Treatment, diagnostics or prevention of leishmaniasis caused by various types of parasites, except that one used to produce histones, with using all of four histones h2a, h2b, h3 and h4, recovered from leishmania infantum with using vector containing nucleotides coding specified histones

FIELD: medicine.

SUBSTANCE: invention aims at treatment, diagnostics or prevention of parasitic disease. There is used combination histone proteins H2A, H2B, H3 and H4 recovered from Leishmania infantum for making a pharmaceutical composition and a diagnostic aid. It involves applying a vector containing nucleotides coding specified histones.

EFFECT: invention allows treating and preventing the parasitic disease caused by one type with using histones originated from the other type.

13 cl, 4 dwg, 5 ex

 

The scope of the invention

The present invention relates to the application of histones in the treatment, diagnosis or prevention of parasitic diseases. In particular, this invention relates to the use of one or more of the histone proteins H2A, as H2B, H3 and H4.

Background of invention

Protozoa Leishmania are obligate intracellular parasites that infect cell lines mononuclear phagocytes their vertebrate hosts. These parasites are the causative agents of leishmaniasis, a group of diseases that humans are characterized by a variety of clinical manifestations: from somosaguas skin ulcers, to potentially fatal visceral infections (Herwardt, Lancet (1999) 354: 1191). The development of the disease and the spread of infection vary considerably in different individuals, depending on genetic background and status of the immune system of the infected host. Murine models of cutaneous leishmaniasis is widely used to study the requirements for effective vaccination. Administration to mice of several antigens encoded in DNA vaccines, in some cases, leads to prevention of the disease (reviewed in Handman, Clin. Environ. Rev. (2001) 14:229). Vaccination with DNA encoding the protein GP63, LACK and PSA-2, protects mice from infection L.major (see, for example, Xu et al., Immunology (1955) 84:173). In addition, proven the, that immunization with a combination of plasmids expressing proteins LACK, LmST11 and TSA, is a highly effective when provocative infection low dose L.major (Mendez et al. J. Immunol. (2001) 166: 5122), whereas a mixture of two plasmids encoding cysteine proteinase CPa and CPb, partially protects BALB/c mice with provocative infection high dose of L.major (Rafati et al., Vaccine (2001) 19 (25-26): 3369). Most experimental studies of immunity is limited to laboratory level and experimental animal models. Thus, due to the insufficient number of studies on real organisms-owners, there is no definitive evidence that candidates will be an effective vaccine.

It should be noted that the antigen that produced high titers of antibodies, that is, which is immunogenic, not always and is essentially a protection against disease. In contrast, although some antibody or cellular responses to antigen may be associated with protection, another antibody or cellular responses to antigen may be associated with susceptibility to disease and/or exacerbation of disease. In addition, the protective effect is often necessary adjuvant, due to the fact that the antigens without adjuvant may be generated immune response, but not provided a protective effect. For example, see Stacey and Blackwell (Infect Immun. 1999 Aug; 67(8): 3719-26) who said, that subcutaneous vaccination of mice with only one soluble Leishmania antigen (SLA), the SLA together with alum, or SLA plus not-oligodeoxynucleotide (one), which include immunostimulatory CG motifs (CpG one), leading to aggravation of the disease compared to unvaccinated mice. In mice that received SLA plus one CpG, revealed highly significant protective effect compared with mice vaccinated with SLA, and increased survival compared with unvaccinated mice.

Antigenic diversity among species of Leishmania, allowing species-specific antigenic determinants may be one of the challenges when creating a vaccine based on individual antigens (Handman, 2001, see above). Known DNA vaccines only protect against those kinds of microorganisms, of which these DNA were obtained. Melby and co-authors reported in Infect Immun. (2000) 68: 5595 that immunization using the library of expressed cDNA sequences and sub-libraries that encode proteins of Leishmania donovani, protects mice against VL form of the disease caused by L.donovani. Gurunathan et al., J. Exp. Med. (1977) 186: 1137 reported that vaccination using DNA encoding the immunodominant LACK (the homologue of receptors for activated With kinase from Leishmania) antigen of the parasite L.major, provides protection against Leishmania major. Melby et al. Infect Immun. (2001) 69: 4719 showed that this antigen does not provide the m is our protection against L.infantum. They also reported that, despite the fact that DNA vaccine L.donovani p36 (LACK) is highly immunogenic, it does not protect against the investigated visceral leishmaniasis. This phenomenon, which is immunogenic molecule does not provide protection, i.e. does not resolve the infection or weakening of clinical symptoms, is one of the problems in producing an effective vaccine. If immunogenic or antigenic molecule is always automatically protected, then the vaccine would not be any difficulties. Getting a vaccine that can be used against several types of microorganisms, is even more challenging.

Detailed description

The present invention relates to the use of each of the histone proteins H2A, H2B, H3 and H4 for treatment, diagnosis or prevention of parasitic diseases. In one embodiment, only apply H4. Preferably use two or more of the histones H2A, H2B, H3 or H4, more preferably employ three or more of these histones, it is most preferable to apply all four histones H2A, H2B, H3 or H4.

An advantage of the present invention is that it allows you to get a drug to treat a wide range of diseases, that is, a drug with interspecies specificity. When m is ogic parasitic diseases vaccine inducing antitelomerase against a certain type, only works against a certain type. One example of parasitic diseases in which this occurs is leishmaniasis. Currently, this disease is controlled by medication, but the use of drugs does not prevent spread of the disease and in many cases is not very efficient.

In one aspect of the present invention histones used for obtaining a pharmaceutical composition for the treatment of parasitic diseases.

In one embodiment of the present invention in that the pharmaceutical composition of all histones are present in equimolar amounts. This means, for example, that pharmaceutical preparation comprising H2A and H2B, includes X mol/l H2A and X mol/l H2B.

In another embodiment, the present invention histones in the pharmaceutical compositions not present in equimolar amounts. This means that a pharmaceutical product comprising, for example, histones H2A, H3 and H4 may include X mol/l H2A, X mol/l of H3 and Y mol/l H4; or, for example, X mol/l H2A, Y mol/l of H3 and Z mol/l H4. In a preferred embodiment, the pharmaceutical composition is based mainly on histone H4.

The pharmaceutical composition of this innovation is the invention can be applied to enhance the ability of the immune system of a person or animal to fight infections. In particular, it can be used for introduction into the human or experimental animal. The pharmaceutical composition preferably is injected into the body parenterally, e.g. by injection or infusion by intravenous, intraperitoneally, intramuscularly, intraarterially or inside the lesion. The pharmaceutical composition may be combined with pharmaceutically acceptable medium or carrier by conventional techniques known in the art. Methods of making compositions for parenteral administration are well known in the art and are described in more detail in various sources, including, for example, Remington''s Pharmaceutical Sciences, Ed. AR Gennaro, 20th edition, 2000, Williams & Wilkins, PA, USA. The pharmaceutical composition preferably is introduced in a therapeutically effective dose, i.e. the dose which increases the ability of the immune system of a person or animal to fight infections.

Of particular interest is a pharmaceutical composition, which is a vaccine. The vaccine may be a vaccine on a protein basis. It may include one or more, but preferably two or more of the proteins encoded by genes of the histone H2A, as H2B, H3 or H4. This means that the protein vaccine may be based on, for example, H2A, H2B and H4, or, for example, H2A, H3 or H4 or H2A and H3, or only on H4. In p edocfile embodiment, the vaccine is based on the H4.

The vaccine may also be a DNA vaccine. The DNA vaccine may include a gene of each histone, which is present in the vaccine. For example, a DNA vaccine based on histones H2A, H2B and H3, may include the gene encoding the histone H2A gene encoding H2B, and the gene encoding the histone H3. Alternatively, a DNA vaccine based on histones H2A, H2B and H3, may include two genes, one gene that encodes, for example, both histone H2A and H3, and the other, which encodes a histone H2B. Or it may include one gene that encodes all three histone. In this application such genes encoding several histones, referred to as recombinant genes.

Genes in DNA vaccine in accordance with the present invention is typically present in the vectors. Examples of suitable vectors are well known to the expert from the prior art, see, e.g. Donnelly et al., Ann. Rev. Immunol. (1997) 15: 617, and include, but are not limited to, pcDNA3, and pcCMV.

Histones H2A, H2B, H3 and H4 are very conservative nuclear proteins and their sequences are well known in the prior art, see, for example, Requena et al., Trends in Parasitol. (2000) 16: 246. Therefore, to obtain pharmaceutical compositions, histones H2A, H2B, H3 and H4 can be obtained from any eukaryotic organism, plant or animal, mammals, reptiles, fish, insects, or any other body having a chromosome, for example the EP simplest. Preferably histones obtained from an organism, which is evolutionary close to the body causing disease. Therefore, of special interest as a source of histones used for the treatment of parasitic diseases such as leishmaniasis, are the simplest and, in particular, members of the family of trypanosomatid, such as Plasmodium, in particular different types trypanosomes the simplest Leishmania (Leishmania).

DNA in the vaccine composition may be any DNA, suitable for expression of the protein, for example cDNA or double-stranded DNA (dzanc), but not genomic DNA or single-stranded DNA (IDNC). Can also be a mixture of protein and DNA in one vaccine through simultaneous or sequential introduction of DNA and protein. Can also be used RNA vaccines, although they need stabilizers for stabilizirovannye input RNA.

There are more than 20 known species of Leishmania, including the types of podporou Leishmania containing complex L.major, including L.major, the L.Donovani complex, including L.chagasi, L.donovani and L.infantum, complex L.Mexican, including L.amazonensis and L.mexican, as well as subspecies Viannia containing L.braziliensis, including L.braziliensis and L.peruviana and complex L.guyanensis, including L.guyanensis and L.panamensis. The species of Plasmodium that cause particular interest are Plasmodium falciparum and Plasmodium vivax.

In one embodiment of this is bretania pharmaceutical composition, contains histones from one form, it is used to produce medicines for the treatment of parasitic diseases caused by another type.

In particular, leishmaniasis, caused by one species of the genus Leishmania, can be treated through the use of pharmaceutical compositions based on the histones from other Leishmania species. In one embodiment, leishmaniasis, caused by L.major, successfully treated with a composition containing a histone of L.infantum.

Alternatively, other parasitic diseases such as malaria, can be successfully treated by the pharmaceutical composition based on histones from another species, for example, based on two or more histones H2A, H2B, H3 and H4 of L.infantum.

In another aspect, the invention provides diagnostic tools, based on one or more, but preferably two or more, the histones H2A, H2B, H3 and H4. Diagnostic tools can be a histone proteins that recognize antibodies present in the serum of patients reacts with some or all of the histones. Diagnostic kit containing the histone proteins of the present invention, is also part of this invention. Histone proteins can be each in a separate container. In addition to one or more, but suppose the equipment to two or more, the histones H2A, H2B, H3 and H4, the kit also can contain in a separate container antibodies to these proteins, for example, for the control reactions.

In another aspect the invention provides a method for preventing parasitic infection, functioning as a therapeutic vaccine. Basically there is a period of time between infection and development of disease. In this case, the vaccine could act as pharmacological immune product that could cure a disease causing organism of the host's immune response, which counteracts pathological effects of infection. Therapeutic vaccine differs from preventive vaccine, the fact that a therapeutic vaccine to induce protection in a patient who already has the infection or disease.

Brief description of drawings

1

(A) Immunity in mice vaccinated with three doses of gene pools of histones. Mice BALB/c mice vaccinated with genes of Leishmania histone and control (pcDNA3 or PBS), were provocative vaccination 5×104promastigote L.major, by injection into the pad of the left hind paws.

Swelling of the paws was determined as the difference between the thickness of the pads infected paws and pads opposite uninfected paws. Weekly measurement of the swelling of the paw pads are the scale average in the guises of the edema paw pads ±SD. Provocative immunization L.major from immunized with the DNA of the mice described in two different experiments essentially with the same results. On the fourth week of the differences between the swelling of the paws in the control group and the vaccinated mice were significant (P<0,001).

(B) Parasite burden in the spleen and lymph nodes through eight weeks after infection with the control animals (pcDNA3) and 10 weeks after infection in vaccinated mice (pcDNA3-histones). Cell suspensions were obtained from the popliteal lymph node of infected paw and spleen. The number of viable parasites was determined by the method of serial dilution. The results are expressed as the mean ±SD total number of parasites in tissue (expressed as the decimal logarithm). Differences between control animals and vaccinated mice were accurate and in the spleen and popliteal lymph nodes (P<0,001).

Figure 2. The process of infection of Balb/c mice with virus L.major

(A) animals were immunized with phosphate-saline buffer solution (S) or trained antigen by dendritic cells bone marrow (DKKM). After one month after immunization, the animals were infected with a virus 1000 L.major promastigotes in each ear. Inflammation was determined by measuring the diameter of defeat uh what.

(B) At 10 weeks after infection filling parasites recorded in each ear by serial dilution method.

EXAMPLES

Example 1

Obtaining a DNA vaccine containing the histone of L.infantum.

To determine whether DNA vaccines encoding histones of Leishmania, to protect mice from infection L.major, H2A genes, as H2B, H3 and H4 L.infantum were subcloned into the eukaryotic expression vector pcDNA3 for expression under control of the strong promoter of the cytomegalovirus (CMV). Then the expression of histones of Leishmania has been evaluated in COS7 cells, transformed with constructs pcDNA3. Expression of recombinant proteins in mammalian cells transformed by plasmid DNA is critical for the stimulation of the immune system. Transformed COS7 cells were cultured for 3 days and the expression of histones of Leishmania was assessed by Western blotting.

1.1 Cloning of cDNA in the expression vector pcDNA3 mammalian

For the expression of the four core histones Leishmania infantum in the expression vector pcDNA3 mammalian used four full-length cDNA clone: H2A (clone cL72; Soto et al., Eur. J. Biochem. 1992, 205(1): 211-6); as H2B (clone LiH2B; Soto et al., Clin. Exp. Immunol., 1999, 115(2): 342-9); H3 (clone LiB6; Soto et al., Biochim. Biophys. Acta, 1994, 18: 1219(2): 533-5) and H4 (clone LiH4-1; Soto et al., Clin. Exp. Immunol. 1999, 115(2): 342-9). All of these cDNA clones previously isolated from the Biblio is EKI expressed cDNA sequences L.infantum λgtl1. The EcoRI insert of clone cDNA was subcloned into the corresponding site of cleavage of the expression vector pCDNA3 mammalian. DNA samples of these recombinante plasmid pcDNA3 was purified by using a free of endotoxins set Giga-preparation Kit (Qiagen, Hilden, Germany).

1.2 Expression of histones of Leishmania in mammalian cells

To confirm that the design DNA was functional and expresses mentioned proteins, COS7 cells transformed 20 µg of each design pcDNA3 obtained in section 1.1, using the reagent Lipofectin® (Gibco, BRL), in accordance with the Protocol of the manufacturer. 3×106cells were sown on a 100 mm die in a modified method of Dulbecco Wednesday Needle with the addition of 5% FCS and transformed when reaching 50-75% confluence. 72 hours after the transformation, the cells were collected, washed twice in ice-cold PBS and immediately literally by adding buffer laemmli's method. Protein obtained from equivalent numbers of cells were separated by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate (SDS-PAGE) and transferred to nitrocellulose membranes (Amersham, Aylesbury, UK). The blots were investigated sera of dogs suffering from visceral leishmaniasis (VCL), purified by affinity chromatography against proteins as H2B, H3, H4 immobilizovannoi phase, or with sera of rabbits, immunodeficiency, yserowanej GNU.

The results showed that the transformed cells expressed detectable levels of proteins H2A, as H2B, H3 and H4.

1.3 Cloning into the expression vector pQE30

For expression as recombinant proteins, histone L.infantum coding region genes were amplified by PCR, was used as a matrix constructs pcDNA3 of section 1.1, and the primers used the following nucleotide sequence:

for H2A gene (forward 5'-CGGGATCCATGGTACTCCTCGCAGC-3' (items 1-17 coding region); reverse 5'-CCCAAGCTTACGCGCTCGGTGTCGCCC-3' (reverse and complementary to the positions of the coding region));

for as H2B gene (forward 5'-CGGGATCCGCCTCTTCTCGCTCTGC-3' (items 1-17 coding region); reverse 5'-CCCAAGCTTCAAGCCGACGCGCTCGACAC-3' (reverse and complementary to the positions of the coding region));

for H3 gene (forward 5'-CGGGATCCATGTCCCGCACCAAGGAGA-3' (positions 1-19 coding region); reverse 5'-CCCAAGCTTCTAGTGGCGCTCACCGCGCA-3' (reverse and complementary to the positions of the coding region)); and

for H4 gene (forward 5'-CGGGATCCATGGCCAAGGGCAAGCGTT-3' (positions 1-19 coding region); reverse 5'-CCCAAGCTTACGCGTAGCCGTACAGGA-3' (reverse and complementary to the positions of the coding region).

The underlined nucleotides indicate the sites of cleavage by restrictase BamHI and HindIII, is included to ensure the cloning of PCR products into the expression vector pQE30 (Qiagen, Hilden, Grmany). The resulting clone is designated as PQE-H2A, pQE-H2B, pQE-H3 and pQE-H4.

1.4 Expression and purification of recombinant proteins, labeled with His

Expression and purification of recombinant proteins, labeled His, was carried out in Escherichia coli M15, using standard procedures (Qiagen). After induction of protein the bacteria were collected and destroyed by ultrasonic treatment under denaturing conditions (8 M urea, 0.5 M NaCl, 20 mm Tris-HCl). The protein purification was performed on agarose column (NI-NTA (Qiagen). Recombinant protein fraction was placed on a column for affinity chromatography, as described (Shi, 1997). Then the recombinant proteins were suirable of 0.3 M imidazole. After elution fractions containing recombinant histones, United and spent dialysis with PBS. Purified protein was additionally passed through a polymyxin-agarose column (Sigma, St Louis, MO) in order to eliminate endotoxins. Residual endotoxin was determined by quantitative chromogenic analysis Limulus Amebocyte (QCL-1000, BioWhittaker, Walkersville, MD).

Example 2. Immunogenetic characteristics of DNA vaccines

2.1 Obtaining General Leishmania antigen (SLA)

Soluble Leishmania antigen (SLA) was obtained by three cycles of freeze-thawing still promastigote L.major, resuspending in PBS. After cell lysis, soluble antigens were separated from insoluble practitionersthe centrifugation.

2.2 Immunization and provocative immunization with parasite

Experiments on immunization was performed in groups of ten mice. Mice three times with an interval in 2 weeks intramuscularly in the quadriceps muscles of both hind limbs were vaccinated with 50 μg (25 μg in each limb) of each of the plasmid DNA (pcDNA3-H2A, pcDNA3-H2B, pcDNA3-H3 and pcDNA3-H4)obtained in section 1.1 in a total volume of 100 μl PBS. Control mice in the same mode vaccinated, but at 200 µg pcDNA3 each vaccination or only PBS. Fourteen days after each vaccination mice were bleeding through the puncture orbital plexus. Four weeks after the final vaccination was received spleen and lymph nodes (LN) from immunized mice, in groups of five immunized mice were immunized with 5×104cultured fixed promastigote by injection pads rear left paw. Swelling of the paws was measured weekly and was defined as the difference between the thickness of the pads infected paws and pads opposite the control paw.

2.3 Determination of titers and isotypes of antibodies

Samples of blood serum was analyzed for specific antibodies against Leishmania histone. On standard tablets for ELISA was applied 100 μl GNA, GNB, GN and GN (1 μg/ml in PBS) or SLA (2 μg/ml in PBS) and incubated at the room for the Noah temperature during the night. Performed serial dilutions of the sera to determine the titer, defined as the reciprocal of the highest dilution factor of the serum, when this absorption >0,2. The isotype-specific analyses were performed with the following conjugated with horseradish peroxidase artemisinine immunoglobulins (Nordic Immunological Laboratories, Tilburg, The Netherlands): anti-IgG1 (1:1000) and anti-IgG2 (1:500). As a substrate for peroxidase is used ortofena the diamine dihydrochloride-OPD- (Dako, A/S, Glostrup, Denmark). After 15 minutes the reaction was stopped by adding 100 μl of 1 M H2SO4and measured the absorbance at a wavelength of 450 nm.

2.4 Determination of cytokines in supernatant

The release of IFN-γ and IL-4 were determined in supernatant cultures of splenocytes and LNC. Spleen and lymph nodes were removed from BALB/c mice under aseptic conditions after dislocation of the cervical spine. Suspensions of splenocytes and cells from lymph nodes were sown in complete RPMI medium (RPMI 1640 with the addition of 10% FCS, 2 mm glutamine, and 10 mm 2-mercaptoethanol). 3×106cells were sown in a 48-hole plates and incubated 72 hours at 37°C in the presence of GNA, GNB, GN and GN (12 µg/ml), histone from calf thymus (SIGMA) or Con A (2 μg/ml). The production of cytokines was determined using a commercial ELISA kit (Diaclone, Besancon, France).

2.5 Quantitative determination of p is race

The number of parasites was determined in the popliteal lymph nodes of infected feet and in the spleen by serial dilution (Buffet, et al., 1995). Tissue is homogenized and serially diluted in 96-well flat-bottomed microtiter tablet containing environment Schneider and 20% FCS. The number of viable parasites in the lymph node was determined based on the highest dilution at which promastigotes could grow up to 7 days of incubation at a temperature of 26°C.

2.6 Statistical analysis

Statistical analysis was performed using t-student criterion. Differences were considered significant at p<0,05.

2.7 Immune response after vaccination with a DNA vaccine

To study immunogenetic properties cDNA, BALB/c mice were immunized intramuscularly two or three times every two weeks with the mixture obtained in section 1.1 of the four plasmids encoding the histone Leishmania infantum (50 μg of each cDNA). Antibodies specific for these antigens was assessed 2 weeks after the last immunization. After two vaccinations by ELISA was not identified specific antibodies, whereas IgG antibodies was detected in low titers after the third vaccination. Predominant in all cases, the isotype of the antibodies was IgG2a. Only minor production of IgG1 antibodies were also detected against a guy who tones H2A and H4.

2.8 T-cell response after vaccination with a DNA vaccine

To measure T-cell response after vaccination mononuclear cells of spleen cells and lymph nodes (LNCs) received 4 weeks after the last DNA immunization and stimulated in vitro with recombinant proteins, obtained in section 1.4. After 3 days incubation collected supernatant and analyzed and IFNγ, and IL-4.

It was noted that we immunized mice with recombinant histone proteins stimulated the production of IFN-γ in larger quantities and in splenocytes and cells LNC, than was found in control mice. Histone-specific production of IL-4 was not defined in supernatant all cultures.

2.9 Analysis of IL-12-based

For a more detailed characterization of the immune response, established in mice by DNA vaccination genes histone L.infantum and its change after immunization L.major, investigated the antigen-specific production of IFN-γ in splenocytes of vaccinated mice. Twenty-five days after infection L.major splenocytes of vaccinated mice continued to produce more histone-specific IFN-γ than splenocytes of control mice. Interestingly, the production of IFN-γ-mediated SLA was 2 times higher in splenocytes of vaccinated mice compared to control animals. Because IL-12-dependent is radoccia IFN-γ is the main mechanism, associated with L.major infection control, defined, do significantly inhibits add to the culture of anti-IL-12 monoclonal antibodies production of IFN-γ in splenocytes of vaccinated mice. It was found that the inhibition of the production of IFN-γ was more than 80% used for four different stimuli (histones H2A, as H2B, H3 and H4 L.infantum). This means that the histone-specific production of IFN-γ is IL-12 dependent and, moreover, that in vitro production of IL-12 also stimulates the splenocytes by histones of Leishmania.

2.10 the Involvement of CD4+ and CD8+ T cells in the production of IFN-γ

Were defined relative contributions of CD4+ and CD8+ T cells in the production of IFN-γ. Mediated stimulation histones production of IFN-γ in splenocytes in all groups was significantly ingibirovany adding to the culture of anti-CD4 monoclonal antibodies. However, the addition in culture of anti-CD8 monoclonal antibodies induced a decrease in the secretion of IFN-γ only in the splenocytes of vaccinated mice and stimulated in vitro by any histone H2A or H3. Thus, DNA vaccination with genes encoding histones H2A and H3 Leishmania, is more Primerose CD8 cells than the other two genes histone (as H2B and H4).

Finally, to provide further understanding of the immune status associated with immunity established in mice by DNA vaccine is AI genes, encoding the histone L.infantum, the frequency of production of IFN-γ CD4+ and CD8+ T-cells in LNC was determined by intracellular staining of cytokines at the end of the studies of immunity (8 control mice and 10 vaccinated mice). The frequency of production of INF-γ and CD4+and CD8+ T-cells was higher in vaccinated mice compared to control animals. Thus, these data are direct evidence that immunity against L.major infection achieved by DNA vaccination with Leishmania histone has a correlation with the increased frequency of production of IFN-γ by T-cells (CD4+ and CD8+).

These results are consistent with a predominance of IgG2a antibodies in the blood serum of immunized mice, and indicate that DNA immunization genes histone H2A, as H2B, H3 and H4 preferably causes a Th1-like immune response against these antigens. Additional control experiments (see Example 3) were to show that these genes also produce a preventive effect.

Example 3. Immunity against Leishmania major induced DNA vaccines encoding the histone Leishmania infantum

Because immunogenicity studies revealed that DNA immunization histones initiates the induction of specific Th1-like immune responses, then, the question was raised whether the scheme cDNA immunization using H2A genes, as H2B, H3 and H4 to ensure amisha immunity against L.major infection.

3.1 DNA vaccine encoding the histone L.infantum, protects against L.major infection.

Groups of seven mice BALB/c two or three times with an interval of two weeks intramuscularly vaccinate using 50 μg of each of the histone DNA structures obtained in section 1.1. The control animals in the same way vaccinate using 200 μg empty vector used for cDNA cloning of genes of histones, or vaccination only using PBS. Four weeks after the last DNA immunization the mice pad left paws conducted provocative immunization by injection of cultured with 5×104forms still promastigote L.major obtained in section 2.1. Swelling of the paws was measured weekly.

The results presented in figa show that DNA vaccination with genes histone induces immunity against infection, while immunization with only one vector does not induce. The authors of the present invention was detected in vaccinated mice explicit delay in the development of the edema paw pads. In all cases, the immunized mice were observed more adjustable inflammation (about 1 mm on the eighth week after infection)than in control animals (about five mm in the same week). Four of seven mice during infection were not observed for any damages the rd. This experiment was replicated with similar results.

3.2 Parasite load in the spleen and lymph nodes after immunization with DNA vaccine encoding the histone

To determine whether there is a correlation between decrease swelling pads paws and parasite load in the spleen and popliteal lymph nodes of mice painlessly cut: the group immunized mice 10 weeks after infection, and the control group at 8 weeks after infection. In vaccinated mice was observed significantly reduced parasitic load as compared to that detected in control animals (pigv). It is noteworthy that the distribution of the parasite in the internal organs in the control group was observed uniformly (pcDNA3), while the vaccinated mice parasitic load was low, and in some cases, parasites were not identified. All these results indicate that the vaccinated mice cutaneous leishmaniasis induced L.major, is adjustable.

Example 4. Immunization histones in individual form

In the previous examples show that the injection of a mixture of DNA of eukaryotic expression plasmid pcDNA3 containing the genes for histones Leishmania infantum (H2A, as H2B, H3 and H4) mice BALB/c mice resulted in specific Th1 immune response, which entails controlinveste L.major. In this example examined the effects of genetic immunization one of these pcDNA3 encoding nucleosomal H2A, as H2B, H3 and H4, applied separately. Experimental conditions were as described above.

The results show that in all cases the introduction of each histone pcDNA3 induces increased and IL-4 and IL-10 Th2 cytokines through 9 weeks after infection L.major, with a concomitant lower humoral response against soluble Leishmania antigen SLA, and limited humoral response against histones (with a predominance of IgG2a antibodies), compared to control mice immunized with empty pcDNA3. In addition, the results of the analysis of the proliferation of splenocytes in mice of the control group show the presence of suppressed cellular immune response to Con A, LPS and SLA. In the course of infection in vaccinated mice was observed delay the swelling of the paws and lower parasitic load in the popliteal lymph nodes, compared with the control mice. In conclusion, the introduction of each histone pcDNA3, coding nucleosomal histones Leishmania, reduces Th2-driven immunity induced by L.major infection, leading to low production of IL-4 and IL-10 in the spleen and low humoral response that is correlated with immunity against murine cutaneous leishmaniasis. The results also show that among Leishmania histone D Is K-immunization with histone H4 is the most effective for induction of protective immunity against cutaneous leishmaniasis.

Figure 2 the Process of infection of Balb/c mice with virus L.major

(A): animals were immunized with phosphate-saline buffer solution (PBS) or trained antigen by dendritic cells bone marrow (DKKM). After one month after immunization, the animals were infected with a virus 1000 L.major promastigotes in each ear. Inflammation was determined by measuring the diameter of the lesion of the ear.

(B) At 10 weeks after infection filling parasites recorded in each ear by serial dilution method.

PBS: phosphate-saline buffer solution

Lm: full parasite proteins from L.major

CpG: Oligodeoxynucleotides with CpG motifs

HIS: histone Proteins

HIS-BMDC: dendritic cells, trained histones

HISCpG-BMDC: dendritic cells, trained histones + CpG

Lm-BMDC: dendritic cells, trained proteins L.major

LmCpG-BMDC: dendritic cells, trained proteins L.major+CpG.

CpG-BMSC: dendritic cells, trained CpG.

Example 5

In this Example, it is shown that dendritic cells in the bone marrow (DKKM)loaded with Leishmania infantum of histone proteins in the absence or presence of CpG motifs provides protection against experimental infection with Leishmania major.

Materials and Methods

Mice and parasites L.major.

Six to eight-week mouse Balb/c mice were kept under normal conditions. Parasites L. major (clone VI: MHOM/IL/80/Friedlin) were cultured in tempera is ur 26°C in the environment Schneider (Gibco, BRL). Metacyclic promastigote were obtained as described previously (1). Used one CpG ((5'-TCAACGTTGA-3' and 5'-GCTAGCGTTAGCGT-3') were previously described (1). L.major Ag (Lm)used for stimulation culture DKKM was made of stationary kulturserver promastigotes, as previously described (2, 3).

Expression of Histone

Four core histone L.infantum (H2A, as H2B, H3 and H4) were obtained as recombinant proteins, following a previously described method (4).

Getting DKKM

DCM were obtained and cultured following a previously described method (1, 2). After 7 days the phenotype of activated DC was evaluated based on 220V", SW-, CD1 1C+, CD40+, CD80+and CD86+the expression. Cells were re-resuspendable at 1×106millifarad1in culture medium containing 20 nanograms colony-stimulating factor macrophage granulocyte (G-CSF) (PeproTech, London, UK). Two groups were grown for 18 hours with Lm (equivalent to 30 parasites per cell) in the absence or presence of CpG (25 micrograms millifarad1). Another group of cells was grown with a mixture of histones H2A, as H2B, H3 and H4 (HIS) L.infantum (2 micrograms millifarad1for each histone) in the absence or presence of CpG. The last group of cells was grown only with CpG.

Detection of parasites

Caseload parasites was determined by the ü damage to the ear and spleen after 10 weeks after infection. In addition, in re-infected mice, the number of parasites was analyzed related to one side of the body popliteal-DLN 10 weeks after re-infection is extremely dissolved in culture (5). The areas of the pads of the feet and ears were obtained from infected BALB/c and C57BL/6 mice, respectively. Ventral and dorsal layers of cells infected ears were separated. The areas of the pads of the foot and the layers of the ears were placed in a modified method of Dulbecco environment Needle containing a mixture of enzyme Liberase CI (50 ml fig-1). After 2 hours incubation at 37°C tissue were cut into small pieces, homogenized and filtered through cell strainers (7th pore size). Gomogenizirovannogo tissue was serially diluted in 96-well flat-bottomed plate microtitre containing environment Schneider plus 20% calf serum (FCS) or two-phase medium prepared using 50 microliters environment NNN containing 30% defibrinating blood rabbit and covered 50 Microlitre M199/S, as previously described. The number of viable parasites was determined from the weak solution in which promastigote can grow up to 7 days of cultivation at a temperature of 26°C. In the ear and LN filling parasites expressed as the number of parasites in the whole body. In the ball of the foot filling parasites exp is low as the number of parasites per mg of tissue.

Infection and adoptive transfer DCM (dendritic cells of bone marrow). DKKM were washed and brought to 5×106mg1100 Microlitre phosphate-saline buffer solution (PBS) for intravenous transfusion in lateral Vienna tail intact recipient BALB/c mice from all experimental groups in=8). Control mice were inoculated with PBS. After one month after adoptive transfusion recipient BALB/c mice did intradermal inoculation of 1×103promastigote L.major in each ear. The infection process was monitored weekly: measured increase the damage of the ear, or tumors of the foot pad in the case of re-infected animals.

Results

After one month after a single intravenous injection of either PBS (control), CpG-pulsed BMDC, Lm-pulsed BMDC, Lm+CpG-pulsed BMDC, Histones-pulsed BMDC or Histones+CpG-pulsed BMDC, the animals were subcutaneously subjected to control infection 1000 parasites L.major in each ear. Mice vaccinated with CpG-pulsed or Lm-pulsed BMDC showed damage to the ear and the local load parasites, similar to what was observed in the control specimens mice (figa). However, the introduction of Histones-pulsed BMDC gave protection against the control L.major infection. In addition, mice vaccinated with either Lm+CpG or Histones+CpG-pulsed BMDC were able to control the infection, and they had developed a very small skin damaged the I (figa). The load of parasites in the ear and spleen of control mice vaccinated with CpG-pulsed and Lm-pulsed BMDC, was not significantly different from what was defined as 10 weeks after infection (pigv). A significant reduction (P<0.05) in the load of parasites in the ear was observed in mice inoculated Lm+CpG-pulsed, Histones and Histones+CpG-pulsed BMDC. In the spleen of mice grafted Lm+CpG, Histones+CpG and Histones-pulsed BMDC, no parasites were not detected (ND).

In conclusion, these data indicate that immunization with a single dose of Lm+CpG, Histones+CpG or Histones-pulsed BMDC able to stimulate protection against L.major infection in BALB/c mice.

List of publications:

1. S.Iborra, J.Carrion, C.Anderson, C.Alonso, D.Sacks and M.Soto, Vaccination with the Leishmania infantum acidic ribosomal PO protein plus CpG

oligodeoxynucleotides dosage protection against cutaneous Leishmaniasis in C57BL/6 mice but does not prevent progressive disease in BALB/c mice. Infect. Immun. 73 (2005), pp.5842-5852.

2. J.R.Ramirez-Pineda, A.Frohlich, C.Berberich and H.Moll, Dendritic cells (DCS) activated by CpG DNA ex vivo are potent inducers of host resistance to an intracellular pathogen that is independent of IL-12 derived from the immunizing DC, J.Immitnol. 172 (2004), pp.6281-6289

3. Scott, E.Pearce, P.Natovitz and A.Sher, Vaccination against cutaneous leishmaniasis in a murine model. I. Induction of protective immunity with a soluble extract of promastigotes, J.Immunol. 139 (1987), pp.221-227.

4. S.Iborra, M.Soto, J.Carrion, C.Alonso and J.M.Requena, Vaccination with a plasmid DNA cocktail encoding the nucleosomal histones of Leishmania confers protection against murine cutaneous leishmaniosis. Vaccine 22 (2004), pp.3865-3876.

5. P.A.Buffet, A.Sulahian, Y.J.Garin, N.Nassar and F.Derouin, Culture microtitration: a sensitive method for quantifying Leishmania infantum in tissues of infected mice, Antiicrob. Agents Chemother. 39 (1995), pp.2167-2168.

1. Use all four Leishmania histone H2A, H2B, H3 and H4, obtained from Leishmania infantum, to obtain drugs for treatment or prevention of leishmaniasis, where leishmaniasis is caused by various types of parasites, in addition to the form from which the histones.

2. The use according to claim 1, where parasitic disease caused by parasites of the species Leishmania major.

3. The use according to claim 1, where each histone is present in equimolar amounts.

4. The use according to claim 1, where the drug is a vaccine.

5. The use according to claim 4, where the vaccine is a vaccine on the protein basis.

6. The use according to claim 4, where the vaccine is a DNA vaccine, which includes genes encoding histones H2A, H2B, H3 and H4.

7. The use according to claim 6, where one or more genes of histones H2A, H2B, H3 and H4 are built into one or more vectors.

8. The use according to claim 6 or 7, where the vaccine comprises a recombinant gene that encodes two or more histones.

9. The use of a vector containing a nucleotide encoding the Leishmania histone H2A, H2B, H3 and H4, obtained from Leishmania infantum, to obtain drugs for treatment or prevention of leishmaniasis, where leishmaniasis is caused by various types of parasites, in addition to the form from which the histones.

10. Pharmaceutical composition for treatment or is the avoiding of leishmaniasis, includes all the Leishmania histone H2A, as H2B, H3 and H4, obtained from Leishmania infantum, or genes encoding these histones, in addition to pharmaceutically acceptable adjuvant and/or media, where leishmaniasis is caused by various types of parasites, in addition to the form from which the histones.

11. Diagnostic tool for the diagnosis of leishmaniasis, including all the Leishmania histone H2A, as H2B, H3 and H4, obtained from Leishmania infantum, where leishmaniasis is caused by various types of parasites, in addition to the form from which the histones.

12. Use all four Leishmania histone H2A, as H2B, H3 and H4, obtained from Leishmania infantum, for the manufacture of a diagnostic agent for the diagnosis of leishmaniasis, where leishmaniasis caused by various kinds, in addition to the species from which is obtained the histones.

13. The use of a vector containing a nucleotide encoding the Leishmania histone H2A, as H2B, H3 and H4, obtained from Leishmania infantum, for the diagnosis of leishmaniasis, where leishmaniasis is caused by various types of parasites, in addition to the form from which the histones.



 

Same patents:

FIELD: medicine.

SUBSTANCE: to detect or chrysanthemum virus B in plants, a diagnostic set containing polyclonal antibodies to protein of Chrysanthemum virus B shell, a conjugate marked with alkaline phosphatase, a fixing buffer; an extraction buffer, ECI-buffer and PNP-buffer is used. Protein of viral shell is produced by amplification of the purified gene of said protein with using a nonsynonymous primer ATGCCTCCCAAACCGGCACCAGGTGAT and synonymous primer TTTATAATGTCTTATTATTCGCAT.

EFFECT: improved antiviral action of the compound.

15 cl, 2 ex

FIELD: medicine.

SUBSTANCE: there is used for diagnostics of transient and persistent latent papilloma virus infection. The diagnostic technique for papilloma virus infection is ensured by history taking and integrated clinical-laboratory examination. As anamnestic signs, there are assumed compromised oncologic characteristics inheritance, early sexual life, age younger than 20 years old and promiscuity; as clinical - anogenital warts, erosion and ectopic neck of uterus, contact hemorrhagic diathesis, Ovuli nabotti, inflammatory diseases of small pelvis organs and intrauterine spiral. Herewith the laboratory signs are sexually transmitted diseases, mixtinfection, deficient lactic acid bacilli, vaginal disbiosis caused by conditional-pathogenic flora, bacterial vaginosis, virus-virus associations, urogenital herpes, urogenital mycoplasma infection, urogenital ureaplasma infection, urogenital candidiasis, urogenital Chlamidia infection and infection with various genotypes of human papilloma virus. Each sign is scored, and depending the number of points, persistent or transient clinical course of papilloma virus infections, or follow-up examination is performed.

EFFECT: determining tactics of the following management of the patient, forming group of potential risk for development of focal dysontogenetic and malignant transformations of urogenital epithelium.

1 dwg, 2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, particularly to laboratory examinations and can be used in selection of therapeutic approach to tonsillitis. The method involves microbiological study of tonsil lacunae contents. It involves detection of microorganism types and concentration. And if the association shows one or more microorganisms which are not normal tonsil lacuna inhabitants in concentration ≥105 CFU/ml, photodynamic therapy is predicted to be inefficient. The fact that test object is microflora enables to determine an etiological agent, as well as degree of activity of inflammatory process whereat photodynamic therapy aims.

EFFECT: method allows determining objective indications for photodynamic therapy in chronic tonsillitis that ensures more effective treatment of the patients.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine and can be used for express-estimation of severity of state of patient with burn disease. Laboratory analysis is carried out, degree of natural colonisation of buccal epithelium cells with bacteria Streptococcus salivarius, average number of bacteria Streptococcus salivarius adhesed on one buccal epithelium cell - index of natural colonisation of buccal epithelim cells (INCBEC), and if INCBEC value is greater than 10, conclusion about light degree of severity of patient's with burn disease state is made, of INCBEC value is from 5 to 10 - about medium degree of severity of patient's with burn disease state is made, and if INCBEC value is lower than 5 - about severe degree of severity of patient's with burn disease state.

EFFECT: method is simple in realisation, takes little time, non-traumatic, eliminates risk of infection.

3 ex

FIELD: chemistry.

SUBSTANCE: description is given of polyaniline in form of an emaraldine base of formula [(-C6 H4-NH)2-(NH=C6·H4=NH-)]n n=20 to 10000 or interpolymer of a complex of polyaniline with poly-(2-acrylamido-2-methyl-1-propane-sulphonic acid), i.e. salt of emaraldine with poly-2-acryloamido-2-methyl-1-propane sulphonic acid of formula , n=50 to 50000 as a sorbent for removing viruses, non-viral proteins and for making an immunoasorbent based on said sorbent for isolating antiviral antibodies.

EFFECT: following methods are also described: method of removing viruses through immobilisation on a sorbent; immunoadsorption method; method of sorption of non-viral proteins from complex mixtures using sorbent.

20 cl, 2 ex, 4 tbl, 2 dwg

FIELD: veterinary.

SUBSTANCE: claimed is test-system of immuno-enzyme analysis, which allows to determine antibodies to viruses of infectious rhinotracheitis (IRT), viral diarrhea-disease of mucous membranes (VD-DMM), parainfluenza viruses -3 (PIV-3), respiratory syncytial (RS) and adenoviral (AVI) infections of livestock. Serological examination of animals allows to detect zones of infection spreading and estimate post-vaccination immunity.

EFFECT: application of claimed test-system IEA will allow to carry out simultaneously epizootological monitoring of five important infections of livestock, retrospective diagnostics of respiratory infections, and estimation of immunity stress in animals resulting from application of vaccines, determination of level of colostral antibodies in young animals in the first weeks or days of life, estimation of therapeutic medicine quality.

10 tbl

FIELD: medicine.

SUBSTANCE: invention concerns medicine, namely to laboratory diagnostics of human tularemia and concerns differentiation of infectious and postvaccinal antibody response at human tularemia. The essence of the invention consists that as an antigenic preparation in addition to LPS Fransicella tularensis in a dot blotting in parallel LPS Fransicella novicida is used. For this purpose LPS preparations are preliminary allocated from corresponding strains which are dissolved in the distilled water and applied on a nitrocellulose membrane in volume 1 mcl from the 1-5 mg/ml solution, with the subsequent processing by a buffering normal saline solution at pH 7.0-7.1 with 1% bull seralbumin and 0.5% twin 20 within one hour. After that the filters are washed out and incubated in the investigated serum dissolved not less than 1:100, within an hour at temperature of 37°C, then the samples are washed three times, also presence of complexes an antigen-antibody is revealed by a withstanding within 1 hour at a room temperature in a working solution of protein A, labelled with horse-radish peroxidase, with the subsequent washing up and placing in a painting solution, thus the account and an estimation of results are spent on presence of two brown maculae on a place of drawing of LPS F.tularensis and LPS F.novicida preparations which presence testifies to infectious process at the investigated patient, and at vaccinal process one maculae on a drawing place only LPS F.tularensis is observed.

EFFECT: advantage of the invention consists in simultaneous revealing infectious and postvaccinal antibody responses.

3 ex

FIELD: medicine.

SUBSTANCE: invention refers to mycoplasmoses laboratory diagnostic techniques and can be used in veterinary medicine. Method for making erythrocytic disgnosticum for indirect hemagglutination reaction (IHR) in pig's mycoplasmosis consists from fractional formalinisation of sheep's erythrocytes and sensitisation with mycoplasmosis antigen at 70°C within 30 minutes. And for sensitisation, erythrocytes are used being loaded with sensitine made of mixed mycoplasma cultures (M.hyosynoviae, M.hyorhinis and Ureaplasma sp.) taken in equal proportions and heated on water bath at 70°C within 30 minutes. Thereafter the diagnosticum is triply washed with a phosphate-buffer salt solution with PH-7.2.

EFFECT: higher specificity and activity of erythrocytic disgnosticum in indirect hemagglutination reaction (IHR) in pig's mycoplasmosis.

3 tbl

FIELD: medicine.

SUBSTANCE: method of preparing diagnostic agglutinating serum for pathogenic Yersinia strains involves hyperimmunisation of rabbits with antigen representing 0.4-0.6% formalin inactivated antigen (pYV+) of Yersinia enterocolitica My 03R strain into auricular cranial vein. Immunisation of rabbits with said antigen is fourfold in dosage as follows: 290-310 million kl/ml, 490-510 million kl/ml, 0.99-1.1 billion kl/ml and 1.9-2.1 billion kl/ml, respectively with dosage interval 6-7 days. Further the producer is examined for immunogenic properties. Serum separated from the sampled blood is preserved.

EFFECT: method ensures preparation of high-quality agglutinating serum used in yersiniosis diagnostics in animals.

3 ex

FIELD: medicine.

SUBSTANCE: invention relates to obtaining mycoplasmosis diagnostic serums for diagnosis of mycoplasmoses in pigs in indirect immunofluorescence reaction. Method includes use of antigens from three mycoplasma cultures - Mycoplasma hyosynoviae, M. hyorhinis and Ureaplasma sp.B which are used for rabbit hyperimmunisation during 21 days by divided intravenous antigen introduction every three days with triple application of immunostimulator levomisol. Antibody synthesis dynamics is studied on 7, 14 and 21 day after first antigen introduction in indirect immunofluorescence reaction (IIFR). Reaction is carried out according to conventional methodology. Four-cross system is used for reaction estimation. It has been established that on the 7-th day after first antigen introduction antibodies in IIFR were detected in low titers 1:10-1:20. On the 14-th day positive reaction in IIFR was at higher dilutions within 1:320-1:640, and on the 21-st day antibody synthesis reached maximal level 1:640-1:1280.

EFFECT: obtaining anti-mycoplasmosis serums in higher diagnostic antibody titers, reduction of hyperimmunisation terms and possibility to use obtained serums for diagnosis of mycoplasmoses in pigs in IIFR.

5 tbl

FIELD: medicine.

SUBSTANCE: agent possesses antiprotozoal activity to Trichomonas vaginalis. The medicinal agent possessing antiprotozoal activity to Trichomonas vaginalis in a model system in vitro, represents a pine chlorophyll-carotene paste that shows trychomonadocidal and trychomonadostatic properties, and inhibits growth of Trichomonas vaginalis if used in certain concentration.

EFFECT: effective antiprotozoal activity to Trichomonas vaginalis in a model system in vitro.

4 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to the bonds consistent with the general formula (I) or the general formula (II) where: R1 = H; Z = O or S; P1 = CR5R6, P2 = CR7R8, Q = CR9R10; each of R5, R6, R7, R8, R9 and R10 denotes H; Y = CR12R13-CO, where R12, R13 is selected from C0-7-alkyl; C3-6-cycloalkyl or phenyl-C0-7-alkyl; and where the phenyl ring doesn't have to be substituted R19, specified below; in the group (X)0, X = CRI4R15, where R14 and R15 are independently selected from C0-7-alkyl, and o represents a number from zero to three; (W)n, W = O, S, C(O), S(O) or S(O)2 or NR16, where R16 denotes H, and n equals zero or one; (V)m, V = C(O), NHC(O), C(O)NH or CR17R18, where R17 and R18 denotes H, and m represents a number from zero to three, on condition that, when m is more than one, (V)m contains a maximum of one carbonyl group; U = a stable 5-7-member monocyclic or 8-11-member dicyclic ring, which is saturated or non-saturated and which has from zero to four heteroatoms selected from: , where R19 represents: C0-7-alkyl, C3-6-cycloclkyl, Ar-C0-7-alkyl, O-C0-7-aklyl, NH-C0-7-alkyl, N(C0-7-alkyl)2, O-phenyl, S-phenyl; or, as a part of CHR19 or CR19 group, R19 can represent a halogen; where Ar represents a stable 5- or 6- member monocyclic or stable 9- or 10- member dicyclic ring, which is unsaturated as determined earlier for U, and where Ar doesn't have to be substituted R19, which is of importance specified above; C0-7-alkyl represents a stable linear or a branched aliphatic carbon chain, which contains from 0 to 7 carbon atoms, which doesn't have to be substituted with one, two or three halogen atoms and doesn't have to contain one or few heteroatoms selected from O, N and S, where the heteroatom is present only when C0-7-alkyl contains as a minimum one carbon atom; C3-6-cycloalkyl relates to C0-7-alkyl, certainly higher than the additionally contained carboxyl ring, which doesn't have to be substituted with one or more halogens, selected from F, Cl, Br and I or heteroatoms, selected from N, O, S; A represents O; B, D and G are independently selected from: CR19, where R19 is as specified above or N; E represents O or S; J, L, M, R, T, T2, T3 and T4 which are independently selected from: CR19 and N, where R19 is as specified above; T5 represents N; q represents a number from one to three, determining in this way a 5-, 6- or 7- member ring or its salt, hydrate or solvate. The bonds of the general formula (I) or the general formula (II), represent cruzipain inhibitors and inhibitors of other cisteinproteases and can be used as therapeutic agents, for example, in cases of Chagas disease or for confirmation of target oriented therapeutic bonding.

EFFECT: new bonds which posses helpful biological properties have been discovered.

27 cl, 156 ex, 2 tbl

FIELD: veterinary medicine, pharmacology.

SUBSTANCE: invention represents injection antiparasitic medicinal agent containing diminazene salts as an active substance and can be used in treatment and prophylaxis of parasitic diseases. Injection medicinal formulation used for treatment and prophylaxis of blood-parasitic and invasion diseases and comprising diminazene as an active substance, organic solvent, stabilizing agent and preserving agent involves additionally a surface-active substance as a solubilizing agent and distilled water as a co-solvent and wherein poly-(1-vinyl-2-pyrrolidone) is used as a stabilizing agent wherein components are taken in the following content, wt.-%: active substance, 1-20; organic solvent, 10-50; co-solubilizing agent, 1-20; stabilizing agent, 1-20; preserving agent, 0.01-1, and co-solvent, up to 100. Proposed medicinal formulation comprises diminazene benzoate or diminazene adipate, or diminazene nicotinate as an active substance. "Cremofor EL" or "Cremofor ELP" (polyoxyethylene-glycerol-trihydroxystearate), or "Tween-80" (polyoxyethylene sorbitan monooleate), or "Solutol HS15" (polyethylene glycol-660 12-hydroxystearate) are used as a co-solubilizing agent. "Collidon 12PF" or "Collidon 17PF" [poly-(1-vinyl-2-pyrrolidone)] are used as a stabilizing agent. Dimethylacetamide or 1-methyl-2-pyrrolidone or "Solufor P" (2-pyrrolidone), or transcutol, or propylene glycol, or ethylene glycol, or glyceroformal, or dimethylsulfoxide are used as a solvent. The proposed injection medicinal formulation comprises additionally phenazone as active substance in the amount 1-10 wt.-%. Invention provides enhancing stability and activity and decreasing toxicity of the medicinal formulation.

EFFECT: improved and valuable properties of formulation.

3 cl, 12 ex

FIELD: molecular biology, veterinary.

SUBSTANCE: invention proposes isolated DNA sequence (variants) encoding Ehrlichia canis protein of size 30 kDa. Also, invention proposes vector comprising such sequence, recombinant Ehrlichia canis 28 kDa protein encoded by this sequence, a cell-host comprising this sequence, a method for preparing the protein, immunoreactive antibody specific to this protein and a method for inhibition of Ehrlichia canis infection in subject. Recombinant protein of size 28 kDa from Ehrlichia canis shows immune reactivity with respect to serum against Ehrlichia canis. Proposed group of inventions can be used in development of vaccines and serodiagnosticum that shows high effectiveness for prophylaxis of diseases and for carrying out the serodiagnosis.

EFFECT: improved preparing method, valuable medicinal and veterinary properties of protein.

19 cl, 17 dwg, 8 ex

FIELD: medicine, in particular agent for treatment of hepatitis, toxoplasmosis, cytomegaloviral infection and influenza.

SUBSTANCE: claimed agent contains physiological saline for intravenous administration, comprising hydrogen peroxide, 0.2 % riboxine solution and decoction of liquorice roots in specific ratio.

EFFECT: non-toxic and effective agent for treatment of abovementioned diseases.

7 ex

FIELD: microbiology.

SUBSTANCE: claimed method includes providing of coccidial oocysts from fecal suspension, homogenization of fecal suspension, oocyst separation from fecal remainders of organic substances by salt flotation with sodium sulfate and other floating agents, oocyst sporulation using hydrogen peroxide and air barbotage, bleaching of sporulated oocysts, washing of bleached oocysts, concentration of sterile washed oocysts and blending of coccidial oocyst concentrates of various species to produce vaccines.

EFFECT: vaccines of high quality without toxic admixtures.

3 dwg

FIELD: medicine, veterinary science.

SUBSTANCE: a new group of compounds, such as: 1) 1.3-benzodixole-5-β-nitroethylene

, 2) 1.3-benzodioxole-5-β-nitropropylene

, 3)benzimidazole-5-β-nitropropylene

, 4) 2-methylbenzimidazole-5-β-nitroethylene

, 5) benzoxazole-5-β-nitroethylene

, 6) 2-methylbenzoxazole-5-β-nitropropylene

has been suggested to protect against the agents of bacterial, protozoan and fungoid nature. Compounds are being the derivatives of heteronitroalkenes (dioxoles, oxazoles, imidazoles) with below-mentioned structural formulas being efficient to gram-positive bacteria and gram-negative aerobes, fungi of Candida, Trichophyton and other types, trichomonads. They could be applied at treating wound infections, fungoid lesions, septic states, pneumonia, trachoma, ornithosis, salmonellosis.

EFFECT: higher efficiency of protection.

5 cl, 5 tbl

FIELD: medicine.

SUBSTANCE: invention proposes an agent for treatment of toxoplasmosis. Agent represents willow bark an aqueous extract prepared by method of thermal treatment in the ratio bark : water = 1:10, or willow bark powder. Invention expands assortment of agents of indicated prescription and provides treatment of patients with toxoplasmosis being among them with prevalent myocardium damage.

EFFECT: valuable medicinal properties of agent.

2 ex

The invention relates to medicine, namely to dermatology, and can be used for treatment of sexually transmitted infections

FIELD: medicine.

SUBSTANCE: invention concerns biotechnology. The method involves splenectomy of an animal, infection with blood parasites, exsanguinations at invasion peak, blood conservation and use for making antigens. Thus before infection, autoblood is accumulated by fivefold draw and transfusion of autoblood in amount 150, 300, 500, 700 and 1000 ml respectively with isotonic solution every 3-4 days, then an animal is infected with Babesia canis. At parasitemia peak, when 30-50% of erythrocytes involved, the blood is taken twice every 3-4 days in amount 800-900 ml, and then the prepared autoblood is injected. Then at the third parasitemia peak, the animal is exsanguinated completely, and the blood prepared at three stages is used for making antigen.

EFFECT: method allows producing greater blood volume from one animal.

1 tbl

Up!