Gene cluster involves in biosynthesis of safracin and application thereof in genetic engineering

FIELD: medicine.

SUBSTANCE: there is recovered a fragment of genomic DNA Pseudomonas fluorescent A2-2, including full-size gene cluster of biosynthesis of safracin (A and B) analysis of which showed the presence of several "OPC" arranged in two operons: sacABCDEFGH and sacIJ. Expression of nucleic acid containing full gene cluster of safracin in a heterosystem enabled producing recombinant forms of natural safracins A and B.

EFFECT: removal or malfunction of separate genes found in operons, and applications of the produced modified forms of nucleic acid in the recombinant DNA technology have resulted in synthesised analogues of safracin to be used as an antimicrobial or antitumour agent, and also in synthesis of ecteinascedine compounds.

20 cl, 9 dwg, 7 ex

 

Description

The technical FIELD TO WHICH the INVENTION RELATES

The present invention relates to a gene cluster responsible for the biosynthesis saracina, to its use in genetic engineering and new saracina obtained by correcting mechanisms of biosynthesis.

BACKGROUND of INVENTION

Saracini, representing a new family of compounds with a wide range of powerful antibacterial activity, were detected in the culture brothPseudomonassp. Saracini found in two strains ofPseudomonassp.,Pseudomonas fluorescens A2-2isolated from soil sample collected in Tagabawa, Fukuoka, Japan (Ikeda et al.,J. Antibiotics1983, 36, 1279-1283; WO 82 00146 and JP 58113192), and the strain ofPseudomonasfluorescens SC12695 isolated from water samples taken from channel Raritan-Delaware near new Jersey (Meyers et al., J. Antibiot. 1983, 36(2), 190-193). Saracini A and B, produced byPseudomonas fluorescensA2-2, were investigated in relation to their impact on the various lines of tumor cells and found that they in addition to antibacterial activity have antitumor activity:

As a result of structural similarity between saracino In and ET-743 with saracina you can poluentes highly promising a powerful new anti-cancer agents ET-743 allocated and the shell marine organism cteinascidia turbinatathat is currently undergoing phase II clinical trials in Europe and the USA. Poluentes ET-743 was carried out using saracina as the parent compound (Cuevas et al.,Organic Lett. 2000, 10, 2545-2548; WO 00 69862 and WO 01 87895).

An alternative way of obtaining saracino or their structural analogs by chemical synthesis by affecting the genes responsible for the control of secondary metabolism, is very promising and it is possible to obtain these compounds biosynthetic path. In addition, due to the structure of safracin can be done combinatorial biosynthesis.

Due to the fact that saracini have the structure of the complex and access is fromPseudomonasfluorescensA2-2 is limited, it would be highly desirable to study the genetic basis of their synthesis in order to create ways of influencing them sufficiently. This could increase the quantity produced of saracino, because the natural strains producing safracin typically give only a small concentration of secondary metabolites of interest. Such methods can also provide the products of saracino at those farmers who do not produce such compounds. In addition, genetic effects can be used for combinatorial creation of new analogues saracina that can region in order to give improved properties and which can be used in prosentase new ecteinascidins connections.

However, the success of biosynthetic approach mainly depends on the availability of new genetic systems and genes coding for new enzymes with the appropriate activity. The study of gene cluster saracina contributes to the basic provisions of combinatorial biosynthesis by expanding the spectrum of genes that are uniquely associated with the biosynthesis saracina that will lead to the eventual receipt of new precursors and saracino by combinatorial biosynthesis.

A BRIEF DESCRIPTION of the INVENTION

Now you can sit identify and clone genes for biosynthesis saracina, creating a genetic database to improve, as well as the impact of a given image on productivityPseudomonassp. and using genetic methods for the synthesis of analogues saracina. In addition, these genes encode enzymes involved in the biosynthesis, leading to the formation of structures such as predecessors saracina that can form the basis of combinatorial chemistry to obtain a large variety of compounds. These compounds can be subjected to screening for the presence of a large range of biological activities, including anticancer activity.

In this regard, in the first aspect of the present invention relates to nucleic acid, respectively, to videolanclient acid, which includes a DNA sequence (including its mutations or variants), which encodes primoonline patalenitsa responsible for the biosynthesis of saracino. The present invention relates to a gene cluster, respectively, to the selected gene cluster open reading frames encoding polypeptides that are related to the Assembly of molecules saracina.

In one aspect the present invention relates to compositions comprising at least one nucleic acid sequence, respectively, to the selected nucleic acid molecule that encodes at least one polypeptide that catalyzes at least one stage of the biosynthesis of saracino. The composition may be present two or more such nucleic acid sequence. The invention also relates to DNA or corresponding RNA molecule.

In particular, the present invention relates to a nucleic acid sequence, respectively, to a selected nucleic acid sequence of the gene cluster saracina, including the sequence of nucleic acids, part or parts of specified nucleic acid sequence, where a specified part or parts of the coding for a polypeptide or polypeptides, or biologically active fragment of the polypeptide or the floor of the peptides, to sequence single-stranded nucleic acid obtained from a specified nucleic acid sequence, or the sequence of single-stranded nucleic acid selected from part or parts of specified nucleic acid sequence, or the sequence of double-stranded nucleic acid obtained from a sequence of single-stranded nucleic acids (such as cDNA from mRNA). The sequence of the nucleic acid may represent DNA or RNA.

More specifically the present invention relates to a nucleic acid sequence, respectively, to a selected nucleic acid sequence that comprises or contains at least SEQ ID 1, its variants, or portions, or at least one of the genessacA,sacB,sacC,sacC,sacD,sacE,sacF,sacG,sacH,sacH,sacI,sacJ,orf1,orf2,orf3 ororf4, including their variants or parts. The length of the parts may be at least 10, 15, 20, 25, 50, 100, 1000, 2500, 5000, 10000, 20000, 25000 or more nucleotides. Usually the length of these parts is in the range from 100 to 5000 100 to 2500 nucleotides and has biological activity.

Mutants or variants include polynucleotide molecules in which at least one nucleotide residue is modified, replaced, removed, or introduced. is also possible multiple changes of different nucleotides 1, 2, 3, 4, 5, 10, 15, 25, 50, 100, 200, 500 or more positions. It is also possible degenerate variants that encode the same polypeptide, and a non-degenerate variants that encode different polypeptides. Part, a mutant or variant nucleic acid sequence, respectively, encodes a polypeptide which retains biological activity of the corresponding polypeptide encoded by any of the open reading frames of gene cluster saracina. It is also possible allelic forms and polymorphisms.

The present invention also relates to the sequence of the selected nucleic acid capable of gibridizatsiya in stringent conditions with the nucleic acid sequence of the present invention. Especially preferred is the hybridization with the nucleic acid sequence of the present invention, having transmitted the length.

The present invention also relates to a nucleic acid that encodes a polypeptide that is at least 30%, preferably 50%, preferably 60%, more preferably 70%, 80%, 90%, 95% or more identical in amino acid sequence of the polypeptide encoded by any of the open reading frames of gene cluster saracinasacA -sacJ andrf1 -orf4 (SEQ ID 1 and the genes encoded in SEQ ID 1) or encoded by invarianten or part. The polypeptide retains the biological activity of the corresponding polypeptide encoded by any of the open reading frames of gene cluster saracina.

In particular, the present invention relates to a sequence of isolated nucleic acid that encodes any protein SacA, SacB, SacC, SacD, SacE, SacF, SacG, SacH, SacI, SacJ, Orf1, Orf2,Orf3 or Orf4 (SEQ ID 2-15) and its variants, mutants or parts.

In one aspect, the sequence of the selected nucleic acid of the present invention encodes patalenitsa, L-Tyr derived hydroxylase, L-Tyr derivative of methylase, L-Tyr O-methylase, the methyltransferase or monooxygenases, or protein resistance to saracino.

The present invention also relates to a probe for hybridization, which is a sequence of the nucleic acid defined above, or a part of it. Probes accordingly include a sequence of 5, 10, 15, 20, 25, 30, 40, 50, 60 or more nucleotide residues. Preferred are sequences with a length of from 25 to 60. The present invention also relates to the use specified above probe for detecting the gene saracina or ecteinascidin. In particular, this gene is used to detect genes inEcteinascidia turbinata.

In related the m aspect the present invention relates to a polypeptide, encoded by the nucleic acid sequence defined above. Provides the full sequence, variant, mutant or fragment of the polypeptide.

In another aspect, the present invention relates to a vector, preferably the expression vector, preferably to cosmides containing a nucleic acid sequence encoding a protein or a biologically active fragment of the protein, where this nucleic acid defined above.

In another aspect, the present invention relates to the cell host transformed with one or more nucleic acid sequences defined above, or a vector, expression vector or kosmidou defined above. Preferred cell host transformed exogenous nucleic acid containing a gene cluster that encodes the polypeptide sufficient to provide for the Assembly saracina or similar saracina. Preferably, a host cell is a microorganism, preferably a bacterium.

The present invention also relates to a recombinant bacterial cell host, in which at least part of the nucleic acid sequence, defined above, is destroyed with the formation of a recombinant host cell that produces altered levels saracinesco soy is inane or similar saracina, compared with the corresponding non-recombinant bacterial cell host.

The present invention also relates to a method for saracinesco connection or similar saracina, which is fermentation conditions and in a medium suitable for production of such compounds or similar, of the body, such asPseudomonassp., which increases the number of genes/cluster saracina encoding polypeptides sufficient to perform Assembly saracina or analogues saracina.

The present invention also relates to a method for saracinesco connection or similar saracina, which is fermentation conditions or in an environment suitable to obtain such a connection or similar, of the body, such asPseudomonassp., in which the expression of genes encoding polypeptides sufficient to perform Assembly saracina or analogues saracina, is modulated by exposure or substitution of one or more genes or sequences responsible for regulation of such expression. Preferably, the gene expression is increased.

The present invention also relates to the use of a composition containing at least one selected nucleic acid sequence as defined above, or its modification, for combinatorial biosynthesis is not ribosomally peptides dicketopeperazinovykh rings and saracino.

In particular, the present method involves the interaction of a compound that is a substrate of the polypeptide encoded by one or more open reading frames gene cluster biosynthesis saracina defined above, with a polypeptide encoded by one or more open reading frames gene cluster biosynthesis saracina, the polypeptide is chemically modifies the connection.

In yet another embodiment, the present invention also relates to a method for saracina or similar saracina. This method includes obtaining a microorganism transformed with an exogenous nucleic acid containing the gene cluster saracina, which encodes polypeptides sufficient to perform a build of the specified saracina or similar saracina; cultivation of bacteria in the conditions under which the possible biosynthesis saracina or similar saracina; and allocating a specified saracina or similar saracina from the selected cells.

The present invention also applies to any connection-predecessor P2, P14, their analogues and derivatives and to their use in combinatorial biosynthesis primoonline proteins, dicketopeperazinovykh rings and saracino.

In addition, the present invention also relates to new saracina, is received by switching off genes saracina P19B, P22A, RW, D and E, and to their use as antimicrobial or anticancer agents, as well as to their application in the synthesis of ecteinascidins connections.

The present invention also relates to new saracina obtained by directed biosynthesis, as defined above, and to their use as antimicrobial or anticancer agents, as well as to their application in the synthesis of ecteinascidin compounds. In particular, the invention also relates to safracin-B-ethoxy or safranin-And-ethoxy and to their application.

In one aspect the present invention relates to the production of structures close to saracina and ecteinascidin that cannot be obtained by chemical means or is it getting difficult. Another aspect relates to the use of knowledge, allowing the biosynthesis of ecteinascidins inEcteinascidia turbinata,for example, with the use of these sequences or parts thereof as a probe in a specified body or suspected symbiont.

Basically the present invention provides a wide range of possibilities and allows you to get ecteinascidin using genetic engineering.

BRIEF DESCRIPTION of DRAWINGS

Figure 1: Structural organization of chromosomal DNA cloned into kosmidou pL30p. Shows DNAP. fluorescensA2-2 containing gene cluster saracina the drawing shows and sacABCDEFGH, andsacIJ, gene operons and modular organization peptisyntha derived from sacA, sacB, and sacC. Specify the following domains: condensation; T - milirovanie; And - adenalineage and Re - reductase. Also shown is the location of other genes present in cosmides pL30p (orf1 - orf4), and their putative functions.

Figure 2: Conservative nuclear motives among NRPS. Conservative amino-acid sequences in proteins SacA, SacB, and SacC and compared with homologous sequences fromMyxococcus xanthusDM50415.

Figure 3: the Mechanism of biosynthesis of NRPS proposed for the formation of the dipeptide Ala-Gly. Stage a*: adenalineage Ala; b*: transfer to the 4'-phosphopantetheinyl shoulder; c*: transfer to the site waiting/elongation; d*: adenalineage Gly; e*: transfer to the 4'-phosphopantetheinyl shoulder; f*: condensation longiremis circuit 4'-phosphopantetheinyl shoulder with the starter circuit on the website standby/elongation; g*: dipeptide Ala-Gly attached to phosphopantetheinyl shoulder SacA and h*: transfer of long-chain to the next site waiting/elongation.

Figure 4: Cross experiment:And. Diagram of DNA fragments A2-2, cloned in the vector pBBR1-MCS2, and products obtained in the heterologous host.B. Parameters HPLC saracina produced in the wild-type strain, in comparison with the sacF mutant. Add predecessor P2 to the mutant sacF when the condition is and, both are located in theTRANS-position and has been used synthetic method, leads to the formation of safracin B. SfcA - safracin A and SfcB - Sarrazin B.

Figure 5: Scheme of the mechanism of biosynthesis saracina and intermediate products of biosynthesis. Separate enzymatic stage shown in solid arrows, and reactions with multiple stages indicated dashed arrows.

6: gene Destruction saracina and the compounds obtained.A.Gene destruction and molecules of the precursor synthesized using the constructed mutants. Genes marked with an asterisk do not belong to samazinajumu cluster. It was shown that inactivation of genesorf1,orf2,orf3 andorf4 does not affect production saracina.B.Parameters HPLC saracina produced in the wild-type strain and mutantssacA sacI andsacJ.Shows different patterns of molecules obtained.

7: Structure of different molecules, obtained by disruption of the gene. Inactivation of protein SacJ (a) leads to the formation of molecules P22B, P22A and P19, while the destruction of the genesacI(b) gives only the connection P19. The destruction of sacI in combination with restored expression ofsacJgives two new saracina: safracin D (a possible precursor in prosentase ET-729) and safracin E (with).

Fig: adding a specifically designed "unnatural" predecessors (P3)Himicheskaya structure of two molecules, obtained by adding P3 connection to the mutantsacF.

Figure 9: scheme of the process of destruction by simple gene recombination using fragment homologous DNA, cloned in pK18: : MOB (plasmid integrated intoPseudomonas).

DETAILED description of the INVENTION

Primoonline peptisyntha (NRPS) are the enzymes responsible for the biosynthesis of a family of compounds, which covers a large number of structurally and functionally different natural products. So, for example, peptides with biological activity, which provides the structural frame of compounds with diverse biological activity, such as antibiotics, antiviral, antitumor and immunosuppressive compounds (Zuber et al.,Biotechnology of Antibiotics1997 (W. Strohl, ed.), 187-216 Marcel Dekker, Inc., N.Y; arahiel et al.,Chem. Rev.1997, 97, 2651-2673).

Despite the structural differences, most of these biologically active peptides have a common mechanism of biosynthesis. In accordance with this model the formation of the peptide bond occurs on multienzyme complexes, developed patalenitsa on which amino acid substrates are activated by ATP hydrolysis to the corresponding adenylate. Received the unstable intermediate product is then transferred to another site multienzyme complex which is bound in the complex tiefer with cysteamine group of the enzyme-bound 4'-phosphopantetheine (4'-PP) cofactor. At this stage, the thiol-activated substrates can be modified, for example to apelrsinovie or N-metiliruetsa. Thioethanolamine amino acid substrates are then combined with the formation of the peptide product through stepwise elongation in a series of reactions transpeptidase. When such temporary accommodation peptisyntha modules, apparently, operate independently from each other, but they act together and catalyze the formation of the corresponding peptide bonds (Stachelhaus et al.,Science1995, 269, 69-72; Stachelhaus et al.,hem. Biol, 1996, 3, 913-921). The General scheme primocanale biosynthesis of peptides described in the literature (Marahiel et al.,Chem. Rev. 1997, 97, 2651-2673; Konz and Marahiel,Chem. and Biol. 1999, 6, R39-R48; Moffit and Neilan,FEMS Environ. Letters2000, 191, 159-167).

Was cloned large number of bacterial operons and genes of fungi, coding patalenitsa that have been recently cloned, sequenced and partially characterized, which gave valuable information about the architecture of the molecule (Marahiel et al.,Chem. and Biol. 1997, 4, 561-567). Used different approaches cloning, including the study of expression libraries with antibodies produced in response to patalenitsa, complementation deficient mutants and using oligonucleotides designed based on the amino acid sequences of fragments patalenitsa.

Analysis of the primary structure of these genes showed the presence of explicit homologous domains of approximately 600 amino acids. These specific functional domains consist of at least six highly conserved sequences with a length of from three to eight amino acids, the sequence and location of all known domains are very similar (Kusard and Marahiel,Peptide Research, 1994, 7, 238-241). The use of degenerate oligonucleotides derived from conservative areas, allows the identification and cloning peptisyntha from genomic DNA by using the technique of polymerase-cableway reaction (PCR) (Kusard and Marahiel,Peptide Research, 1994, 7, 238-241; Borchert et al.,FEMS Environ Letters1992, 92, 175-180).

Structure saracina suggests that this compound is synthesized according to the mechanism of NRPS. Cloning and expression primoonline peptisyntha and associated tail enzymes from cluster saracinaPseudomonas fluorescens A2-2it could allow for the production of an unlimited number saracina. In addition, the cloned genes could be used to create combinatorial methods new analogues carpatina that may have improved properties and which can be used in prosentase new ecteinascidins. In addition, cloning and expression of the gene cluster saracina in heterol is similar systems or a combination of the gene cluster saracina with other genes in the system NRPS can lead to the creation of new drugs with improved activity.

The present invention relates, in particular, DNA sequences encoding NRPS, which is responsible for biosynthesis saracina, for example synthetases saracina. The authors described the plot length 26705 mo (SEQ ID No. 1) of the genomePseudomonas fluorescens A2-2cloned in cosmides pL30P, and has shown by experiments with off genes and heterologous expression that this site is responsible for the biosynthesis saracina. The authors expressed kosmidou pL30P in two strains ofPseudomonassp., not produce sarazin, and as a result made products safracin A and B at levels up to 22% in the case ofPseudomonas fluorescens(CECT 378), and 2% in the case ofPseudomonas aerugenosa(CECT 110) in comparison with the products ofP. fluorescensA2-2. The predicted amino acid sequences of different proteins encoded by this DNA sequence shown in the sequence SEQ ID No. 2 - SEQ ID No. 15, respectively.

Isolated fromP. fluorescensA2-2 gene cluster biosynthesis saracina characterized by the presence of several open reading frames (ORFS), which are organized in two different operon (figure 1), in operon with eight genes (sacABCDEFGH) and operon of two genes (sacIJ), preceded by a rather conservative areas estimated overlapping promoters. Gene cluster biosynthesis saracina there is only one copy of the genomeP. fluorescensA2-2.

these results indicate the operon of the eight genes possibly responsible for the biosynthesis of the frame saracina and operon of two genes possibly responsible for creating the final stage of the "tail" section in molecules saracina.

In the operon sacABCDEFGH installed amino acid sequence encoded by sacA, sacB, and sacC, very similar to the gene products of the NRPS. Within the established amino acid sequence SacA, SacB, and SacC on each of the ORFS identified one pertinently module.

The first remarkable feature of proteins spacenoah NRPS is the fact that among the known active sites and crustal sections peptisyntha (Konz and Marahiel,Chem. and Biol. 1999, 6, R39-R48) of the first core section is weakly conservative in all three patalenitsa: SacA, SacB, and SacC (figure 2). The other five crustal sections are quite conservative in three genes spacenoah NRPS. The biological value of the first crustal section (LKAGA) is not known, but the nuclear sequence SGT(ST)TGxPKG (Gocht and Marahiel,J. Bacteriol. 1994, 176, 2654-266; Konz and Marahiel,Chem. and Biol. 1999, 6, R39-R48), TGD (Gocht and Marahiel,J. Bacteriol. 1994, 176, 2654-2662; Konz and Marahiel, 1999) and KIRGxRIEL (Pavela-Vrancic et al.,J. Biol Chem.1994, 269, 14962-14966; Konz and Marahiel,Chem. and Biol. 1999, 6, R39-R48) can be used for ATP binding and hydrolysis. The serine residue in the cow sequence LGGxS can be represented as a site of education complex t is ofira (D'souza et al., J. Bacteriol. 1993, 175, 3502-3510; Vollenbroich et al.,FEBS Lett. 1993, 325(3), 220-4; Konz and Marahiel,Chem. and Biol. 1999, 6, R39-R48) and the binding of 4'-phosphopantetheine (Stein et al.,FEBS Lett. 1994, 340, 39-44; Konz and Marahiel,Chem. and Biol. 1999, 6, R39-R48). These results, along with the fact that sarazin, apparently, is synthesized from amino acids, supports the hypothesis that education primocanale peptide bond through the mechanism of participation of thio-containing matrix occurs during biosynthesis pathway saracina and that sacA, sacB, and sacC encode the corresponding patalenitsa. In accordance with this mechanism, the amino acids are activated as aminoacetanilide as a result of ATP hydrolysis and then covalently linked to the enzyme through carboxyl-thioester linkages. Then at the subsequent stages is transpeptidase and the formation of the peptide bond.

Secondly, it is surprising that these data clearly indicate that in the system synthetases saracina not conserved colinearity rule, according to which the order of the modules amino acid binding chromosome corresponds to the order of amino acids in the peptide. In accordance with the information available in the database by homology sequences, and homology spacenoah and saframycin structures, SacA is responsible for the recognition and activation of the Gly residue, and Sac and Sac responsible for detected the existence and activation of two derivatives of L-Tyr, included in saraciny frame, whereas the estimated gene Ala-NRPS may be absent in the gene cluster saracina. A few primoonline gene clusters peptisyntha, for example, the biosynthesis pathway poistaminen (Crecy-Lagard et al.,J. of acteriol. 1997, 179(3), 705-713) and phosphinotricine Tripeptide (Schwartz et al.Appl Environ Environ1996, 62, 570-577), the first NRPS is not located next to the second NRPS gene. Specifically in the biosynthesis pathway poistaminen the first structural gene (behind snbaand the second structural gene (snbC) are located at a distance of 130 TPN This situation is not observed in the gene cluster saracina, for which the results heterologous expression using Comedy pL30P clearly shows the lack of NRPS gene because of heterologous products saracina.

Third, even if the question of the mechanism by which forms a dipeptide Ala-Gly remains open, the presence of sacA outside With domain aminocore first NRPS gene suggests that this gene will act in the system bifunctional activation adenalineage. The authors suggest that Ala may first be made on phosphopantetheinyl "shoulder" SacA (figa* and b*before transferring to the standby position, domain, condensation, located on the N-end SacA (figs*). Then the Gly adenylate to be paid on the same phosphopantetheine the TV the shoulder ( fig.3d* and e*), located at the site of elongation, and elongation (fig.3f*). The shoulder of the first module will be at this stage to carry the dipeptide Ala-Gly (figd*). The authors suggest that this/this dipeptide is then transferred to the stand by position the second phosphopantetheinyl shoulder (fig.3h*), located in the SacB, for continuation of the synthesis on the main frame saracinesco of tetrapeptide. In the alternative mechanism of biosynthesis of the dipeptide Ala-Gly can directly be entered in SacA. In this case, the dipeptide may have been formed as a result of activity of representatives of the family of highly active peptidyl transferase ribozymes (Sun et al.,Chem. and Biol. 2002, 9, 619-626) or in the activity of enzymes of bacterial proteolysis.

And, fourthly, although in the case of the majority of the prokaryotic peptisyntha phosphoesterase fragment that is likely responsible for the release of the Mature peptide chain of the enzyme complex, fused with C-terminal end of the last module linking amino acids (Marahiel et al,Chem. Rev.1997, 97, 2651-2673), in the case spacenoah synthetases THE domain is missing. Probably in the way of synthesis saracina after passing through the last stage of the elongation tetrapeptide may be released on an alternative approach to the implementation of the termination of synthesis of the peptide chain, which also occurs when si is Teze saframycin (Pospiech et al., Environ. 1996, 142, 741-746). In this particular approach the process termination is catalyzed by a reductase domain to carboxyterminal the end of the SacC patalenitsa, which catalyzes reductive cleavage of bound acyl group attached to the T-domain, with the release of the linear aldehyde.

Cross experiments, the authors showed that the last two amino acids introduced in samazinosu molecule, represent two derivatives of L-Tyr, called P2 (3-hydroxy-5-methyl-O-methyltyrosine) (4, 5), instead of two L-Tyr, as was assumed in the case of synthesis saframycin. First, the products of two genes (sacF and sacG)similar to the bacterial methyltransferase has been shown to be involved in O-, C-methylation of L-Tyr education P14 (3-methyl-O-methyltyrosine), the predecessor of P2. The possible mechanism may be based on the fact that the first O-methylation, and then S-methylation of amino acid derivative. Secondly, P2, the substrate for peptisyntha SacB, and SacC is formed by the hydroxylation P14 under the action of SacD (4, 5):

C11H15NO3
Exact mass: 209,11
Mo is. weight: 209,24,
With - 63,14; H - 7.23 percent; N - 6,69;
O - 22,94
C11H15NO4
Exact mass: 225,10
Mol. weight: 225,24,
With - 58,66; H - of 6.71; N - 6,22;
O - 28,41
R-14R-2

In addition to genes involved in the biosynthesis saracina in the operon sacABCDFGH were also identified two genesacEandsacHwith unknown function and is involved in the mechanism of resistance to saracino respectively. The authors showed thatsacHthe gene encodes a protein, which in the case of heterologous expression in other strains ofPseudomonasgenerates a marked increase in resistance to Saraceno B. Assume that SacH is a transmembrane domain, which transforms C21-OH group safracin B C21-H group with the formation of safracin A connection with less antibiotic and antitumor activity. And finally, even though the still unknown potential function SacE, it was found that homologues of this gene is close to a variety of secondary metabolites biosynthetic chain gene cluster in the genomes of some organisms, suggesting a conserved function of these genes in the formation or regulation of secondary metabolites.

In the operonsacIJinstalled amino acid sequence encoded bysacIII> sacJhighly similar to the gene products methyltransferase and hydroxylase/monooxygenase respectively. The data obtained by the authors show that SacI is the enzyme responsible for N-methylation present in samazinosa structure, and that SacJ is a protein which is optionally hydroxylase on one of the derivatives of L-Tyr in tetrapeptide, with the formation of quinone structures, present in all spacenoah molecules. N-methylation is one of the modifications of peptides synthesized on primocanale mechanism that contribute to their biological activity. Except saframycin (Pospiech et al.,Environ.1996, 142, 741-746), which is produced by bacteria and which N-metiliruetsa, all known N-methylated primoonline proteins produced by fungi or actinomycete and in most cases, for such N-methylation domain is responsible, which is primocanale pepresentatives (see table).

Table I
A brief description of the genes of the biosynthesis saracina and resistance genes identified in cosmides pL30P
Name LFSBoe is OK The intended functionPosition starter stop-moAmanakis-
lots
Molecular weight
sacASacApatalenitsa3052-60631004110,4
sacBSacBpatalenitsa6068-92681063117,5
sacCSacCpatalenitsa9275-135701432157,3
sacDSacDL-Tyr-derived hydroxylase13602-1465135039,2
sacESacEunknown14719-14901616,7
sacFSacFL-Tyr-derived etiez 14962-1602635539,8
sacGSacGL-Tyr-methylase16115-17155347to 38.3
sacHSacHProtein resistance17244-1778318019,6
sacISacIMethyltransferase2513-185422024,2
sacJSacJmonooxygenase1861-35550955,3

Figure 5 shows the likely path of synthesis saracina, which shows the specific amino acid substrates used in each reaction of condensation, and various enzymes, the activity of which is required after condensation.

To further assess the role of genes of the biosynthesis saracina the authors have constructed mutants with off of each of the genes in the cluster saracina (6). The destruction of the NRPS genes( sacA, sacB, and sacC), andsacD, sacF and sacG,results in mutants that do not produce safracin and P2. These results indicate that genes fromsac-sacHare part of the same genetic operon. The destruction of the genes sacI and sacJ formed three new molecules: P19B, RA and P22B (6):

Products P22A and P22B (figa*)sacJmutant indicates that the role SacJ is to implement additional hydroxylation in the left derivatives of L-Tyr amino acids saracina involved in quinone ring. EducationsacImutant RW (Fig.7 b*) molecules, such saracino that lacks the N-methylation and quinone ring, confirms the fact that SacI is N-methyltransferase and suggests thatsacIJan operon involved in transcription. Education RW mutantsacJ(figa*) also suggests that N-methylation probably occurs after the formation of the quinone ring. Even despite the fact that these new structures have no interest antimicrobial activity against B. subtilis or do not have a high cytotoxic effect on cancer cells, they can serve as new precursors for poluentes new active molecules. That Cam is by structural activity, the observation that RV, RA and RV lose their activity, suggesting that the absence of the quinone ring in samazinosa structure is directly related to the loss of activity of the molecules of the family of saracino.

The destruction of thesaclgene with subsequent restoration of gene expressionsacJleads to the formation of two new saracino. Two received the antibiotic production as high as in the case of producing saracina And/saracina In the wild-type strain, were named safracin D and safracin E (7 s*):

Safracin D and safracin E represent molecules, such saracino In and saracino And therefore lacking the N-methylation. It was shown that Sarrazin D and safracin E have the same antibacterial and antitumor activity as safracin In and safracin And respectively. Sarrazin D, in addition to high antibacterial and antitumor activity, has properties that enable its use in prosentase of ecteinascidin ET-789, a powerful anti-cancer agents, as well as in prosentase new ecteinascidins.

The question arises concerning the role of the protein, such aminopeptidase encoded by a gene located at the 3-site saracinesco operon. Inactivation by embedding orfl (PM-S1-14) does not affect p is oductio saracina And/saracina Century With regard to functional properties, it remains unclear whether this protein to perform a role in the metabolism saracina. Should be investigated in more detail other genes present in cosmides pL30P (orf2-orf4).

In another aspect, the present invention relates to the necessary tools to obtain new specifically designed "non-natural" molecules. Adding specifically modified precursor derived P2, denoted as P3, 3-hydroxy-5-methyl-O-ethylthiophene, mutant sacF leads to the formation of two "unnatural" saracino, which include this specific modified predecessor, safracin A(OEt) and safracin B(OEt) (Fig):

C30H40N4O6
Exact mass: 552,29
Mol. weight: 552,66, 65,20; H - 7,30; N - 10,14; O - 17,37
C30H40N4O7
Exact mass: 568,29
Mol. weight: 568, 66; S - 63,36; H - to 7.09; N - 9,85; O - 19,69
Safracin A(OEt)Safracin B(Ot)

Two new saracina are a powerful antibiotic and antitumor compounds. Biological activity is here safracin A(OEt) and safracin B(Ot) are characterized by the same efficiency, as the activity saracina and safracin respectively. These new saracini can be a powerful source of new anticancer agents, as well as a source of molecules for poluentes new ecteinascidins.

In addition, genes involved in the synthesis saracina, can be combined with other genes primoonline peptisyntha with obtaining as a result of new "unnatural" means and analogues with improved activity.

EXAMPLES

Example 1: Extraction of nucleic acid molecules of thePseudomonas fluorescensA2-2

Bacterial strains

Strains ofPseudomonassp. grown at 27°C in broth, Luria-Bertani (Luria-Bertani (LB)) (Ausubel et al., 1995, J. Wiley and Sons, New York, N.Y). Strains ofE. coligrow at 37°C in LB medium. Antibiotics are used in the following concentrations: ampicillin (50 μg/ml), tetracycline (20 μg/ml) and kanamycin (50 μg/ml) (see table II).

Table II
The strains used in this invention
CodeGenotype
RM-S1-001P. fluorescens A2-2wild-type
RM-S1-002sacA-
R is-S1-003 sacB-
RM-S1-004sacC-
RM-S1-005sacJ-
RM-S1-006sacI-
RM-S1-007sacIwith the restoration of the expressionsacJ
RM-S1-008sacF-
RM-S1-009sacG-
RM-S1-010sacD
RM-S1-014orf1-
RM-S1-015A2-2 + pLAFR3
RM-S1-016A2-2 + pL30p
RM-19-001P. fluorescensCECT378 + pLAFR3
RM-19-002P. fluorescensCECT378 + pL30p
RM-19-003P. fluorescensCECT378 + pBBR1-MCS2
R is-19-004 P. fluorescensCECT378 + pB5H83
RM-19-005P. fluorescensCECT378 + pB7983
RM-19-006P. fluorescensCECT378 + pBHPT3
RM-gloves 16-001P.aeruginosaCECT110 + pLAFR3
RM-16-002P.aeruginosaCECT110 + pL30p
RM-17-003P.putidaATCC12633 + pBBR1-MCS2
RM-17-004P.putidaATCC12633 + pB5H83
RM-17-005P.putidaATCC12633 + pB7983
RM-18-003P.stutzeriATCC17588 + pBBR1-MCS2
RM-18-004P.stutzeriATCC17588 + pB5H83
RM-18-005P.stutzeriATCC17588 + pB7983

Manipulation of DNA

Unless otherwise stated, we use standard molecular biology techniques for manipulating DNAin vitroand cloning (Sambrook et al., 1989, Cold Spring Hrbor, NY: Cold Spring Harbor Laboratory).

Extraction of DNA

Total DNA from culturesPseudomonas fluorescensA2-2 receive according to published procedures (Sambrook et al., 1989, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory).

Computer analysis

The data sequences are combined and analyze them using the software package DNA-Star.

Example 2: Identification of NRPS genes responsible for the formation of safracin inPseudomonas fluorescensA2-2

Creating a primer

Previously Marahiel et al. (Marahiel et al.,Chem. Rev. 1997, 97, 2651-2673) has published data on the highly conserved core motifs in the catalytic domain of cyclic and branched peptisyntha. Based on the results of multiple comparisons of sequences for a number described peptisyntha were used conservative areas of peptisyntha A2, A3, A5, A6, A7 and A8 modules adenalineage and modules T etiolirovaniya as targets for the design of degenerate primers (Turgay and A2, arahiel,eptide Res. 1994, 7, 238-241). In the selected modules have been introduced preferred in accordance with the degeneracy of the nucleotide and derivedPseudomonassp. with the expected high content of G/C. All oligonucleotides receive from ISOGEN (Bioscience BV). When using degenerate oligonucleotides obtained PCR fragment based on the sequence YGPT (A5 core) and LGGXS (T core). These oligonucleotide is identified as PS34-YG and PS6-FF, respectively.

Table III
PCR primers designed for this study
Identification and orientation of the primerSequenceLength
PS34-YG (in forward direction)5'-TAYGGNCCNACNGA-3'14 residues
PS6-FF (backward)5'-TSNCCNCCNADNTCRAARAA-3'20 residues

The PCR conditions for amplification of DNA from Pseudomonasfluorescens A2-2

The internal fragment of the plot primoonline peptisyntha (NRPS) amplified using oligonucleotides PS-34-YG and PS6-FF and chromosomal DNA fromP.fluorescensA2-2 as a matrix. Using the reaction buffer and Taq polymerase from Promega. Cycles are carried out in a Personal thermocycler (Eppendorf), which includes 30 cycles of 1 minute at 95°C, 1 minute at 50°C and 2 min at 72°C. PCR products have the expected size (about 750 BP), which was calculated on the basis of information about the location of the primers within the NRPS domains of other genes synthetase.

DNA cloning

Fragments amplificatoare PCR clone in which the sector pGEM-Teasy according to the method of the manufacturer (Qiagen, Inc., Valencia, CA). Cloned in this way, the fragments flank the two restriction sitesEcoRI, so as to facilitate the subsequent cloning of other plasmids (see below). Because NRPS enzymes are modular, clones of degenerate PCR primers reflect a pool of fragments from different domains.

DNA sequencing

All analyses sequencing performed using primers directed against cloning vector, using an automated ABI sequencing machine (Perkin-Elmer). Cloned DNA sequences identified using the BLAST server of the National Center for biotechnology information (National Center for Biotechnology Information)available through the Internet (Altshul et al., Nucleic Acids Res. 1997, 25, 3389-3521). All sequences are signal plots for NRPS and demonstrate high similarity search system BLAST with bacterial NRPS, indicating that they actually have a peptide origin. In addition, the search for possible similarities on domains are using the web server PROSITE (European Molecular Biology Laboratory, Heidelberg, Germany).

The destruction of the gene in PseudomonasfluorescensA2-2

To analyze the function of the cloned genes destroy these genes by homologous recombination (Fig.9). For this purpose, the recombinant plasmid (derived pG-PS)carrying a gene fragment NRPS, Rasse the amount of restriction enzyme EcoRI. The resulting fragments belonging to the gene that is mutated, clone raised in the plasmid pK18mob (Schafer et al.,Gene1994, 145, 69-73), which is integrated into the chromosome plasmid that can replicate in E. coli, and may not be replicated inPseudomonas. The recombinant plasmid is injected first into the E. coli strain S17-λPIR by transformation, and then toP.fluorescensA2-2 by conjugation of the two parental options (Herrero et al.,J. Bacteriol1990, 172, 6557-6567). Different dilution of the conjugate is placed on solid LB medium containing ampicillin and kanamycin, and incubated overnight at 27°C. Selected kanamycin-resistant transconjugants containing the plasmid integrated into the genome by homologous recombination.

Biological analysis (Biotest) education saracina

Strains ofP.fluorescensA2-2 and its derivatives incubated in erlenmeyers flasks with baffle 50 ml, containing fermentation medium with appropriate antibiotics. First use fermentation environment SA3 (Ikeda Y.J.Ferment. Technol. 1985, 63, 283-286). To increase the productivity of the fermentation process using statistical and mathematical methods such as a method Plakette-Boorman (Plackett-Burman) for selection of nutrients, as well as optimization methods surface response (Hendrix C.Chemtech1980, 1, 488-497) to determine the optimal level of each key independent variable. Conduct experiments aimed at improving the culture conditions, such as incubation temperature and stirring speed. And finally, choose a highly productive on saracino on Wednesday called 16V (152 g/l mannitol, 35 g/l G20-25 of yeast, 26 g/l CaCO314 g/l of ammonium sulfate, 0.18 g/l of ferric chloride, pH 6.5).

Products saracina analyzed by determining the ability to inhibition of solid cultureBacillus subtilis10 μl of the supernatant of the 3-day culturePseudomonassp., incubated at 27°C (Alijah et al.,Appl Environ Biotechnol1991, 34, 749-755). CultureP.fluorescensA2-2 to form a zone of inhibition diameter of 10-14 mm, whereas neproducyruth mutant does not inhibit the growth ofB. subtilis. Three selected clones contain invalid biosynthesis pathway saracina. To confirm the obtained results was carried out an analysis of the level of educated saracino by HPLC method.

Analysis of education saracina by HPLC

The supernatant analyzed using HPLC Symmetry C-18, 300Å, column (5 µm, 250 x 4.6 mm (Waters) with a protective jacket (Symmetry C-18 column, 5 μm, 3.9 x 20 mm, Waters). As the mobile phase using a gradient of ammonium acetate buffer (10 mm, 1% diethanolamine, pH of 4.0) - acetonitrile. Safracin detected by absorption at the wave length of 26 nm. On6shows HPLC profiles saracina and predecessors saracina produced by a strain ofPseudomonasfluorescensA2-2, and various safracin-like structures produced by mutants ofP.fluorescens.

Example 3. Cloning and sequence analysis saracinesco cluster

Inverse PCR and hybridization with ragovoy library

Southern hybridization using chromosome DNA of mutants confirmed the correctness of the destruction of the gene and showed that the fragment patalenitsa, cloned in the plasmid pK18mob necessary for the production saracina. The analysis does not produce safracin mutants showed that they all include the destruction of the gene in the same genesacA.

Inverse PCR-based genomic DNA and screening ragovoy library using genomic DNAP.fluorescensA2-2 revealed the presence of additional genes flanking the gene ofsacAthat is likely involved in the biosynthesis saracina.

The access number in the database of GenBank to information on the nucleotide sequence of the cluster associated with the biosynthesis saracina inP.fluorescensA2-2, AY061859.

Design kosmidou library and heterologous experse

To identify whether saraciny cluster to give the ability to the biosynthesis saracina neproducyruth strain,this cluster was cloned in a wide range komenich vectors (pLAFR3, Staskawicz B, et al.,J. Bacteriol1987, 169, 5789-5794) and anywhereman with different strains from the collection ofPseudomonassp.

To obtain a clone containing a cluster, design, and subjected to screening kosmidou library. For this purpose, the chromosomal DNA is partially destroy restriction enzymePstI, the fragments are dephosphorylated and are ligated inPstI the website kosmidou vector pLAFR3. Comedy Packed using extracts that promote packaging (Gigapack III gold (Stratagene), in accordance with the manufacturer's recommendations. Infected cells strain XL1-Blue was placed on LB agar containing as an additive 50 μg/ml of tetracycline. Selected positive clones by the method of hydridization colonies with DIG-labeled DNA fragment, belonging to the 3'-end saracinesco cluster. In order to guarantee the cloning of the entire cluster, a new hybridization of colonies from the 5'end of the DNA fragment. Only cosmid pL30 demonstrates multiple hybridization with DNA probes. To confirm the accuracy of cloning conduct PCR amplification and DNA sequencing using oligonucleotide DNA belonging to samazinosa sequence. The size of the insert in pL30 is 26705 P.N. pL30p clone DNA transformed into E. coli S17λPIR and the resulting strain kongugiruut with heterologous strains ofPseudomonassp. Kosmidou pL30p enter in the. fluorescensCECT378 andP. aeruginosaCEST by conjugation of the two parental options, as described above. After identification of a clone encoding a cluster, determine whether this potential strain to produce safracin. Products saracina in conjugated strains evaluate the analysis method HPLC and using biological test, which uses supernatant broth cultures, as described previously.

The strain ofP.fluorescensCECT378 expressing kosmidou pL30p (PM-19-002), and are able to produce safracin in significant quantities, while education saracina in strainP. aeruginosaCECT110 expressing pL30 (RM-16-002), 10 times less than in CECT378. Products saracina in these strains is approximately 22% and 2% of the total production in comparison with the natural strain-producer.

Genes involved in the formation saracina. Analysis of the sequences of operons sacABCDEFGH and sacIJ

Computer analysis of DNA sequences pL30 revealed 14 ORFS (1). The site of a possible link with ribosomal precedes each of the ATG start codons.

In the operonsacABCDEFGHthree very large LFS:sacA, sacBandsacC(position 3052-6063, 6080-9268, and 9275-13570 in the sequence saracinaP.fluorescensA2-2 SEQ ID No. 1, respectively) can be read in the same direction and encode hypothetical NRPS Safra is ina: S acA(1004 amino acids, Mr110452),sacB(1063 amino acids, Mr117539) andsacC(1432 amino acids, Mr157331). Three NRPS gene contain domains corresponding to the activating amino acid domains known peptisyntha. Specific domain that activates the amino acid specified NRPS genes are very close to three of the four domains, activating amino acid (Gly, Tyr, and Tyr), found in NRPS saracina in Myococcus xanthus (Pospich et al.,Microbiology1995, 141, 1793-803; Pospich et al.,Environ. 1996, 142, 741-746). In particular, SacA (SEQ ID No: 2) shows 33% identity with the protein synthetase In saframycin Mx1 B (SafB) from M. xanthus (access number in NCBI U24657), whereas SacB (SEQ ID No: 3) and SacC (SEQ ID No: 4) are characterized by 39% and 41% identity, respectively, with the synthetase And saframycin Mx1 (SafA) of M. anthus (access number in NCBI U24657). On2shown in a comparative perspective SacA, SacB, and SacC, as well as the various domains, activating amino acid, and NRPS saframycin.

There is a reading of five small ORFS in the direction of transcriptionsacC,as NRPS genes (1). The first of themsacD(position 13602-14651 in samazinosa sequenceP.fluorescensA2-2) presumably encodes a proteinSacD(350 amino acids, Mr39187, SEQ ID No:5), when this is not observed similar variations in GeneBank DB. The followingsac(position 14719-14901 in samazinosa sequenceP.fluorescensA2-2) encodes pedological is but a small protein Sac(61 amino acid, Mr6729, SEQ ID No: 6), which shows some similarity with proteins in the databases of unknown functions (LFS 1 fromStreptomyces viridchromgenes(the access number in NCBI Y17268; 44% identity) and MbtH fromMycobacretium tuberculosis(the access number in NCBI Z95208; 36% identity). Third LFSsacF(position 14962-16026 in samazinosa sequenceP.fluorescensA2-2) encodes a protein of 355 residues with a calculated molecular mass of 39834 (SEQ ID No: 7). This protein is most similar to methyltransferase hydroxylaminopurine (CrtF) fromChloroflexus aurantiacus(the access number in NCBI AF288602; 25% identity). The nucleotide sequence of the fourth LFSsacG(position 16115-17155 in samazinosa sequenceP.fluorescensA2-2) corresponds to the predicted gene product of 347 amino acids with a molecular mass 3822 kDa (SEQ ID No: 8). Protein named SacG, close to the bacterial O-methyltransferases, including On-dimethylpyrimidin-O-methyltransferase (DmpM) fromStreptomyces anulatus(the access number in NCBI R; 31% identity). A computer search shows that this protein contains three motif sequences found in different S-adenosylmethionine-dependent methyltransferases (Kagan and Clarke, Arch. Biochem. Biophys. 1994, 310, 417-427). The fifth gene, SacH (position 17244-17783 in samazinosa sequenceP.fluorescensA2-2) encodes a hypothetical SacH (180 amino acids; Mr19632; SEQ ID No: 9). A computer search of the similarity between the calculated amino acid sequence SacH and other protein sequences reveals identity with some conservative hypothetical proteins of unknown function that contains a fairly conservative transmembrane motif and site activity type digidrofolyatreduktazy (conservative hypothetical proteinPseudomonas aeruginosaPAO1, the access number in NCBI R; 35% identity).

Progress against reading operon sacABCDEFGH are two genessacIJin the antisense direction. GenesacI(position 2513-1854) encodes a protein of 220 amino acids (Mr24219; SEQ ID No: 10), which is closest to the methyltransferase ubiquinone/manekenon fromThermotoga maritime(the access number in NCBI AE001745; 32% identity). Gene sacJ (position 1861-335) encodes a protein of 509 amino acids (SEQ ID No: 11) c molecular weight 55341 Yes, which is similar bacterial monooxygenase/hydroxylases, including presumably the regioselectivity of theBacillus subtilis(the access number in NCBI Y14081; 33% identity) andStreptomyces coelicolor(the access number in NCBI AL109972; 29% identity).

Operons sacABCDEFGH and sacIJ are transcribed differently and separated by a stretch of approximately 450 BP Both operon flanked remaining transported fragments.

Genes related genes saracinesco cluster

Was obnaruzhena hypothetical ORFS ( orf1; position 18322-19365 in samazinosa sequenceP.fluorescensA2-2), located on the 3'-end samazinosa sequence (figure 1). ProteinORF1(SEQ ID No: 12) shows similarity with aminopeptidase from Gene Bank database (peptidase family M20/M25/M40 fromaulobacter crescentusCB15; the access number in NCBI NP422131; 30% identity). Using the strategy described in example 2, it is shown that the destruction of the geneorf1does not affect production saracina inP. fluorescensA2-2.

Samazinosu sequence of clone 3'-end in cosmides pL30p and identify three hypothetical ORFS (orf2, orf3 and orf4). Read geneorf2in the direction opposite to the direction of reading of the operonsacABCDEFGH(position 22885 - 21169, SEQ ID No: 1), gives ORF2 protein (SEQ ID No: 13), which has similarity with sensory protein HoxX inAquifex aeolicus(the access number in NCBI NC000918.1; 35% identity), whereas geneorf3(position 23730-23041 in SEQ ID No: 1) encodes a protein ORF3 (SEQ ID No: 14), which has 44% identity with the protein, close to glycosyltransferaseXanthomonas axonopodispv. Citri str. 306 (access number in NCBI NP642442).

The third gene is located on the 3'-end of SEQ ID No: 1 (position 25037-26095). This gene, namedorf4(position 2513-1854), encodes a protein RF4 (SEQ ID No: 15), which is more reminiscent of a hypothetical proteinEscherichia colifrom the family of izkoristiti YcdL (access number in NCBI P75897; 32% identity).

These three genes are probably not involved in the biosynthesis pathway saracina, however, only further destruction of these genes will be able to confirm this assumption.

Various found DNA sequences are listed in the end of the description.

Example 4. Functional analysis of the locus saracina and a search of possible predecessors

As presently unknown path synthesis saracina inP. fluorescensA2-2, inactivation of each of the genes described in example 3, will represent a fundamental study of the mechanism of biosynthesis saracina in this strain.

To analyze the functional properties of each individual protein in the way of products saracina spend the destruction of each individual gene in the cluster, except forsac. All genetic mutants obtained by this strategy of destruction, have been previously described.

6is a brief description of the different mutants constructed in the framework of the present invention, as well as a brief description of the compounds obtained using mutants containing the destroyed gene. In the wild-type strain HPLC methods were clearly detected and safracin, and safracin In, as well as other compounds, P2 and R (see6, WT). Gene destructionsacA(PM-S1-002),sacB(PM-S1-003),sacC(PM-S1-004),sacD(PM-S1-010),sacF(PM-S1-008) andsacG(PM-S1-009) results in gene mutants which is not capable of producing no safracin And nor safracin In, no connection predecessors, and have a retention time less than 15 minutes, P2 and P4, respectively. The study of the patterns P2 and R shows that R represents 3-methyl-O-methyltyrosine, whereas P2 is a 3-hydroxy-5-methyl-O-methyltyrosine. Due to the small size of the genesacthissacthe mutant cannot be obtained by gene disruption, but in ongoing attempts to obtain deletions in this gene. Overexpression of protein Sac in the TRANS-position had no effect on production saracina/A. MutantssacI(PM-S1-006) produce P2, R and significant amounts of compounds called RV (6, fig.7b*). The study of the structure RV shows that this compound is safracin-like molecule, in which N-Met and one of the Oh groups of quinone rings are missing. In mutantssacJ(PM-S1-005) were obtained P2, P14, P19B, and two new compounds, named RA and RV (6, figa*).

The study of the structure RA and RV showed that they are molecules that are close to Saraceno and saracino In accordingly, but without one IT group in the quinone ring. Biological testing of extracts of mutantssacI and sacJdetects very low activity againstBacillus subtilis.

The destruction of thesacIgene by restoring Express the gene and sacJresults of a new mutant, producing saracini, PM-S1-007. Both antibiotic produced at the same high level as safracin and safracin In the wild-type strain, were identified as safracin D and safracin E (figs*). Safracin D and safracin E represent molecules safracin B and safracin A, respectively, which lack the N-methylation.

These results greatly to believe that (i) genessacA, sacB, and sacCencode NRPS saracina; (ii) genessacD, sacF and sacGresponsible for the transformation of L-Tyr L-Tyr-derived P2 and (iii)sacI and sacJresponsible for the "tail" modifications that make P19 and P22 in sarazin.

Characteristics of natural predecessors

R-14

C11H15NO3
Exact mass: 209,11, Mol. weight: 209,24
With - 63,14; H - 7.23 percent; N - 6,69; O - 22,94

Strain:

Pseudomonas fluorescensA2-2 (wild type) (PM-S1-001)

Fermentation condition:

In the sowing medium YMP3 containing 1% glucose, 0.25% of meat extract, 0.5% bactopeptone, of 0.25% NaCl, 0.8% of CaCO3, inoculant of 0.1% frozen vegetative culture of microorganisms and incubated on a rotary shaker(250 rpm) at 27°C. After 30 hours of incubation with 2% V/V seed culture is transferred into erlenmeyers flask 2000 ml containing 250 ml of producing environment M-16V, which consists of 15,2% mannitol, 3,5% of dry Baker's yeast, 1,4% (NH4)2SO4, 0,001% FeCl3, 2.6% caso3. The incubation temperature is 27°C at the time of inoculation until after 40 hours of incubation and then 24°C until the end of the process (71 hours). The pH is not controlled. The speed of mixing on a rotary shaker 220 rpm with eccentricity 5 see

Selection:

After 71 hours of incubation, combine the contents of two erlenmeyers Kolb and 500 ml of fermentation broth clarify by centrifugation at 7500 rpm for 15 minutes. To the supernatant add 50 g of resin XAD-16 (mberlite) and stirred for 30 minutes at room temperature. Then the resin is recovered from the clarified broth by filtration. Next, the resin is washed twice with distilled water and extracted with 250 ml of isopropanol (2-D). Alcohol extract is dried in high vacuum to obtain 500 mg of the crude extract. This crude extract was dissolved in methanol and purified through column chromatography using Sephadex LH-20 and methanol as mobile phase. Connection R-14 elute and dried, receiving 15 mg of yellowish solid. The purity determined what ispolzovaniem analytical method HPLC and method 1H-NMR.

R-14 also produce a similar way from cultures of mutantsacJ(PM-S1-005) using prepreparation HPLC at the last stage of the cleaning process.

Biological activity:

ACTIVITY IS ABSENT.

Spectroscopic data:

ESMS m/z 254 (C11H14NO3Na2+), 232 (C11H15NO3Na+), 210 (M+H+),1H NMR (300 MHz, CD3OD): 7,07 (d, J=8,1 Hz, H-9), 7,06 (s, H-5), at 6.84 (d, J=8,1 Hz, H-8), 3,79 (s, H-11), and 3.72 (DD, J=8,7, 3,9 Hz, H-2), 3,20 (DD, J=14,4, 3,9 Hz, H-3a), only 2.91 (DD, J=14,4, and 8.9 Hz, H-3b), 2,16 (, H-10).13With NMR (75 MHz, CD3OD): 174,1 (C-1), 158,6 (C-7), 132,5 (C-5), 128,9 (C-9), 128,5 (C-4), USD 128.0 (C-6), BYR111.4 (C-8), AND 57.6 (C-2)AND 55.8 (C-11), OR 37.4 (C-3), AND 16.3 (C-10).

R-2

C11H15NO4
Exact mass: 225,10, Mol. weight: 225,24
With - 58,66; H - of 6.71; N - 6,22; O - 28,41

Strain:

Pseudomonas fluorescensA2-2 (wild type) (PM-S1-001).

Fermentation condition:

The same process as in the case of R-14.

Selection:

Carry out a procedure similar to the one used in the case of R-14, except chromatography on Sephadex, which later suiryudan fractions containing P-2. For purification of R-2 binding stage prepreparation HPLC (Colo is ka Symmetry of Rger C-18, 7,8 x 150 mm, 10 mm AcONH4pH 3/CH3CN (95:5)for 5 minutes and then the gradient 5-6,8% CH3CN for 3 minutes).

There are also connections from the fermentation brothPseudomonas putidaATCC12633+pB5H83 (PM-17-004)obtained by heterologous expression.

Biological activity:

ACTIVITY IS ABSENT.

Spectroscopic data:

ESMS m/z 226 [M+H]+;1H NMR (CD3OD, 300 MHz): of 6.65 (d, J=1.8 Hz, H-5), 6,59 (d, J=1.8 Hz, H-9), and 3.72 (s, H-11), 3,71 (DD, J=9,0, 4,2 Hz, H-2), and 3.16 (DD, J=14,4 and 4.2 Hz, H-3a), and 2.83 (DD, J=14,4, 9.0 Hz, H-3b), 2,22 (s, H-10);13C NMR (DMSO, 75 MHz): 170,88 (s, C-1), 150,025 (s, C-7), 144,56 (s, C-8), 132,28 (s, C-4), 130,36 (s, C-6), 121,73 (d, C-5), 115,55 (d, C-9), 59,06 (kV, 7-OMe), 55,40 (d, C-2), 36,21 (t, C-3), 15,86 (kV, 6-Me).

Feature safracin-like compounds obtained by turning off the gene function

Connection R-22B

With28H38N4O6
Exact mass: 526,28
Mol. weight: 526,62
With - 63,86; H - 7,27; N - At 10.64; O - 18,23

Strain:

sacJmutantPseudomonas fluorescensA2-2 (PM-S1-005).

Fermentation condition:

In the bioreactor for growing crops (Woadie LP-351) with a total capacity of 75 litres pour 50 liters environment SAM-7 (50 l), consisting of dextrose (,2%), mannitol (9,6%), dry Baker's yeast (2%), ammonium sulphate (1,4%), secondary potassium phosphate (0,03%), potassium chloride (0,8%), 6-hydrate of iron chloride (III) (0,001%), L-tyrosine (0,1%), calcium carbonate (0.8 per cent), poly(propylene glycol) 2000 (0,05%) and antifoam ASSAF 1000 (0,2%), and after sterilization add sterile antibiotics (ampicillin 0.05 g/l and kanamycin 0.05 g/l). Then on Wednesday inoculant seed culture (2%) mutant strain PM-S1-005. The fermentation is carried out in a period of 71 hours under conditions of aeration and mixing (1.0 l/l/min and 500 rpm). The temperature maintained within the range from 27°C (from the moment of inoculation within 24 hours) to 25°C (starting from 24 hours before the end of the process). The pH value is maintained at the level of 6.0 by automatic addition of diluted sulphuric acid, since 22 hours before the end of the process.

Selection:

The whole broth lighten (centrifuge Sharples (Sharples)). the pH of the clarified broth was adjusted to pH of 9.0 by adding 10% NaOH and extracted with 25 liters of ethyl acetate. After 20 minutes of stirring the two phases are separated. The organic phase is freeze overnight, then filtered to remove ice and evaporated to obtain oily dark green extract (65.8 g).

The extract obtained is mixed with 500 ml of hexane (add twice 250 ml) and filtered to remove soluble in hexane impurities. The remaining solid after su is key gives a 27.4 g of dry green-beige extract.

New the extract obtained is dissolved in methanol and purified by chromatography on Sephadex (Sephadex LH-20) (using methanol as mobile phase solvent) and safranin-like substances elute in the Central fractions (TLC analysis: silica gel, normal phase, mobile phase: EtAc: MeOH 5:3. Approx. the Rf value: 0.3 for P-22B, 0.25 for P-22A and 0.1 to P-19).

Combined fractions (7.6 g), containing three safracin-like compounds, purified on a column of silica gel using a mixture EtAc: MeOH gradient from 50:1 to 0:1 and other chromatographic systems (isocratic system CHCl3:Meon:H2O:Asón, 50:45:5:0,1). Connection P22, P22 and P19-purified by HPLC with phase reversal (column SummetryPrep C-18, 150×7.8 mm, 4 ml/min, mobile phase: 5 min, Meon:H2O (0,02% TFU), 5:95, and the gradient from the Meon:H2O (0,02% TFU) 5:95 to Meon 100% within 30 minutes).

Antimicrobial activity: on solid medium.

Bacillus subtilis: 10 ág/disc (6 mm diameter): zone of inhibition of 10 mm

Spectroscopic data:

HRFABMS m/z 509,275351 [M-H2O+N]+(calculated for: C28H37N4O5509,276396 Δ 1,0 mmu); LRFABMS using m-NBA as matrix m/z (relative intensity) 509 [M-H2O+N]+(5), 460 (2,7), 391 (3).

1H NMR (CD3OD, 500 MHz): 6,70 (s, H-15), of 6.52 (s, H-5), 4,72 (users, H-11), of 4.66 (d, J=2.0 Hz, H-1), to 4.62 (DD, J=8,4, and 3.7 Hz, H-1), 3,98 (userd, J=7,6 Hz, H-13), 3,74 (s, 7-OMe), 3,71 (s, 17-OMe), 3,63 (m, overlapped signals, H-25), 3,62 (m, overlapped signals, H-3), 3,30 (m, H-22A), 3,29 (m, H-14a), 3,18 (d, J=18.6 Hz, H-14b), 2,90 (m, H-4A), is 2.88 (m, H-22b), was 2.76 (s, 12-NMe), is 2.30 (s, 16-Me), 2,22 (m, H-4b), of 1.16 (d, J=7,4 Hz, H-26);

13With NMR (CD3OD, 125 MHz): 170,75 (s, C-24), 149,24 (s, C-18), 147,54 (s, C-8), of 145.95 (s, C-7), 145,82 (s, C17), 133,93 (s, C-16), 132,31 (s, C-9), 131,30 (s, C-6), 128,95 (s, C-20), 121,93 (d, C-15), 121,76 (d, C-5), 121,44 (s, C-10), 112,45 (s, C-19), 92,87 (d, C-21), 60,86 (kV, 7-OMe), 60,76 (kV, 17-OMe), 59,39 (d, C-11), 57,96 (d, C-13), 55,51 (d, C-1), 54,29 (d, C-3), 50,08 (d, C-25), 45,55 (t, C-22), 40,43 (kV, 12-NMe), 32,56 (t, C-4), 25,84 (t, C-14), 17,20 (kV, C-26), 16,00 (kV, 16-Me), 15,81 (kV, 6-Me).

CONNECTION R-22A

Strain:

The same as in the case of P-22V.

Fermentation condition:

The same as in the case of P-22V.

Selection:

Same as in the case of P-22V.

Biological activity saracina R-22A

Antitumor activity

Antimicrobial activity: on solid medium.

Bacillus subtilis: 10 ág/disc (6 mm diameter):

ACTIVITY IS ABSENT.

Spectroscopic data:

HRFABMS m/z 511,290345 [M+H]+(calculated for C28H39N4O5511,292046 Δ 1,7 mmu); LRFABMS using m-NBA as matrix m/z (relative intensity) 511 [M+H]+(61), 409 (25), 391 (4);1H NMR (CD3OD, 500 MHz): of 6.68 (s, H-15), 6,44 (s, H-5), 3,71 (s, 7-OMe), 3,67, 17-OMe), of 2.72 (s, 12-NMe), 2,28 (s, 16-Me), measuring 2.20 (s, 6-Me), of 0.87 (d, J=7,1 Hz, H-26).

Connection R-19C

Strain:

The same as in the case of P-22V.

Fermentation condition:

The same as in the case of P-22V.

Selection

Same as in the case of P-22V.

Biological activity saracina R-19C

Antitumor activity

Cell lines (mol/l)

Antimicrobial activity: on solid medium.

Bacillus subtilis: 10 ág/disc (6 mm diameter):

ACTIVITY IS ABSENT.

Spectroscopic data:

HRFABMS m/z 495,260410 [M-H2O+N]+(calculated for: C27H35N4O5495,260746 Δ of 0.3 mmu); LRFABMS using m-NBA as matrix m/z (relative intensity) 495 [M-H2O+N]+(13), 460 (3), 391 (2);1H NMR (CD3OD, 500 MHz): 6,67 (s, H-15), and 6.5 (s, H-5), of 3.73 (s, 7-OMe), 3,71 (s, 17-OMe), to 2.29 (s, 16-Me), 2,24 (s, 6-Me), of 1.13 (d, J=7,1 Hz, H-26).

New saratsinovata compounds obtained by turning off the gene function

Safracin D

C27H34N4O7
Exact mass: 526,24
Mol. weight: 526,58
With - 61,58; H - 6,51; N - At 10.64; O - 21,27

Strain:

sacIwith restored exp is essay sacJfromP. fluorescensA2-2 (PM-S1-007)

Fermentation condition:

In the bioreactor for growing crops (Woadie LP-351) with a total capacity of 75 litres pour 50 liters environment SAM-7 (50 l), consisting of dextrose (3,2%), mannitol (9,6%), dry Baker's yeast (2%), ammonium sulphate (1,4%), secondary potassium phosphate (0,03%), potassium chloride (0,8%), 6-hydrate of iron chloride (III) (0,001%), L-tyrosine (0,1%), calcium carbonate (0,8%), poly(propylene glycol) 2000 (0,05%) and antifoam ASSAF 1000 (0.2%) and after sterilization add sterile antibiotics (ampicillin 0.05 g/l and kanamycin 0.05 g/l). Then on Wednesday inoculant seed culture (2%) mutant strain PM-S1-007. The fermentation is conducted for 89 hours under conditions of aeration and mixing (1.0 l/l/min and 500 rpm). The temperature maintained within the range from 27°C (from the moment of inoculation within 24 hours) to 25°C (starting from 24 hours before the end of the process). The pH value is maintained at the level of 6.0 by automatic addition of diluted sulphuric acid, starting with 27 hours before the end of the process.

Selection:

Thus obtained culture medium (45 l) after removal of cells by centrifugation, adjusted to a pH of 9.5 with dilute sodium hydroxide and extracted with twice 25 liters of ethyl acetate. The mixture is introduced into the vessel with stirring at room temperature for 20 minutes. The two phases are separated by centrifuge is of the type of liquid-liquid. The organic phase is frozen at -20°C, filtered to remove ice and evaporated to obtain 35 g of a dark oily crude extract. After trituration with 5 l of hexane extract (12,6 g) purified flash chromatography on a column (diameter 5.5 cm, length 20 cm) using normal phase silica gel, mobile phase: ethyl acetate: MeOH: 1 l of each of the systems: 1:0; 20:1; 10:1; 5:1 and 7:3. Elute fractions of 250 ml and unite in connection with the terms TLC (silica gel, normal phase, EtOAc:MeOH, 5:2, Sarrazin D: Rf - 0,2; sarazin E - 0,05). The fraction containing the crude safracin D and E, is evaporated in a high vacuum (2.2 g). Required additional cleaning stage to separate saracina D and E in a similar situation (EtOAc:MeOH 1:0 to 5:1), and then the fractions containing safracin D and E, separated and evaporated, and then purified by chromatography on a column of Sephadex LH-20, which elute with methanol.

Received saracini D and E represent the form, deposited from CH2Cl2(80 ml) and hexane (1500 ml), having the appearance of a dry green/yellowish dry solids (800 mg saracina D) and (250 mg saracina E).

Biological activity saracina D

Antitumor screening:

Cell lines (mol/l)

WTO the ranks assessment (mol/l)
Secondary screeningMacromolecular synthesisApoptosisDNA bindingThe cytoskeleton
ProteinDNARNAThe nucleosomeGELActinTubulinTelomerase
PM-Fernando de la Calle 020 20-AUG-02IC501,90E-051,52E-053,80E-062,85E-066,65E-06..

Antimicrobial activity: on solid medium.

Bacillus subtilis: 10 ág/disc (6 mm diameter): Zone of inhibition: 15 mm in diameter.

Spectroscopic data:

ESMS: m/z 509 [M-H2O+N]+;1H NMR (CDCl3, 300 MHz): 6,50 (s, C-15), was 4.02 (s, OMe), of 3.73 (s, OMe), 2,22 (s, Me), of 1.85 (s, Me)to 0.80 (d, J=7.2 Hz);13With NMR (CDCl3, 75 MHz): 186,51, 181,15, 175,83, 156,59, 145,09, 142,59, 140,78, 137,84, 131,20, 129,01, 126,88, 121,57 (2 × With), 82,59, 60,92, 60,69, 53,12, 21,40, 50,68, 50,22, 48,68, 40,57, 9,60, 25,01, 21,46, 15,64, 8,44.

Strain:

The same as in the case saracina D.

Fermentation condition:

The same party that in the case of safracin D.

Selection

Cm. conditions for obtaining saracina D.

Biological activity saracina E

Antitumor screening:

Cell lines (mol/l)

Secondary assessment (mol/l)
Secondary screeningMacromolecular synthesisApoptosisDNA bindingThe cytoskeleton
ProteinDNARNAThe nucleosomeGELActinTubulinTelomerase
PM-Fernando de la Calle 020 20-AUG-02IC50..1.57E-05>1.96E-05.. ..

Antimicrobial activity: on solid medium.

Bacillus subtilis: 10 ág/disc (6 mm diameter): Zone of inhibition: 9.5 mm

Spectroscopic data:

ESMS: m/z 511 [M+H]+;1H NMR (CDCl3, 300 MHz): 6,51 (c, C-15), Android 4.04 (c, OMe), 3.75 to (c, OMe), 2,23 (c, Me), 1,89 (c, Me), is 0.84 (d, J=6.6 Hz);13C NMR (CDCl3, 75 MHz): 186,32, 181,28, 175,83, 156,43, 145,27, 142,75, 141,05, 137,00, 132,63, 128,67, 126,64, 122,00, 120,69, 60,69, 60,21, 59,12, 58,04, 57,89, 50,12, 49,20, 46,72, 39,88, 32,22, 25,33, 21,29, 15,44, 8,23.

Example 5. Cross experiments with added components

Heterologous expression of genes of the biosynthesis of precursors saracina for products P2 and R

With the aim to shed light on the mechanism of biosynthesis of P2 and R the authors carried out the cloning and expression of in the direction of reading NRPS genes to determine their biochemical activity.

To achieve overproduction R clone genessEFGH(pB7983) (4). To achieve overproduction P2 in heterologous system clone genessacD sH(pB5H83) (4). To achieve this goal using PCR amplificatoare fragments carrying the genes of interest, using oligonucleotides that contain the restriction site XbaI at the 5'-end. Use oligonucleotides PFSC79 (5'-CGTCTAGACACCGGCTTCATGG-3') and PFSC83 (5'-GGTCTAGATAACAGCCAACAAACATA-3') for amplification of genessacE - sacH; and use oligonuclear the IDA 5HPT1-XB (5'-CATCTAGACCGGACTGATATTCG-3') and PFSC83 (5'-GGTCTAGATAACAGCCAACAAACATA-3') for implicitely genes sacD - sacH. The PCR fragments, split XbaI, clone the restriction site XbaI in pBBR1-MCS2 plasmid (Kovach et al.,Gene1994, 166, 175-176). Both plasmids pB7983 and pB5H83 injected separately in three heterologous bacteriaP. fluorescens(CECT 378),P. putida(ATCC12633)P.stutzeri(ATCC 17588) by conjugation (see table II). According to HPLC analysis, the fermented culture broth with strains transconjugate there is a large number R connections in all three strains containing plasmid pB7983, while large quantities of P2 and R products are observed in the case when the expression pB5H83 plasmids in heterologous bacteria.

Cross-version cultivation

As can be seen from the data of example 4, the mutantssacF-(PM-S1-008) andsacG-(PM-S1-009) is not capable of producing no safracin or P2 and P14 connection. The addition of chemically synthesized P2 to these mutants during fermentation results in safracin.

In addition, the joint cultivation of heterologous strains ofP. stutzeri(ATCC 17588)carrying plasmid pB5H83 (PM-18-004), the expression of which is formed by P2 and P14, with one of two strains ofsacF-andsacG-that leads to the formation of saracina. Joint cultivation of heterologous strains ofP. stutzeri(ATCC 17588)carrying plasmid pB7983 (PM-18-005), the expression of which leads to the obtaining of the 14, with one of the two mutantsP. fluorescensA2-2, above, does not lead to the formation saracina. The obtained results allow to assume that R transformed into P2, the molecule that can easily be transported in and out through the cell wall of Pseudomonas sp., and whose presence is absolutely necessary for the biosynthesis saracina.

Example 6. Biological production of new "non-natural" molecules

Add in the amount of 2 g/l specific modified derivative predecessor P2, P3 3-hydroxy-5-methyl-O-ethylthiophene to sacF mutant (PM-S1-008) during fermentation, gives two "unnatural" saracina, which include the modified precursor P3 in its structure, safracin A(OEt) and safracin In(OEt).

Strain:

Mutant sacF on the basis of P.fluorescens A2-2 (PM-S1-008).

Fermentation condition:

The sowing medium containing 1% glucose, 0.25% of meat extract, 0.5% bactopeptone, of 0.25% NaCl, 0.8% caso3, inoculant of 0.1% frozen vegetative cultures of microorganisms and incubated on a rotary shaker (250 rpm) at 27°C. After 30 hours of incubation with 2% V/V seed culture of a mutant PM-S1-008 carry in erlenmeyers flask 2000 ml containing 250 ml of medium M-16 In production, consisting of 15.2 per cent mannitol, 3,5% of dry Baker's yeast, 1,4% (NH4)2, 0,001% FeCl3, 2.6% caso3and 0.2% of the 3 (3-hydroxy-5-methyl-O-methyltyrosine). Temperature during incubation is 27°C, starting from the moment of inoculation up to 40 hours, and then 24°C until the end of the process (71 hours). The pH is not controlled. Speed agitation in a rotary shaker 220 rpm with eccentricity 5 see

Selection:

Combine the contents of 4 x 2000/250 ml erlenmeyers Kolb (970 ml), centrifuged (12000 rpm, 4°C, 10', J2-21 centrifuge, BECKMAN) to remove cells. pH in purified broth (765 ml) is brought to a value of 9.0 by adding 10% NaOH. Then the clarified alkaline broth is extracted in a ratio of 1:1 (volume/volume) EtOAc (x2). The organic phase is evaporated in a high vacuum and get greasy dark extract (302 mg).

The extract is washed by trituration with hexane to remove impurities and solid components purified column chromatography using normal phase silica gel and a mixture of ethyl acetate/methanol (12:1 to 1:1). The fractions are examined by UV when using the TLC (silica gel 60, mobile phase EtOAc:MeOH, 5:4, Rf - 0.3 for Safracin B-Ot and 0.15 for safracin A-Ot). The result of this procedure, get safracin B Ot (25 mg) and safracin A Ot (20 mg).

Biological activity saracina In(OEt)

Antitumor activity

Cell lines (mol/l)

Secondary the assessment (mol/l)
Secondary screeningMacromolecular synthesisApoptosisDNA bindingThe cytoskeleton
ProteinDNARNAThe nucleosomeGELActinTubulinTelomerase
10-OCT-02IC50>1.76E-051.76E-061.76E-075.28E-081.76E-05..

Antimicrobial activity: on solid medium.

Bacillus subtilis: 10 ág/disc (6 mm diameter): zone of inhibition of 17.5 mm

Spectroscopic data:

ESMS: m/z 551 [M-H2O+N]+;1H NMR (CDCl3, 300 MHz): 6.48 in (s, H-15), 2,31 (s, 16-Me), 2,22 (s, 12-NMe), a 1.88 (s, 6-Me), was 1.43 (t, J=6.9 Hz, Me-ethoxy), of 1.35 (t, J=6.9 Hz, Me-ethoxy), 0,81 (d, J=7.2 Hz, H-26).

Strain:

The same as in the case saracina In(OEt).

Conditions of farms is ncacii:

The same as in the case saracina In(OEt).

Selection:

Combine the contents of 4 × 2000/250 ml erlenmeyers Kolb (970 ml), centrifuged (12000 rpm, 4°C, 10', J2-21 centrifuge, BECKMAN) to remove cells. In the clarified broth (765 ml), adjusted pH to 9.0 by adding 10% NaOH. Then the clarified alkaline broth is extracted in a ratio of 1:1 (volume/volume) EtOAc (x2). The organic phase is evaporated in a high vacuum and get greasy dark extract (302 mg).

The extract is washed by trituration with hexane to remove impurities and solid components purified column chromatography using normal phase silica gel and a mixture of ethyl acetate/methanol (12:1 to 1:1). The fractions are examined by UV when using the TLC (silica gel 60, mobile phase EtOAc:MeOH, 5:4, Rf - 0.3 for safracin B-OEt and 0.15 for safracin A-OEt). The result of this procedure, get safracin In OEt (25 mg) and safracin A OEt (20 mg).

Biological activity safracin A(OEt)

Antitumor activity

Secondary assessment (mol/l)
Secondary screeningMacromolecular synthesisApoptosisDNA binding The cytoskeleton
ProteinDNARNAThe nucleosomeGELActinTubulinTelomerase
10-OCT-02IC50..6.33E-061.81E-06...

Antimicrobial activity:on solid medium.

Bacillus subtilis:10 ág/disc (6 mm diameter): zone of inhibition of 10 mm

Spectroscopic data:

ESMS: m/z 553 [M+H]+;1H NMR (CDCl3, 300 MHz): 6.48 in (c, H-15), 2,33 (c, 16-Me), 2,21 (c, 12-NMe), 1,88 (c, 6-Me), to 1.42 (t, J=6.9 Hz, Me-ethoxy), of 1.34 (t, J=6.9 Hz, Me-ethoxy), 0,8 (d, J=6,9 Hz, H-26).

Example 7. Enzymatic transformation saracina In safracin And

To assess the enzymatic activity aimed at making saracina In safracin And cultures of various strains after 120 hours fermentation (see conditions in example 2:Biological analysis (Biotest) education saracina)collected and centrifuged (9000 rpm x 20 minutes). Analyzed shtam the s include P. fluorescensA2-2 and the wild-type strain andP. fluorescensCECT378 + pBHPT3 (PM-19-006) as host cells for heterologous expression. Supernatant discarded and cells washed (NCl 0,9%) twice and resuspended in 60 ml of 100 mm phosphate buffer, pH 7,2. 20 ml of cell suspension was dispensed into three erlenmeyers retorts:

(a) cell suspension + sarazin (400 mg/l);

b) cell suspension, heated to 100°C for 10 minutes, + sarazin (400 mg/l) (negative control);

(C) cell suspensions without saracina (negative control).

Biochemical reaction occurs in the process of incubation at 27°C and a speed of 220 rpm, and every 10 minutes away samples. Transformation saracina In safracin And track by HPLC. The obtained results clearly show that genesacHcloned in pBHPT3, encodes a protein responsible for the transformation of safracin In safracin A.

Based on these results, the authors conducted an analysis to determine whether this is the same enzyme to recognize another substrate, such as ecteinascidin 743 (ET-743), and to transform this connection in Et-745 (in which the hydroxy-group in position C-21 is missing). Repeat the above experiments with obtaining erlenmeyers flasks containing:

(a) cell suspension + ET-743 (approximately 567 mg/l);

b) CL is the exact suspension, heated to 100°C for 10 minutes, + ET-743 (567 mg/l) (negative control);

(C) cell suspension without ET-743 (negative control).

Biochemical reaction occurs in the process of incubation at 27°C and a speed of 220 rpm, and samples taken at the point 0, 10 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 20 hours, 40 hours, 44 hours, 48 hours. The transformation of ET-743 in ET-745 track by HPLC. The results obtained clearly show that the gene sacH, cloned in pBHPT3, encodes a protein responsible for the transformation of ET-743 in ET-745. The result shows that these enzymes recognize ecteinascidin as the substrate and that it can be used for biological transformation of a wide range of structures.

SEQUENCE

1. Nucleic acid, providing biosynthesis safracin a and b, which is selected from the group consisting of:
a) a nucleic acid that contains a full-sized gene cluster saracina Pseudomonas fluorescens And-2 and characterized by the sequence SEQ ID NO:1;
b) nucleic acid, essentially corresponding to the operons sacABCDEFGH and sacIJ gene cluster saracina Pseudomonas fluorescens A2-2 and characterized by the structure and location in the sequence of SEQ ID NO:1, as shown in figure 1;
c) a nucleic acid that represents a variant of a) or b), which includes substitutions in the coding areas defined by the degeneracy of the genetic code.

2. Nucleic acid according to claim 1, containing genes sacA, sacB, scC, sacD, sacE, sacG and sacH.

3. Nucleic acid, providing biosynthesis structural analogue saracina, which is a genetically modified form of a nucleic acid according to claim 1 and characterized by the absence or disruption of the gene sacI and/or gene sacJ operon sacIJ.

4. Nucleic acid according to claim 3, in which the gene sacI missing or destroyed.

5. Nucleic acid according to claim 3, in which the gene sacJ missing or destroyed.

6. Nucleic acid according to claim 3, in which the gene sacI is missing or destroyed, and the gene expression sacJ restored.

7. Nucleic acid used to obtain saracina or its structural analogue, which is a genetically modified form of a nucleic acid according to claim 1 and characterized by the absence or disruption of the gene sacF or gene sacG.

8. The expression vector containing the nucleic acid to the slot according to claim 1.

9. A host cell of Pseudomonas sp., transformed by the vector of claim 8, providing the biosynthesis of saracino a and B.

10. The method of receiving saracino a and b, including:
a) culturing the host cell containing the nucleic acid according to claim 1 in a suitable culture medium and under conditions for cell proliferation;
b) the restoration of the culture medium and
c) purification of saracino from the culture medium.

11. A method of obtaining structural analogue saracina, including:
a) culturing the host cell containing the nucleic acid according to claim 3 in a suitable culture medium and under conditions for cell proliferation;
b) the restoration of the culture medium and
c) cleaning compounds saracina from the culture medium.

12. The method according to claim 11, where specified a host cell contains a nucleic acid according to claim 4.

13. The method according to claim 11, where specified a host cell contains a nucleic acid according to claim 5.

14. The method according to claim 11, where specified a host cell contains a nucleic acid according to claim 6.

15. The method of receiving saracino a and b, including:
a) culturing the host cell containing the nucleic acid according to claim 7, in a suitable culture medium and under conditions for cell proliferation;
b) the restoration of the culture medium and
c) purification of saracino of the culture medium,
where this culture medium contains L-Tyr of proizvodi is e P2 with the following structure:
.

16. A method of obtaining structural analogue saracina, including:
a) culturing the host cell containing the nucleic acid according to claim 7, in a suitable culture medium and under conditions for cell proliferation;
b) the restoration of the culture medium and
c) purification of saracino of the culture medium, where this culture medium contains L-Tyr-derived P3 with the following structure:
.

17. Structural analogue of safracin formula:

obtained by the method according to item 12 or 13.

18. Structural analogue of safracin formula:
or
obtained by the method according to item 13.

19. Structural analogue of safracin formula:
or
obtained by the method according to 14.

20. Structural analogue of safracin formula:
or
obtained by the method according to item 16.



 

Same patents:

FIELD: chemistry, biochemistry.

SUBSTANCE: invention relates to field of biotechnology, namely to bacteriochlorophyll derivatives and can be used for medical and diagnostic purposes. Anion-containing water-soluble tetracyclic and pentacyclic bacteriochlorophyll (Bchl) derivatives contain one, two or three negatively charged groups and/or acid groups, which transform into negatively charged groups at physiological pH. Obtained derivatives are used for photodynamic therapy and for tumor diagnostics, as well as for killing cells or infectious agents.

EFFECT: increasing selectivity of binding with target in photodynamic therapy and diagnostics.

25 cl, 34 dwg, 5 tbl, 57 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention refers to genetic engineering and biotechnology and can be used in food industry. Enzyme chosen from gamma glutamyl hydrolase, GTP cyclohydrolase, dihydroneopterin aldolase and 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase is superexpressed in lactobacillus used in enzyme method for production of monoglutamylpholate and in composition of food, including dairy product.

EFFECT: higher pholate content in bioavailable form.

9 cl, 5 dwg, 2 ex

FIELD: organic chemistry, microbiology, medicine, oncology.

SUBSTANCE: invention relates to novel class of antitumor compounds found in isolation from new marine microorganisms of genus Actinomadura sp., strain PO13-046, namely, to compound denoted as IB-00208: and relates to class of compounds of the formula (I) or (II) , wherein each substitute R1 is similar or different and can represent hydrogen atom, acyl, alkyl, alkenyl, aryl, benzyl, alkaline metal and/or monosaccharide, disaccharide, trisaccharide or their derivative; R2 and R3 can represent hydrogen atom or alkyl. These compounds show antitumor activity.

EFFECT: valuable medicinal properties of compounds.

8 cl, 3 tbl, 9 dwg, 11 ex

The invention relates to the field of biotechnology and Microbiology

The invention relates to biotechnology and relates to a new and improved method of allocation of clavulanic acid from the aqueous culture broth producer clavulanic acid

The invention relates to a method of stereoselective recovery phenylalkylamines to their respective (S)-hydroxycodone and the new strain

The invention relates to biotechnology, namely microbiological synthesis and release from biomass actinomycete Streptomyces avermitilis avermectins used for antiparasitic drugs

The invention relates to Microbiology and relates to a new strain actinomycete for the production of antiparasitic drugs on the basis of avermectins
The invention relates to the field of biotechnology, namely, to receive the berberine in immobilized cell culture vasilistnika small (Thalictrum minus L.)

FIELD: medicine.

SUBSTANCE: invention represents a recovered nucleic acid with a nucleotide sequence coding human lysosomal glucocerebrosidase protein continuously bound with C-terminal vacuolar target signal and N-terminal signal peptide of endoplasmic reticulum. The invention concerns host-cells, vectors and methods for expression and production of high-yield biologically active glucocerebrosidase (GCD) with high mannose content. The invention also concerns pharmaceutical compositions and methods of treating Gaucher disease.

EFFECT: invention allows high-efficient treatment of Gaucher disease.

54 cl, 22 dwg, 3 tbl, 7 ex

FIELD: biotechnologies.

SUBSTANCE: invention is related to the field of biotechnology, specifically, to separation and identification of new genes of spiramycins biosynthesis track and to new polypeptides, which participate in this biosynthesis, and may be used to produce acyltransferase, which is responsible for modification of platenolid in position 3. Polynucleotide coding acyltransferase, which is responsible for modification of platenolid in position 3, cells of bacterium Streptomyces type are transformed, and strain-producer of end polypeptide is made.

EFFECT: increased extent of production and purity of produced spiramycin.

26 cl, 41 dwg, 44 tbl, 31 ex

FIELD: agriculture.

SUBSTANCE: genetic modification of wheat in the form of mutation in gene SBEIIa with reduction of level of its activity.

EFFECT: grain with high content of amylose in its starch; wheat with reduced level of SBEIIb-activity with grain with non-wrinkled phenotype, with relatively high content of amylose.

62 cl, 28 dwg, 12 tbl, 16 ex

FIELD: biotechnologies.

SUBSTANCE: there described is the obtained and purified new protein called aflatoxin-detoxifizyme (ADTZ), which has activity of conversion of aflatoxin into non-toxic. There found is the gene coding ADTZ, as well as recombinant expression vector. There described is the transformant obtained by transforming a host cell using the above recombinant expression vector. There developed is the method for obtaining detoxifizyme, which provides for cultivation of the above transformant, obtaining, purification and reduction of expression detoxifizyme with activity of conversion of aflatoxin into non-toxic.

EFFECT: obtaining new protein that can be used for producing fodders and food products.

8 cl, 14 dwg, 12 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention pertains to biotechnology and can be used in biomedicine for producing hyaluronan. Proposal is given of a method of producing hyaluronan, involving culturing Bacillus host cells in conditions, suitable for obtaining hyaluronan, and extraction of the target product from the culture medium. The Bacillus host cell contains a genetic structure, comprising a promoter, functionally active in the given cell, and encoding a region, consisting of a nucleotide sequence, encoding streptococcal hyaluronansynthase (hasA); sequence encoding UDP-glucose-6-dehydrogenase Bacillus (tuaD) or a similar enzyme of streptococcal origin (hasB), and a sequence, encoding bacterial or streptococcal UDP-glucose pyrophosphorylase (gtaB and hasC respectively). Use of the invented method provides for production of considerable quantities of hyaluronan with good examined, nonpathogenic cellular system.

EFFECT: obtaining considerable of hyaluronan with good examined, nonpathogenic cellular system.

15 cl, 45 dwg, 2 tbl, 20 ex

FIELD: chemistry, biochemistry.

SUBSTANCE: invention refers to biotechnology and represents method of solution analysis for homocysteine and/or cystathionine through enzymatic cyclic conversion. The analysis includes contacting stages of homocysteine and/or cystathionine containing solution with CBS, L-serine and CBL and reducing agent within time sufficient for homocysteine to cystathionine cyclic coversion catalysis deriving pyruvate and ammonia; reaction mixture is evaluated for pyruvate and/or ammonia. These findings are used to evaluate homocysteine and/or cystathionine content in solution. The first contacting stage takes at least 15 minutes. Besides invention covers analysis set.

EFFECT: reduced analysis time and higher sample throughput.

23 cl, 16 dwg, 34 tbl, 16 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention refers to genetic engineering and biotechnology and can be used in food industry. Enzyme chosen from gamma glutamyl hydrolase, GTP cyclohydrolase, dihydroneopterin aldolase and 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase is superexpressed in lactobacillus used in enzyme method for production of monoglutamylpholate and in composition of food, including dairy product.

EFFECT: higher pholate content in bioavailable form.

9 cl, 5 dwg, 2 ex

FIELD: medicine, peptides, biochemistry, pharmacy.

SUBSTANCE: invention relates to modification of glycosylation of proteins for preparing polypeptides with improved therapeutic indices including antibodies with enhanced antibody-dependent cellular cytotoxicity. For preparing indicated polypeptides cell-host is used that is modified with nucleic acid encoding enzyme β-1,4-N-acetylglucosaminyltransferase III (GnTIII). Prepared polypeptide represents, in particular, IgG or its fragment. Invention discloses a method for preparing polypeptide and antibodies or its fragment and a fusion protein prepared by indicated method. Invention describes a pharmaceutical composition used for increasing Fc-mediated cellular cytotoxicity and comprising antibody and carrier, and its using in cancer treatment, and a method for treatment of disease associated with elevated amount or production of B cells using indicated antibody, in particular, against CD20, and representing antibody IDEC-C2B8 in the preferable variant. Invention provides preparing polypeptide and antibody possessing the enhanced Fc-mediated cellular cytotoxicity that decrease the content of B cells in a patient body.

EFFECT: improved preparing method, valuable medicinal properties of polypeptide and antibodies.

38 cl, 21 dwg, 4 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to method for DNA amplification, method for cloning of second DNA and method for DNA reverse transcription. In each method heat stable DNA polymerase is used which encoded by SEQ ID NO:7, derived from Anaerocellum thermophilum or recombinant R.coli strain, transformed by vector containing SEQ ID NO:7. DNA polymerase catalyzes matrix-targeted DNA polymerization, has 5'-3'-activity and reverse transcriptase activity, and has no 3'-5'-endonuclease activity in presence of magnesium ions and in absence of manganese ions. DNA polymerase retains at least 90 % of its activity after incubation for 30 min at 80°C in absence of stabilizing detergents and has apparent molecular mass between of approximately 96 kDa and approximately 100 kDa. Magnesium-dependent reverse transcriptase activity of DNA polymerase is more than 30 % of DNA polymerase activity, and manganese-dependent reverse transcriptase activity of said polypeptide is more than 60 % of DNA polymerase activity.

EFFECT: increased precision of matrix RNA transcrption at high temperatures.

7 ck, 5 dwg, 7 ex

FIELD: biotechnology, gene engineering, ecology.

SUBSTANCE: Escherichia coli cells containing plasmides with luxCDABE-genes are produced by recombinant DNA method under control of PkatG, PsoxS, PrecA, PgrpE inducible stress promoters. On the base of the same kit of Escherichia coli bacterial cells is developed for heptyl detection in environment medium.

EFFECT: accelerated method for heptyl detection.

1 tbl, 4 dwg

FIELD: agriculture.

SUBSTANCE: set of oligonucleotides-primers is proposed for identification of virus of raspberry bushy dwarf comprising 2 pairs of desoxyoligonucleotides having activity of direct and reverse primers in reaction of reverse transcription and polymerase chain reaction. Primers have the following structure: 5'ttcttttgtcgggttcagtgag3' - RBDV-CP+2; 5'aactattgtggaggatttgc3' - RBDV-CP-2, 5'gacatgtatatgtctgctaagg3' - RBDV-CP+3; 5'tgtcgtcgacggcaccgccc3' - RBDV-CP-3. According control oligonucleotides are also available for set of primers. Usage of primers set makes it possible to detect VKKM virus in the territory of Russia.

EFFECT: invention may be used in biotechnology of plants, phytopathology, selection, berries and plants growing for detection of genetic material of raspberry bushy dwarf virus in samples of test-tube and field plants.

3 dwg, 1 tbl, 2 ex

Up!