Production of diagnostic set for detection of chrysanthemum virus b

FIELD: medicine.

SUBSTANCE: to detect or chrysanthemum virus B in plants, a diagnostic set containing polyclonal antibodies to protein of Chrysanthemum virus B shell, a conjugate marked with alkaline phosphatase, a fixing buffer; an extraction buffer, ECI-buffer and PNP-buffer is used. Protein of viral shell is produced by amplification of the purified gene of said protein with using a nonsynonymous primer ATGCCTCCCAAACCGGCACCAGGTGAT and synonymous primer TTTATAATGTCTTATTATTCGCAT.

EFFECT: improved antiviral action of the compound.

15 cl, 2 ex

 

The technical field to which the invention relates.

The present invention relates to primers suitable for detection of the virus In chrysanthemum (Chrysanthemum virus B) in plants.

More specifically, the invention relates to a method for detection of the virus In chrysanthemum plants using primers suitable for detection of the virus In chrysanthemum plants.

The present invention also relates to a diagnostic kit suitable for detecting protein shell of the virus In chrysanthemum plants.

Prior art

Chrysanthemum is one of the most important cutting (cut) flowers in the world. It ranks 3rd in the world among cut flowers. Usually the chrysanthemum plant vegetative, and this practice allows the virus, once established in the plant to persist from generation to generation. Quality germplasm and to minimize infection by viruses of different cultivars, proper diagnosis and monitoring of viral diseases are not only desirable, but also necessary to improve the quality of crop products.

The virus In chrysanthemum (CVBS), carlavirus has a narrow steep hosts and spread throughout the world, wherever grown chrysanthemums. It infects the chrysanthemum and about 10 other species in 5 families of dicotyledons (Brunt, A.A., Crabtree, K., Dallwitz, M.J., Gibbs, A.I, and Watson, L. (Edts) Vruses of Plants, CAB International, UK. Page No. 398-400). CVBS is widely distributed throughout the country. During a thorough examination chrysanthemum cvs. it was found that all tested commercial sources (commercial stocks) infected at from 40% to 95% (Verma, N.. Sharma, A., Ram, R., Hallan, V., Zaidi, A.A. and Garg, LD. (2003) Detection, identification and incidence of Chrysanthemum In carlavims in chrysanthemums in India. Crop Prof. 22, 425-429). In Himalayan Institute of technology of bioresources were collected cultivars Palampur chrysanthemum twenty-eight geographical areas. Twenty-eight isolates were cloned, sequenced, and sequences were submitted to Genbank. Developed different primernye pair (EMBL Nucleotide Sequence Accession Numbers: AJ566196, AJ566195, AJ609493, AJ609494, AJ609495, AJ609496, AJ609497, AJ609498, AJ609499, AJ609500) and was successfully used for the identification and characterization of Indian isolates of CVBS. It also shows a wide distribution CVBS in chrysanthemum grown in different parts of the country.

For the first time on CVBS it was reported from the Netherlands as a member of a group of carlaviruses (Noordam, D, 1952 Virusziekten by chrysant in Nedeland. With a summary: a virus disease of Chrysanthemum morifolium in Netherlands. Tijaschrift over Plantenziekten. 58, 121-190). Discovered that CVBS infection leads to loss of quality flowers, moderate patchy colouration of the leaves, enlightenment veins, or a combination of this (Hollings, M. and Stone. O.M. (1972) Chrysanthemum virus B CMI/AAB Descriptions of Plant viruses No. 110). Were also reported symptoms range from mosaic, malformations and small d is strong necrosis (Hakkart, F.A. and Matt, D.Z. (1974) Variation of Chrysanthemum virus B.J.Plant Path. 80, 97-103).

Traditional methods of diagnostics of plant viruses need in a biological sample using plant-indicator, the observation of symptoms, the establishment of host range and partial morphology and relationships with the vector. These processes consume time and require a lot of work. However, the development of molecular biology, biochemistry and immunology leads to the creation of new accurate, faster and less labor-intensive methods of virus detection. There are various diagnostic procedures suitable in the field of viral diagnostics, such as precipitation tests, agglutination tests, tests using fluorescent monoclonal antibodies, enzyme-linked immunosorbent assay, ELISA analysis, tissue blot analysis, Western blotting, hybridization of nucleic acids from samples labeled with isotopes and unlabeled isotopes, and the discovery-based polymerase chain reaction.

To detect CVBS in Chrysanthemum morifolium successfully used immunological techniques (Raizada, R.K., Srivastava, C.M., Chandra. G. and Singh, B.P. (1989) Comparative evaluation of sero-diagnostic methods for detection of Chrysanthemum virus In chrysanthemum. Indian J. Exp.Biol. 27. 1094-1096). For diagnosis of the virus In chrysanthemums were effectively used serological methods (Zaidi, A,A., Ram, R., Zaidi, S.N.H. and Mukherjee, D. (1990) Diagnosis of viruses in some ornamental plants with special reference t serological methods: New Developments. Indian Rev. Life Sci. 13,157-174).

Enzyme-linked immunosorbent assay (ELISA) and another modified type of ELISA is widely used to detect CVBS from Chrysanthemum morifolium (Venna, N, Sharma, A., Ram, R., Hallan, V., Zaidi, A.A. and Garg, I.D. (2003) Detection, identification and incidence of Chrysanthemum In carlavirus in chrysanthemum in India. Crop Prot. 22, 425-429).

It is highly effective in detecting CVBS in leaves. Using DAS-ELISA status of viral diseases was analyzed for 36 cultivars of Chrysanthemum morifolium. Some cultivars also showed moderate mottling of the leaves, the enlightenment of the veins, or a combination of this (Hollings, M. and Stone, O.M. (1972) Chrysanthemum virus B CMI/AAB Descriptions of Plant viruses No. 110). Therefore, it is important to have a reliable and rapid technique for the detection of latent infection and to establish serological correlation with virus isolates In chrysanthemums.

Like ELISA, immunosorbent electron microscopy (ISEM) also makes it easy to find CVBS in leaves (Verma, N., Shanna, A.. Ram, R., Hallan, V., Zaidi, A.A. and Garg, I.D. L (2003) Detection, identification and incidence of Chrysanthemum In carlavirus in chrysanthemum In India. Crop Prot. 22, 425-429). Like ELISA, ISEM can detect CVBS in leaves of chrysanthemums.

In the past decade to detect viral genome in infected plants used RT-PCR with varying degrees of modification (Yamamoto, H., Kiguchi. T. and Ohya. T. (2001) 52ndThe Annual Report of the Society of Plant Protection of North Japan. 85-86). Was developed partial sequence of alnost virus In chrysanthemums, and she was 3.4 KB (Levay, K.E. and Zavriev, S.K. (1991) Nucleotide sequence and gene organization of the 3'-terminal region of Chrysanthemumvirus In genomic RNA. J. Gen. Virol. 72(10), 2333-7). At IHBT, Palampur sequenced approximately 5 KB of the genome CVBS (EMBL Nucleotide Sequence Accession Numbers: AJ617281, AJ617282, AJ617287, AJ585240, AJ704627, AJ580956. AJ633542, AJ633540, and AJ633629). Based on the sequencing of various geographical isolates identified three biological isolates, including Russian isolates reported previously, which reminds one of the three isolates.

The purpose of the invention

The main purpose of the present invention is the provision of primers suitable for detection of the virus In chrysanthemum plants.

Another purpose of this invention is the provision of a method for detection of the virus In chrysanthemums in plants with application of the developed primers suitable for detection of the virus ring spot Prunus necrotic plants.

The next objective of the present invention is the provision of a diagnostic kit suitable for detecting protein shell of the virus In chrysanthemum plants.

Brief description of the invention

The present invention relates to a method for the detection of virus In chrysanthemums in plants with application of the developed primers

Sequence ID 1; Sense primer ATGCCTCCCAAACCGGCACCAGGTGAT

Sequence ID 2: Antisense primer TTTATAATGTCTTATTATTCGCAT

This is also what relates to diagnostic set, suitable for detection of the protein shell of the virus In chrysanthemum plants containing:

(a) polyclonal antibodies to the protein shell of the virus In chrysanthemum plants;

b) conjugate, labeled alkaline phosphatase;

(c) sensitizing buffer;

d) extraction buffer;

e) ECI buffer;

f) PNP buffer.

Detailed description of the invention

The specific sequence CVBS was detected in the extract the total RNA of infected plants by transcription of viral RNA into cDNA and subsequent amplification using the polymerase chain reaction. Like ELISA and ISEM, PCR also allows you to easily find CVBS in sheets.

Thus, DAS-ELISA, ISEM and RT-PCR are suitable methods for the detection of infection chrysanthemums CVBS, RT-PCR and hybridization of nucleic acids are sensitive tools to detect the virus, but they require fine tools, which is also expensive. Still ELISA is widely used for the detection of viral contamination of chrysanthemums and other plants, as it is rapid, easy to perform, can be applied even in field conditions and is cost-effective. It can be used in the form of a diagnostic kit.

To develop a diagnostic kit was amplified gene protein shell CVBS presented in EMBL (Vide Accession No. AJ871583), using specially designed primers with restriction enzyme sites compatible for directional and inframe (frame) cloned into the vector pGex-2TK. Amplificatory product was cloned into the vector pGex 2TK by transformation into competent cells BL21.

Then the cloned gene envelope protein induced in transformed E. coli cells grown in the medium YT.

Conditions for expression were standardized in relation to the IPTG concentration, time of incubation, growth conditions and method of cell disruption. In order to obtain the maximum yield of expressed recombinant envelope protein in a soluble form, the culture was induced with 0.5 OD600with 0.25 mm isopropyl-p-D-thiogalactopyranoside (IPTG) for 3 hours at 25°C with the destruction of the cells with lysozyme (10 mg/ml) and ultrasound (pulse included in the course of 9.0 seconds and the pulse is turned off for 4 seconds).

Downregulation of envelope protein was purified to homogeneity using affinity chromatography on glutathione-agarose. Immobilization of glutathione on agarose media allows you to get a highly effective adsorbent for affinity chromatography. Bound peroxidase GST crosslinked proteins were suirable using buffer containing free glutathione.

Purified protein preparations obtained after affinity chromatography, ICP is litovali as antigen for immunization of rabbit (Meenu Katoch. A.A.Zaidi and Raja Ram. 2002. Development of diagnostic kit for the detection of Bean yellow mosaic virus. Patent case No. 76/NF/2002). To obtain hyperimmune sera to CVBS used healthy white male new Zealand rabbits, albino approximately six months of age. The antigen (100 μg per injection) was mixed with incomplete adjuvant's adjuvant (1:1) and injected intramuscularly into the thigh muscle of rabbits. Within one week were made four injections. One week after immunization, blood samples of animals were collected from the marginal ear vein. Blood was collected in glass tubes and allowed to clot at room temperature for one hour. Then the glass tubes were left at 4°C over night. The serum was centrifuged at 2000 rpm for ten minutes at 4°C. the Supernatant was collected and stored at 4°C after addition of sodium azide to a concentration of 0.2% (V/V).

According to the present invention, primers suitable for detection of the virus In chrysanthemums (CVBS) in plants containing the following sequence:

Sequence ID. 1: Sense primer ATGCCTCCCAAACCGGCACCAGGTGAT

Sequence ID 2: Antisense primer TTTATAATGTCTTATTATTCGCAT

The present invention also provides a method for detection of the virus In chrysanthemums (CVBS) in plants, which includes stages:

a) providing a purified protein shell CVBS using RA is operating primers

Sequence ID 1: Sense primer ATGCCTCCCAAACCGGCACCAGGTGAT

Sequence ID 2: Antisense primer TTTATAATGTCTTATTATTCGCAT

b) obtaining polyclonal antibodies to the protein shell CVBS obtained at stage (a);

c) directly or antibody-based test enzyme-linked immunosorbent sandwich assay (DAS ELISA) for the detection of CVBS.

In the embodiment of the present invention a complete protein shell CVBS amplified using the developed primerov having the sequence:

Sequence ID 1: Sense primer ATGCCTCCCAAACCGGCACCAGGTGAT

Sequence ID 2: Antisense primer TTTATAATGTCTTATTATTCGCAT

In another embodiment of the present invention a complete protein shell CVBS containing the sequence ID with No.

cloned in pGEX-2TK, followed by transformation of the strain of E-coli BL 21.

Then, in the embodiment of the present invention, the optimum expression of the envelope protein CVBS induced IPTG at a concentration of 0.25 to 1 mm at a temperature of about 25°C for 3.5 to 4 hours.

In addition, in the embodiment of the present invention obtained envelope protein CVBS sequenced by known methods sequencing.

In another embodiment of the present invention the protein purification membrane CVBS performed in a known manner.

In e is e one embodiment of the invention three times complied with the immunization of rabbits with purified protein shell CVBS and complete adjuvant's adjuvant at the ratio of 1:1 with weekly intervals.

In yet another embodiment, the present invention immunization was performed intramuscularly, subcutaneously or intravenously.

In the following embodiment, the present invention after 14-15 days in rabbits collected blood, in order to obtain polyclonal antibodies to the protein shell CVBS.

In the following embodiment, the present invention polyclonal antibodies to the protein shell CVBS was purified from serum by known methods.

In the following embodiment, the present invention titration microplates were senzibilizirani polyclonal antibody, diluted in sensitizing buffer in the ratio of from 1:500 to 1:1000, followed by washing PBS-T 4-5 times.

In the following embodiment of the present invention, the test samples were prepared in titration microplate by soaking the infected leaf tissue of plants with the extraction buffer, followed by dilution from Ix - 1/h the original antigen.

In yet another embodiment, the present invention tetrazinni the microplate was incubated overnight at about 37°C, followed by washing to allow the antigen to cover the walls.

In the following embodiment, the present invention was added to the conjugate antibody in buffer ECI in the ratio of 1:500 to 1:1000 for 2 hours is at approximately 37°C, followed by washing PBS-T.

In another embodiment of the present invention to the mixture was added about 100 μl of a solution of p-nitrophenyl phosphate (approximately 1 mg/ml) in buffer PNP.

In yet another embodiment of the present invention the reaction was stopped by adding about 50 μl to approximately 3M NaOH 15-20 min to obtain a product of yellow color.

In the following embodiment of the present invention, a colored product is a conjugate of the antigen and antibodies.

In another embodiment of the present invention to detect the virus In chrysanthemums (CVBS) optical density of the colored product was measured at 405 nm.

The present invention also provides a diagnostic kit suitable for detecting protein shell of the virus In chrysanthemums (CVBS), including:

(a) polyclonal antibodies to the protein shell of the virus In chrysanthemums (CVBS) in plants;

b) conjugate, labeled alkaline phosphatase;

(c) sensitizing buffer;

d) extraction buffer;

e) a buffer ECI;

f) the PNP buffer.

The following examples are given to illustrate the present invention and they should not be construed as limiting the scope of the present invention.

Information confirming the possibility of carrying out the invention

Example 1

The virus is found In chrysanthemums the chrysanthemums

To check AK is Yunosti set different varieties of chrysanthemums were tested by the method of DAS-ELISA. Samples were extracted in a similar manner as described in DAS-ELISA. At the same time they were also tested using a standard (reference) set BIORAD (USA). The obtained antibodies were tested on newly discovered isolates, including isolates, similar to Russian isolates reported previously, and it was shown that antibodies effectively detect all isolates. The reference set is weakly identified other isolates, whereas antibodies according to the invention allowed the reliable detection of tested isolates. The results are summarized in table.

DAS-ELISA

1. Plates (Nunc Measurement plate TM, Denmark) was senzibilizirani 100 µl polyclonal antibodies (diluted 1:10,000) in sensitizing buffer and then incubated overnight at 4°C in a humid chamber.

2. The tablets were washed five times with PBS-T.

3. The antigen was obtained by soaking the leaf tissue in extraction buffer 1 g/2 ml Some cultivation were made accordingly 1x-1/h breeding primary antigen, 100 μl of the diluted antigen was added to the wells of the microtiter tablet according to the scheme, and incubated at 37°C for two hours in a humid chamber in order to allow the antigen to cover the walls.

4. Were repeated stage of leaching, and the conjugate (diluted 1:500 in buffer EC1 was added to the Lu the Ki (100 µl/well). The plates were incubated for 2 hours at 37°C in a humid chamber.

5. After washing tablet PBST to the wells was added 100 μl of a solution (1 mg/ml p-nitrophenyl phosphate in buffer PNP (10% solution of diethanolamine, brought to a pH of 9.8 with HCl).

6. After appeared the corresponding color (15-20 min), the reaction was stopped by adding 50 μl of 3M NaOH to each well.

7. Were also made positive and negative controls on the same tablet. The optical density was measured at 405 nm using a multi-channel spectrophotometer (reader). The reaction was considered positive if the observed optical density was higher than 0.1, which was three times more than in negative control.

Set responded well with a positive sample, whereas in the negative control sample, to no avail. Was selected titer of 1:10,000.

Sensitizing buffer: (0.05 M per liter): 1,59 mg of sodium carbonate and 2.93 mg sodium bicarbonate, pH 9,6.

PBST buffer: 20 mm sodium phosphate pH 7.4; 150 mm NaCl and 0.05% (V/V) Tween 20.

Extraction buffer: 1.3 g sodium sulfite (anhydrous), 20 g of polyvinylpyrrolidone (PVP) MW24 - 40,000, 0.2 g of sodium azide, 2.0 g powdered egg albumin class II and 20.0 g of Tween-20 was dissolved in 1000 ml 1XPBST and brought the pH to a value of 7.4.

ECI buffer; 2.0 g BSA, 20,0 g PVP 24-40,000 and 0.2 g of sodium azide was dissolved in 1000 ml IxPBST and brought the pH to a value of 7.4.

PNP buffer: 0.1 g of magnesium chloride, 0.2 g of sodium azide and 97 ml of diethanolamine were dissolved in 800 ml of distilled water and made up to 1000 ml and to a pH of 9.8.

S.NoVarietiesSet according to the inventionReference-set
1.Pink Gin++++
2.Funshine+++
3.Inga++
4.Regol Time++++
5.Royal Mundial++
6.Bronze Mundial++
7.* Zakura++
8.Tichmg Queen- -
9.Mundial+++
10.Shymal+++
11.Chandrama++
12.White Stafour++++
13.Fish Tail++
14.Pancho+++
15.Akita+++
16.White Prolific++++
17.Pink Casket++++
18.Dignity++
19.Jyoti- -
20.Penny Lane++
21.Jubilee+++
22.Vasantika+++
23.Nanako++
24.Kundan++
25.Himani++++
26.Birbal multi-stories++
27.Jaya++
28.Flirt+++
29.Lilith--
30.Sharad Shobha+++ +
31.Megani++
32.Jayanti+++
33.Niharika+++
34.Snow Ball++
35.Meghdoot--
36.White Shoesmith+++
(-) - Negative reaction,
(+++) - Strong reaction
( ++ ) : Moderate reaction
(+) - Weak reaction

Example 2

Obtaining antisera

Purified recombinant envelope protein was used as antigen to immunize a rabbit. To obtain hyperimmune serum to CVBS used healthy white male new Zealand rabbits, albino approximately six months of age is. The antigen (100 μg per injection) was mixed with adjuvant's adjuvant at the ratio of 1:1 and injected intramuscularly and subcutaneously in the thigh muscles of rabbits. The first two injections were made with complete adjuvant's adjuvant at intervals of one week. Similarly the third and fourth injections were given with incomplete adjuvant's adjuvant (1:1) with an interval of one week. After two weeks of immunization in animals, the blood was collected from the marginal ear vein. Blood was collected in glass tubes and allowed to clot at room temperature for one hour. Then the glass tube containing clotted blood was left at 4°C over night. Serum was collected using a Pasteur pipette, and centrifuged at 5000 rpm for ten minutes at 2-6°C. the Supernatant was collected and stored at 4°C after addition of sodium azide to a concentration of 0.2% (V/V). To gather more serum, were made repeated injections through 5, 12, 16 and 22 weeks after the first injection. For reference and serological studies used anticigarette to CERV from BioRad, USA.

Purification of antibodies (Separation of IgG from whole serum):

A) Deposition (precipitation) ammonium sulfate:

1. Distilled water (9 ml) was added to 1 ml of raw antisera.

2. Slowly dropwise added 10 ml of neutralized nasusunog the ammonium sulphate (Sigma), and incubated with continuous stirring.

3. After stirring was left at room temperature for about 1 hour. The resulting solution should be viscous and turbid due to the deposition of antibodies, or IgG.

4. The solution was centrifuged at 9000 g for 15 min and the precipitate was washed with 2 ml of the diluted (half-strength) PBS. Stage washing was repeated three times to remove traces of ammonium sulfate.

5. Finally the precipitate was dissolved in 1 ml of the diluted PBS.

6. OD was measured at a wavelength of 280 nm.

7. Antibodies were diluted to a final concentration of 1 mg/ml (OD reading 1,4=1 mg/ml).

8. Aliquot 1 ml of 0.02% (W/V) of sodium azide were stored at -20°C for further use.

PBS (100 ml): Na2HPO4·12H2O=5,8 gm; NaH2PO4·2H2O=1,0 gm; NaCl=8,76 gm.

C) Affinity chromatography:

1. Protein a - sepharose (Sigma) was allowed to swell and was placed in the column.

2. The column was washed equilibrating buffer.

3. Serum was diluted and passed through the column at a certain speed.

4. Unbound proteins were washed PBS until the disappearance of the protein (spectrophotometer).

5. Bound peroxidase protein (IgG) was suirable eluting buffer.

6. the pH was neutralized Tris HCl.

7. The column was recovered by washing or equilibrating buffer, or a buffer for storage. Then the sorbent was kept in the buffer for storage at 4°C.

8. The eluate dial Aravali three times against PBS and stored at -20°C until further use.

PBS (100 ml): Na2HPO4·12H2About=5,8 mg; NaH2PO4·2H2O=1.0 mg; NaCl=8,76 mg.

Equilibrating buffer (5X): Tris - 0.05 M; NaCl 0.15 M, pH 8,6.

Buffer to store: Na2HPO4- 0.05 M; Thomersol - a 0.05%, pH 6.0

Eluting buffer: CH3COONa - 0.5 M; NaCl 0.15 M, pH 4.5

Getting conjugate the antibody to an enzyme (alkaline phosphatase):

1. 1 mg of alkaline phosphatase (Sigma) was dissolved in 2 ml of purified antibodies.

2. Fresh gluteraldehyde (25% runoff, Merck) was added to the solution to a final concentration of 0.05% and well stirred.

3. Incubated at room temperature for 4 hours. Observed weak brown color.

4. After 4 hours was centrifuged at 9000 g for 20 minutes

5. The precipitate was washed twice with PBS and diluted was dissolved in 2 ml of the diluted PBS.

6. Was dissolved in the same buffer bovine serum albumin (BSA) to 5 mg/ml and sodium azide to 0.02% (V/V) for longer life. Kept at 4°C until further use.

The definition of a conjugate of alkaline phosphatase

The activity of the conjugate was tested using DAS-ELISA as described in the examples are listed in the full description of the patent, using known positive and negative samples, and was also titrated.

Advantages

The main advantages of the present invention are:

1. Chrysanthemum is among the first ten retailiation cultures within the country, and also in international horticulture (Floriculture Trade). As floriculture strongly influenced CVBS, which lowers the quality of flowers and crops, in order to create free from disease material for breeding and selection of healthy plants use local diagnostic kit is absolutely necessary because it helps in the management of plant viruses.

2. The set, which is polyclonal in nature, can detect all strains CVBS.

3. The kit can detect CVBS in different cultivars of chrysanthemums, giving a stronger response compared to the reference set (table).

4. All kit components can be stored at 4°C without any loss of activity, whereas some components of the reference set should be stored at -20°C.

5. Purification of expressed protein increases the purity and duration of antigen delivery.

6. Being local, the diagnostic kit is also cost-effective.

7. Developed diagnostic kit can be used for screening are free from virus tissue culture grown plants.

8. Developed diagnostic kit can be used for understanding the epidemiology of the disease and prognosis of the disease CVBS.

9. Developed diagnostic kit can be used to control (monitoring) of the virus in the vector registered the AI and weeds.

10. CVBS diagnostic kit can be used when conducting plant quarantine, thus facilitating exports and imports of chrysanthemums.

11. CVBS diagnostic kit can be used for growing source of Chrysanthemums, free from the virus.

1. Diagnostic kit, applicable for the detection of virus In Chrysanthemum (CVBS), including:
(a) polyclonal antibodies to the protein shell of the virus In Chrysanthemum (CVBS) in plants, and this envelope protein is obtained by amplification of purified envelope protein gene CVBS using the set of primers:
direct primer with the sequence SEQ ID No. 1: ATGCCTCCCAAACCGGCACCAGGTGAT
and a reverse primer with the sequence SEQ ID No. 2: TTTATAATGTCTTATTATTCGCAT;
(b) conjugate antibody labeled with alkaline phosphatase;
(c) fixing the buffer;
(d) extraction buffer;
(e) buffer ECI;
(f) the PNP buffer.

2. The method of detection of the virus In Chrysanthemum (CVBS) in plants, which includes stages:
(a) amplification of the gene of the protein shell CVBS using the set of primers:
direct primer with the sequence SEQ ID No. 1: ATGCCTCCCAAACCGGCACCAGGTGAT
and a reverse primer with the sequence SEQ ID No. 2: TTTATAATGTCTTATTATTCGCAT, and these primers contain cleavage sites of restriction enzymes suitable for directional cloning in one frame are read into the vector pGex-2TK;
(b) cloning the amplified gene protein, Obolo the key from stage (a) in the vector pGex-2TK by transformation of competent cells BL21 E. coli;
(c) induction of transformed E. coli cells from stage (b) in the environment YT, promoting optimal expression for the preparation of recombinant envelope protein in a soluble form;
(d) purification of recombinant envelope protein from stage (C) to obtain purified envelope protein CVBS;
(e) obtaining polyclonal antibodies to purified protein shell CVBS from stage (d), with these polyclonal antibodies are produced by immunization of rabbits using as antigen purified protein shell CVBS from stage (d);
(f) obtaining a conjugate of the antibody by labeling polyclonal antibodies from stage (e) alkaline phosphatase;
(g) directly or antibody-based test enzyme-linked immunosorbent sandwich assay (DAS ELISA) for the detection CVBS using polyclonal antibodies from stage (e) and conjugate antibodies from the stage (f).

3. The method according to claim 2, in which the total protein shell CVBS subjected to amplification of chrysanthemums using a set of primers: forward primer with the sequence SEQ ID No. 1: ATGCCTCCCAAACCGGCACCAGGTGAT
and a reverse primer with the sequence SEQ ID No. 2: TTTATAATGTCTTATTATTCGCAT.

4. The method according to claim 2, in which the optimal expression of recombinant envelope protein CVBS is checked when the IPTG concentration of 0.25-1 mm at 25°C for 3.5 to 4 hours.

5. The method according to claim 2, in which the purification of the recombinant envelope protein PR is found by precipitation with ammonium sulfate or by the method of affinity chromatography, preferably the method of affinity chromatography.

6. The method according to claim 2, in which immunization of rabbits is carried out 4 times with purified envelope protein of stage 2(d) and complete adjuvant's adjuvant at the ratio of 1:1 with an interval of 1 week.

7. The method according to claim 2, in which immunization of rabbits can be performed intramuscularly, subcutaneously or intravenously.

8. The method according to claim 2, in which polyclonal antibodies to the protein shell CVBS purified from the serum by centrifugation.

9. The method according to claim 2, in which when executed direct or antibody-based test enzyme-linked immunosorbent sandwich assay (DAS ELISA) microtiter tablets cover polyclonal antibody at a dilution of their fixation buffer in the range from 1:500 to 1:1000, followed by washing 4-5 times with PBS-T.

10. The method according to claim 9, in which fixation of the antigen in the wells of microtiter tablets incubated at 4°C overnight or at 37°C for 2 h followed by washing.

11. The method according to claim 9, in which to obtain a mixture in the wells add conjugate antibodies from stage 2(f) in the ECI buffer at a dilution of 1:500 to 1:1000 for about 2 h at 37°C followed by washing with PBS-T.

12. The method according to claim 9, in which the mixture according to claim 11 add 100 ál of a solution of n-nitrophenylphosphate 1 mg/ml in buffer PNP.

13. The method according to claim 9, in which the reaction 15-20 min stop adding the 50 μl of 3M NaOH to obtain a product of yellow color.

14. The method according to item 13, in which the obtained dyed product is n-NITROPHENOL formed by the reaction of the enzyme alkaline phosphatase with p-nitrophenylphosphate.

15. The method according to item 13, in which to detect the virus In Chrysanthemum (CVBS) measure the absorption of a colored product at 405 nm.



 

Same patents:

FIELD: medicine.

SUBSTANCE: there is used for diagnostics of transient and persistent latent papilloma virus infection. The diagnostic technique for papilloma virus infection is ensured by history taking and integrated clinical-laboratory examination. As anamnestic signs, there are assumed compromised oncologic characteristics inheritance, early sexual life, age younger than 20 years old and promiscuity; as clinical - anogenital warts, erosion and ectopic neck of uterus, contact hemorrhagic diathesis, Ovuli nabotti, inflammatory diseases of small pelvis organs and intrauterine spiral. Herewith the laboratory signs are sexually transmitted diseases, mixtinfection, deficient lactic acid bacilli, vaginal disbiosis caused by conditional-pathogenic flora, bacterial vaginosis, virus-virus associations, urogenital herpes, urogenital mycoplasma infection, urogenital ureaplasma infection, urogenital candidiasis, urogenital Chlamidia infection and infection with various genotypes of human papilloma virus. Each sign is scored, and depending the number of points, persistent or transient clinical course of papilloma virus infections, or follow-up examination is performed.

EFFECT: determining tactics of the following management of the patient, forming group of potential risk for development of focal dysontogenetic and malignant transformations of urogenital epithelium.

1 dwg, 2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, particularly to laboratory examinations and can be used in selection of therapeutic approach to tonsillitis. The method involves microbiological study of tonsil lacunae contents. It involves detection of microorganism types and concentration. And if the association shows one or more microorganisms which are not normal tonsil lacuna inhabitants in concentration ≥105 CFU/ml, photodynamic therapy is predicted to be inefficient. The fact that test object is microflora enables to determine an etiological agent, as well as degree of activity of inflammatory process whereat photodynamic therapy aims.

EFFECT: method allows determining objective indications for photodynamic therapy in chronic tonsillitis that ensures more effective treatment of the patients.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine and can be used for express-estimation of severity of state of patient with burn disease. Laboratory analysis is carried out, degree of natural colonisation of buccal epithelium cells with bacteria Streptococcus salivarius, average number of bacteria Streptococcus salivarius adhesed on one buccal epithelium cell - index of natural colonisation of buccal epithelim cells (INCBEC), and if INCBEC value is greater than 10, conclusion about light degree of severity of patient's with burn disease state is made, of INCBEC value is from 5 to 10 - about medium degree of severity of patient's with burn disease state is made, and if INCBEC value is lower than 5 - about severe degree of severity of patient's with burn disease state.

EFFECT: method is simple in realisation, takes little time, non-traumatic, eliminates risk of infection.

3 ex

FIELD: chemistry.

SUBSTANCE: description is given of polyaniline in form of an emaraldine base of formula [(-C6 H4-NH)2-(NH=C6·H4=NH-)]n n=20 to 10000 or interpolymer of a complex of polyaniline with poly-(2-acrylamido-2-methyl-1-propane-sulphonic acid), i.e. salt of emaraldine with poly-2-acryloamido-2-methyl-1-propane sulphonic acid of formula , n=50 to 50000 as a sorbent for removing viruses, non-viral proteins and for making an immunoasorbent based on said sorbent for isolating antiviral antibodies.

EFFECT: following methods are also described: method of removing viruses through immobilisation on a sorbent; immunoadsorption method; method of sorption of non-viral proteins from complex mixtures using sorbent.

20 cl, 2 ex, 4 tbl, 2 dwg

FIELD: veterinary.

SUBSTANCE: claimed is test-system of immuno-enzyme analysis, which allows to determine antibodies to viruses of infectious rhinotracheitis (IRT), viral diarrhea-disease of mucous membranes (VD-DMM), parainfluenza viruses -3 (PIV-3), respiratory syncytial (RS) and adenoviral (AVI) infections of livestock. Serological examination of animals allows to detect zones of infection spreading and estimate post-vaccination immunity.

EFFECT: application of claimed test-system IEA will allow to carry out simultaneously epizootological monitoring of five important infections of livestock, retrospective diagnostics of respiratory infections, and estimation of immunity stress in animals resulting from application of vaccines, determination of level of colostral antibodies in young animals in the first weeks or days of life, estimation of therapeutic medicine quality.

10 tbl

FIELD: medicine.

SUBSTANCE: invention concerns medicine, namely to laboratory diagnostics of human tularemia and concerns differentiation of infectious and postvaccinal antibody response at human tularemia. The essence of the invention consists that as an antigenic preparation in addition to LPS Fransicella tularensis in a dot blotting in parallel LPS Fransicella novicida is used. For this purpose LPS preparations are preliminary allocated from corresponding strains which are dissolved in the distilled water and applied on a nitrocellulose membrane in volume 1 mcl from the 1-5 mg/ml solution, with the subsequent processing by a buffering normal saline solution at pH 7.0-7.1 with 1% bull seralbumin and 0.5% twin 20 within one hour. After that the filters are washed out and incubated in the investigated serum dissolved not less than 1:100, within an hour at temperature of 37°C, then the samples are washed three times, also presence of complexes an antigen-antibody is revealed by a withstanding within 1 hour at a room temperature in a working solution of protein A, labelled with horse-radish peroxidase, with the subsequent washing up and placing in a painting solution, thus the account and an estimation of results are spent on presence of two brown maculae on a place of drawing of LPS F.tularensis and LPS F.novicida preparations which presence testifies to infectious process at the investigated patient, and at vaccinal process one maculae on a drawing place only LPS F.tularensis is observed.

EFFECT: advantage of the invention consists in simultaneous revealing infectious and postvaccinal antibody responses.

3 ex

FIELD: medicine.

SUBSTANCE: invention refers to mycoplasmoses laboratory diagnostic techniques and can be used in veterinary medicine. Method for making erythrocytic disgnosticum for indirect hemagglutination reaction (IHR) in pig's mycoplasmosis consists from fractional formalinisation of sheep's erythrocytes and sensitisation with mycoplasmosis antigen at 70°C within 30 minutes. And for sensitisation, erythrocytes are used being loaded with sensitine made of mixed mycoplasma cultures (M.hyosynoviae, M.hyorhinis and Ureaplasma sp.) taken in equal proportions and heated on water bath at 70°C within 30 minutes. Thereafter the diagnosticum is triply washed with a phosphate-buffer salt solution with PH-7.2.

EFFECT: higher specificity and activity of erythrocytic disgnosticum in indirect hemagglutination reaction (IHR) in pig's mycoplasmosis.

3 tbl

FIELD: medicine.

SUBSTANCE: method of preparing diagnostic agglutinating serum for pathogenic Yersinia strains involves hyperimmunisation of rabbits with antigen representing 0.4-0.6% formalin inactivated antigen (pYV+) of Yersinia enterocolitica My 03R strain into auricular cranial vein. Immunisation of rabbits with said antigen is fourfold in dosage as follows: 290-310 million kl/ml, 490-510 million kl/ml, 0.99-1.1 billion kl/ml and 1.9-2.1 billion kl/ml, respectively with dosage interval 6-7 days. Further the producer is examined for immunogenic properties. Serum separated from the sampled blood is preserved.

EFFECT: method ensures preparation of high-quality agglutinating serum used in yersiniosis diagnostics in animals.

3 ex

FIELD: medicine.

SUBSTANCE: invention relates to obtaining mycoplasmosis diagnostic serums for diagnosis of mycoplasmoses in pigs in indirect immunofluorescence reaction. Method includes use of antigens from three mycoplasma cultures - Mycoplasma hyosynoviae, M. hyorhinis and Ureaplasma sp.B which are used for rabbit hyperimmunisation during 21 days by divided intravenous antigen introduction every three days with triple application of immunostimulator levomisol. Antibody synthesis dynamics is studied on 7, 14 and 21 day after first antigen introduction in indirect immunofluorescence reaction (IIFR). Reaction is carried out according to conventional methodology. Four-cross system is used for reaction estimation. It has been established that on the 7-th day after first antigen introduction antibodies in IIFR were detected in low titers 1:10-1:20. On the 14-th day positive reaction in IIFR was at higher dilutions within 1:320-1:640, and on the 21-st day antibody synthesis reached maximal level 1:640-1:1280.

EFFECT: obtaining anti-mycoplasmosis serums in higher diagnostic antibody titers, reduction of hyperimmunisation terms and possibility to use obtained serums for diagnosis of mycoplasmoses in pigs in IIFR.

5 tbl

FIELD: veterinary science.

SUBSTANCE: invention refers to veterinary microbiology and biotechnology can be used for development of specific colibacillosis diagnostic aids. According to the invention the method covers producing antibody erythrocytic colibacillosis diagnosticum and provides carrier processing with antibodies to Escherichia antigens being adhesive antigens extracted from Escherichia cultures with phosphate-carbamide buffer 1.8-2.0 M of pH 7.2-7.4 at temperature 40-45°C during 25-30 min. The culture fluid containing Escherichia cell culture and phosphate-carbamide buffer are taken in mass ratio 1:0.4-0.6 respectively. The supernatant from the extraction is heated up at 65-68°C within 25-30 min. Gamma globulin fractions are used as serum antibodies for carrier processing.

EFFECT: method allows for high-quality end product due to improved sensitivity and specificity.

3 ex

FIELD: medicine.

SUBSTANCE: the present innovation refers to new mutations, mutation combinations or those of mutation profiles of the genes of reverse transcriptase HIV-1 and/or protease that correlate with phenotypic resistance to medicinal preparations against HIV. To be more concrete, the present innovation deals with applying genotypic characteristics of HIV target population and subsequent correlation of the present information at phenotypic interpretation to establish the correlation of viral mutation profiles at resistance to medicinal preparations. The innovation in question enables to apply the data obtained in screening medicinal preparations applied against HIV-infection.

EFFECT: higher efficiency.

12 cl, 2 dwg, 14 ex, 13 tbl

FIELD: analytical methods in microbiology.

SUBSTANCE: substance of the method resides in performing, under human embryo cell culture monolayer conditions, common 2-h culturing of test strains of microorganisms with suitable therapeutical bacteriophage or multifunctional (polyvalent) bacteriophage, which includes a phage corresponding to test culture. Specific activity of bacteriophage is evaluated from degree of adhesion of test strain of microorganism to monolayer cells compared to control (cell monolayer and test strain without bacteriophage).

EFFECT: speeded up determination and enabled evaluation of therapeutical bacteriophage due to approaching evaluation conditions to microorganism conditions.

2 tbl

FIELD: medicine.

SUBSTANCE: device has plate, stripped, absorbed HbsAg, HbsAg-conjugate, positive control sample, negative control sample, washing solution, buffer substrate solution with hydrogen peroxide, chromogen, stop-reagent. Virus-safe HbsAg purified by precipitating immune complex from plasma is used as antigen for absorbing plate and producing HbsAg conjugate composed of HbsAg directly conjugated with peroxidase enzyme. Normal human immunoglobulin with anti-HBs concentration of 50 mIU/ml stabilized with normal donor plasma and maltose in final concentration of 2-20% tittered according to international HBs content standard. Substrate solution and chromogen-0.2% solution 3, 3', 5, 5' tetramethylbenzidine in dimethylsulfoxide diluted 5-fold with citrate buffer with Hydroperit resulting concentration of 0.015% and 2-chloracetamide resulting concentration of 0.1%. Quantitative proportion of antibody content with respect to HbsAg is calculated from formula CX=((meanODX - meanODC-)/(meanODC50+ - meanODC-)*50n, where CX is anti-BHs concentration in sample under test (mIU/ml), meanODX is mean value of optical density of sample under test, meanODC- is the mean value of optical negative control sample density, meanODC50+ is the mean value of optical positive control sample density, 50 is the anti-BHs concentration in C50+ in mIU/ml, n is the dilution factor of sample under study. The results are estimated if meanODC- ≤ 0.150 opt.units, meanODC50+ > 2.5 ODcrit, where ODcrit = meanODC- + 0.06. Anti-HBs concentration is determined if OD value of sample under test is from ODcrit to 1.500 opt.units. The sample OD violating the upper limit of said range, its dilution factor is selected in empirical way.

EFFECT: simplified HBs quantity calculation.

FIELD: microbiology.

SUBSTANCE: invention relates to a method for detecting microorganisms in any sample, in particular, in field of medicine, biotechnology, food industry and so on. Method involves the following stages: a) joining bacteriophages and/or bacteriophage proteins with a carrier; b) a carried joined with bacteriophages and/or bacteriophage proteins is incubated with sample, sample and microorganisms in the sample not binding with bacteriophages and/or bacteriophage proteins can be removed followed by addition of substances penetrating or destroying bacterial membranes; c) microorganisms in the sample bound with bacteriophages and/or bacteriophage proteins are detected and bound microorganisms are not subjected for the culturing stage. The set used for realization of the method comprises a carrier with immobilized phages or bacteriophages proteins wherein the latter are bound by direct binding with a carrier or by direct binding with polypeptide immobilized on the carrier, and reagents required for analysis in detection of bound microorganisms. The set comprises additionally solutions for washing out and/or substances penetrating or destroying microorganism membranes. Invention provides the possibility for rapid and sensitive detection of microorganisms.

EFFECT: improved method for detection.

14 cl, 7 dwg, 5 ex

The invention relates to Microbiology and ecology, in particular to methods for modeling of symbiosis (biocenosis) plague agent saprophytic microorganisms and subsequent detection of Yersinia pestis cells in this symbiosis

The invention relates to the field of medicine and biotechnology, and relates to a method of analyzing activity in vitro for DNA polymerase of hepatitis b virus (HBV) the person who provides the use as a 5'-oligonucleotide in the PCR amplification of the DNA polymerase of HBV from the sample of the oligonucleotide, in which was embedded the SP6 promoter, a viral polymerase, a direct transcription and translation of PCR products in the presence of radioactively labeled agent and measuring the priming DNA polymerase of HBV

The invention relates to biotechnology, Virology and immunology, and can be used to create a vaccine against the virus of classical swine fever (CSFV)

The invention relates to medicine, in particular, the described systems and methods that can be used to test donor blood products or plasma in order to detect specific donor samples infected with virus

The invention relates to medicine and offers the vaccine containing virus immunogen goat arthritis-encephalitis virus (CAEV) and a pharmaceutically acceptable carrier

FIELD: microbiology.

SUBSTANCE: invention relates to a method for detecting microorganisms in any sample, in particular, in field of medicine, biotechnology, food industry and so on. Method involves the following stages: a) joining bacteriophages and/or bacteriophage proteins with a carrier; b) a carried joined with bacteriophages and/or bacteriophage proteins is incubated with sample, sample and microorganisms in the sample not binding with bacteriophages and/or bacteriophage proteins can be removed followed by addition of substances penetrating or destroying bacterial membranes; c) microorganisms in the sample bound with bacteriophages and/or bacteriophage proteins are detected and bound microorganisms are not subjected for the culturing stage. The set used for realization of the method comprises a carrier with immobilized phages or bacteriophages proteins wherein the latter are bound by direct binding with a carrier or by direct binding with polypeptide immobilized on the carrier, and reagents required for analysis in detection of bound microorganisms. The set comprises additionally solutions for washing out and/or substances penetrating or destroying microorganism membranes. Invention provides the possibility for rapid and sensitive detection of microorganisms.

EFFECT: improved method for detection.

14 cl, 7 dwg, 5 ex

Up!