapy, chemotherapy, and hyperthermia is no positive dynamics were observed, the patient became difficult to breathe, because the tumor was pressed to the trachea. After the patient 8 times were injected with recombinant adenovirus p53, the tumor decreased significantly (48%).

Experiment 6:

Clinical effects of recombinant adenovirus p53 (cancer of the neck).

On Fig shown clinical effects of recombinant p53 adenovirus when processing them in the case of cancer of the neck (phase II). Carcinoma patient in this experiment was diagnosed as casuality cancer. After the patient 8 times were injected with recombinant adenovirus p53, the tumor decreased significantly (91%). 3 months later, the tumor had disappeared completely.

Experiment 7:

Clinical effects of recombinant adenovirus p53 (cancer of the esophagus). On Fig shown clinical effects of recombinant p53 adenovirus when processing them in the case of esophageal cancer (phase II). Esophageal cancer participating in the experiment a patient with subclavian metastatic lymph nodes was diagnosed as casuality cancer. Radiotherapy is any positive results has not given. After the patient 8 times were injected with recombinant adenovirus p53, the tumor decreased significantly (29%).

1. Recombinant virus for the prevention and/or treatment of tumors having the sequence of SEQ ID No.l, containing the adenovirus vector and the cassette gene expression human p53, characterized in that the adenovirus vector is a combined vector containing the sequence of the adenovirus vector and the specified vector E1 adenovirus cut; tape Express the AI gene composed of the promoter of the long terminal repeat of rous sarcoma virus 5', operating in the CIS-position sequence p53 cDNA 3', operating in the CIS-position sequence polyadenine.

2. The recombinant virus according to claim 1, characterized in that the adenovirus vector constructed in accordance with the method of cloning DNA.

3. Pharmaceutical composition for prevention and/or treatment of tumors containing an effective amount of recombinant virus according to any one of claims 1 to 3, and pharmaceutically acceptable carrier.

4. The pharmaceutical composition according to claim 3, characterized in that it is a dosage form selected from the group including injections, tablets, capsules, pills, solutions, suspensions and emulsions.

5. The application of the recombinant virus according to claim 1 for the preparation of drugs for the treatment of malignant tumors.

6. The application of the recombinant virus according to claim 1 for the preparation of drugs for preventing postoperative recurrence of tumors.

7. A method of obtaining a recombinant virus according to claim 1, characterized in that the recombinant virus get in any prokaryotic cells using homologous recombination.

8. The method according to claim 7, characterized in that the method comprises the following stages:
1) preparation of recombinant virus pGT-2 using homologous recombination adenovirus and loft the IDA pGT-1, containing at both ends of two adenovirus inverted terminal repeat, in E. coli;
2) preparation of recombinant virus pGT-3 using homologous recombination pGT-2 and artificial sequence right shoulder adenovirus /promoter-cgncr-polyhedrosis/ left shoulder of adenovirus in E. coli;
3) preparation of recombinant virus p53 adenovirus by dropping the prokaryotic sequences using endonuclease Pacl.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention is related to preparation of protein, binding tumour necrosis factor (TNF), and may be used in medicine. Strain-producer of baculovirus BvG2RIgG is created with the help of recombinant plasmid DNA pFastBac-G2R-IgG with size of 6444 p.n. and molecular mass 4.18 mDa, which bears fragment of smallpox virus genome of strain India-1967, which codes protein that binds TNF, and fragment of human genome, which codes fragment of heavy chain of human antibody G. Produced strain produces soluble chimeric protein, which consists of smallpoz virus protein, which binds TNF, and fragment of heavy chain of human antibody G.

EFFECT: wider spectrum of new generation preparations intended for treatment of human diseases related to hyperproduction of tumour necrosis factor.

2 cl, 3 dwg, 1 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention concerns medicine and biotechnology. There is disclosed application of coding DNA for making virus-like particles of hepatitis C virus, as well as the method for making the specified particles and a pharmaceutical composition using the same. The virus-like particles cause induction of interferon system in vivo.

EFFECT: invention can be used for making a preparation for prevention and treatment of the HCV-related conditions, as well as diagnostics thereof.

5 cl, 4 dwg, 1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention claims synthetic DNS molecule encoding L1 HPV58 protein, where codons are optimised for high expression level in yeast cell. Also invention claims expression vector, yeast host cell, HPV58 virus-like particle and method of its obtainment, and pharmaceutical composition including such VLP.

EFFECT: invention can be applied in medicine for efficient immune prevention of papillomavirus infection by neutralising antibodies and cell-mediated immunity, and for treatment of developed HPV infections.

10 cl, 10 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: invention concerns virology and medicine area. The synthetic DNA-molecule coding protein L1 HPV45 is presented. Thus DNA-molecule was Codonum-optimised for high-level protein expression in a yeast cell. The given synthetic molecules can be used for reception of virus-like particles (VLP) HPV45 and for reception of vaccines and the pharmaceutical compositions containing VLP-particles HPV45.

EFFECT: effective immunologic prophylaxis of infections with papilloma virus due to neutralised antibodies and cellular immunity.

9 cl, 6 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: there are offered recombinant protein molecule M2E-HBC, and virus-like particles formed of such molecules. The recombinant virus-like particle based on nuclear antigen of hepatitis B virus represents surface polypeptides of outer domain M2 of avian influenza virus protein. The produced virus-like particles are characterised with high immunogenicity. There is also disclosed vaccine for the infection caused by avian influenza virus, including such virus-like particles as an active agent.

EFFECT: preparations are active to various strains of avian influenza virus and can be considered as a candidate for universal avian influenza virus type A vaccine.

7 cl, 8 dwg, 4 tbl, 8 ex

FIELD: biology, genetic engineering.

SUBSTANCE: invention concerns molecular biology and genetic engineering. Invention claims synthetic DNA molecule encoding HPV31 L1 protein, virus-like HPV31 particles, vaccine and pharmaceutical composition including virus-like HPV31 particles.

EFFECT: papilloma virus therapy.

17 cl, 6 dwg, 8 ex

FIELD: chemistry, biochemistry.

SUBSTANCE: invention relates to virology and genetic engineering. Claimed is recombinant virus of fowl pox, inducing immune response against hepatitis C (HCV) virus, containing DNA-fragment obtained from HCV. Said DNA-fragment codes fragment core-E1 polyprotein or chimeric protein, containing HCV epitopes, specific to helper and cytotoxic T-cells. Also claimed is pharmaceutical composition containing such virus.

EFFECT: invention can be used in medicine.

9 cl, 8 dwg, 4 ex

FIELD: chemistry, biochemistry.

SUBSTANCE: invention refers to molecular biology, virology and genetic engineering. There are disclosed method of producing recombinant influenza virus with mutant gene NB of membrane protein, recombinant influenza virus produced by this method, and vector composition based on parts of recombinant influenza virus.

EFFECT: developed method of recombinant influenza virus with mutant gene NB of membrane protein.

24 cl, 8 dwg

FIELD: medicine; virology.

SUBSTANCE: strain expresses the VP2 protein which contacts a monoclonal antibody moab B69 and moab 67, cosecreted by the monoclonal antibody cellular lines HB-9437 and HB-11122. Contains a mutation of coding area of the classical VP2 in the position 222, coding series or threonine, and the nucleotide sequence coding amino-acid sequence, presented in any of SEQ ID No. 1-5 in position 318-323.

EFFECT: effective utilisation for bacterination against infectious bursal disease.

24 cl, 1 dwg, 5 tbl, 2 ex

FIELD: technological processes; veterinary medicine.

SUBSTANCE: method consists in the following: in cells LMH homologous recombination is performed between genomic DNA of birds adenovirus CELO with deleted right end fragment and plasmid structure, which contains the right end fragment of CELO genome with deletion in 3620 bps, in the area of which the expressing cassette with gene of birds flu virus H5N1 hemagglutinin is cloned, or with gene of birds flu virus H5N1 neuraminidase, or with both above mentioned genes.

EFFECT: creation of genetically engineered recombinant vaccines of new generation.

4 cl, 5 dwg, 7 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention pertains to bioengineering. In particular, the invention relates to method of obtaining recombinant mutant horse cytochrome c. This method is realised by introduction of K27E/E69K/K72E/K86E/K87E/E90K or K8E/E62K/E69K/K72E/K86E/K87E or K8E/K27E/E62K/E69K/K72E/K86E/K87E/E90K mutations through site-directed mutagenesis into the horse cytochrome c gene which is contained in pBPCYCS/3 plasmid DNA. Further, the Escherichia coli JM-109 strain of the obtained recombinant plasmid DNA is transformed and the target protein is expressed and introduced through cation-exchange and adsorption chromatography.

EFFECT: invention enables use of recombinant mutant horse cytochrome c as a test system for measuring the rate of generation of superoxide in membrane preparations.

3 dwg, 5 ex

FIELD: biotechnologies.

SUBSTANCE: method is based on assessment of ACTN3 genotype, where genotype 577RR is positively related to sprinter or power abilities; genotype 577XX is negatively related to sprinter or power abilities; genotype 577XX is positively related to stamina; genotype 577RX is positively related to sprinter or power abilities; and genotype 577RX is negatively related to stamina in women.

EFFECT: method makes it possible to select type of sports or competitions for an individual, for instance speed-power type of sports or type of sports that requires stamina, and to develop more optimal training regime for a single sportsman.

1 dwg, 6 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: gene of human vascular endothelial growth factor (VEGF) optimised for expression in mammal cells is presented.

EFFECT: due to introduction of VEGFopt gene into pC4W-VEGFopt plasmid, the invention allows improving the yield of an end product in 1,5 times in comparison with the technology of pC4W-hVEGF165 plasmid containing a natural gene.

3 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: invention concerns technology of genetically engineered constructs to be applied in cell-based and gene therapy. Gene of human hepatocyte growth factor optimised for expression in mammal cells is presented.

EFFECT: invention allows doubling the production of hepatocyte growth factor in comparison with a human natural gene.

3 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: there is offered application of group of survival-improving polypeptide cone cells originated from rod cells and designated as RDCF, and also coding molecules of nucleic acid to prepare medicines, particularly pharmaceutical compositions used to treat retinal dystrophy. Methods for preparing RDCF by recombinant DNA technologies, and required aids, as well as preparation of antibodies distinguishing said polypeptides are described.

EFFECT: improved clinical effectivenesses.

12 cl, 19 dwg, 1 ex

FIELD: microbiology.

SUBSTANCE: invention represents plasmid vector for transfer of DNA, which comprises sequence coding various fragments of oncoprotein p185neu, which are able to induce immune response in respect to tumors, which hyperexpress p185neu. Invention is also related to pharmaceutical composition on the basis of vector for prophylactics or treatment of patients with risk of development of p185neu-positive tumors, or patients with primary tumors, metastases or relapses of p185neu-positive tumors.

EFFECT: invention makes it possible to increase efficiency of prophylactics or treatment of patients with risk of development of p185neu-positive tumors, or patients with primary tumors, metastases or relapses of p185neu-positive tumors.

10 cl, 14 dwg, 2 tbl, 2 ex

FIELD: microbiology.

SUBSTANCE: glia cells are extracted, seeded, and cell is cultivated to produce monomolecular layer. Then cells are extracted and washed. Total RNA is extracted from them, reverse transcription is carried out, as well as amplification of produced DNA. Genes expression is assessed under action of tested compound.

EFFECT: invention makes it possible to accelerate screening of compounds, to search for new compounds with highest activity, which are potential neuroprotectors.

4 cl, 4 dwg, 1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: there is described method for preparing a polymorphous region of gene PAR1 which can contain T to C replacement in position 3090 and/or A to C replacement in position 3329 of the polynucleotide sequence of wild type gene (NM_001992) with applying a pair of specific primers, and also the method for observing said region prepared of a DNA-containing biological sample for the presence or absence of the specified replacements. There are offered complete sets of the components application of which provides both amplification of the polymorphous region of gene PAR1 under the invention, and if needed, further analysis for genetic modifications in positions 3090 and/or 3329.

EFFECT: higher accuracy of estimating risk of cardiovascular diseases.

7 cl, 17 dwg, 1 ex

FIELD: biotechnologies.

SUBSTANCE: invention is related to the field of biotechnology and immunology. Separated and cleaned DNA is presented, which codes receptor CTLA-4 (CD 152) of cat. The following is also suggested - diagnostic oligonucleotide, cloning vector, vaccine, methods of induction, strengthening and suppression of immune response in cat.

EFFECT: creation of model cat for research of retroviral infection.

24 cl, 10 dwg, 6 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention is related to nucleic acids and multidomain proteins, which are able to bind vessel endotheliocyte growth factor (VEGF), and may be used in medicine. Recombinant method is used to produce polypeptide, which consists of component (R1R2)X and, unnecessarily, multidomain component (MC), which represents aminoacid sequence with length from 1 to 200 of amino acids, having at least one remainder of cysteine, where X≥1, R1 means antibody-like (Ig) domain 2 of VEGF receptor Llt-1, and R2 means Ig-domain 3 of VEGF receptor Flk-1. Produced fused polypeptide does not contain multidomain component in case, when X=2, and in case when X=1, multidomain component represents aminoacid sequence with length from 1 to 15 amino acids. Produced polypeptide is used in composition of pharmaceutical compound for VEGF-mediated disease or condition.

EFFECT: invention makes it possible to produce highly efficient trap of VEGF, special structure of which is suitable for local introduction into specific organs, tissues or cells.

16 cl, 3 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention concerns area of gene engineering, virology and medicine. Nominally replicating carcinolytic improved recombinant of the adenovirus includes the basic virus, the modified hTERT promotor and immune regulatory genes. The virus preferably expresses immunostimulating factor GM-CSF in tumoral cells. Also the modified promotor, the pharmaceutical composition including virus, the way of reception of virus and its application is revealed. The invention can be used in medicine for treatment of tumours.

EFFECT: development of a virus which preferably expresses immunostimulating factor GM-CSF in tumoral cells.

22 cl, 13 dwg, 2 tbl, 7 ex

Up!