Production of pepties and proteins by means of accumulation in endoplasmic reticulum of plants

FIELD: biotechnologies.

SUBSTANCE: plants are transformed with application of nucleic-acid constructs, which contain the first nucleotide sequence that codes γ-sein, or its fragment, which is able to direct and retain protein in endoplasmic reticulum of plant cell, the second sequence of nucleic acid, which codes aminoacid sequence, which is specifically split by ferment or chemical compounds, and the third sequence of nucleic acid, which codes target peptide or protein.

EFFECT: transformation of plant by such constructs makes it possible to produce fused proteins accumulated in endoplasmic reticulum of cells in the form of protein bodies, from which target proteins may be extracted, in particular calcitonin.

47 cl, 19 dwg, 1 ex

 

The scope of the invention

The invention relates to obtain peptides and proteins in host plants by accumulation in the endoplasmic reticulum of plants producing the protein of Taurus, to the nucleic acid encoding such products, and to the use of these nucleic acids for the production of constructs and vectors for transformation of systems of host plants. In particular, the disclosed method of expression and allocation of interest heterologous products, such as calcitonin (CT), in plants.

Background of invention

As it is assumed that the demand for biopharmaceutical drugs will increase dramatically, thanks to the great advances in knowledge of the genome and in the relevant biomedical research, there is considerable interest in the development of low-cost recombinant production systems.

Genetic engineering of plants for the production of biopharmaceutical drugs is relatively new, while other transgenic systems, including bacteria, fungi and cultured mammalian cells, widely and for a long time adapted to riproduzione. However, some recombinant therapeutic proteins using plant expression systems are already on the market or are different from adiah clinical trials on humans, for example, hirudin, an anticoagulant protein for the treatment of thrombosis (Parmenter et al., 1995), chimeric IgG-IgA vaccine against dental caries (MA et al., 1998), bacterial vaccinogen against enterotoxigenic strains of E. coli (Haq et al., 1995), and recombinant gastric lipase dogs for the treatment of cystic fibrosis (Benicourt et al., 1993).

Plant expression systems are attractive because the level of expression of recombinant proteins can be enhanced by the use of natural mechanisms of sorting and targeting that use plants for targeting host proteins to organelles. In addition, a biopharmaceutical products produced by plants, can be easily extended to mass production and have the advantage, due to the minimal risk to health arising from contamination by pathogens or toxins.

Plants are becoming more and more attractive expression systems because of their potential, providing an unlimited number of biologically active material at a low production cost and with reduced risk to health. The ability of plants to accumulate high levels of recombinant proteins and to make the most of post-translational modifications allows to consider them as bioreactors for molecular breeding R is combinant therapeutic drugs (see review of Fischer and Emans, 2000). However, important decisions concerning the choice of species, choice of fabrics, strategies for expression and isolation and post-translational processing, which are crucial for the feasibility of commercial production on the basis of plants (Cramer et al., 1999).

Intracellular targeting of recombinant proteins is an important prerequisite for a high level of accumulation and proper Assembly and folding of such proteins in plants. Compartmentalisation host proteins in the intracellular storage organelles mainly achieved by the use of suitable signal peptides or whole of m proteins. The number of recombinant therapeutic proteins was sent to the subsequent compartments of plants: apoplastically space (McCormick et al., 1999), chloroplast (Staub et al., 2000), endoplasmic reticulum (ER) (Stoger et al., 2000). Immunoglobulins directed in the ER compartment in transgenic plants, it turned out, give 10-100 times larger outputs than targeted to other compartments, such as the apoplast or the cytosol (Conrad and Fiedler, 1998).

The targeting complex proteins such as antibodies, in the ER compartment is particularly interesting, because most post-translational modifications required to produce a functional product, occur within the ER (Düring et al., 1990; Ma and Hein, 1995; Conrad and Fiedler, 1998). Nesemann is, inside the ER signal peptide is cleaved and tense proteins, such as IgG binding protein (BiP) and enzymes such as protoindustrialization (PDI), function as companions, associate unassembled protein and guide subsequent accumulation and Assembly. In addition to these special characteristics, it is useful to indicate that the plant ER is highly elastic, which makes it the perfect vessel for heterologous pharmaceutical proteins. ER, even if it appears at the input of the secretory pathway, is able to maintain proteins in a short or long period of time. Plants retain amino acids for a long period in the form of specific spare proteins. One of the protection mechanisms of these spare proteins from uncontrollable premature destruction is placing them in ER-derived cumulative organelles called protein bodies (BT) (see Müntz, 1998). The Assembly of such organelles as a simple accumulation of recombinant proteins in the ER lumen requires, as a first step, save the host protein. Secretory proteins, true accumulated and assembled in the ER, have a number of cell assignments, mainly through promotion via the Golgi apparatus. However, ER saving soluble transport-competent proteins may be caused by using carboxy-terminal retaining the th/restoring signal KDEL (or HDEL) (Munro et al., 1987; Wandelt et al., 1992; Vitale et al., 1993). This is a conservative C-terminal link, which resolves in the Golgi apparatus via transmembrane receptors, which allows the recycling of selected ER-resident proteins back to the ER (Vitale and Denecke, 1999; Yamamoto et al., 2001). Many fragments of recombinant antibodies have been lengthened KDEL signal to stably accumulated in the plant ER (Vitale et al., 1998; Torres et al., 1999). An alternative way of generating the preservation and accumulation of recombinant proteins in the ER compartment is the creation of a suitable merge with the natural ER resident, such as an auxiliary protein of the seed.

WO 01/75312 discloses a method of production of the cytokine in the system of the host plant, where this system of the host plant transformed with the chimeric nucleic acid sequence that encodes the specified cytokine found the chimeric nucleic acid sequence containing the first nucleic acid sequence capable of regulating transcription in said system of the host plants of the second nucleic acid sequence, where this second sequence of nucleic acid encodes a signal sequence, which is linked in reading frame with the third nucleic acid sequence that encodes a cytokine, and a fourth sequence nukleinovokisly, linked in reading frame with the 3' end of the specified third nucleic acid sequence encoding "KDEL" amino acid sequence.

Seine are a group of proteins that are synthesized during the development of the endosperm in the seed, and can be divided into four groups α, β, γ and δ on the basis of their solubility. Seine can be combined in BT right in the ER. Plants or plant tissues containing rumenova stable protein bullock, expressed in the form of a fused protein containing the complete protein Zein and operable associated protein material, are disclosed in WO 00/40738.

γ-Zein, spare protein maize, is one of the four maize prolamins and is 10-15% of the total protein in the endosperm of maize. Like other cereal prolamins, α and γ Seine biosynthesized in membrane-associated policeman on the cytoplasmic side of the rough ER, going inside of the lumen and then sequestered in ER-derived BT (Herman and Larkins, 1999, Ludevid et al., 1984, Torrent et al., 1986). γ-Zein consists of four characteristic domains: (i) a signal peptide of 19 amino acids, (ii) repetitive domain containing eight units Hexapeptide PPPVHL (53 AK), (iii) proX domain, where prolinnova residues replaced by other amino acids (29 AK) and (iv) hydrophobic rich in cysteine C-terminal domain (111 AK). The ability of γ-Zein to gather in ER-derived the T is not limited to seeds. Indeed, when the gene for γ-Zein constitutive expressed in transgenic Arabidopsis plants, spare protein was accumulated within the ER-derived BT in the cells of the leaf mesophyll (Geli et al., 1994). Consideration of the signal responsible for the premises γ-Zein in ER-derived BT (prolamins not have a KDEL signal), showed that rich in Proline N-terminal domain, including the tandem repeated domain necessary for maintaining the ER, and that the C-terminal domain involved in the formation of BT. However, the mechanisms by which these domains stimulate the Assembly of BT still not known.

Calcitonin (CT), hormonal peptide of 32 amino acids, is necessary for proper calcium metabolism and has found wide clinical application in the treatment of osteoporosis, gipercalziemiceski shock and disease Paget (Reginster et al., 1993; Azria et al., 1995; Silverman et al., 1997). Human ART synthesized in the form of preproprotein with a signal peptide of 25 amino acids and two propeptides at N - and C-ends (57 AK and 21 AK, respectively). The resulting active peptide has a length of 32 amino acids with a single disulfide bond (Cysl-Cys7) and amitirova on the carboxy-end. In vitro human ART is collected in the units, which limits its use as therapeutic agents. Therefore, salmon ARTICLE that is less prone to aggregation, typically the replacement (Cudd et al., 1995). The manufacture of the ARTICLE at present is carried out by chemical synthesis, but the cost of this production has prompted several research groups to develop alternative approaches. Human and salmon ARTICLE were obtained in E. coli (Ray et al., 1993; Hong et al., 2000), in murine cells (Merli et al., 1996), in nonendocrine cell lines Cos-7 and Cho (Takahashi et al., 1997) and more recently in the milk of transgenic rabbits (McKee et al., 1998). Obtaining bioactive calcitonin using biotechnological methods includes at least two stages: (i) the generation of a glycine-extended calcitonin (Bradbury et al., 1988) and (ii) formation of carboxy-terminal prolinamide through the action of the enzyme amidation, peptidylglycine α-lidiruyushey monooxygenase (RAM) (Eipper et al., 1992). Since it is not known flows do carboxy-amidation in plant cells, in vitro amidation of plant glycine-extended calcitonin with FRAMES enzyme gave a C-terminal amide (Ray et al., 1993).

Summary of invention

The problem solved by the present invention is the development of alternative systems to obtain the interest of peptides and proteins in the system of the host plant.

The solution presented here is based on the ability of Proline-rich domain of γ-Zein to the self-Assembly and stability of the fused proteins in the ER system is asthenia-owner. The use of the system, based on the fused protein γ-Zein, for the accumulation of interest of product in the system of the host plant is a successful approach to the accumulation of a specified interest product within the ER-derived BT plants.

The invention is illustrated in the examples described based on the fused protein system of accumulation of recombinant ARTICLE in ER-derived BT in tobacco plants. A number of Proline-rich domains were selected from γ-Zein for use as a merge partner through cleaved by a protease site. The coding region of Mature calcitonin was merged with the end of the domain of γ-Zein and expressed in transgenic tobacco plants. Slit proteins accumulated in the ER-derived BT tobacco leaves. After cleaning fused proteins were subjected to cleavage by enterokinase, allowing the release of calcitonin.

Accordingly, one aspect of the present invention relates to a nucleic acid sequence containing (i) a nucleotide sequence encoding a protein γ-Zein, or a fragment containing a nucleotide sequence that encodes the amino acid sequence capable of directing and retaining a protein in the endoplasmic reticulum; (ii) the nucleotide sequence encoding the last amino acid is the sequence, which is specifically cleaved via an enzymatic or chemical means; and (iii) a nucleotide sequence encoding a desired product; where these nucleotide sequences are operatively linked.

In another aspect the invention relates to the design of nucleic acid containing the sequence of nucleic acids.

The following aspect of the invention relates to a vector containing a specified sequence or structure, and to the cell transformed by the specified vector.

The following aspect of the invention relates to a transformed system of the host plant, with the sequence of a nucleic acid construct or vector.

The following aspect of the invention relates to transgenic system of the host plant, containing integrated in its genome the sequence of nucleic acids.

The following aspect of the invention relates to a method of producing interesting product in the system of the host plant.

The following aspect of the invention relates to a method for production of calcitonin in the system of the host plant.

The following aspect of the invention relates to fused protein and the indicated protein has the amino acid sequence, with the expansion of the above nucleic acid sequence.

Brief description of drawings

Figure 1 shows the nucleotide sequence and translation of γ-Zein (Figa) and derivatives of γ-Zein RX3 (FIGU, top), R3 (FIGU, bottom), P4 (Figs, top) and X10 (Figs, bottom).

Figure 2 shows the nucleotide sequence (lane 2) and broadcast (band 1) synthetic calcitonin (CT). Gene synthetic calcitonin was constructed using the preferred codon plants. Modification of the codon are underlined in comparison with the genome of salmon ST wild-type (lane 3). Synthetic gene contains at the 5' end of the linker sequence corresponding to the site of cleavage by enterokinase (EC), and extended at the 3' to obtain C-terminal glycine.

Figure 3 shows the schematic design pCRX3CT plasmids. Presents the process was the same for the following plasmids pCZeinCT, pCR3CT, rrst and rhst, the difference between them is to enter the appropriate γ-Zein or derived from γ-Zein sequence. Different plasmids depicted not in propecia.

Figure 4 shows a schematic representation of plasmids pBZeinCT, R3, pBR3CT, rvrt and rust. Different plasmids shown are not in proportion.

Figure 5 shows a schematic representation of various fused proteins. The domain of γ-Zein and derivatives of γ-Zein (RX3, R3, R4 and X10) were merged with calcitonin (CT) through the site is AssetLine enterokinase (EC). SP, signal peptide; REPEAT eight units repetitive domain (PPPVHL); RI is one repeat unit; RHS-X - Proline-XAA; PX - fragment Pro-X domain; C-term - rich in cysteine C-terminal domain; N Is the N-terminal sequence of the Mature protein. The number of amino acids for each fused protein is indicated on the right.

Figure 6 shows the results of immunoblot analysis of fused proteins in transgenic tobacco plants using antisera γ-Zein. Soluble proteins were extracted from leaves of wild (WT) and transgenic tobacco (It), were separated on 15% SDS-polyacrylamide gel (20 µg per lane) and transferred to nitrocellulose. Numbers represent independent transgenic lines obtained for different chimeric genes: γ-zein-CT, RX3-CT, R3-CT, P4-ST.

7 shows: a Comparative Western blot analysis of various recombinant fused protein using ST antisera. Extracts of soluble proteins were obtained from wild plants (WT) and transgenic tobacco lines (T1)having the maximum expression of the fused protein related chimeric gene. 8 μg of soluble protein was placed on a 15% SDS-polyacrylamide gel and transferred to nitrocellulose. C. Comparative Northern blot analysis of different transcripts of a chimeric genes. Total RNA were isolated from the analyzed transgenic lines using immunoblot analysis (Figa), practionier the Ana using denaturing formamide gel electrophoresis (30 μg per lane) and capillary batterbury nylon membrane. The blots were hybridized with a randomly selected probe-dressing (129 bases)obtained from cDNA of calcitonin.

On Fig shows intracellular localization RX3-CT and P4-CT proteins in transgenic tobacco plants: (a) Immunolocalization RX3-CT protein in RX3-CT transgenic lines using antisera ARTICLE (dilution 1:100). (C) Immunolocalization P4-ST protein P4-ART transgenic lines using antisera ARTICLE (dilution 1:100). (C) Immunolocalization RX3-CT protein in RX3-CT transgenic lines using antisera γ-Zein (dilution 1:1500). (D) Immunolocalization BiP protein in RX3-CT transgenic lines using antisera BiP (dilution 1:250). (E) Immunolocalization in wild plants using antisera γ-Zein (dilution 1:1500). (F) Immunolocalization in RX3-CT transgenic plants without primary antibody (dilution 1:1500). Immunocytokine on the sliced tobacco leaves was performed using indicator primary antibodies and protein A-colloidal gold (15 nm). cw: cell wall; ch: chloroplast; pb: protein body; v: vacuole.

Figure 9 shows the results of immunoblot analysis of EC splitting RX3-CT and P4-CT fused protein. 12 μg of each partially purified fused protein were incubated with 0.2 U EC within 24 hours at 20°C. Hydrolyzed fused proteins were fractionally with what ispolzovaniem 18% Tris-tricin-polyacrylamide gel electrophoresis and transferred to nitrocellulose. Lanes 1 - non-hydrolyzed fused proteins (1 μg); lanes 2 - hydrolyzed products; band 3 - standard, synthetic salmon ARTICLE.

Figure 10 shows the results of RP-HPLC fractionation RX3-CT fused protein, hydrolyzed using EQ. PCT isolated from RX3-CT fused protein was detected in fraction 3 (Tr=13 min) using TOF-MALDI using synthetic salmon ST as standard.

Figure 11 shows the results of TOF-MALDI mass spectroscopy (A) synthetic salmon ST (MW=3433.24) and (C) plant ARTICLE (MW=3491.93), buervenich when Tr=13 min at RP-HPLC fractionation.

Detailed description of the invention

The first aspect of the invention is the nucleic acid sequence further defined as a sequence of nucleic acid according to the invention, containing:

the first sequence of nucleic acid containing a nucleotide sequence that encodes a protein γ-Zein, or a fragment containing a nucleotide sequence that encodes the amino acid sequence capable of directing and retaining a protein in the endoplasmic reticulum (ER);

the second sequence of nucleic acid containing a nucleotide sequence that encodes the amino acid sequence that is specifically cleaved with what omashu enzymatic or chemical methods; and

the third nucleic acid sequence containing the nucleotide sequence that encodes the desired product;

where the 3' end of the specified first nucleic acid sequence linked to the 5' end of the specified second nucleic acid sequence and the 3' end of the specified second nucleic acid sequence linked to the 5' end of the specified third nucleic acid sequence.

The first sequence of nucleic acid contains a nucleotide sequence that encodes a protein γ-Zein, or a fragment containing a nucleotide sequence that encodes the amino acid sequence capable of directing and retaining a protein in the ER.

Used herein, the term "γ-Zein" refers to a spare protein maize, which consists of four characteristic domains mentioned earlier in the section "Background of invention". The term includes native protein γ-Zein, as well as its variants and recombinant protein γ-Zein, which is capable of directing and retaining a protein in the ER.

Can be used for virtually any nucleotide sequence encoding a protein γ-Zein, or a fragment containing a nucleotide sequence that encodes the amino acid sequence, which is one direction and the preservation of the protein in the ER.

Accordingly, in a preferred embodiment of the invention the first sequence of nucleic acid contains a nucleotide sequence encoding a full length protein γ-Zein. In the private embodiment of the invention the nucleotide sequence encoding a full length protein γ-Zein, shown in Figa and identified in SEQ ID NO:1.

In another preferred embodiment of the invention the first sequence of nucleic acid contains a nucleotide sequence encoding a fragment of the protein γ-Zein, this fragment contains a nucleotide sequence that encodes the amino acid sequence capable of directing and retaining a protein in the ER. In this case, the first sequence of nucleic acid may contain:

- one or more nucleotide sequences coding for all or part of the repetitive domain of the protein γ-Zein;

- one or more nucleotide sequences coding for all or part of the ProX domain protein γ-Zein; or

- one or more nucleotide sequences coding for all or part of the repetitive domain of the protein γ-Zein, and one or more nucleotide sequences coding for all or part of the ProX domain protein γ-Zein.

In the private preferred embodiment, is subramania specified first sequence of nucleic acid contains a nucleotide sequence, encoding a fragment of the protein γ-Zein, the specified fragment containing a nucleotide sequence that encodes the amino acid sequence capable of directing and retaining a protein in the ER, selected from the group consisting of:

- the nucleotide sequence shown in SEQ ID NO:2 [nucleotide sequence identified as RX3 (Pigv)],

- the nucleotide sequence shown in SEQ ID NO:3 [nucleotide sequence identified as R3 (Pigv)],

- the nucleotide sequence shown in SEQ ID NO:4 [nucleotide sequence identified as P4 (Figs)], and

- the nucleotide sequence shown in SEQ ID NO:5 [nucleotide sequence identified as X10 (Figs)].

The second sequence of nucleic acid contains a nucleotide sequence that encodes the amino acid sequence that is specifically cleaved by enzymatic or chemical methods. In the private embodiment of the invention the specified second sequence of nucleic acid contains a nucleotide sequence that encodes a cleavage site by the protease, for example, amino acid site, fissile using a protease such as enterokinase, Arg-C endoprotease, Glu-C endoprotease, Lys-C endoprotease, f is ctor Ha and similar.

Alternatively, the second sequence of nucleic acid contains a nucleotide sequence that encodes the amino acid that is specifically cleaved by a chemical reagent, such as, for example, ciambrone, which cleaves methionine residue, or any other suitable chemical reagent.

The second nucleic acid sequence can be generated as a result of the merger of the specified first nucleic acid sequence and the third nucleic acid sequence. In this case, each sequence contains a number of nucleotides such that when said first and third nucleic acid sequence become linked, forms a functional nucleotide sequence that encodes the amino acid sequence that is specifically cleaved by enzymatic or chemical means, i.e. the second sequence of nucleic acid. In an alternative embodiment of the invention, the second nucleic acid sequence is an alien sequence, operatively inserted between the first and third nucleic acid sequences.

The third sequence of the nucleic acid contains a nucleotide consequently is here, which encodes the desired product. In principle, any product can be expressed using the system proposed by the present invention. In a preferred embodiment of the invention the desired product is a protein (i.e. a protein or peptide) of the medicinal product, for example, peptide hormones, such as calcitonin, erythropoietin, thrombopoietin, growth hormone and the like, interferon, i.e, a protein produced in response to viral infection, and as a cytokine in the immune response, etc. Preferably, these interesting therapeutic products are effective for the treatment of humans or animals.

In the private embodiment of the invention, the third sequence of the nucleic acid contains a nucleotide sequence encoding calcitonin (CT), for example, human calcitonin (hCT) or salmon calcitonin (sCT). In General, in this case, this third sequence of nucleic acid, preferably, includes the codon for glycine at the 3' end of the specified nucleic acid sequence that encodes calcitonin, reproducing thus the glycine-extended calcitonin.

According to the invention, the 3' end of the specified first nucleic acid sequence linked to the 5' end of the specified second sequence well Lanovoy acid and the 3' end of the specified second nucleic acid sequence linked to the 5' end of the specified third nucleic acid sequence, i.e. the above first, second and third nucleic acid sequence are in a frame are read.

The sequence of the nucleic acid according to the invention can be obtained using conventional methods known to the person skilled in the art. Basically, these methods include linking the various fragments of the nucleic acid sequence according to the invention with a suitable vector. An overview of these traditional methods can be found, for example, in "Molecular cloning, a Laboratory Manual, 2nded., by Sambrook et al., Cold Spring Harbor Laboratory Press, 1989. The design of some vectors, containing a nucleic acid according to the invention described in the examples and illustrated in figure 3 and 4. As there shown, various Proline-rich domains have been selected from γ-Zein for use as a merge partner through cleaved by a protease site. The coding region of Mature calcitonin (32 AK) was fused with the C-end domain of γ-Zein and expressed in transgenic tobacco plants. Slit proteins accumulated in the ER-derived protein bodies in tobacco leaves. After cleaning fused proteins were subjected to cleavage by enterokinase to secure the release of calcitonin, which can be further purified from the hydrolysis mixture using chromatography with reversed phase.

In another aspect of the invention Ave is dstanley protein, hereinafter referred to as a fused protein according to the invention containing (i) the amino acid sequence of the protein γ-Zein, or its fragment, capable of directing and retaining a protein in the ER, (ii) the amino acid sequence that is specifically cleaved via an enzymatic or chemical methods, and (iii) the desired product; the specified protein is the product of expression of a nucleic acid sequence according to the invention in the system of the host plant.

Protein according to the invention is accumulated in a stable ER-derived BT in the system of the host plant. Enzymatically or chemically cleaved site, which is located at the ends of the domain of γ-Zein, allows to obtain subsequently the desired product. The desired product can then be isolated and purified well-known methods. Therefore, the protein according to the invention represents a new and successful approach to the accumulation of interest of the product.

In one embodiment of the invention fused protein according to the invention contains a complete protein γ-Zein. Specific amino acid sequence of the full γ-Zein shown in Figa and identified as SEQ ID NO:6.

In another embodiment of the invention fused protein according to the invention contains a fragment of the protein γ-Zein, this fragment contains amino acid p is the sequence, capable of directing and retaining a protein in the ER. In the private embodiment of the invention fused protein according to the invention contains a fragment of the protein γ-Zein selected from the group consisting of:

- amino acid sequence shown in SEQ ID NO:7 [amino acid sequence corresponding to RX3 (Pigv)],

- amino acid sequence shown in SEQ ID NO:8 [amino acid sequence corresponding to R3 (Pigv)],

- amino acid sequence shown in SEQ ID NO:9 [amino acid sequence corresponding to P4 (Figs)], and

- amino acid sequence shown in SEQ ID NO:10 [amino acid sequence corresponding to X10 (Figs)].

Protein according to the invention contains an amino acid sequence that is specifically cleaved via an enzymatic or chemical methods. In the private embodiment of the invention specified fissile site contains the cleavage site by the protease, for example, amino acid site, fissile using a protease such as enterokinase, Arg-C endoprotease, Glu-C endoprotease, Lys-C endoprotease, factor XA and similar, or amino acid site, fissile using a chemical reagent, such as, for example, ciambrone, which cleaves methionine residue, or any other under odasi chemical reagent.

Protein according to the invention also contains the desired product, for example, protein (i.e. a protein or peptide) medicine, for example, a peptide hormone, interferon, and similar. Preferably, the specified interest product is effective for the treatment of humans or animals. In the private embodiment of the invention fused protein according to the invention contains calcitonin (CT), for example, optional glycine-extended human calcitonin (hCT) or salmon calcitonin (sCT).

The following aspect of the invention relates to the design of nucleic acid containing (i) the sequence of nucleic acid according to the invention, and (ii) a regulatory nucleotide sequence that regulates the transcription of a nucleic acid according to the invention (i), and specified regulatory sequence (ii) is functional in plants. These nucleic acid sequence is operatively linked.

Almost can be used any functional regulatory sequence of a plant. In one embodiment of the invention the specified regulatory sequence (ii) is preferably tissue-specific, i.e. it can regulate the transcription of a nucleic acid according to the invention in specific tissues, such as the SEMA is a, leaves, nodules, etc.

Regulatory sequence (ii) may contain a promoter functional in the plant. Actually can be used any promoter functional in the plant. In the private embodiment of the invention the specified regulatory sequence (ii) contains the 35SCaMV promoter. In another private embodiment of the invention the specified regulatory sequence (ii) contains the promoter "patatina", the promoter reserve the protein, the promoter of the gene ubicacin, a regulatory sequence of a gene of γ-Zein, or similar.

Regulatory sequence (ii) may also contain a sequence of the transcription has been completed. Actually can be used in any sequence of the transcription has been completed, functional in the plant. In the private embodiment of the invention the sequence of the end of the transcription contains terminator 35SCaMV, the terminator gene octopunctata (ocs), the terminator gene napadisylate (nos)terminator gene γ-Zein, and similar.

Regulatory sequence (ii) may also contain translational enhancer, functional in the plant. In fact, you can use any translational enhancer, functional in a plant, for example, promoting the sequence for viral transcription engraving t the Mat, etc.

The sequence of the nucleic acid according to the invention or design obtained by using this invention, can be inserted into a suitable vector. Therefore, in the following aspect of the invention presents a vector containing a nucleic acid sequence according to the invention or design of nucleic acid obtained by the present invention. Suitable vectors include plasmids, Comedy and viral vectors. In one embodiment of the invention the specified vector is suitable for transformation of plants. The choice of the vector may depend on the host cell into which it is subsequently introduced. As an example, vector, where we introduce a sequence of nucleic acid according to the invention can be a plasmid, kosmidou or viral vector which, when introduced into the cell-master integrates into the genome of the specified host cell and is replicated along the chromosome (or chromosomes)into which it was integrated. For this vector can be used traditional methods (Sambrook et al., 1989).

The following aspect of the invention presents a system of a host plant, said system of the host plant transformed nucleic acid according to the invention or design or vector obtained by the present invention.

Used is here, the term "system of the host plant" includes plant, including, but not limited to, one-cotyledonous, dicots, and especially cereals (e.g. maize, rice, oats etc), legumes (such as soybeans and so on), crucifers (e.g., Arabidopsis thaliana, canola etc) or Solanaceae (e.g., potatoes, tomatoes, tobacco etc). The system of the host plant includes plant cells. Plant cells include suspension culture, the ovaries, the meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, seeds and microspora. The system of the host plant may be at different stages of maturity and may be growing in liquid or solid culture, or in the soil or in a suitable medium in a pot in the greenhouse or in the field. Expression in the system of the host plant may be transient or permanent. The system of the host plant also refers to any clone of such a plant, seed, or hybrid product, cuttings propagated sexually or asexually, and the descendants of any of them, such as shoots or seeds.

Transformation of systems of host plants can be carried out using traditional methods. Overview of genetic transfer in plants can be found in the manual entitled "Ingenieria genetica and transferencia génica", written by Marta Izquierdo, Ed. Pyramide (1999), in particular Chapter 9,"Transferencia génica a plantas", str-316.

In the following aspect izobreteny is presented transgenic system of the host plant, it is designed so that it contains a new laboratory specific transgene, and the indicated transgenic system of the host plant contains integrated in its genome a nucleic acid according to the invention. Specified transgenic system of the host plant can be obtained using well-known techniques, for example, by using conventional techniques antisense mRNA and/or irexpress (in the sense suppression) or other, for example, through the use of binary vectors or other vectors suitable for the currently used methods of transformation of various plants. Examples of transgenic systems of the host plants provided by the present invention include one-cotyledonous and dicotyledonous plants, especially grains, legumes, Brassicaceae, Solanaceae, etc.

The sequence of the nucleic acid according to the invention is used to receive the necessary product in the system of the host plant. Therefore, in the following aspect of the invention presents a method of obtaining interesting product in the system of the host plant, which includes the cultivation of a transformed or transgenic system of the host plant, represented by the present invention, under conditions that allow the acquisition and expression of a specified interest of product in the form of a fused protein. As mentioned above, the decree of the config protein accumulates in the stable ER-derived BT in this system the host plant. Enzymatically or chemically cleaved site, which is located on the C-end of the domain of γ-Zein, so you can get interested in the product. The desired product can then be isolated and purified by conventional methods. Therefore, the method proposed by the present invention, further includes, if desired, separation and purification specified fused protein, and, optionally, the release of the above interesting product from the specified fused protein. Protein is cleaved at the site of cleavage by the enzyme or chemical reagent, according to the situation.

The following aspect of the invention provides a method of production of calcitonin in the system of the host plant, including:

a) transformation of the host plant expression vector or construct nucleic acids containing

(i) a regulatory sequence and

(ii) a nucleic acid sequence consisting of:

the first nucleic acid sequence containing the nucleotide sequence that encodes a protein γ-Zein, or a fragment containing a nucleotide sequence that encodes the amino acid sequence capable of directing and retaining a protein in the endoplasmic reticulum (ER);

the second sequence of nucleic sour is s, containing a nucleotide sequence that encodes the amino acid sequence that is specifically cleaved via an enzymatic or chemical means; and

the third nucleic acid sequence containing the nucleotide sequence that encodes calcitonin;

where the 3' end of the specified first nucleic acid sequence linked to the 5' end of the specified second nucleic acid sequence and the 3' end of the specified second nucleic acid sequence linked to the 5' end of the specified third nucleic acid sequence; and

where regulatory sequence regulates transcription of the aforementioned nucleic acid sequence

b) generating full of plants from these systems of host plants, transformed with the indicated expression vector or construct nucleic acids;

c) the cultivation of such transformed plants under conditions which provide for the production and expression of calcitonin in the form of a fused protein; and, if desirable,

d) isolation, purification specified fused protein and the processing of the specified fused protein to release calcitonin.

The invention is therefore based on the fused protein system for accumulation recombinant the x of interesting products in ER-derived BT in the system of the host plant. The invention is further illustrated limitiruyuschie examples.

EXAMPLE 1

Receiving calcitonin in tobacco plants

An example of successful receipt of the ARTICLE in tobacco plants described below. Various Proline-rich domains have been constructed from γ-Zein for use as a merge partner through cleaved by a protease site. The coding region (32 AK) Mature ART was merged with the ends of the domain of γ-Zein and expressed in transgenic tobacco plants. Cleaved by a protease site was inserted at the ends of the domain of γ-Zein to return later clean calcitonin. This approach offers high accumulation of fused proteins within the ER and the formation of ER-derived BT in tobacco plants. Slit proteins strongly accumulate in ER-derived BT in tobacco leaves. The level of expression of these fused proteins was achieved, in some cases, to 12.44% of the total soluble proteins. After only two stages of purification fused proteins were subjected to cleavage by enterokinase, allowing the release of calcitonin. End calcitonin, accumulated in tobacco plants, was identified using mass spectroscopy. Also carried out the purification of fused proteins, proteiny enzymatic hydrolysis and complete characterization of the released plant calcitonin (PCT).

I. EXPERIMENTAL METHODS AND

Construction of chimeric genes and vectors

Gene γ-Zein wild-type and four derived from γ-Zein sequences, called RX3, R3, R4 and X10 encoding different domains of γ-Zein (Figa, 1B and 1C), were merged with synthetic genome ARTICLE containing a hydrolyzable enterokinase site (Figure 2), and inserted into the vectors of plant transformation as described below and in figure 3.

The cDNA sequence of γ-Zein, RX3 and R3 generated by the PCR using pKSG2 (Torrent et al., 1994) as a template. X10 cDNA amplified from pDR20, a plasmid was obtained from pKSG2 after deletion of the sequence corresponding to the repetitive domain. The primers used for the different PCR were: for the cDNA sequence of γ-Zein:

T1: 5'TCATGAGGGTGTTGCTCGTTGCCCTC3'

T4: 5'CCATGGCGTGGGGGACACCGCCGGC3',

for sequences of cDNA RX3 and X10:

T1 and

T2: 5'CCATGGTCTGGCACGGGCTTGGATGCGG 3', and

for sequencing cDNA R3:

T1 and

T3: 5'CCATGGTCCGGGGCGGTTGAGTAGGGTA3'.

The PCR products were subcloned into the vector pUC 18 (SureClone Ligation Kit, Pharmacia) and the resulting plasmids were named pUCZein, pUCRX3, pUCR3 and pUCX10. Vector pUCP4 that contains derived from γ-Zein sequence P4, (Figs), was obtained during the screening of clones derived pUCRX3. The cDNA fragments of γ-Zein, RX3, R3, R4 and X10 containing "sticky" ends BspHI and NcoI were inserted into the vector pCKGFPS65C (Reichel et al., 1996), previtellogenesis with NcoI. This vector was chosen because it contains a regulatory sequence for expression in plants and GFP coding sequence that would be used to study parallel targeting of proteins, derivatives of γ-Zein in transgenic plants. The generated vectors pCZeinGFP, pCRX3GFP, pCR3GFP, pCP4GFP and pCXIOGFP contained the following regulatory sequences for expression in plant systems: (i) enhanced 35S promoter derived from cauliflower mosaic virus (CaMVp35S), (ii) translational enhancer of virus engraving tomatoes (TL) and (iii) the sequence of termination of transcription of the CaMV35S (pA35S). Chimeric constructs derived γ-Zein/ST were generated by replacing the GFP coding sequence synthetic genome ARTICLE, as described below (Figure 3).

A synthetic gene that encodes a 32 amino acids of the active salmon CT (Figure 2), generated from two 122 main complementary oligonucleotides. Oligonucleotides were designed for use with the preferred codons of the plant, in order to achieve high expression in plants. 5' phosphorylated oligonucleotides were synthesized using a DNA synthesizer, Applied Biosystems 394, had the following sequence:

CalI:

5'CATGGACGACGACGACAAGTGCTCCAACCTCTCTACCTGCGTTCTTGG

TAAGCTCTCTCAGGAGCTTCACAAGCTCCAGACTTACCCTAGAACCAACACTG

GTTCCGGTACCCCTGGTTGAT 3',

p> CalII:

5'CTAGATCAACCAGGGGTACCGGAACCAGTGTTGGTTCTAGGGTAAGTC

TGGAGCTTGTGAAGCTCCTGAGAGAGCTTACCAAGAACGCAGGTAGAGAGGTT

GAGCACTTGTCGTCGTCGTC3'.

After purification on a 12% polyacrylamide gel 60 pmol of each nucleotide used for forming double-stranded molecules. The hybridization mixture was heated at 95°C for 5 min, kept at 70°C for 1 hour and cooled to room temperature. The synthetic fragment cDNA contained NcoI and XbaI "sticky" ends with 5' and 3' ends, respectively. Synthetic cDNA ARTICLE included a 5' linker sequence corresponding to the site-specific cleavage by enterokinase ((Asp)4-Lys), and was extended at the 3' end, to receive a single glycine to further amidation ST peptide. NcoI/XbaI ARTICLE cDNA was subcloned into pUC 18 vector, and then inserted into the NcoI and BamHI restriction sites of the vector pCZeinGFP, pCRX3GFP, pCR3GFP, pCP4GFP and pCX10GFP containing coding derived from γ-Zein sequence, and deleterule of the GFP coding sequence. The resulting sequences were named pCZeinCT, pCRX3CT, pCR3CT, rrst and rhst (Figure 3). Effective vectors for transformation of plants pBZeinCT, pBRX3CT, pBR3CT, pBP4CT and rust (Figure 4) were finally obtained by inserting different HindIII/HindIII cassette expression in the binary vector pBin19 (Bevan, 1984).

The sustainable transformation of tobacco plants

The binary vector was transferred into a LBA 4404 strains of Agrobacterium tumefaciens. the claims of the tobacco leaf (Nicotiana tobaccum, W38) transformed according to the method of Draper et al. (1988). The regenerated plants were selected on medium containing 200 mg/l kanamycin and transferred into the greenhouse. Transgenic tobacco plants with higher levels of transgenic product, cultivated to obtain the T1 generation. Developing leaves (about 12 cm in length) were collected, immediately frozen in liquid nitrogen and kept at -80°C for further experiments.

Extraction and Western blot analysis of recombinant proteins

Tobacco leaves were crushed in liquid nitrogen and homogenized using 4 ml of extraction buffer (50 mm Tris-HCl pH 8, 200 mm dithiothreitol (DTT) and protease inhibitors (10 μm Aprotinin, 1 μm of pepstatin, 100 μm leupeptin, 100 μm of phenylmethylsulfonyl and 100 μm E [(N-(N-(L-3-TRANS-carbondioxide-2-carbonyl)-L)agmantine] per gram of fresh leaf material. The homogenates were stirred for 30 min at 4°C and then double-centrifuged (15,000 rpm, 30 min, 4°C) to remove insoluble material. The total amount of protein was measured using analysis of proteins by Bradford (Bio-Rad). Proteins were separated on 15% SDS polyacrylamide gel and transferred to nitrocellulose membranes (0.22 μm) using a semidry apparatus. Membranes were incubated with anticorodal γ-Zein (dilution 1/7000) (Ludevid et al., 1985) or anticorodal against KLH-ka is ecitoninae (ST-anticavity) (1/1000 dilution) and then incubated with conjugated antibodies horseradish peroxidase (dilution 1/10000). Immunoreactive relationships were determined using an improved chemiluminescence (ECL Western blotting system, Amersham). The calcitonin antibodies were raised in rabbits by inoculation of synthetic salmon calcitonin associated with KLH. After four inoculate antigen (200 g each) serum was collected, divided into aliquots and stored at -80°C. Titration of serum was performed using the dot immunoblot analysis using synthetic calcitonin and ELISA analysis using BSA-calcitonin as antigen.

Northern blot analysis

Total RNA was isolated from leaves of wild and transgenic tobacco according to Logemann et al., 1987. RNA was fractionally using denatured formamid-agarose gel electrophoresis (30 μg per lane) and the capillary was bottiroli on nylon membranes (Hybond N, Amersham Pharmacia Biotech). The RNA blots were hybridisable with 129 main DNA sample obtained from the cDNA ARTICLE, and noted (α32P) dCTP using the kit for labeling with randomly charged DNA (Roche). Hybridization was carried out overnight at 42°C and the filters were washed three times for 15 min in 3X SSC and 0.5% SDS(WN) at 65°C. the Blots were determined using phosphor-imaging scanner (Fluor-S™ Multilmager, BIO-RAD).

ELISA assay (enzyme-linked immunosorbent assays)

ELISA analyses were conducted to quantify and is Aliza vegetable calcitonin (PCT) in extracts of soluble leaf proteins and partially purified γ-Zein-ART fused proteins. Titration microplates (MaxiSorp, Nalgene Nunc International) were charged soluble proteins (100 μl), diluted with phosphate-buffered saline pH 7.5 (PBS), and incubated overnight at 4°C. After three times washing of the wells nonspecific binding sites were blocked with 3% bovine serum albumin (BSA) in PBS-T (PBS containing 0.1% Tween 20) for one hour at room temperature. The plates were incubated with anticorodal ARTICLE (dilution 1/1000) for two hours and after four washes with PBS-T, incubated with peroxidase-conjugated secondary antibodies (1/8000 dilution) (Sigma) for two hours. Primary and secondary antibodies were diluted in PBS-T containing 1% BSA. After intensive washing PBS-T was carried out by the enzymatic reaction at 37°C with 100 µl of the primary buffer (100 mm sodium acetate pH 6, 0.01 mg/ml TMB (3,3',5,5'-tetramethylbenzidine) and 0.01% hydrogen peroxide). The reaction was stopped after 10 min 2N sulfuric acid and measured the optical density at 450 nm using a Multiskan spectrophotometer EX (Labsystems). The concentration of antigen in the plant extracts extrapolated from the standard curves obtained using calcitonin-BSA and ST antisera (dilution 1/1000).

Electron microscopy

The leaves of wild and transgenic plants were consolidated by vacuum infiltration with 1% glucurono what about the aldehyde and 2.5% paraform in 20 mm phosphate buffer pH 7.4 for one hour at room temperature. After sequential washing of 20 mm phosphate buffer and 200 mm ammonium chloride samples were obezvozhivani in ethanol and injected in Lowicryl CM polymer. The immunochemistry was performed essentially as described by Moore et al., 1991. Ultra-thin sections were incubated with anticorodal against KLH-calcitonin (1/500), αBiP (1/500) and γ-Zein (1/1500). For the detection of antibodies used protein A-colloidal gold (gold particles of 15 nm). The quality control was carried out by parallel incubation nereshennyh plant samples using identical dilution of primary antibodies and transgenic samples without primary antibody. Sections were stained with uranylacetate and lead citrate and examined using a 301 model electron microscope (Phillips, Eindhoven, The Netherlans).

Purification and cleavage of enterokinase RX3-CT and P4-CT fused proteins

Soluble extracts RX3-CT and P4-CT was obtained from leaves of transgenic tobacco (T1) in extraction buffer as described above. Solid (NH4)2SO4was gradually added at 0°C for soluble extracts RX3-CT and P4-CT to 45% and 60% saturation, respectively. The samples were stirred for 30 min at 0°C and then centrifuged at 15,000 rpm for 45 min at 4°C. Precipitated proteins resuspendable in 20 mm Tris-HCl pH 8.6 and was absoluely on a PD 10 column (Sephadex G-25 M, Amersham Pharmacia). Desalted protein extracts were fractionally is by using high-speed liquid chromatography (FPLC), using anion-exchange column (HiTrap Q sepharose, Amersham Pharmacia), equilibrated with 20 mm Tris-HCl pH to 8.6, 100 mm DTT. The protein elution was performed with a linear salt gradient from 0 to 200 mm NaCl in 20 mm Tris-HCl pH to 8.6, 100 mm DTT. The presence of RX3-CT and P4-CT in buervenich fractions was assessed by electrophoresis in 15% SDS polyacrylamide gel and immunoblot analysis using antisera ARTICLE. Positive fractions were absoluely and concentrated to 5 K NMWL centrifugal filters (BIOMAX, Millipore). Quantitative determination of RX3-CT and P4-CT fused proteins was performed by the ELISA method.

For EC enzymatic hydrolysis of 15 μg partially purified fused proteins were incubated with 0.2 U EK (EK Max, Invitrogen) in 30 μl of hydrolysis buffer (50 mm Tris-HCl pH 8.1, 1 mm NaCl, 0.1% Tween-20) for 24 hours at 20°C. the Buffer EC hydrolysis was supplemented with 100 mm DTT. The presence of a reducing agent allows you to optimize the splitting of enterokinase. The products of hydrolysis were analyzed using 18% Tris-tricin-polyacryamide gel electrophoresis, and released the PCT was determined using immunoblot analysis. Synthetic salmon ARTICLE was used as a positive control.

Purification and analysis released PCT

Vegetable calcitonin (PCT)released from the slit proteins with EC hydrolysis was purified using RP-HPLC. Hydrolysis mixture was placed on analytical to which the PMC RP-C18 (250×4 mm, the particle size of 10 μm, pore size 120 Å) and the column was suirable with a gradient varying from 25 to 60% acetonitrile with being 0.036% TFA over 20 min at a flow rate of 1 ml/ml of the Collected fractions were concentrated by lyophilization and stored at -20°C for characterization of the PCT. In a separate experiment, the standard salmon ARTICLE was suirable under the same chromatographic conditions. To characterize the PCT used TOF-MALDI mass spectrometry. Aliquots of fractions RP-HPLC was mixed with an equal volume of matrix solution (10 mg/ml α-cyano-4-hydroxyanisol acid and 0.1% TFA) and 1 µl was placed on the holder and analyzed using a mass spectrometer Voyager-DE-RP (Applied Biosystems). Standard salmon ARTICLE used in the experiments TOF-MALDI mass spectrometry as a control. C-terminal analysis of the PCT was performed by incubation of purified peptide (20 pmol/μl) for 60 min at 37°C With carboxypeptidase Y (Or 0.1 U/µl) and analyzed the products of hydrolysis using TOF-MALDI mass spectrometry.

II. RESULTS

Construction of chimeric genes for different derivatives of γ-Zein-ST

Expression and successful Assembly of the Proline-rich domain of γ-Zein in ER-derived protein bodies in the leaves of plants (Geli et al., 1994) present a complete tool for the accumulation of therapeutic proteins in the ER of plant tissues. Gene γ-Zein delet is believed to create different enriched in Proline shortened proteins, used as a binding partner for the production of ART in tobacco plants. Chimeric genes containing the domain of γ-Zein and synthetic gene ARTICLE, linked using linker, corresponding to the protease cleaved site. A synthetic gene that encodes a 32 amino acid active salmon calcitonin, generated from two complementary oligonucleotides (122 base), intended for the use of preferred codons of the plant, in order to achieve high expression of recombinant proteins in plants. Synthetic cDNA ARTICLE (Figure 2) were included at the 5' end of the linker sequence corresponding to the site of cleavage by enterokinase ((Asp)4-Lys), and at the 3' end of the additional codon for the production of glycine. This glycine is a necessary substrate for ameerega enzyme (S)to generate C-terminal prolinamide required for biological activity ARTICLE. cDNA calcitonin was merged with sequences encoding the domain of γ-Zein, C-end merger. For optimal expression of a chimeric gene derived γ-Zein-ART systems plant transformation vectors of the plants contained the following regulatory sequences: (i) advanced constitutive 35S promoter and 35S terminator from cauliflower mosaic virus and (ii) translational EN Anser of virus engraving tomatoes (TL). Various generated fused proteins are presented in figure 5. Protein γ-Zein-ST contains a γ-Zein, merged with the ARTICLE. Slit proteins RX3-CT, R3-CT, P4-ST and X10-ARTICLE contain domains derivatives of γ-Zein-related ARTICLE in the same way as a γ-Zein. These fused proteins differ by the presence or absence of repetitive and proX domains.

Getting fused proteins in tobacco plants

All genes merge was used for the sustainable transformation of tobacco plants using Agrobacterium tumefaciens. At least twenty independent kanamycin-resistant plants (That) was generated for each gene fusion. Screening of transgenic plants was performed using Western blot analysis of extracts of soluble proteins using polyclonal antisera γ-Zein. Configuration of immunoblots transgenic lines representing each gene fusions, shown in Fig.6. As observations showed that recombinant fused proteins were present in all transgenic lines, except for gene fusion X10-ST, where was not determined traces of fused proteins. This small protein (80 amino acids) probably unstable in tobacco plants. Two immuno-labeled bands were detected in transgenic lines R3-CT, one with unusually high apparent molecular weight. This protein was probably subjected posttranslational m is devikulam, such as glycosylation. In addition, it was shown that rich in Proline repetitive domain of γ-Zein can glikozilirovanie, when expressed in Arabidopsis plants (Alvarez et al., 1998). The level of expression of the protein was completely changed for different lines of the same gene fusions, except gene fusion RX3-CT, which showed high level expression of recombinant protein in all transgenic lines. Additional screening of immunoblots was performed using antisera grown specifically against a peptide sCT (Figa). As indicated by the observations, RX3-CT and P4-CT is well recognized by antisera sCT, indicating that these mergers provide the best ARTICLE accumulation of the peptide in tobacco plants. It should be noted that the image of immunoblot RX3-CT and P4-CT showed different labeled bands, with a major band corresponding to the correct apparent molecular mass related recombinant protein. According to one hypothesis labeled bands of high molecular weight were the result of the oligomerization domain of γ-Zein, which was formed during the accumulation of the fused proteins in plant tissues. In order to control the levels of gene expression merge relative protein levels was performed comparative Northern blot analysis (Pigv) using a transgene, the s lines, analyzed using immunoblot analysis (Figa). As shown, transcripts RX3-CT and P4-CT were more abundant, showing a steady accumulation of these transcripts. Suddenly transcripts R3-CT were more abundant compared to the low-fused protein R3-CT determined using immunoblot analysis. Probably post-translational modification cancels the correct self-fused protein and, consequently, its stability in the ER.

The maximum levels of expression of RX3-CT and P4-CT proteins measured using ELISA in extracts of leaf proteins from T1 plants were respectively to 12.44% 10,65% of the total soluble proteins. Regarding these results, transgenic line RX3-CT and P4-CT were selected for further experiments that produce vegetable calcitonin (PCT).

Intracellular localization of the fused proteins RX3-CT and P4-CT

Expression of γ-Zein and two deletion mutants of γ-Zein in Arabidopsis showed that these proteins are localized within the ER mesophyll cells, forming ER-derived BT (Geli et al., 1994). However, it is not clear that calcitonin, merged with derivatives of γ-Zein, is distributed in a similar organelles ER-BT. To investigate the intracellular localization in tobacco leaves fused protein γ-Zein containing calcitonin, the inventors used immunolab the electronic microscopy (Fig). Ultra-thin sections of leaves of transgenic tobacco, downregulation of RX3-CT and P4-CT proteins were incubated with the antibody ART and protein A-gold. Strongly labeled BT-like organelles were observed in mesophyll cells of tobacco, downregulation of RX3-CT and P4-CT (Figa and b, respectively). Identified several vesicles to the cell and their size was quite heterogeneous. As fused proteins contained protein calcitonin and fragments of γ-Zein, ultra-thin sections were also incubated with the antibody for γ-Zein. As expected, BT were labeled with antibody to γ-Zein, confirming that the fused proteins accumulated within these organelles (Figs). To demonstrate that BT was formed from the ER, the sections were incubated with antibodies against ER-resident protein BiP (Fig D). Concomitant distribution ST-fused proteins and BiP in these organelles showed that RX3-CT and P4-CT accumulated within the ER lumen and subsequent formation of independent ER-derived vesicles. Because the inventors were unable to identify BT-like organelles in ultrathin sections nereshennyh plants (Fige), control experiments were performed without primary antibodies in transgenic plants (Fig.8F). As expected, non-specific label was determined in control experiments.

Purification of fused proteins and the release of the PCT

RX3-CT and P4-CT fused b is the CTL effectively were extracted from leaves of transgenic tobacco (T1), using extraction buffer containing reducing agent, such as DDT (200 mm). About 85 μg RX3-CT and 75 μg P4-ARTICLE was obtained from a gram of fresh material. RX3-CT and P4-CT proteins were concentrated by precipitation with 45% and 60% ammonium sulfate, respectively. Desalted protein extracts were fractionally method FPLC using anion-exchange chromatography, and a dedicated fused proteins were analyzed using ELISA method. RX3-CT protein was about 80% of the total purified proteins, while P4-ST was only about 50% of the total purified proteins. This difference can be explained by the fact that more protein is precipitated with 60% ammonium sulphate than with 45%, and that, therefore, precipitated P4-ST proteins contained a lot more related proteins. Partially purified fused proteins RX3-CT and P4-CT hydrolyzed using EC and the release of the PCT was controlled using Tris-tricin-polyacrylamide gel electrophoresis and immunological analysis. As shown in Fig.9, the only labeled band corresponding to the calcitonin was generated by splitting both RX3-CT and P4-CT proteins. Small quantities of fused proteins RX3-CT and P4-CT remained non-hydrolyzed, probably due to the unavailability of some enzyme cleavage sites.

Purification and characterization of the PCT

Vegetable calcitonin (PCT) was allocated fracc what onerownim mixtures of enzyme EC hydrolysis on the analytical column C18 RP-HPLC (Figure 10) and analyzed eluruume fractions using TOF-MALDI mass spectroscopy, using synthetic sCT as standard (Mm 3433.24, Figa). PCT calcitonin was suirable 13 min (synthetic sCT Tr=14 min) and received one spectrum with the mass 3491,93 Yes using TOF-MALDI mass spectroscopy, which is consistent with theoretical molecular weight of the obtained calcitonin, elongated glycine at the C-end (Pigv). Mass spectrometric analysis of the PCT subjected to enzymatic hydrolysis by carboxypeptidase Y, confirmed the integrity of the C-terminal glycine, which is necessary for obtaining the C-terminal prolinamide.

III. DISCUSSION of RESULTS

Offered a good system based on the fused proteins to accumulate salmon calcitonin in tobacco leaves. There were found two fused protein RX3-Cal and P4-Cal for a strong accumulation in ER-derived BT tobacco leaves. These fused proteins contain ST peptide and Proline-rich domains of the γ-Zein, which include i) repeat domain containing eight units Hexapeptide PPPVHL (only one unit in P4-Cal fused protein) and (ii) proX domain, where prolinnova residues replaced by other amino acids. Rich in Proline domain of γ-Zein necessary for the proper preservation and Assembly of the γ-Zein inside the ER of Arabidopsis (Geli et al., 1994). The folding and stabilization of the polypeptide chains of γ-Zein in the ER due to the ability repetitive and proX domains to implement is Noboru and promote the formation of oligomers. Special conformation adopted by these vysokolegirovannyh domains, probably due to Proline rich sequences, which are able to form an amphipatic secondary structure. As a result of their characteristic conformation of the Proline-rich domains will induce aggregation mechanisms, including protein-protein interactions and disulfide cross-links, contributing to the preservation ER and the formation of ER-derived BT. This example shows that downregulation of method N-terminal merge Proline-rich domain of γ-Zein remain fully capable of self-Assembly and promotion of a variety of phenomena, leading to the preservation and accumulation of ER-derived BT. It was also found that salmon ARTICLE included in protein, strongly accumulated in BT. High level of expression ARTICLE in transgenic tobacco plants can be explained by the ability of Proline-rich domains to fold and stabilize the protein. Depositing fused protein in BT certainly contributes to the enrichment plant tissue calcitonin, by moving it from hydrolytic intracellular environment. Since small proteins are unstable in biological systems, have now decided to use fused proteins to obtain calcitonin in heterologous systems, such as E. coli (Rayet al., 1993; Yabuta et al., 1995; Hong et al., 2000), Staphylococcus carnosus (Dilsen et al., 2000) and in the milk of transgenic rabbits (Mckee et al., 1998). In this latter case, the purpose of merging ART with human alpha-lactalbumin was hiding activity of calcitonin, in order to avoid possible interference with normal development of the animal.

The inventors have succeeded in rapidly retrieve the elongated glycine sCT from the tobacco plant:

i) RX3-Cal and P4-Cal fused proteins were effectively isolated from the tissues of tobacco due to their high solubility in the presence of reducing agents,

ii) enterokinase the release of calcitonin from the fused proteins was carried out after one stage of purification of fused protein using anion-exchange chromatography, and

iii) reverse-phase chromatography led to the cleaned ARTICLE by allocating it from a mixture of EC enzymatic hydrolysis.

Mass spectrometric analysis of the released ARTICLE confirmed that exactly elongated glycine ARTICLE was obtained using tobacco plants.

Sources of information

Álvarez, I., Gelim M.I., Pimentel, E., Ludevid, D., Torrent, M. 1998. Lysine-rich γ-zeins are secreted in transgenic Arabidopsis plants. Planta 205: 420-427.

Azria, M., Copp, D.H., Zanelli, J.M. 1995. 25 years of salmon calcitonin: from synthesis to therapeutic use. Calcif. Tissue Int. 57 (6): 405-408.

Bénicourt, C, Blanchard, C, Carriére, F., Verger, R. and Junien, J.L. 1993. Potential use of a recombinant dog gastric lipase as an enzymatic supplement to pancreatic extracts in cystic fibrosis, pp.291-295 in Clinical Ecology of Cystic Fibrosis. Escobar H, Baquero CF, uarez L (eds). Elsevier Sciences Publishers B.V., Amsterdam.

Bevan, M. 1984. Binary Agrobacterium vectors for plant transformation. Nucleic Acids Research 12: 8711-8721.

Bradbury, A.F. and Smyth, D.G. 1988. Biosynthesis of peptide neurotransmitters: studies on the formation of peptide amides. Physiol. Bohemoslov. 37: 267-274.

Conrad, U. and Fiedler, U. 1998. Compartment-specific accumulation of recombinant immunoglobulins in plant cells: an essential tool for antibody production and immunomodulation of physiological functions and pathogen activity. Plant Mol. Biol. 38: 101-109.

Cramer, C.L., Boothe, J.G. and Oishi, K.K. 1999. Transgenic plants for therapeutic proteins linking upstream and downstream strategies. Curr. Top. Environ. Immunol. 240: 95-118.

Cudd, A., Arvinte, T., Das, R.E., Chinni, C. and MacIntyre, I. 1995. Enhanced potency of human calcitonin when fibrillation is avoided. J. Pharm. Sci. 84: 717-719.

Dilsen, S., Paul, W., Sandgathe, D., Tippe, R., Freudl, J., Kula, M.R., Takors, C, Wandrey, and D. Weuster-Botz, D. 2000. Fed-batch production of recombinant human calcitonin precursor fusion protein using Staphylococcus carnosus as an expression-secretion system. Appl. Environ. Biotechnol. 54: 361-369.

Draper, J., Scott, R. and Hamil, J. 1988. In: Plant Genetic Transformation and Gene Expression. A Laboratory Manual (Eds. Draper, J., Scott, R., Armitage, P. and Walden, R.), Blackwell Scientific Publications.

Düring, K., Hippe, S., Kreuzaler, F. and Schell, J. 1990. Synthesis and self-assembly of a functional monoclonal antibody in transgenic Nicotiana tabacum. Plant Mol. Biol. 15: 281-293.

Eipper, B.A., D.A. Stoffers and Mains R.E. 1992. The biosynthesis of neuropeptides: peptide α-amidation. Annu. Rev. Neurosci. 15: 57-85.

Fischer, R. and Emans, N. 2000. Molecular farming of pharmaceutical proteins. Transgenic Research 9: 279-299.

Geli, M.I., Torrent, M. and Ludevid, M.D. 1994. Two structural domains mediate two sequential events in the γ-zein targeting: protein endoplasmic reticulum retention and protein body formation. Plant Cell 6: 1911-1922.

Haq, T.A., Mason, H.S., Clements, J.D. and Arntzen, C.J. 1995. Oral immunization with a recombinant bacterial antigen produced in transgenic plants. Science 268: 714-715.

Herman, E.M. and Larkins, B.A. 1999. Protein torage bodies. Plant Cell 11: 601-613.

Hong, D., Mingqiang, Z., Min, L., Changqing, C. and Jifang, M. 2000. Production of recombinant salmon calcitonin by amidation of precursor peptide using enzymatic transacylation and photolysis in vitro. Biochem. Biophys. Res. Com. 267: 362-367.

Kogan, M.J., Dalcol, I., Gorostiza, P., López-Iglesias, C., Pons, M., Sanz, F., Ludevid, M.D., and Giralt, E. 2001. Self-assembly of the amphipathic helix (VHLPPP)8. A mechanism for zein protein body formation. J. Mol. Biol. 00: 1-7.

Logemann, J., Schell, J., Willmitzer, L. 1987. Improved method for the isolation of RNA from plant tissues. Anal. Biochem. 163: 16-20.

Ludevid, M.D., Martinez-Izquierdo, J.A., Armengol, M. Torrent, M., Puigdomènech, P. and Palau, P., J. 1985. Immunological relations between glutelin-2 and low molecular weight zein-2 proteins from maize (Zea mays) endosperm. Plant sci. 41: 41-48.

Ludevid, M.D., Torrent, M., Martinez-Izquierdo, J.A., Puigdomènech, P. and Palau, P. 1984. Subcellular localization of glutelin-2 in maize. Plant Mol. Biol. 3: 277-234.

Ma, J.K., Hikmat, B.Y., Wycoff, K., Vine, N.D., Chargelegue. D., Yum L., Hein, M.B. and Lehner, T. 1998. Characterization of a recombinant plant monoclonal secretory antibody and preventive immunotherapy in humans. Nat. Med. 4: 601-606.

Ma, J.K. and Hein, M.B. 1995. Plant antibodies for immunotherapy. Plant Physiol. 109: 341-346.

McCormick, A.A., Kumagai, M.H., Hanley, K., Turpen, T.N., Hakim, I., Grill, L.K., Tusé, D., Levy, S. and Levy, R. 1999. Rapid production of specific vaccines for lymphoma by expression of the tumor-derived single-chain Fv epitopes in tobacco plants. Proc. Natl. The ACA. Sci. USA 96 (2) 703-708.

McKee, C, Gibson, A., Dalrymple, M., Emslie, L., Garner, I. and Cottingham, I. 1998. Production of biologically active salmon calcitonin in the milk of transgenic rabbits. Nature Biotechnology 16: 647-651.

Merli, S., De Falco, S., Verdoliva, A., Tortora, M., Villain, M., Silvi, P., Cassani, G. and Fassina, G. 1996. An expression system for the single-step production of recombinant human amidated calcitonin. Protein Express. Purif. 7: 347-354.

Moore, P.J., Swords, K.M.M., Lynch, M.A. and Staehelin, L.A. 1991. Spatial organization of the assembly pathways of glycoproteins and complex polysaccharides in theGolgi apparatus of plants. J. Cell Biol. 112: 589-602.

Munro, S. and Pelham, H.R.B. 1987. A C-terminal signal prevents secretion of luminal ER proteins. Cell 48: 899-907.

Müntz, K. 1998. Deposition of storage proteins. Plant Mol. Biol. 38: 77-99.

Parmenter, D.L., Boothe, J.G., Van Rooijen, G.J., Yeung, E.C. and Moloney, M.M. 1995. Production of biologically active hirudin in plant seeds using oleosin partitioning. Plant Mol. Biol. 29: 1167-1180.

Ray, M.V., Van Duyne, P., Bertelsen, A.H., Jackson, Matthews, D.E., Sturmer, A.M., Merkler, D.J., Consalvo, A.P., Young, S.D., Gilligan, J.P. and Shields, P.P. 1993. Production of recombinant salmon calcitonin by in vitro amidation of an Escherichia coli produced precursor peptide. Bio/Technology 11: 64-70.

Reginster, J.Y. 1993. Calcitonin for prevention and treatment of osteoporosis. Am. J. Med. 95 (5A): 44S-47S.

Reichel, C, Mathur, J., Eckes, P., Langenkemper, K., Koncz C, Schell, J., Reiss, B., and Maas, C. 1996. Enhanced green fluorescence by the expression of an Aequorea victoria green fluorescent protein mutant in mono - and dicotyledonous plant cells. Proc. Natl. Acad. Sci. USA 93: 5888-5893.

Sambrook, J., Fritsch, E., Maniatis, T., 1989. Molecular Cloning: A laboratory manual. Cols Spring Harbor Laboratory, Cold Spring Harbor, New York.

Silverman, S.L. 1997. Calcitonin. Am. J. Med. Sci. 313 (1): 13-16.

Staub, J.M., Garcia, B., Graves, J., Hajdukiewicz, P.T., Hunter, P., Nehra, N., Paradkar, V., Schlittler, M., Caroll, J.A., Spatola, L., Ward, D., Ye, G. and Russell, D.A. 2000. High-yield production of a human therapeutic protein in tobacco chloroplasts. Nature Biotechnology 18: 333-338.

Stöger, E., Vaquero C, Torres, E., Sack, M., Nicholson, L., Drossard, J., Williams, S., Keen, D., Perrin, Y., Christou, P. and Fischer, R. 2000. Cereal crops as viable production and storage systems for pharmaceutical scfv antibodies. Plant Mol. Biol. 42: 583-590.

Takahashi, K.I., Liu, Y.C., Hayashi, N., Goto, F., Kato, M., Kawashima, H. and Takeuchi, T. 1997. Production of bioactive salmon calcitonin from the nonendocrine cell lines COS-7 and CHO. Peptides 18: 439-444.

Torrent, M., Rosa, E., Campos, N., Ludevid, M.D. and Palau, J. 1986. In maize, glutelin-2 and low molecular weight zeins are synthesized unit by membrane-bound polyribosomes and translocaed into microsomal membranes. Plant Mol. Biol. 7: 393-403.

Torrent, M., Geli, M.I., Ruir-Avila, L., Canals, JM., Puigdomènech, P. and Ludevid, D. 1994. Role of structural domains for maize g-zein retention in Xenopus oocytes. Planta 192: 512-518.

Torres, E., Vaquero, C, Nicholson, L., Sack, M., Stöger, E., Drossard, J., Christou, P., Fischer, R. and Perrin, Y. 1999. Rice cell culture as an alternative production system for functional diagnostic and therapeutic antibodies. Transgenic Research 8: 441-449.

Verch, T., Yusibov, V., and Koprowski, H. 1998. Expression and assembly of a full-length monoclonal antibody in plants using a plant virus vector. J. Immunol. Methods 220: 69-75.

Vitale, A., Ceriotti, A. and Denecke, J. 1993. The role of The endoplasmic reticulum in protein synthesis, modification and intracellular transport. J. Exp. Bot. 44: 1417-1444.

Vitale, A. and Denecke, J. 1999. The endoplasmic reticulum gateway of the secretory pathway. Plant Cell 11: 615-628.

Wandelt, S, Khan, M.R.I., Craig, S., Schroeder, H.E., Spencer, D. and Higgins, T.J.V. 1992. Vicilin with carboxy-terminal KDEL is retained in the endoplasmic reticulum and accumulates to high levels in the leaves of transgenic plants. Plant J. 2: 181-192.

Yabuta, M., Suzuki, Y. and Ohsuye, K. 1995. High expression of a recombinant human calcitonin precursor peptide in Escherichia coli. Appl. Environ. Biotechnol. 42 (5): 703-708.

Yamamoto, K., Fujii, R., Toyofuku, Y., Saito, T., Koseki, H., Hsu V.W. and Aoe, T. 2001. The KDEL receptor mediates a retrieval machanism that contributes to quality control at the endoplasmic reticulum. EMBO J. 20 (12): 3082-3091.

1. The sequence of the nucleic acid for expression of a fused protein in the system of the host, including:
the first sequence of nucleic acid containing a nucleotide sequence that encodes a protein γ-Zein, or a fragment containing a nucleotide sequence that encodes the amino acid sequence, capable direction, and registering the protein in the endoplasmic reticulum (ER) plant cell;
the second sequence of nucleic acid containing a nucleotide sequence that encodes the amino acid sequence that is specifically cleaved via an enzymatic or chemical means; and
the third nucleic acid sequence containing the nucleotide sequence that encodes the desired product;
where the 3'-end of the specified first nucleic acid sequence linked to the 5'-end of the specified second nucleic acid sequence and the 3'-end of the specified second nucleic acid sequence linked to the 5'-end of the specified third nucleic acid sequence.

2. The sequence of the nucleic acid according to claim 1, where the specified first sequence of nucleic acid contains a nucleotide sequence that encodes complete protein γ-Zein.

3. The sequence of the nucleic acid according to claim 1, where the specified first sequence of nucleic acid contains:
one or more nucleotide sequences coding for all or part of the repetitive domain of the protein γ-Zein;
one or more nucleotide sequences coding for all or part of the ProX domain protein γ-Zein; or
one or more nucleotide sequences coding for all or part of the recurring is gosia domain protein γ-Zein, and one or more nucleotide sequences coding for all or part Rhoh domain protein γ-Zein.

4. The sequence of the nucleic acid according to claim 1, where the specified first nucleic acid sequence selected from the following groups:
the nucleotide sequence shown in SEQ ID NO:l [a nucleotide sequence that encodes γ-Zein (figa)],
the nucleotide sequence shown in SEQ ID NO:2 [nucleotide sequence identified as RX3 (pigv)],
the nucleotide sequence shown in SEQ ID NO:3 [nucleotide sequence identified as R3 (pigv)],
the nucleotide sequence shown in SEQ ID NO:4 [nucleotide sequence identified as P4 (figs)], and
the nucleotide sequence shown in SEQ ID NO:5 [nucleotide sequence identified as X10 (figs)].

5. The sequence of the nucleic acid according to claim 1, where the specified second sequence of nucleic acid contains a nucleotide sequence that encodes the amino acid sequence, which determines the site of cleavage by the protease.

6. The sequence of the nucleic acid according to claim 5, where this protease is enterokinase, Arg-C endoprotease, Glu-C endoprotease, Lys-C endoprotease or factor XA

7. The sequence of the nucleic acid according to claim 1, where the specified second sequence of nucleic acid contains a nucleotide sequence that encodes the amino acid that is specifically cleaved by chemical reagents.

8. The sequence of the nucleic acid according to claim 7, where the specified chemical reagent is labronica.

9. The sequence of the nucleic acid according to claim 1, where the specified desired product is a protein drug.

10. The sequence of the nucleic acid according to claim 9, where the specified protein drug is a peptide hormone or interferon, and the specified drug is effective for treatment of human and animal.

11. The sequence of the nucleic acid of claim 10, where the specified peptide hormone selected from calcitonin, erythropoietin, thrombopoietin and growth hormone.

12. The sequence of the nucleic acid according to claim 1, where this third sequence of the nucleic acid contains a nucleotide sequence encoding calcitonin, and the codon for glycine at the 3'-end of the specified nucleic acid sequence that encodes calcitonin.

13. Protein that contains:
(i) the amino acid sequence of the protein γ-Zein, or its fragment, capable on the management and conservation of the protein in the ER of plant cells
(ii) an amino acid sequence that is specifically cleaved via an enzymatic or chemical methods, and
(iii) the desired product;
moreover, the specified protein is the product of expression of a nucleic acid sequence according to any one of claims 1 to 12 in the system of the host plant.

14. Protein indicated in paragraph 13 that contains a complete protein γ-Zein.

15. Protein on 14 containing the amino acid sequence shown in figa and identified as SEQ ID NO:6.

16. Protein indicated in paragraph 15 contains a fragment of the protein γ-Zein, with the specified fragment contains the amino acid sequence capable of directing and retaining a protein in the ER of plant cells.

17. Protein according to clause 16, containing a fragment of the protein γ-Zein selected from the group consisting of:
amino acid sequence shown in SEQ ID NO:7 [amino acid sequence corresponding to RX3 (pigv)],
amino acid sequence shown in SEQ ID NO:8 [amino acid sequence corresponding to R3 (pigv)],
amino acid sequence shown in SEQ ID NO:9 [amino acid sequence corresponding to P4 (figs)], and
amino acid sequence shown in SEQ ID NO:10 [amino acid sequence corresponding to X10 (figs)].

18. Protein p is item 13, where the specified amino acid sequence, which is specifically cleaved by using enzymatic methods, contains the cleavage site by the protease.

19. Protein indicated in paragraph 13 where the specified amino acid sequence, which is specifically cleaved by chemical methods, contains the website, split using a chemical reagent.

20. Protein indicated in paragraph 13, where the specified desired product is a protein drug.

21. Design a nucleic acid that contains (i) the sequence of nucleic acid according to claim 1, and (ii) a regulatory nucleotide sequence that regulates the transcription of a nucleic acid according to the invention (i), and specified regulatory sequence (ii) is functional in plants.

22. Design according to item 21, where the specified regulatory sequence (ii) is tissue-specific.

23. Design according to item 21, where the specified regulatory sequence (ii) contains a promoter functional in plants.

24. Design by article 22 where the specified regulatory sequence (ii) contains the 35SCaMV promoter, the promoter patatina, the promoter reserve the protein, the promoter of the gene ubicacin or regulatory sequence of a gene of γ-Zein.

25. Design according to item 21, where the specified regulatory sequence (i) contains the sequence of the transcription has been completed, functional in a plant.

26. Design A.25 where the specified regulatory sequence (ii) contains the terminator 35SCaMV, the terminator gene octopunctata (ocs), the terminator gene napadisylate (nos) or the terminator gene γ-Zein.

27. Design according to item 21, where the specified regulatory sequence (ii) further contains a translational enhancer, functional in a plant.

28. Design by item 27, where the specified translational enhancer, functional in the plant, contains the promoting sequence for viral transcription engraving tomato.

29. A vector containing expressibly sequence of nucleic acid according to claim 1 for the transformation of the system of the host.

30. A vector containing expressibly design nucleic acid according to item 21 for transformation of the system of the host plant.

31. The transformed system of the host plant, and this system of the host plant transformed nucleic acid according to claim 1, or construction item 21, or the vector according to clause 29, or the vector according to item 30.

32. Transgenic system of the host plant, and the indicated transgenic system of the host plant contains integrated in its genome a sequence of nucleic acid according to claim 1.

33. The system of the host plant on p, where this plant is a monocotyledonous or dicotyledonous plant.

34. The system of the host plant on p, where this plant is a cereal, legumes, cruciferous or Solanaceae.

35. The system of the host plant on p, where the plant contains seeds.

36. The system of the host plant on p, where this plant is a monocotyledonous or dicotyledonous plant.

37. The system of the host plant on p, where this plant is a cereal, legumes, cruciferous or Solanaceae.

38. The system of the host plant on p, where the plant contains seeds.

39. The way to get targeted product in the system of the host plant, which includes the cultivation of a transformed system of the host plant on p under conditions that allow the acquisition and expression of a specified interest of product in the form of a fused protein.

40. The way to get targeted product in the system of the host plant, which includes the cultivation of transgenic system of the host plant on p under conditions that allow the acquisition and expression of a specified interest of product in the form of a fused protein.

41. The method according to § 39, which further includes isolation and purification of the specified fused protein.

42. The method according to § 39, which further includes the release of the above interesting product from the specified fused protein.

43. The method according to p, which further includes the selection and the eyes of the weave of the specified fused protein.

44. The method according to p, which further includes the release of the above interesting product from the specified fused protein.

45. The method of producing calcitonin in the system of the host plant, including:
a) transformation of the host plant expression vector or construct a nucleic acid that contains (i) a regulatory sequence; and (ii) a nucleic acid sequence consisting of:
the first nucleic acid sequence containing the nucleotide sequence that encodes a protein γ-Zein, or a fragment containing a nucleotide sequence that encodes the amino acid sequence capable of directing and retaining a protein in the endoplasmic reticulum (ER) of plant cells;
the second nucleic acid sequence containing the nucleotide sequence that encodes the amino acid sequence that is specifically cleaved via an enzymatic or chemical means; and
the third nucleic acid sequence containing the nucleotide sequence that encodes calcitonin;
where the 3'-end of the specified first nucleic acid sequence linked to the 5'-end of the specified second nucleic acid sequence and the 3'-end of the specified second pic is egovernance nucleic acid is linked to the 5'-end of the specified third nucleic acid sequence; and
where regulatory sequence regulates transcription of the aforementioned nucleic acid sequence
b) generating full of plants from these systems of host plants, transformed with the indicated expression vector or construct nucleic acid;
c) the cultivation of such transformed plants under conditions which provide for the production and expression of calcitonin in the form of a fused protein; and, if desirable,
d) isolation, purification specified fused protein and the processing of the specified fused protein to release calcitonin.

46. The method according to paragraph 41, where this first nucleic acid sequence encodes complete protein γ-Zein.

47. The method according to paragraph 41, where this first nucleic acid sequence encodes a fragment of the protein γ-Zein.



 

Same patents:

FIELD: medicine.

SUBSTANCE: plant is transformed with a genetic make-up that incorporates DNA sequence coding a receptor for systemic signal compound chosen from the group consisting of salicylic acid, jasmine acid and brassinosteroids. Preferentially, the receptor represents a RKS-receptor. The combinations of receptors and/or chimeric receptors also can be used.

EFFECT: improved resistance to pathogenic germs.

13 cl, 26 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: membrane pyrophosphatase gene of bacterium Rhodospirillum rubrum is introduced in a plant genome that enables synthesis of the related protein in plant cells. Particularly, there are designed transgene tobacco plants expressing a membrane H+ -pyrophosphatase gene from bacterium Rhodospirillum rubrum. As a result of transformation, when grown in vivo, the transgene plants exceed the reference length of root system and the reference weight of leaves. The average number of seed capsule of the transgene plants is more than in the reference, while the average amount and weight of seed material of the transgene plants is more as well. The chlorophyll content in leaves of the transgene plants exceeds that of the reference plants. The transgene plants considerably overtake the reference plants in growth.

EFFECT: plants with improved economic-valued indicators, such as accelerated growth, higher length and weight of the roots, increased weight of the leaves, improved biological efficiency and plant resistance to salinisation.

7 cl, 13 dwg, 6 tbl, 9 ex

FIELD: agriculture.

SUBSTANCE: in plant nucleic acid is introduced, which codes protein of cyclin A2, engaged to promoter, specific to seed genes. Produced plants have increase crop capacity both compared to according wild types of plants and relative to transgenic plants, which constitutively express cyclin A.

EFFECT: increased crop capacity of plant in optimal and suboptimal conditions.

19 cl, 4 dwg, 16 tbl, 4 ex

FIELD: agriculture.

SUBSTANCE: genetic modification of wheat in the form of mutation in gene SBEIIa with reduction of level of its activity.

EFFECT: grain with high content of amylose in its starch; wheat with reduced level of SBEIIb-activity with grain with non-wrinkled phenotype, with relatively high content of amylose.

62 cl, 28 dwg, 12 tbl, 16 ex

FIELD: genetic engineering.

SUBSTANCE: in a genetically transformed plant, activity of protein Rpi-blb2 is increased.

EFFECT: resistance of the plant to Oomycetes pathogens.

13 cl, 31 dwg, 8 tbl, 17 ex

FIELD: agriculture.

SUBSTANCE: stress-tolerant wheat plant is described, where specified wheat plant is transformed with molecule of nucleic acid, which codes ornithineaminotransferase (OAT). Method is disclosed for protection of wheat plant against stress, which includes stage of nucleic acid molecule introduction into wheat plant, where molecule of nucleic acid codes ornithineaminotransferase (OAT). Structure of nucleic acid is presented, including activating agent extracted from plant and gene of ornithineaminotransferase (OAT), where specified structure is able to transform wheat plant so that specified plant of wheat becomes tolerant to stress. Method is disclosed for production of transgenic wheat plant with induced or increased tolerance to salt, including transformation of vegetable tissue or cell of wheat plant with molecule of nucleic acid, which codes ornithineaminotransferase (OAT), regeneration of tissue or cell into whole plant, and expression of OAT in regenerated plant for time and under conditions sufficient for induction or increase of plant tolerance to concentration of salt of more than 100 mM.

EFFECT: invention makes it possible to obtain stress-resistant plant.

13 cl, 5 dwg, 1 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: nucleic acid coding self-activated stability protein contains a limited site of NBS-LRR-gene extended from 5'-end of coding region of NBS-LRR-gene towards 5'-3' prior to NBS-domain, and NBS-LRR-gene is not TIR-NBS-LRR-gene.

EFFECT: plants containing self-activated stability protein gain pathogen resistance.

19 cl, 24 dwg, 3 tbl

FIELD: agriculture.

SUBSTANCE: in plant expression is increased for at least one protein Bax inhibitor - 1 (BI1) in at least one vegetable tissue. At the same time expression in leaves epidermis is left mainly invariable. Plants are transformed by recombinant expression cassettes and vectors, which include sequence of nucleic acids that codes BI-protein under control of tissue-specific promoter, which mainly does not have activity in epidermis of leaves.

EFFECT: transformation provides for arrangement or improvement of resistance to at least one biotic or abiotic stress factor in plants, preferably to vegetable pathogens.

13 cl, 16 dwg, 7 tbl, 8 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and is a method of growing transgenic carrot plants, which produce human intereleukin-10. Recombinant plasmid DNA pBi101-IL10 is constructed, which codes synthesis of human interleukin-10, and transfers it to the Agrobacterium strain. Tylosis is obtained, which is induced from mature embryos of carrot seeds using agarised culture medium MS, which contains 0.2 mg/l 2,4-D and 0.2 mg/l kinetin. Agrobacterial transformation of tylosis with pBi101-IL10 construction is carried out, obtaining transgenic explants. The obtained explants are cultured for inducing kanamycin-resistant tylosis using culture medium MS, containing 0.2 mg/l 2,4-D, 0.2 mg/l kinetin, 100 mg/l kanamycin and 500 mg/l cefotaxime. The formed embryoids are transferred for regeneration of plants on paper bridges in test-tubes using liquid medium MS, containing 100 mg/l kanamycin, 500 mg/l cefotaxime with subsequent growing of regenerated plants in nursery conditions.

EFFECT: method allows for simple and cheap growing transgenic carrot plants, which produce human interleukin-10.

4 dwg, 3 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: expression of endogeneous reserve proteins in plant seeds is suppressed through transformation of plant cells using a genetic construct, which contains a seed-specific promoter, functionally linked with a DNA sequence which codes transcription factors of endogenous genes or part of these factors, including their different combinations. The transcribed target of the said sequence is capable of suppressing, slowing down or in some other way, lowering expression of reserve proteins of seeds in a plant cell. Further, this or another plant cell is transformed by the construct, which contains the same seed-specific promoter, functionally linked with the DNA sequence which codes the heterologous polypeptide of concern.

EFFECT: in a plant regenerated from the said cell, expression of endogenous mRNA is reduced, which enables accumulation of heterologous polypeptide in that plant.

25 cl, 5 dwg, 7 ex

FIELD: medicine.

SUBSTANCE: there is offered molecule of nucleic acid inducing CEA immune response, containing a nucleotide sequence that codes a fused protein on a basis of carcinoembryonal antigen (CEA) or its functional version fused with a subunit B of thermolabile enterotoxin E coli. There are described versions thereof, as well as the related purified protein. There is disclosed an expression vector containing said molecule of nucleic acid, and a host-cell containing specified vector. There are described adenoviral vaccinal vector for inducing the immune response and a vaccinal plasmid on the basis of the specified molecule.

EFFECT: application of the invention allows to inducing the immune response in a mammal which is stronger, than that induced with natural CEA that can find application in medicine for cancer treatment.

20 cl, 62 dwg, 20 ex

FIELD: medicine.

SUBSTANCE: there is prepared identification peptide with amino acid sequence: Gly-Pro-Ala-Pro-Gln-Pro-Asp-Glu-Asp-Leu-Lys-Arg-Gln. The prepared peptide is applied to identify, purify and recover the recombinant proteins containing it. For making the recombinant proteins with a polypeptide label, an expression vector pDED is applied. Said vector contains a nucleotide sequence coding amino acid sequence of the identification protein.

EFFECT: invention allows extending range of the methods to identify the recombinant proteins.

14 cl, 6 dwg, 1 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention refers to genetic engineering and can be used in medicine. The mucosal vaccine contains effective amount of hybrid protein consisting of oncoprotein E7 of human papilloma virus fused with heat-shock protein of mycobacteria Hsp70, chitosan related to hybrid protein 1:0.1-10 and additives pharmaceutically acceptable manufacturing of suppositories. The mucosal vaccine is used in therapy of the diseases associated with human papilloma virus.

EFFECT: possibility for multiple improvement of clinical effectiveness of diseases associated with human papilloma virus, considerable reduction of treatment cost in comparison with common techniques of treating cervical carcinoma and "РПК"; elimination of injection by-effects undesirable and extremely dangerous for the patent's life, eg anaphylactic shock, owing to local application; simplification of medical process - the patient can receive medical treatment out of clinic by independent introduction of the preparation.

6 cl, 4 dwg, 2 tbl, 10 ex

FIELD: medicine.

SUBSTANCE: invention is related to preparation of protein, binding tumour necrosis factor (TNF), and may be used in medicine. Strain-producer of baculovirus BvG2RIgG is created with the help of recombinant plasmid DNA pFastBac-G2R-IgG with size of 6444 p.n. and molecular mass 4.18 mDa, which bears fragment of smallpox virus genome of strain India-1967, which codes protein that binds TNF, and fragment of human genome, which codes fragment of heavy chain of human antibody G. Produced strain produces soluble chimeric protein, which consists of smallpoz virus protein, which binds TNF, and fragment of heavy chain of human antibody G.

EFFECT: wider spectrum of new generation preparations intended for treatment of human diseases related to hyperproduction of tumour necrosis factor.

2 cl, 3 dwg, 1 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention is related to nucleic acids and multidomain proteins, which are able to bind vessel endotheliocyte growth factor (VEGF), and may be used in medicine. Recombinant method is used to produce polypeptide, which consists of component (R1R2)X and, unnecessarily, multidomain component (MC), which represents aminoacid sequence with length from 1 to 200 of amino acids, having at least one remainder of cysteine, where X≥1, R1 means antibody-like (Ig) domain 2 of VEGF receptor Llt-1, and R2 means Ig-domain 3 of VEGF receptor Flk-1. Produced fused polypeptide does not contain multidomain component in case, when X=2, and in case when X=1, multidomain component represents aminoacid sequence with length from 1 to 15 amino acids. Produced polypeptide is used in composition of pharmaceutical compound for VEGF-mediated disease or condition.

EFFECT: invention makes it possible to produce highly efficient trap of VEGF, special structure of which is suitable for local introduction into specific organs, tissues or cells.

16 cl, 3 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used for screening of compounds with properties of agonists or antagonists of leptin receptor. There is disclosed method for detecting leptin receptor definition that provides contact of a candidate compound and cells expressing after contransfection with two expressing vectors, respectively, two fused proteins, one of which consists of a short isoform of leptin receptor (OBRs) and an energy donor protein (preferentially luciferase), and the second - of OBRs and an energy acceptor protein (preferentially GFP or its mutant form); measurement of energy transfer (BRET) between the fused proteins; comparison of its value to the relevant indicator measured in the same system, however without tested compound, and estimated result where higher energy transfer indicates binding of the candidate compound-candidate with leptin receptor. Prospective application of the invention is related to development of the preparations for prevention or treatment of disease wherein leptin or its receptor are involved.

EFFECT: development of effective method for detecting leptin receptor ligands.

4 cl, 15 dwg, 3 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, specifically to a method of producing recombinant protein human albumin-interleukin-2 or recombinant protein human albumin-alpha 16-interferon, modified by attachment of human albumin. The method involves technology of culturing yeast strain Pichia pastoris PS106/pPIC9HAbIL-2 or yeast strain Pichia pastoris PS106/pPIC9HAbIFNa-16 in modified culture medium BMGY, after which induction synthesis of target proteins is carried out at low temperature. Further, cells are removed and the medium is concentrated. Target proteins are then precipitated using ammonium sulphate or polyethyleneglycol 3350. Target proteins are then separated by gel filtration on Sephacryl HR 200 or BioRad P-300 sorbents. Finally, affinity chromatography is then done on Cibacron F3GA sorbent.

EFFECT: invention simplifies and increases efficiency of the technology of purifying target proteins, and also allows for obtaining biologically active hybrid proteins, suitable for making medicinal agents.

3 cl, 1 tbl, 5 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology, specifically to a method of identifying γ-secretase and its inhibitors and can be used in medicine when searching for active compounds for treating Alzheimer's disease. A genetic structure is formed, which codes fused protein, which contains a signal peptide and amino acid sequence GAIIGLMVGGVVIATVIVITLVML. In the obtained fused protein, except the GAIIGLMVGGVVIATVIVITLVML sequence, all sites acting as a signal for endo- or exocytosis, and/or protease splitting site are excluded.

EFFECT: invention allows for highly effective identification of γ-secretase or substances which inhibit its activity by reducing background signal and increasing specificity of the signal.

41 cl, 4 dwg, 17 ex

FIELD: medicine.

SUBSTANCE: invention concerns medicine and Fc-erythropoietin fused protein with improved pharmacokinetics. Invention claims novel sialylated Fc-EPO fused proteins preferably including modification pair in Fc part, as well as in EPO part, showing improved pharmacokinetics. Particularly, Fc-EPO proteins have longer half-life in blood serum and higher efficiency in vivo. Fc-EPO fused proteins synthesised in BHK cells show much longer half-life in blood serum and higher efficiency in vivo than similar Fc-EPO fused proteins obtained in other cell lines, such as NS/0 cells.

EFFECT: improved pharmacokinetic properties of erythropoietin.

23 cl, 14 ex, 6 tbl, 11 dwg

Fused proteins il-7 // 2369616

FIELD: medicine.

SUBSTANCE: there is provided fused protein, including immunoglobulin chain and the molecule IL-7 or its fragment, displaying activity typical to IL-7, that is modified in comparison with IL-7 of wild type, where modification in IL-7 represents amino-acid residues in positions 70 and 91, that are glycated, and amino-acid residue in the position 116 is nonglycated. There is proposed pharmaceutical composition, containing described protein. There is provided the method fro production of described fused protein, including: host cell transformation by DNA, coding specified fused protein IL-7, host cell culture and collection of fused protein IL-7.

EFFECT: invention can be applied for treatment of disorders, accompanied by immune deficiencies.

27 cl, 16 dwg, 1 tbl, 10 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention pertains to genetic engineering, more specifically to chimeric polypeptides, containing an antagonist of growth hormone receptor. The invention can be used in medicine. The binding domain of the growth hormone is modified by substituting glycine amino acid residue in position 120 and is further modified in site 1, where at least one amino acid residue is substituted, which increases affinity of the growth hormone to its binding domain on the growth hormone receptor. The amino acid residue is then conjugated with the ligand-binding domain of the growth hormone receptor, through a peptide linker.

EFFECT: obtaining a highly effective antagonist of the growth hormone receptor with longer half-life, reduced immunogenesity and nontoxicity, compared to known mutant forms.

35 cl, 16 dwg, 1 tbl

Up!