Method of cardiac hystiocytes proliferation

FIELD: medicine.

SUBSTANCE: cardiac hystiocytes are proliferated by inducing of cyclin and CDK expression in cardiac hystiocytes and by inhibiting function or activity of protein of Cip/Kip family or by inhibiting production of protein of Cip/Kip family. There is described expression vector that contains a cyclin gene, a cyclin-dependent kinase gene and one or several agents chosen from the group consisting of a gene coding the factor which inhibits production, function or activity of protein of Cip/Kip family and nucleic acid sequence which inhibits production of protein of Cip/Kip family. There is disclosed pharmaceutical composition containing said vector, and applied for treatment of cardiac diseases. There is offered cardiac hystiocyte produced by the declared method. There is presented method of treating a cardiac disease that implies injection of the disclosed pharmaceutical composition.

EFFECT: regeneration and recovery of cardiac hystiocytes.

31 cl, 13 dwg, 1 tbl, 6 ex

 

The invention relates to a method of proliferating cardiomyocytes mammals.

PRIOR art

Due to the loss of Mature cardiomyocytes ability to proliferation by cell division, heart damage caused by various stresses, such as ischemia and inflammation, leading to necrosis or loss of cardiomyocytes without subsequent recovery. Subsequently, the remaining cardiomyocytes exaggerated compensatory to maintain the functions of the heart. However, when the number of cardiomyocytes is reduced below an acceptable level, they are vulnerable to further damage and die. In the end, this condition leads to dysfunction of the heart muscle, namely heart failure.

Heart disease, mainly associated with heart failure, take the second place in the number of deaths in Japan. In addition, the prognosis of patients with heart disease are so bad that five-year survival is approximately 50% of patients. Thus, it is obvious that the development of effective methods of treatment of heart failure is currently very important from the point of view of medical care and health Economics. Currently used drugs for the treatment of heart failure includes the t digitalis preparations, which increase the strength of contraction of the myocardium, drugs xanthine and other cardiac stimulants, however, it is known that prolonged use of these drugs leads to deterioration. In recent years, the main direction of the treatment with the use of pharmaceuticals is the appointment of β-blockers and ACE inhibitors to reduce damage to the heart through activation of the sympathetic nervous system and renin-angiotensin system. However, these treatments are only symptomatic and unable to repair damaged heart tissue. On the other hand, the optimal method of treatment of serious forms of heart failure is heart transplantation. In connection with the problems caused by the small number of organ donors, the problems of medical ethics, trauma to the body, and also the high cost of treatment for the patient, a heart transplant may not be used as the primary method of treatment.

Was recently described method supports the introduction of cardiomyocytes in the injured tissue of the heart. It is known that in some animal experiments, when the embryo cardiomyocytes were injected into Mature cardiac tissue, the cells were able to function effectively as cardiomyocytes (for example, see non-patent reference 1). Research continues in obtaining cardiomyocytes of patentnyh cells, able to differentiate into various cells, including cardiomyocytes, the so-called embryonic stem cells (ES cells), for use as input cells. However, these methods are associated with significant difficulties of application in clinical medicine due to ethical constraints. There have recently been new attempts to introduce stem cells in the bone marrow tissue of the heart and ensure their differentiation into cardiomyocytes. However, the degree of differentiation was very low. Thus, this method has no practical significance for the regeneration and recovery of cardiomyocytes (see, for example, non-patent references 2, 3 and 4, in review).

The authors of this invention have investigated the regulatory mechanism of the cell cycle cardiomyocytes, in particular, the role of cyclin-cyclin-dependent kinase (CDK). At the same time, the authors found that although the expression of cycline type 4 and CDK4 induces stimulation, for example, serum or growth factors in cardiac myocytes, these protein molecules are localized in the cytoplasm and translocated in the nucleus, so there is no phosphorylation of RB protein, i.e. nuclear molecular targets Collina D-CDK4 or activation cycline E-CDK2. After that the authors of the invention was obtained adenoviral vector capacity, which has integrated the gene cycline D1, the sword of the frame signal localization in the nucleus (NLS) (called here D1NLS) and gene encoding CDK4, and they infected the culture of cardiomyocytes, in nuclei expressibility proteins cyclin D1 and CDK4, causing division and proliferation of cardiomyocytes by RB-phosphorylation. The authors then successfully stimulated the proliferation of cardiomyocytes, almost unable to divide in a normal culture conditions. In addition, the authors have introduced genes D1NLS and CDK4 in the tissue of cardiac muscle of adult animals for their expression, thus successfully prolonging the cell cycle cardiomyocytes of adult animals (see, for example, patent reference 1 and non-patent reference 5). The way the proliferation of cardiomyocytes according to the invention is denoted as a way DNLS/CDK. The content of the patent 1, non-patent references 5 and other links provided here are completely included in the description of the present invention.

The purpose of the induction of cell division was taken by a large number of other attempts to extend the cell cycle cardiomyocytes (see, for example, non-patent reference 6, as an overview about the prolongation of the cell cycle cardiomyocytes). For example, it was reported that when the culture of cardiomyocytes isolated from neonatal rats, expressed adenoviral gene EA/EV (see non-patent reference 7) or gene 2F (see non-patent reference 8), this results in the induction of DNA synthesis in cardiomyocytes. In transgenic mice, over expressing the intact gene is ilina D1, without any signal localization in the nucleus, in cardiomyocytes was observed an increased expression of the gene CDK4 along with increased DNA synthesis (see, for example, non-patent reference 9). Recently it was shown that mice deficient in jumonji gene that inhibits expression of a gene cycline D1, there is an increase in the duration of cell proliferation embryonic cardiomyocytes (see, for example, non-patent reference 10). As described above, it has been shown that increased DNA synthesis and elongation of the cell cycle even in cardiomyocytes. In the experimental examples, however, in cardiomyocytes often observed increased apoptosis and appearance of pathological polynuclear cells. No other way except DNLS/CDK, is not polutorachasovom period dividing cardiomyocytes with a real increase in the number of cells.

As described above, the method DNLS/CDK is an innovative method that increases the number of cardiomyocytes, which practically do not share" in normal conditions. Thus, this method has a wide industrial application.

It is known that many stimulating and inhibiting factors regulate the duration of the cell cycle of eukaryotic cells. Stimulating factors include the types of cyclina and CDK, while inhibiting factors include the number of protein groups, called the CDK-inhibitors. Identified two families of CDK inhibitors with different mechanism of action (see, for example, non-patent reference 11, in review). The first group of proteins called the Ink4 family and includes P6 (also known as Ink4A, Mts1, Cdkn2 and Cdkn4i), p15 (also called Ink4B and Mts2), p18 (also called Ink4C and Ink6A), and p19 (also called p20, Ink4D and Ink6B). The first group selectively binds to CDK4 or CDK6 and inhibits the action of the complex of cyclin D-CDK4 (or CDK6) (see, for example, non-patent references 12, 13 and 14). The second group of CDK-inhibitory proteins called proteins of the family of Cip/Kip and includes P21 (also known as Cip1, Pic1, Sdi1, mda6 and Waf1; here called - p21Cip1), p27 (also known as Ick, Kip1 and Pic2, here called - p27Kip1), and P57 (also called Kip2, here called p57Kip2). It is shown that, in contrast to the Ink4 family, a second family inhibits the duration of the cell cycle by inhibiting the functions of the various cyclin-CDK complexes (see, for example, non-patent reference 15, 16, 17 and 18).

As for how CDK-inhibiting proteins involved in the inhibition of proliferation of cardiomyocytes, there have been several messages about the role of molecules of the family of Cip/Kip. In particular, it is known that the level of p21 protein expressionCip1and p27Kip1increases followed by a decrease in the ability of cardiomyocytes to proliferation during the period from late in the embryonic to postnatal stage, the activity of CDK2 and CDK4, as target molecules, is reduced (see, for example, non-patent reference 19). Adding IGF-1 (insulin-like growth factor-1) to cardiomyocytes with increased expression of E2F-1 therein, the level of p21 protein expressionCip1and

p27Kip1is reduced, thus increasing the percentage of cardiomyocytes in the phase of DNA synthesis (S-phase) (see, for example, non-patent reference 20). It was also reported that mice deficient in the gene p27Kip1during that time , the proliferation of cardiomyocytes shorter than in normal mice, and the number of cardiomyocytes in gene-deficient mice increased (see, for example, non-patent reference 21). As described above, it was assumed that proteins of the family of Cip/Kip, in particular protein p27Kip1may participate in the inhibition of proliferation of cardiomyocytes. In addition to deletion of the gene do not know of other examples in which there is inhibition of the expression and function of proteins of the family of Cip/Kip, and, thus, strengthen the division and proliferation of cardiomyocytes.

It is known that the level of intracellular expression of proteins of the family of Cip/Kip mainly governed by the system of destruction through ubiquitinates path (see, for example, non-patent references 22, 23 and 24). Ubiquitin is a polypeptide consisting of a highly conserved 76 amino acids and is found in all Mature eukaryotic cells. Ubiquit the new path is what polyubiquitin chain covalently associated with the substrate-target and then destroyed multifunctional proteasome complex. Protein molecules, collapsing such ubiquitin-proteasome system include, in addition to protein family of Cip/Kip, a wide range of molecules, such as cyclin, p53, R, 2F, STAT-1, c-Myc, c-Jun, EGF-receptor, IkBα, NFkB and β-catenin. Currently under intensive study of the mechanism ubiquitination protein molecules. In General, protein molecules ubiquitinylation several groups of enzymes, namely ubiquitination enzyme (E1), ubiquitinmediated enzyme (E2) and ubiquitinate (E3), and, ultimately, destroyed by the 26S-proteasome (see, for example, non-patent reference 25, 26, 27 and 28, as surveys).

Probably ubiquitinate (E3) is responsible for the specificity of ubiquitination specific target proteins. There are a large number of examples, such as a complex that promotes the anaphase/cyclosome (APC/C), VHL (complex protein von Hipple-Lindau - alongin b/C (VBC)), Nedd4, Ufd4, Rad4, Rad18 and Parkin. Recently, in studies using lower biological organisms, such as yeast, was identified a new type ubiquitylated complex, called SCF. Ubiquitinate complex type SCF (sometimes referred to here ubiquitylated SCF complex) are the two which is a protein module, consisting of three subunits, called Skp1, Cul1 (another name Cdc53) and protein F-box. Name ligase SCF is an acronym of the names of the individual subunits (see, for example, non-patent references 29 and 30, as surveys).

Protein F-box, as one of the components of the SCF complex, contains a motif F-box, first identified in cyclin F. Region motif is required for interaction with Skp1. In addition, protein F-box contains a repeat region motif of approximately 40 amino acids, called repeat, WD-40, or motive, enriched with leucine, called leucine-rich repeat. In the SCF complex subunit Skp1 and Cull/Cdc53 never changed depending on the substrate-target, whereas molecular specificity protein F-box varies depending on the substrate-target ubiquitination. Recognizing and binding the substrate target repeat, WD-40 or repeat, leucine rich protein F-box determines the substrate specificity of SCF complex (see, for example, non-patent references 31, 32 and 33, as reviews). As described above, the SCF complex includes various types of SCFβTrCPSCFCdc4SCFMet30and SCFCrr1depending on differences in protein F-box contained as a component (see, for example, non-patent references 29 and 30).

In the case of a protein family of Cip/Kip in the ubiquitin-proteasome degradation involved the SCF complex, with the as containing a series of protein F-box Skp2 (SCF Skp2). Skp2 has been identified as a factor associated with collinum A-CDK2 complex. Because the accumulation of Skp2 occurs during the period from late G1 phase of the cell cycle, and the level of expressii reaches its maximum in the period from S phase to G2 phase, Skp2 called kinase-associated protein S-phase (see, for example, non-patent reference 38). There is evidence that, in addition to protein family of Cip/Kip, Skp2 recognize such protein molecules, as E2F-1 (see non-patent reference 39), cyclin E (see non-patent reference 40), CDK9 (see non-patent reference 41) and c-Myc (see non-patent references 42 and 43) as substrate targets, and Skp2 is involved in their degradation.

As described above, it is known that the CDK inhibitors, including protein family of Cip/Kip, are involved in the inhibition of proliferation of the major proliferating cells, thus, the ubiquitin-proteasome system by means of the SCF complexSkp2is responsible for the regulation of the level of intracellular expression. However, almost nothing is known about how the ubiquitin-proteasome system is involved in the mechanisms that regulate proliferation of cardiomyocytes.

Method DNLS/CDK is the only currently known method of proliferation of cardiomyocytes. The method is very effective and has a huge industrial application. To implement therapeutic method of regeneration of cardiac muscle in practice and its promyshlennogo the applications it is desirable to increase the efficiency of proliferating cardiomyocytes and their activity.

Patent reference 1: Pamphlet of International Publication WO 02/095026

Non-patent reference 1: Soonpaa, et al., Science 264:98, (1994).

Non-patent reference 2: Murry, et al., Cold Spring Harb. Symp. Quant. Biol. 67:519, (2002).

Non-patent reference 3: Menasche, Ann. Thorac. Surg. 75:S20, (2003).

Non-patent reference 4: Nir, et al., Cardiovasc. Res. 58:313, (2003).

Non-patent reference 5: Tamamori-Adachi, et al., Circ. Res. 92:e12, (2003).

Non-patent reference 6: Kishore, et al., Circ. Res. 90:1044, (2002).

Non-patent reference 7: Kirshenbaum, et al., J. Biol. Chem. 270: 7791, (1995).

Non-patent reference 8: Kirshenbaum, et al., Dev. Biol. 179:402, (1996).

Non-patent reference 9: Soonpaa, et al., Clin. Invest. 99: 2644, (1997).

Non-patent reference 10: Toyoda, et al., Dev. Cell 5: 85, (2003).

Non-patent reference 11: Sherr & Roberts, Genes Dev. 9:1149, (1995).

Non-patent reference 12: Hannon& Beach, Nature 371: 257, (1993).

Non-patent reference 13: Serrano, et al., Nature 366: 704, (1993).

Non-patent reference 14: Hirai, et al., Mol. Cell. Biol. 15:2672, (1995).

Non-patent reference 15: Harper, et al., Cell 75:805, (1993).

Non-patent reference 16: Polyyak, et al., Cell 78:59, (1994).

Non-patent reference 17: Toyoshima & Hunter Cell 78:67, (1994).

Non-patent reference 18: Matsuoka, et al., Genes Dev. 9:650, (1995).

Non-patent reference 19: Flink, et al., J. Mol. Cell. Cardiol. 30:563, (1998).

Non-patent reference 20: von Harsdorf et al., Circ. Res. 85:128, (1999).

Non-patent reference 21: Poolman, et al., Circ. Res. 85:117, (1999).

Non-patent reference 22: Pagano, et al., Science 269: 682 (1995).

Non-patent reference 23: Maki& Howley, Mol. Cell Biol. 17:355, (1997).

Non-patent reference 24: Urano, et al., J. Biol. Chem. 274:12197, (1999).

Non-patent reference 5: Coux, et al., Annu. Rev. Biochem. 65:801, (1996).

Non-patent reference 26: Hochstrasser, Annu. Rev. Genet. 30:405, (1996).

Non-patent reference 27: Pagano, J. FASEV 11:1067, (1997).

Non-patent reference 28: Hershko, et al., Annu. Rev. Biochem. 67:425, (1998).

Non-patent reference 29: Patton, et al., Trends Genet. 14:236, (1998).

Non-patent reference 30: Jackson & Eldridge, Mol. Cell 9:923,(2002).

Non-patent reference 31: Bai, et al., Cell 86:263, (1996).

Non-patent reference 32: Slowrya, et al., Cell 91:209, (1997).

Non-patent reference 33: Kobe, et al., Curr. Opin. Struct. Biol. 11725, (2001).

Non-patent reference 34: Carrano, et al., Nature Cell Biol. 1:193, (1999).

Non-patent reference 35: Tsverkov, et al., Curr. Biol. 9:661, (1999).

Non-patent reference 36: Bornstein, et al., J. Biol. Chem. 278:26752, (2003).

Non-patent reference 37: Kamura, et al., Proc. Natl. Acad. Sci. USA 100:10231, (2003).

Non-patent reference 38: Zhang, et al., Cell 82:915, (1995).

Non-patent reference 39: Marti, et al., Nat. Cell Biol. 1:14, (1999).

Non-patent reference 40: Nakayama, et al., EMBO J. 19:2069, (2000).

Non-patent reference 41: Kiernan, et al., Mol. Cell. Biol. 21:7956, (2001).

Non-patent reference 42: Kim, et al., Mol. Cell 11:1177, (2003).

Non-patent reference 43: von der Lehr, et al., Mol. Cell 11:1189, (2003).

Description of the INVENTION

In relation to the way the proliferation of cardiomyocytes object of the present invention is to provide a method for enhancing the proliferative activity of cardiomyocytes and the creation of a recombinant vector, and the like for use in this method.

MEANS to solve the aforementioned PROBLEMS

To solve these problems, the authors of the Britania analyzed the mechanism of cell cycle regulation of cardiomyocytes. Specifically, the authors studied this mechanism, paying particular attention to the role of individual factors in the cell cycle regulation of cardiomyocytes, increased expression of genes cyclina and CDK, in particular inhibitors of CDK. In addition, the authors found that a protein called P27Kip1relating to the family of proteins Cip/Kip and which is the inhibitor of CDK, unexpectedly excessively accumulates in the nuclei of cardiomyocytes with stimulation of cyclin and CDK.

It is known that protein family of Cip/Kip, mainly P27Kip1, ubiquitinated using ubiquitinate in most proliferating cells, and, thus, a protein of the family of Cip/Kip destroyed by the proteasome. Therefore, simultaneously with genes cyclina and CDK in cardiomyocytes expressively gene that encodes a component of ubiquitinate. Then it was discovered that the level of protein P27Kip1significantly reduced in the nuclei of cardiomyocytes. In addition, it was found a significant increase in the ability of cardiomyocytes to proliferation, and on the basis of these discoveries was made by the present invention.

In particular, this invention relates to a method for increasing the proliferative activity of cardiomyocytes by inhibiting the production, function and activity (efficiency) protein family of Cip/Kip expressed in cardiomyocytes, with stimulation of cyclin and CDK. Be the key family of Cip/Kip, activity which is subject to inhibition, is not limited, but the protein P27Kip1is preferred.

In the framework of this invention, the term "cardiomyocytes" means any cardiac muscle cells expressing numerous specific for cardiomyocytes markers that are recognized as morphological, physiological and/or immunological features of intact cardiomyocytes. The term includes not only cardiomyocytes obtained directly from the heart tissue of mammals and their primary cell culture, but also the cardiomyocytes, which differentiate from stem cells such as embryonic stem cells, stem cells in the bone marrow and CMG cells.

Any way of inhibition of inhibition, functioning and activity of the protein family of Cip/Kip can be considered acceptable and has no special restrictions. The method is aimed at the inhibition of expression of the gene encoding the protein, the inhibition of the production of the protein, the inhibition activity of the protein or an increase in protein degradation.

In particular, activation of protein degradation, preferably, is a way to activate ubiquitination protein. Ubiquitination can be achieved by introducing into the target cell, for example, pharmaceuticals, proteins, peptides, low molecular weight compounds and g is new.

In addition, a gene that activates ubiquitination protein family of Cip/Kip, preferably, is a gene that encodes a component of ubiquitinate, even more preferably, the gene encoding the factor F-box capable of contact with a protein of the family of Cip/Kip, including, for example, Skp2 gene.

When carrying out the invention, moreover, can be used a method of inhibiting gene expression (transcription, mRNA) of the gene encoding the protein of the family of Cip/Kip or inhibiting translation and production of the gene. For example, can be used siRNAs specific gene, codereuse protein family of Cip/Kip.

When carrying out the invention, moreover, the nucleotide sequence encoding the nuclear localization signal, is attached, preferably, at least one of the genes cyclina or CDK, for introducing the resulting gene in target cells. Cyclin able to activate CDK4 or CDK6 and preferably includes, for example, cyclin D1, D2 and D3 mammals. In addition, CDK is activated by cyclin D type and preferably includes, for example, CDK4 and CDK6 mammals.

In yet another embodiment, the invention relates to a vector carrying a gene cyclina, CDK gene and gene factor inhibiting the activity of a protein of the family of Cip/Kip. When we assume the introduction of a gene in cardiomyocytes, preferably, the introduction of production is t using a viral vector, or liposomes, or the like. As a viral vector, for example, can be used adenovirus.

In an additional embodiment of the invention the invention relates to pharmacological compositions containing the vector carrying the gene cyclina, CDK gene and gene factor inhibiting the activity of a protein of the family of Cip/Kip.

In yet another additional embodiment of the invention the invention relates to cardiomyocytes obtained by way of the proliferation of cardiomyocytes.

In another embodiment of the invention, the invention relates to a method of screening using cells obtained by the method of proliferation of cardiomyocytes, to identify new factors that support and promote the viability and function of cardiomyocytes and the like, or to identify chemotherapeutic agents and their capabilities.

In an additional embodiment of the invention the invention relates to a method of treatment of diseases of the heart, providing for the introduction (transplantation) patients pharmacological composition or cardiomyocytes in an area with weak cardiomyocytes, whose weak function or they are destroyed, for repair and cell proliferation.

Accordingly, the present invention generally relates to the following.

(1) How Strait is perezii cardiomyocytes, providing stage introduction (a) cyclina, (b) cyclin-dependent kinase, and (c) one or more agents selected from the group comprising the gene encoding the factor, which inhibits the production, function or activity of the protein family of Cip/Kip and nucleic acid inhibitory protein products of the family of Cip/Kip, in cardiomyocytes, and the stage subsequent cultivation or maintenance of these cells.

(2) Method of proliferation of cardiomyocytes which the stages of introduction (a) cyclina, (b) cyclin-dependent kinase, and (C) one or more agents selected from the group comprising the gene encoding the factor, which inhibits the production, function or activity of the protein family of Cip/Kip and nucleic acid, which inhibits the production of the protein family of Cip/Kip in cardiomyocytesin vitroand stage subsequent culturing of these cells.

(3) How the proliferation of cardiomyocytes which the stages of introduction (a) cyclina, (b) cyclin-dependent kinase, and (C) one or more agents selected from the group comprising the gene encoding the factor, which inhibits the production, function or activity of the protein family of Cip/Kip and nucleic acid, which inhibits the production of the protein family of Cip/Kip in cardiomyocytesin vivoand stage subsequent maintenance of cells.

(4) the Method described above in (1)-(3), wherein said cycle which is a cyclin, able to activate CDK4 or CDK6 mammals.

(5) the Method described above in (4), wherein said cyclin is cyclin D mammals.

(6) the Method described above in (1)to(5), in which the indicated cyclin-dependent kinase is a cyclin-dependent kinase that is activated by cyclin D.

(7) the Method described above in (6), in which the indicated cyclin-dependent kinase is a CDK4 or CDK6.

(8) the Method described above in (1)to(7), in which the protein family of Cip/Kip represents p27Kip1.

(9) the Method described above in (1)-(8)where the factor inhibiting the production, function or activity of the protein family of Cip/Kip, is a factor with activity, stimulating the degradation of the protein family of Cip/Kip.

(10) the Method described above in (9), in which factor activity, stimulating the degradation of the protein family of Cip/Kip, is a component of ubiquitinate.

(11) the Method described above in (10), in which the component ubiquitinate is a factor F-box capable of contact with a protein of the family of Cip/Kip.

(12) the Method described above in (11), where the factor F-box capable of contact with a protein of the family of Cip/Kip is a Skp2.

(13) the Method described above in (1)to(12), in which nucleic acid that inhibits the production of the protein family of Cip/Kip represents siRNAs, with elfico in respect of the gene encoding a protein of the family of Cip/Kip.

(14) the Method described above in (13), in which nucleic acid, inhibiting production of a protein of the family of Cip/Kip represents siRNAs, specific gene p27Kip1.

(15) the Method described above in (1)to(14), which includes the introduction of genes into cardiomyocytes using a viral vector or liposome.

(16) the Method described above in (1)to(15), in which at least one of the genes cyclina and cyclin-dependent kinase target nucleotide sequence encoding a nuclear localization signal.

(17) the Vector containing (a) a gene cyclina, (b) gene cyclin-dependent kinase, and (C) one or more agents selected from the group comprising the gene encoding the factor, which inhibits the production, function or activity of the protein family of Cip/Kip, and the sequence of the nucleic acid, inhibiting production of a protein of the family of Cip/Kip.

(18) the Vector described above in (17), in which cyclin is cyclin able to activate CDK4 or CDK6 mammals.

(19) the Vector described above in (18), in which cyclin is cyclin D mammals.

(20) the Vector described above in (17)-(19), in which the cyclin-dependent kinase is a cyclin-dependent kinase that is activated by cyclin D.

(21) the Vector described above in (20), in which the cyclin-dependent kinase is with the battle CDK4 or CDK6.

(22) the Vector described above in (17)-(21)where the factor inhibiting the production, function or activity of the protein family of Cip/Kip is a factor with activity, stimulating the degradation of the protein family of Cip/Kip.

(23) the Vector described above in (22), in which factor activity, stimulating the degradation of the protein family of Cip/Kip, is a component of ubiquitinate.

(24) the Vector described above in (23), in which the component ubiquitinate is a factor F-box capable of contact with a protein of the family of Cip/Kip.

(25) the Vector described above in (24), where the factor F-box capable of contact with a protein of the family of Cip/Kip represents Skp2.

(26) the Vector described above in any of the above (17)to(25), in which nucleic acid, inhibiting production of a protein of the family of Cip/Kip represents siRNAs specific in respect of the gene encoding the protein of the family of Cip/Kip.

(27) the Vector described above in (26), in which nucleic acid, inhibiting production of a protein of the family of Cip/Kip represents siRNAs, specific gene P27Kip1.

(28) the Vector described above in any of the above (17)to(27), in which at least one of the genes cyclina or cyclin-dependent kinase labeled nucleotide sequence that encodes a nuclear localization signal.

(29) the Pharmaceutical is Kai composition, which is used in the treatment of heart disease, containing a vector described in any of the above(17)-(28).

(30) the Pharmaceutical composition described above in (29), where heart disease is myocardial infarction, ischemic heart disease, dilated cardiomyopathy, myocarditis, or chronic heart failure.

(31) Cardiomyocytes obtained by the method described in any of the above(1)-(16).

(32) a Method of treating heart disease, representing the injection of a pharmaceutical composition as described above in (29), or transplantation of cardiomyocytes, as described in (31), in an area with a violation of the patient suffering from heart disease, and the maintenance and proliferation of cardiomyocytes in this field.

(33) the Method described above in (32), in which heart disease is myocardial infarction, ischemic heart disease, dilated cardiomyopathy, myocarditis, or chronic heart failure.

Advantages of the invention

Application of the method according to the invention allows to inhibit the activity of the protein family of Cip/Kip in the nuclei of cardiomyocytes and to stimulate, thus, the proliferation of cardiomyocytes. In addition, advantages and characteristic features of the invention is described below in the section "detailed description of the preferred method is to carry out the invention".

Brief description of drawings

Fig. 1

Expression of the protein P27Kip1in cardiomyocytes, transfected genes D1NLS and CDK4. When selecting nuclear protein expression of P27 proteinKip1evaluated by Western blot. CM: rat cardiomyocytes; REF: cellular line of rat fibroblasts (REF52 cells).

Fig. 2

Localization of the protein P27Kip1in cardiomyocytes, transfected genes D1NLS and CDK4. The infection of cardiomyocytes with recombinant adenovirus carrying LacZ gene (upper column, control), or gene D1NLS and CDK4 gene (lower column), intracellular expression of the protein P27Kip1was estimated by the method of immunofluorescence staining. The figure in green shows P27Kip1red color shows sarcomeric actin. In addition, the cell nucleus was stained with DAPI.

3

Regulation of expression of the protein P27Kip1in cardiomyocytes. Cardiomyocytes, FBS-stimulated or stimulated D1NLS+CDK4 were treated with a proteasome inhibitor of lactosamine (LC) for comparison by the expression of the protein P27Kip1.

4

Ubiquitination protein P27Kip1in cardiomyocytes. Cells isolated from cardiomyocytes (CM) or fibroblasts (REF) upon stimulation with FBS or stimulation D1NLS+CDK4, used for ubiquitination in vitro for subsequent determination of protein P27Kip1using Western-nl is tting. On FIGU refers to antibodies that are used in the analysis Western blotting. The band observed at higher molecular weight, is ubiquitination protein P27Kip1(p27-GST-Ub).

Fig. 5

Expression of protein Skp2 in cardiomyocytes. Cardiomyocytes, FBS-stimulated or stimulated D1NLS+CDK4, were treated with a proteasome inhibitor of lactosamine (LC) for comparison by the expression of the protein Skp2.

6

The decrease in protein P27Kip1through joint gene expression of Skp2. Studied the expression of the protein P27Kip1in cardiomyocytes, transfected genes D1NLS, CDK4 and Skp2.

Fig. 7

Localization of the protein P27Kip1in cardiomyocytes with coexpression in them genes D1NLS, CDK4 and Skp2. The infection of cardiomyocytes with recombinant adenovirus carrying the genes D1NLS+CDK4 (upper column, control), or carrying genes D1NLS+CDK+Skp2 (middle and lower column), and the processing part of cardiomyocytes proteasome inhibitor by echostation (LC) (lower column), intracellular expression of the protein P27Kip1was estimated by the method of immunofluorescence staining. The figure in green shows P27Kip1red color shows sarcomeric actin. In addition, the cell nuclei were stained DAPI.

Fig. 8

The effect of enhanced expression of Skp2 gene for the stimulation of proliferation of cardiomyocytes. When Jn is zirovanii cardiomyocytes recombinant virus, bearing the gene LacZ (control), genes D1NLS+CDK4, genes D1NLS+CDK4+Skp2 or only Skp2 gene, in these days were counting the number of cardiomyocytes.

Fig. 9

The decrease in protein P27Kip1due to the joint expression of siRNAs specific gene

P27Kip1. In cardiomyocytes, transfected genes D1NLS, CDK4 and siRNAs specific gene P27Kip1evaluated the expression of the protein P27Kip1.

Fig. 10

The effect of enhanced expression of siRNAs specific gene P27Kip1on stimulation of the proliferation of cardiomyocytes. The infection of cardiomyocytes with recombinant virus carrying the gene LacZ (control), genes D1NLS+CDK4, genes D1NLS+CDK4+siRNAs specific gene P27Kip1(P27 siRNAs), or bearing only siRNAs specific gene P27Kip1in these days of counting the number of cardiomyocytes.

Fig. 11

Study of the effect of enhanced expression of Skp2 gene on the weight of the lungs. Measured the mass of the lungs in rats 6 weeks after ischemia heart and reperfusion for counting relation to body weight. *: p<0.05 compared with the experimental group. #: p<0.05 compared with the control group.

Fig. 12

The change curve of the passive volume of the left ventricle in enhanced expression of Skp2 gene. Estimated curve passive volume of the left ventricle using heart of rats 6 weeks after ischemia heart and reperfusion. *: p<0.05 compared with the experimental group. #: p<0.05 sravnenie is with the control group. †: p<0.05 compared with group D1NLS.

Fig. 13

Study of the effect of enhanced expression of Skp2 gene to reduce the area of myocardial infarction. Measured the area of myocardial infarction in rats 6 weeks after ischemia heart and reperfusion for counting relationship to the area of the left ventricle. #: p<0.05 compared with the control group.

+Indicates the addition of FBS and pharmaceutical agents or infections of various types of adenoviruses.

-: Indicates no addition of FBS and pharmaceutical agents or infection by different types of adenoviruses.

P27: Indicates the protein P27.

The best way of carrying out the invention

When carrying out the invention and with the purpose of implementation of the invention in practice, professionals can go to a normal reference manuals in the field of molecular biology, Microbiology, cell biology and basic techniques such as recombinant DNA technology and similar technologies, if not stated otherwise. These sources include, for example, Molecular Cloning: A Laboratory Manual, the 3rdedition (Sambrook &Russel, Cold Spring Harbor Laboratory Press, 2001); Current Protocols in Molecular biology (edited by Ausubel,et al., John Wiley & Sons, 1987); Methods in Enzymology in series (Academic Press); PCR Protocols: Methods in Molecular Biology (edited by Barlett & Striling, Humana Press, 2003); Animal Cell Culture: A Practical Approach, the 3rdedition (edited by Masters, Oxford University Press, 2000); Antibodies: A Laboratory Manual (edited by Harlow,et al. & Lane, Cold Spring Harbor Laboratory Press, 1987). Reagents and kits for cell culture and experiments in the field of cell biology, which are referred to in the present description, may be commercially available from manufacturers such as Sigma, Aldrich, Invitrogen/GIBCO, Clontech and Stratagene.

Obtaining cardiomyocytes

Cardiomyocytes as a target for proliferation using the method according to the invention include all cells in the development stage, such as cardiomyocytes of the embryonic type, postpartum type and Mature type, and are defined as cells with at least one, preferably several, markers or standards that are approved by at least one, preferably several methods described below.

The expression of different markers that are specific for cardiomyocytes, can be determined by conventional biochemical or immunochemical methods. These methods is not limited. Preferably used immunochemical methods, such as immunohistochemical staining and immunoelectrophoresis. This can be used in marker-specific polyclonal antibodies or monoclonal antibodies that react with cells-precursors of cardiomyocytes or cardiac myocytes. Antibodies against individual-specific markers that are commercially available and can easily be used. Markers that are specific for cells before the of estevanico cardiomyocytes or cardiomyocytes, include, for example, a heavy chain/light chain of myosin, α-actinin, troponin I, ANP, GATA-4 and Nkx2,5 and MEF-2C.

On the other hand, the expression of markers specific for cell-cardiomyocyte precursors or cardiomyocytes, can be confirmed by methods of molecular biology, widely used in their respective fields for amplification, detection and analysis of mRNA encoding the relevant protein markers, including, for example, polymerase chain reaction with reverse transcriptase (RT-PCR) and hybridization analysis. Nucleic acid sequences encoding the protein markers (e.g., heavy chain/light chain of myosin, α-actinin, troponin I, ANP, GATA-4 and Nkx2,5 and MEF-2C) - specific cell-cardiomyocyte precursors or cardiomyocytes, are known and can be obtained from public databases such as GenBank at the National Center for Biotechnology. Marker-specific sequence required for use as primers or probes can be easily defined.

In addition, can be used physiological signs. In particular, can be applied such features as Autonomous pulsation of cardiomyocytes and expression of various ion channels in cardiomyocytes, so that the cardiomyocytes could respond to electrophysiological stimuli.

In accordance with what means according to the invention, the object can be used directly cardiomyocytes present in the tissues of the mammalian heart. In addition, can also be used cardiomyocytes isolated from fresh tissues of the heart by various methods, such as enzymatic processes or primary cell culture obtained by culturing cardiomyocytes under appropriate conditions within one to 5 days. Specific methods of culturing cardiomyocytes described in a number of guidelines. These methods include a method Chien'and modified the way Chien'and (Chien, et al., J. Clin. Invest. 75: 1770, 1985; Meidell, et al., Am. J. Physiol. 251: H1076, 1986; Tamamori, et al., Am. J. Physiol. 275: H2036, 1998).

In addition, cultured cardiomyocytes include cardiomyocytes derived by inducing differentiation of stem cells, not limited to the methods described here. Stem cells for use according to the invention indicate cells with the ability of the potential of differentiation into cells with cardiomyopathy phenotypes, when cultivated in vitro. In particular, stem cells include, for example, embryonic stem cells (ES cells) and embryonic stem cells (EG cells)derived from mammals such as mice, monkeys and humans, for use in cell cultures, and multipotential stem cells, such as multipotent zrelye precursor cells (MARS). Established standard protocols for the implementation of the methods of preparation, cultivation and storage of these cells. These multipotential stem cells can easily be used in accordance with the descriptions of many guidelines, such as, for example, Manipulating the Mouse Embryo: A laboratory manual (edited by Hogan,et al., Cold Spring Harbor Laboratory Press, 1994), Embryonic Stem Cells (edited by Turkesen, Humana Press, 2002) and in several articles (Matsui,et al., Cell 70:841, 1992; Shamblott,et al., Proc. Natl. Acad. Sci. USA 95:13726, 1998; U.S. patent No. 6090622; Jiang, et al., Nature 418:41, 2002; international publication No. 01/11011).

Stem cells that can be used in accordance with the invention are not limited to the three types described above. Any stem cells that are similar in their properties with ES cells, can be used. In this connection properties similar to the properties of ES cells, can be defined as cell biological properties that are specific to ES cells, such as the presence of surface marker (antigen)specific to ES cells, the expression of a gene specific to ES cells, the ability to form a teratoma and ability to generate chimeric mice. Specific examples include stem cells, similar in its properties to ES cells, such as stem cells, obtained by processing cells in the hair follicle and epidermis cells to chemical agents such as 5-azacytidine (Sharda has cheap as chips & Zaher, International publication No. 02/051980), stem cells, obtained by processing mononuclear cells antibody CR3/43 (Abuljadayel, Curr. Med. Res. Opinion 19:355. 2003), and stem cells derived from the Mature cells of the inner ear (Li, et al., Nature Med., preliminary on-line publication).

The method according to the invention can be applied to any cells without properties similar to the properties of ES cells or any remotepoint cells unless the cell has at least the ability to differentiate into cells with a phenotype similar to the phenotype of cardiomyocytes, at least under cultivation in vitro. Examples of such cells include mesenchymal stem cells originating from bone marrow cells (Bruder, et al., U.S. patent 5736396; Pittenger, et al., Science 284:143, 1999: international publication number WO 03/035382).

As a method of cultivation for obtaining cardiomyocytes from stem cells according to the invention, any method acceptable to the induction of differentiation of cardiomyocytes, can be used. In the case of using, for example, ES cells, the method of cultivation includes, for example, the suspension method of cultivation, method of cultivation in hanging drop, fashion co-culture with supporting cells, rotary method of cultivation, method of cultivation in soft agar and way of cultivation on the micron is the bearers. Created numerous ways for the induction of differentiation. Those wishing to apply the invention in practice can find the manuals, such as Embryonic Stem Cells (edited by Turkesen, Humana Press, 2002) and a number of reference manuals (Klug, et al., J. Clin. Invest. 98:216, 1996; Wobus, et al., J. Mol. Cell. Cardiol. 29:1525, 1997; Kehat et al., J. Clin. Invest. 108:407, 2001; Xu, et al., Circ. Res. 91:501, 2002; Takahashi, et al., Circulation 107:1912, 2003; Field, et al., U.S. patent 6015671; Xu, et al., International publication number WO 03/06950).

Method proliferation of cardiomyocytes

One way of carrying out the invention is a method of proliferating cardiomyocytes which the stages of introduction and expression cyclina and CDK in cardiomyocytes and stage of inhibiting the expression, function and activity of the protein of the Cip/Kip. As cardiomyocytes, cells were isolated from the living tissues of the heart in various ways, such as enzymatic treatment, primary cell culture obtained by culturing the above-mentioned cardiomyocytes under certain conditions within one to 5 days, and can also be used cardiomyocytes differentiated from a variety of stem cells, as described above. Cardiomyocytes present in the heart tissue of mammals, can proliferate in the immediate treatment of cardiomyocytes in a variety of ways, described below, and maintenance of cells in vivo. The term "maintaining" here means the AET providing the cells ability to exist without any changes of physiological functions, in the physiological environment of the biological body, for example, at an acceptable body temperature and blood supply to the extent necessary to maintain the cells.

One of the most preferred methods for the introduction and/or expression cyclina and CDK in cardiomyocytes is the way DNLS/CDK previously described by the inventors (see patent reference 1 and non-patent reference 5). In particular, initially receive two types of adenoviral vectors with gene D1NLS (cyclin D1, labeled NLS) or CDK4 gene, introduced into vectors; then two types of viruses injected into cardiomyocytes to localize in the nucleus protein cycline D1 and CDK4 protein so as not to cause significant strengthening of the division and proliferation of cardiomyocytes. The content of the patent is also included in the present description.

When implementing the invention, the method of introduction and/or expression cyclina and CDK in cardiomyocytes can be any, without special restrictions, by the way, if he can cause the same effect as the method DNLS/CDK. For example, cyclin introduced and expressed in cardiomyocytes, can be any of cyclin able to activate CDK4 or CDK6. In addition cycline D1 can be used genes cyclina D2 or D3.

This CDK can satisfactorily be activated by cyclin d type, such as CDK can be used not only CDK4, and CDK6. Such genes cyclina and CDK were you the Helena and identified from various organisms, including humans. In addition, can be used nucleotide sequences from public DNA databases such as GenBank. Thus, the person skilled in the art can easily obtain the desired genes by designing specific primers or probes, and then using the basic approaches of molecular biology.

As a way of introduction cyclina and CDK in cardiomyocytes can be applied by physical methods, such as microscopic injection. From the point of view of efficiency of introduction, it is preferable to apply the method of transliterowany gene. In addition, the protein molecules produced in the cytoplasm of cardiomyocytes in expression transfitsirovannykh gene mainly moved into the kernel. In this regard, can be used any way, without special restrictions. The method includes, for example, the method of joining each of the genes of the nucleotide sequence that encodes a NLS. Two types of proteins produced by these genes, namely cyclin and CDK form in the cytoplasm of the complexes. If any of these proteins, preferably, cyclin, has a NLS sequence, respectively, the resulting complex can be moved into the kernel. Currently, there are three types of NLS sequences. In particular, the first example is of the type with almost missing key amino acids such as lysine and arginine, and they, for example, is that NLS nucleoprotein influenza virus (Davy, et al., Cell 40:667, 1985). An example of the second type is the type with a higher content of essential amino acids, and, for example, is the sequence of the NLS (N-Pro-Lys-Lys-Lys-Arg-Lys-Val-C; SEQ ID NO.1) antigen SV40 T (Kalderon, et al., Nature 311:33, 1984). A third example is the type where the basic amino acids form a cluster with an interval of about 10 amino acids, and it is called the NLS of type double (Robbin, et al., Cell 64:615, 1991). During implementation of the invention can be used NLS any of the three types. Can also be used NLS, not related to these three types. Taking into account the length of the sequence of the NLS, the ability to move the desired protein molecule in the nucleus, and easily accessible gene sequence of the NLS, preferably, can be used the sequence of the NLS of SV40 antigen So for Example, a plasmid containing the sequence of the NLS of SV40 antigen T, namely, pEF/myc/nus, commercially available from the company Invitrogen.

According to the invention the protein family of Cip/Kip is a series of protein groups that are part of one family of CDK inhibitors, negatively regulating the duration of the cell cycle and consisting of three molecules: p21Cip1, p27Kip1and p57Kip2. It is known that protein family of Cip/Kip inhibits the function of different complexes of cyclin-CDK, such as cyclin D-CDK4/CDK6 and cyclin A/E-CDK2 (see review Sherr &Roberts, Genes Dev. 9:1149, 1995).

Among the proteins of the family of Cip/Kip, are currently being explored, in particular the function and features of the protein p27Kip1. p27Kip1was first identified as a factor binding to the complex of cyclin E-CDK2 in cells with the cell cycle, stopped incentive TGF-β (Koff, et al., Cell 66:1217, 1991). It is known that p27Kip1is a negative regulator of the cell cycle responsible for the stagnation in G1 phase. For example, overexpression of the protein p27Kip1in mammalian cells causes cell cycle arrest in the G1 phase (Polyak, et al., Cell 79:59, 1994; Toyoshima & Hunter Cell 78:67, 1994). It is assumed that p27Kip1plays a significant role in the G0 phase delay in the static phase, as p27Kip1actively expressed at this stage of the cells (Nourse, et al., Nature 372:570, 1994). The following studies show that p21Cip1and p57Kip2structural, functional and distinctive features, very similar to those of p27Kip1(Mainprize, et al., J. Neurooncol. 51:205, 2001; Conqueret, Trends. Cell Biol. 13:65, 2003). Therefore, if not stated otherwise, in the present description, the term protein (family) Cip/Kip indicates three types of proteins, p21Cip1, p27Kip1and p57Kip2mainly p27Kip1.

When carrying out the invention a method of inhibiting the functions and activity of the protein family of Cip/Kip is not specifically limited. An example of such a method I have is the method of inhibiting the activity of a protein of the family of Cip/Kip, introducing into cells of neutralizing antibodies, inhibiting the function and activity of the protein, or low-molecular compounds or similar compounds in the cells. Furthermore, the method, which stimulates the degradation of protein family of Cip/Kip, is also not specifically limited. However, preferably, it is a method of promoting ubiquitination protein.

Ubiquitin is a polypeptide, a large number of presents in all eukaryotic cells. The level of expression of a protein of the family of Cip/Kip in cells is mainly regulated by the system of destruction through ubiquitination path (Pagono, et al., Science 269:682, 1995; Maki & Howley, Mol. Cell Biol. 17:355, 1997; Urano, et al., J. Biol. Chem. 274:12197, 1999). In particular, polyubiquitin chain covalently binds with protein Cip/Kip (ubiquitinylation) by function and activity ubiquitination enzyme (E1), ubiquitinmediated enzyme (E2) and ubiquitinate (E3). Further ubiquitination protein Cip/Kip finally destroyed by the 26S proteasome. Therefore, the method of introduction into the cardiomyocyte molecules, causing ubiquitination protein Cip/Kip, is preferred when carrying out the invention. Any substance with the effect of causing ubiquitination protein Cip/Kip is an acceptable substance for introduction into cardiomyocytes. In particular, the substance, including the example pharmaceutical agents, proteins, peptides and low molecular weight compounds. Preferably, use of the nucleic acid, namely gene. This gene include genes encoding proteins that comprise ubiquitination enzyme ubiquitinmediated enzyme and ubiquitinate. Taking into account that ubiquitinate responsible for the specificity of ubiquitination protein target, it is preferable to use the gene encoding proteins that comprise ubiquitinate.

At the present time, there are numerous molecules, as ubiquitinate, including complex APC/C complex VBC, the SCF complex, Nedd4, Ufd4, Rad5, Rad18 and Parkin. In addition, there are several types of SCF complex, depending on differences in protein F-box contained in them as components, such as SCFβTrCPSCFCdc4SCFMet3and SCFGrr1(Patton, et al., Trends Genet. 14:236, 1998; Jackson & Eldridge, Mol. Cell 9:923, 2002). As ubiquitinate (complex)involved in ubiquitination protein Cip/Kip, ubiquitinate called SCFSkp2. Preferably use a gene that encodes a component of complex, but it is not specifically limited. The gene encoding a component of ubiquitinate with the action causing ubiquitination protein Cip/Kip, can also be used. It is known that the molecules of SCFSkp2protein F-box, called Skp2, the company shall and, recognizes a protein of the Cip/Kip and associated with and attached to the protein polyubiquitin chain (Carrano, et al., Nature Cell Biol. 1:193, 1999; Tsvetkov et al., Curr. Biol. 9:661, 1999; Bornstein, et al., J. Biol. Chem. 278:26752, 2003; Kamura et al., Proc. Natl. Acad. Sci. USA 100:10231, 2003). Therefore, when carrying out the invention the gene encoding the protein Skp2 (sometimes in the present description called genome Skp2), is preferred for use as a gene introduced into cardiomyocytes.

Skp2 gene was isolated and identified in humans (Zhang, et al., Cell. 82:915, 1995) and animals such as mice (Nakayama, et al., EMBO J. 19:2069, 2000; Nakayama, et al., JP-A-2001-224380) and rats. Also known nucleotide sequence. In addition, can be used nucleotide sequences from public DNA databases such as GenBank (Skp2 person: U33761, AY029177; Skp2 mouse: AF:083215, BC003468). Thus, the person skilled in the art can easily obtain and use Skp2 gene, designing specific primers or probes specific for the gene Skp2, and then applying the basic approaches of molecular biology. Genes Skp2 obtained from mammals such as human, mouse or rat, can lead to similar results, and that Skp2 gene, when the device is used for carrying out the invention.

When carrying out the invention, moreover, not only Skp2 gene, but also genes encoding factors that cause ubiquitination and/or destruction of the tree Cip/Kip (here called genes, causing the degradation of protein Cip/Kip), as Skp2 gene, can be used as a gene for insertion into cardiomyocytes. For example, can be used genes encoding protein F-box, recognizing and binding protein Cip/Kip protein F-box, which is 80% or more homology, preferably 90% or more homologous to the amino acid sequence region of the motif, called WD-40 repeat, or repeat, rich in leucine, considered as a place of recognition/binding of the substrate Skp2, and components ubiquitinate that can cause ubiquitination protein Cip/Kip.

Genes encoding proteins of any of the factors, and with specific binding and/or interaction with the protein p27Kip1causing its destruction without direct involvement in ubiquitination protein Cip/Kip, can also be used in the method according to the invention. It was reported, for example, about nucleoporin 50, the protein that binds to the nuclear pore membrane (also called Nup50, NPAP60 and p163) (Buergin, et al., EP No. 926236; Mueller, et al., EMBO J. 19:2168, 2000; Smitherman, et al., Mol. Cell. Biol. 20:5631, 2000; Buergin, et al., U.S. patent No. 6265562)and Jab1/CSN5, signalosome Cop9 (Tomoda, et al., J. Biol. Chem. 277:2302), and genes. It is known that when the serine residue at position 10 in p27Kip1phosphorylated, p27Kip1binds with protein CRM1, which underno-localized vector, so p27Kip1get the camping from the kernel and then destroyed (Ishida, et al., J. Biol. Chem. 277:14355, 2002; Connor et al., Mol. Biol. Cell 14:201, 2003). Was identified KIS (interacting with the kinase statin), which is a specific phosphorylate serine residue in position 10 protein (Boehm, et al., EMBO J. 21:3390, 2002). The method, which uses the gene encoding KIS, is also included in the scope of the present invention. In accordance with the invention, the factors or genes associated with factors that can be used separately or in combination with some other factors, or genes to stimulate protein degradation of the family of Cip/Kip.

As described above, a typical example of a preferred embodiment of the invention involves the step of introducing the gene encoding cyclin and CDK, at least one of which is labeled NLS, and the gene that causes the degradation of protein Cip/Kip, in cardiomyocytes, and the expression of these genes in them. Preferably, these genes are attached to the nucleic acid sequences, which makes it possible transcription and expression of genes in mammalian cells, especially cardiac myocytes, the so-called promoter sequence, so that the transcription and expression was under control of the promoter. In addition, transcribed and expressed the gene should preferably be connected to the signal polyA (polyA). Preferably, the promoter includes, for example, the promoter shall, derived from viruses such as SV (simian virus 40 virus, cytomegalovirus (CMV) and sarcoma virus rose; and β-actin promoter and EF (elongation factor) 1α promoter. Moreover, it is acceptable GAG promoter (Niwa et al., Gene 108:193, 1991), which is a hybrid promoter, obtained by introducing the gene amplifier CMV sequence and polyA signal of β-globin rabbit in the promoter of the chicken β-actin.

In another method of carrying out the invention, the promoter used in the transcription and expression of the gene is a promoter specific for cardiomyocytes. Even in this case, transcribed and expressed the gene should preferably be connected to the signal poly. The promoter, specific for cardiomyocytes includes, for example, the promoter of the light chain of myosin-specific cardiomyocytes (Lee, et al., J. Biol. Chem. 267:15876, 1992), the promoter of the heavy chain of myosin-specific cardiomyocytes, and the promoter of the cardiac protein with ancyranum repeat (CARP), specific for cardiomyocytes (Guo, et al., Development 126:4223, 1999; International Publication No. WO 00/15821). The nucleotide sequences of these promoters can be obtained from public DNA databases such as GenBank. Using the basic approaches of molecular biology can be obtained gene vectors containing the desired gene sequence.

In accordance with the invention, the method Engibarov the s gene expression, encoding a protein (transcription of mRNA), or a method of inhibiting the translation and production of the gene product can also be used instead of the method of promoting the destruction of the protein family of Cip/Kip. In particular, oligonucleosomal acid or its derivatives or similar compounds, inhibiting or stopping the gene encoding the protein of the family of Cip/Kip, or the gene encoding the factor capable of inducing expression of a protein can be introduced intracellularly. In accordance with the invention, the term "derived oligonucleosomal acid" means a compound obtained by chemical modification, addition or substitution in a certain place of the nucleic acid in order to increase intracellular stability and efficiency of introduction of the nucleic acid. A derivative includes, for example, a modified phosphorothioate group oligonucleosomal acid or oligonucleosomal acid obtained by the substitution of uridine or cytidine 2'-fluorouridine or 2'-fluorocytidine.

Available oligonucleosome acid, which can be used, for example, to obtain antisense DNA, DNA encoding RNA with ribozyme activity, and false DNA. Recently, a method of RNA interference (called RNC)that uses double-stranded RNA. RNC is a phenomenon specific endogenous destruction is RNA gene target when double-stranded RNA with the same sequence as the gene target, or with similar gene target sequence is introduced intracellularly. In the initial stages, it was assumed that the use of RNC as method-specific inhibition of genes in mammals is associated with great difficulties. It was shown that in the case of short double-stranded RNA as an intermediate product RNC (called short/small interfering RNA; siRNAs), RNC applicable to mammalian cells (Hammond, et al., Nat. Rev. Genet. 2:110, 2001; Elbashir, et al., Nature 411-494, 2002). As reviews siRNAs, methods of production and methods of use, see, for example, various textbooks, for example, RNA Interference (RNC): The Nuts & Bolts of siRNA Technology (edited by Engelke, DNA Press, 2004) and RNA Interference, Editing, and Modification; Methods and Protocols (edited by Gott, Humana Press, 2004).

siRNAs can be easily obtained in the usual way polymerase chain reaction (PCR) or by chemical synthesis. It is known that the effect of siRNAs depends on the particular sequence. siRNAs specific for the gene of the protein of the Cip/Kip, can be obtained on the basis of the gene sequence of a gene, preferably, the sequence 300-bp, starting from the initiating codon. Gene used in siRNAs, not necessarily must be exactly the same as gene target. Gene used in siRNAs must be homologous gene target for men is our least 70%, or more preferably, 80% or more, more preferably 90% or more, most preferably 95% or more. Nucleotide sequence of a gene can be obtained from public DNA databases such as GenBank. Proteins p27Kip1human, mouse and rat registered under access numbers U10906, U10440 and D83792, respectively. It was reported about the various methods and programs for designing more effective siRNAs (Chalk, et al., Nucl. Acids Res. 32:936, 2004; Reynolds, et al., Nat Biotechnol. 22:326, 2004). The person skilled in the art can obtain and use siRNAs specific for the gene of the protein of the Cip/Kip, as well as for p27Kip1.

siRNAs obtained in this way can be used in the form oligonucleosomal acid or its derivative. With the aim, for example, improving the efficiency and duration of action of siRNAs preferably used in the form introduced in the vector expressing the RNA. The vector expressing the RNA includes, for example, expressing any vector with a promoter allowing the expression of siRNAs, without specific restrictions. It is preferable to use the promoters of Pol. III, suitable for the expression of short RNA, in particular promoters of U6 and H1. In addition, it is preferable to use a tRNA promoter, providing the localization of the product of transcription in the cytoplasm. siRNAs expressing vector, which is you can use these promoters, commercially available from Ambion, Invitrogen, TAKARA and iGene.

As way of introduction of a gene or gene vector can be used known methods. The method includes, for example, methods of transfection using calcium phosphate and an electric pulse, the method comprising introducing a desired gene into liposomes and then transferowania gene in a cell, the method comprising attaching the desired gene to gene vectors, such as retrovirus and adenovirus, and infection resulting recombinant virus into the cell. In this case, the term viral vector means a construction in which the desired gene is introduced into the sequence of the nucleic acid with a lack of or change in full length or part of the viral DNA or RNA, to ensure the expression.

Viral vectors include vectors derived from, for example, adenovirus, adeno-associated virus (AAV), retrovirus, virus haemagglutination Nippon (HVJ; another name for the Sendai virus), lentivirus, vaccinia virus, the virus of chicken pox and papovavirus, including SV40. Using an adenovirus vector, an AAV vector, the HVJ vector or vector lentivirus, preferably, may be made effective gene transfer and high level of transgene expression. The movement of a gene with these viral vectors is the most promising way to put what I genes in mammalian cells. In particular, the method is applicable for the introduction of genes into all types of human cells and a large number of nonhuman cells. Because infection with these viruses is not dependent on the cell cycle, genes can be expressed in many models of primary cell cultures and the series of transformed cells. Genes can be introduced with high efficiency even in cells without DNA synthesis or cell division, such as cardiomyocytes. Since a large number of cells receive multiple copies of a recombinant DNA (RNA) after infection, entered temporarily gene is expressed at a high level. In the case of adenoviral vector and vector HVJ, for example, DNA/RNA remain largely in the cytoplasm and not penetrate into the core. Therefore, when using these viral vectors, there is not yet any random mutagenic errors when clearly manifests of alien gene ustroivshis into the genome of the host cell.

An adenoviral vector, as one of the preferred uses in accordance with the invention, can be obtained by the method using homologous recombination in cells of the host, such as human embryonic kidney cells 293 or Esherichia coli (Miyake, et al., Proc. Natl. Acad. Sci. USA 93:1320, 1996), and easy way ligation in vitro (Mizuguchi, et al., Hum. Gene Ther. 9:2577, 1998). An adenoviral vector is one of the DNA-VIR the owls double-stranded DNA genome. The adenovirus type 5 and type 2 human have been studied most intensively. By removing the majority of the E1 and E3 genes from a wild strain of these adenoviruses can be derived viral vector is unable to replicate, so alien DNA size KBP can be entered without side effects on the formation of viral particles. Recombinant adenovirus does not contain E1 gene, which is the factor in the regulation of transcription. However, the adenoviral vector can Express the desired gene is introduced through a single transcription units that are specific to the introduced gene, regardless of the proliferation of the target cells or the presence or absence of other viral gene.

Those wishing to apply the invention in practice can refer to the various manuals that provide reviews on adenoviral vector and other viral vectors, and methods of making and using such methods. These guides include, for example, Gene Therapy Protocols: Methods in Molecular Medicine (edited by Robbins, Humana Press, 1997), Gene Transfer in Cardiovascular System: Experimental Approaches & Therapeutic Implications (edited by March, Kluwer Academic Publishers, 1997), Adenoviral Vectors for Gene Therapy (edited by Curiel & Douglas, Academic Press, 2002). Sets to obtain adenoviral vector commercially available. For example, Adenovirus Expression Vector Kit (No. 6170), commercially available from Takara Bio company, suitable for carrying out the invention. The authors from whom retene recently reported on the successful example of this application (see Nakayama, et al., EMBO J. 19:2069, 2000; patent reference 1 and non-patent reference 5, described below).

If necessary expression of several genes, such as gene combinations cyclina and CDK gene, and a combination with another gene, causing the degradation of protein Cip/Kip, in accordance with the invention, these two types or three types of genes can be introduced into one viral vector for infection, or may be infected in the form of a separate recombinant vectors. In the case of competitive infection with various recombinant viruses, the infection can be carried out together or be separated by a certain interval of time. As a measure of the infected viruses, in accordance with the invention, uses the mother liquor of the virus, for example, from 107up to 1013plaque-forming units/ml, more preferably from 109up to 1012plaque-forming units/ml For cell culture the mother liquor of the virus, preferably, should be about 100 viruses per cell (moi=100) for infection. Viral titer can be easily obtained by analysis of plaques.

In another embodiment of the invention instead of (1) gene cyclina, (2) gene CDK and (3) one or more genes that cause degradation of the protein family of Cip/Kip or nucleic acids, inhibiting production of a protein of the family of Cip/Kip, can be used, niskama colerne connection with the effect of gene expression and the same effect, that this gene, and specifically includes, for example, the connection with the action, similar to that of protein cyclina connection with the action, similar to that of protein CDK, the connection with the action, contributing to the degradation of protein Cip/Kip, or in connection with the action, inhibiting the production of protein Cip/Kip. In this case, the method of introducing the compound into cardiomyocytes has no specific limitations. In General, the compounds are dissolved in a pharmaceutically acceptable carrier, such as buffered physiological saline solution, and solutions of the diluents to obtain dosage forms, such as forms for oral administration, intravenous injection, intraperitoneal injection, percutaneous injection, subcutaneous injection, and direct injection into cardiac tissue. When cardiomyocytes are in culture, the connection may also be added directly in their culture medium.

(Use as a gene therapy method)

In another embodiment, the invention can be obtained pharmaceutical composition for gene therapy, and the composition contains a gene vector for use in the practice of the invention, preferably, the viral vector, more preferably an adenoviral vector or HVJ vector, AAV vector or lentiviral transfer vector. Every pharmaceutical composition for gene is Oh therapy can be used as pharmaceutical agents for the regeneration of cardiomyocytes or as a therapeutic agent in diseases of the heart. This application can be effective for any disease of the heart, if heart disease occurred damage, functional impairment or death of cardiomyocytes. Specific examples of such diseases include myocardial infarction, ischemic heart disease, congestive heart failure, hypertrophic cardiomyopathy, dilated cardiomyopathy, myocarditis and chronic heart failure.

Acceptable is any form of pharmaceutical compositions. The pharmaceutical composition can be obtained in the usual way. For example, the pharmaceutical composition may be in the form of injectable form containing the vector of gene expression of the invention in pharmaceutically acceptable carriers, such as sterile water, buffer, saline solution, and the dilution solution. Pharmaceutical acceptable carriers may further contain appropriate stabilizers (for example, inhibitors of nucleases), chelating agents (such as EDTA) and/or other auxiliary agents. Pharmaceutical composition comprising the components can be sterilized by filtration and in a similar fashion, if necessary, and then placed in a sterile vial. Using, for example, osmotic osmotic pump or tube, the drug may then be delivered to the place of the invalid who I am. Here, the dose of the pharmaceutical composition according to the invention increase or decrease depending on the need, respectively, depending on conditions such as age, sex, body weight and symptoms of the patient and route of administration doses. The person skilled in the art may accordingly determine the correct dose. Typically, a single dose adults is in the range of 1.0 microgram/kg to 1.0 g/kg, preferably in the range from 10 μg/kg to 100 mg/kg In the case of viral vectors, such as adenoviral vector, additionally, the final titer of the virus, preferably, 107up to 1013plaque-forming units/ml, more preferably, 109up to 1012plaque-forming units/ml

In the case when the vector of gene expression is a non-viral vector, in particular, the pharmaceutical composition of the invention can be delivered in a liposome complex. Through every form of the pharmaceutical composition can realize high efficiency of transfection, in particular, in cardiomyocytes. As specific examples of liposomes has been developed a large number of lipid drugs, including for example N-[2,3-(dialerace)propyl]-N,N,N-trimethylammoniumchloride (DOTMA) and dioleoylphosphatidylcholine (DOFA). Experiments were carried out by transfection with various cellular systems. (Banerjee, J. Biomater Appl. 16:3, 2001; Maurer, et al., Expert Opin. Biol. Ther. 1:923, 2001). In addition, also effective way, using synthesized viral liposome synthetic membrane obtained from HVJ called HVJ-liposomal method (Yonemitsu et al., Int.J. Oncol. 12:1277, 1998; Kaneda, et al., Mol. Med. Today 5:298, 1999).

The vector of gene expression or a pharmaceutical composition comprising a vector, can be successfully introduced into the whole heart of the patient with heart disease. However, it is preferable that the vector of gene expression or pharmaceutical composition can be introduced into the injury site. According to the invention, the areas of damage indicate areas of damage, functional disturbance or loss of cardiomyocytes, functional delay or death, or such an individual (human or animal: the same is true here), or place, where the expected strengthening of the violation or functional damage to or destruction of cardiomyocytes. In this case, the method of introducing the vector of gene expression or pharmaceutical composition comprising the vector of gene expression in the injury involves the direct injection of the vector of gene expression or pharmaceutical composition containing it, in the heart after thoracotomy, using a syringe for injection and method injection vector or pharmaceutical composition through the catheter under rentgenovsk the m diaphanoscopy. The preferred method of insertion through the catheter, since the introduction of the gene can be localized exactly in the heart. In this case, the vector of gene expression or pharmaceutical composition comprising the vector can be injected into the catheter to release the vector or composition through the bloodstream in cardiomyocytes. Vector or pharmaceutical composition can also be directly injected into the layer of the heart muscle in contact with cardiomyocytes. This surgical approach that uses a catheter and the like, known in the field. Reference literature includes, for example, Gene Transfer in Cardiovascular System: Experimental Approaches & Therapeutic Implications (edited by March, Kluwer Academic Publishers, 1997), Vascular Surgery, the 5thedition (Rutherford, W.B.Saunders, 2000) and in Textbook of Interventional Cardiology, the 4thedition (edited by Topol, W.B.Saunders, 2002).

The catheter used in this invention, commercially available from Boston Scientific, Edwards Life Sciences Corporation and similar companies.

(The use of cardiomyocytes, proliferating using the method of the invention)

From cardiomyocytes, proliferating using the method of the invention can be effectively obtained highly purified cardiomyocytes on a large scale, with the consistent application of cell isolation, separation and purification according to known conventional methods. Cardiomyocytes derived in a similar way, here called the camping cardiomyocytes, obtained according to the invention.

Can be used any method of purification of cardiomyocytes from the known methods of separation and purification of cells. Specific examples of such methods include methods of reaction antigen-antibody, for example the methods with flow cytometry or magnetic beads and method of leaching, and the methods of cell fractionation by centrifugation in a density gradient, using such media as sucrose and Percoll. Another method of screening cardiomyocytes is a method for selective derivation of cardiomyocytes with prior such artificial modifications, which will retain chemical tolerance and potential ectopic expression of the protein to the gene of the animal or stem cells such as ES-cell as a source of cardiomyocytes, and then use the received modifications as an indicator for screening. For example, a Field with co-constructed system is obtained by introducing the gene cassettes that can Express the neomycin-(G418)-resistant gene in mouse ES-cell under the control of the promoter of heavy α-chain of myosin for differentiation of ES cells into cardiomyocytes to allow gene expression heavy α-chain of myosin with subsequent differentiation, exactly when the cell is able to survive in culture with G418. Researchers who oabout, the cell identified in the screening as G418-resistant, is a cardiomyocyte with a probability of 99% or more (U.S. patent 6015671; J. Clin. Invest. 98:216, 1996).

In an additional embodiment, the invention cardiomyocytes obtained in accordance with the invention, was used for pharmacological evaluation and assessment of the activity of various physiologically active substances (e.g. drugs) and is functionally unidentified new gene products. For example, cardiomyocytes can be used for screening substances or pharmaceutical agent associated with the functional regulation of cardiomyocytes and the chemical and pharmaceutical agent toxicity and damaging properties of the cardiomyocytes. In yet another further implementation of the evaluation set containing the cardiomyocytes obtained according to the invention, used for screening.

Can be successfully applied to any type of a test substance for use in screening, thus, the test substance can be added to the culture and includes, for example, low-molecular components, high molecular weight components, organic components, inorganic components, a protein, a peptide, a gene, a virus, a cell, a liquid cell culture and liquid microbial culture. How effective the introduction of a gene into the culture includes the way to relax is of viral vector, such as retrovirus and adenovirus, culture, or packing of such viral vector is a liposome and the like with the addition of vectors in culture.

Evaluation of test substances can be made by examining quantitative and qualitative changes of the functions of cardiomyocytes. One example of a study of the viability of cardiomyocytes following. Cardiomyocytes obtained according to the invention, inoculable for a Cup of culture to the appropriate cell density to induce cell death (apoptosis)when grown in the medium without serum or to explore the viability or death of cardiomyocytes in the environment with the appropriate amount of test substance added. Way of exploring the viability or death of cardiomyocytes is carried out under visual observation or using an injected dye, such as tripney blue as indicator. Can also be used the other way, such as the use of dehydrogenase activity (reducing activity) as an indicator or method of using the activity of caspase-specific in relation to apoptotic cells, or the expression of annexin V as an indicator. Sets that use this mechanism, commercially available from many companies such as Sigma, Clontech and Promega.

Pollcount and pharmaceutical agents obtained by the screening method, have the ability to induce differentiation of cardiomyocytes and the ability to regulate the function of, and these substances and pharmaceuticals can be used as a preventive for heart disease such as myocardial infarction, ischemic heart disease, congestive heart failure, hypertrophic cardiomyopathy, dilated cardiomyopathy, myocarditis and chronic heart failure. These parts may be new or known components.

In addition, cardiomyocytes obtained according to the invention can also be used as the transplanted cells to regenerate heart muscle or for therapeutic treatment of heart disease. Heart diseases include, for example, myocardial infarction, ischemic heart disease, congestive heart failure, hypertrophic cardiomyopathy, dilated cardiomyopathy, myocarditis and chronic heart failure. As the transplanted cells cells containing highly purified cardiomyocytes derived according to the invention can be used in any form, such as cells suspended in the aqueous medium such as culture medium, the cells entered in solid media, such as biodegradable substances, or cells, in which it is possible in single or multiple layers of cardiomyocytes (Shimizu, et al., Circ. Res. 90: e40, 2002).

The method of introduction of cardiomyocytes as a transplanted cardiomyocytes in the injured area includes the method of direct injection of transplanted cardiomyocytes in heart after thoracotomy, using a syringe for injection, method of surgical incision of the heart for the introduction of cardiomyocytes and method injection cardiomyocytes through blood tube with the use of a catheter (Murry, et al., Cold Spring Harb. Symp. Quant. Biol. 67:519, 2002; Menasche, Ann. Thorac. Surg. 75:S20, 2003; Dowell, et al., Cardiovasc. Res. 58:336, 2003). However, the method is not limited to the above. When the cardiomyocytes derived from the fetal heart, have entered into the heart of the animal with cardiac pathology, received excellent therapeutic effect, as reported (Menasche, Ann. Thorac. Surg. 75:S20, 2003; Reffelmann, et al., Heart Fail. Rev. 8:201, 2003). Cardiomyocytes derived from ES cells, phenotypically very similar to the cardiomyocytes derived from the fetal heart (Maltsev et al., Mech. Dev. 44:41, 1993; Circ. Res. 75:233, 1994). In the experimental example in animals, where the cardiomyocytes derived from ES cells were transplanted really in the heart of the adult, it is proved that received very high biocompatibility. (Klug, et al., J. Clin. Invest. 98:216, 1996). Transplantation of cardiomyocytes obtained by the method according to the invention, in disturbed cardiac tissue in diseases of the heart due to the violation and dissociation cardiomyocyte compensatory type, as you might expect, can improve heart function.

EXAMPLES

Now the invention will be specifically described by the following examples. However, the examples set forth below, simply illustrate the invention but do not limit its scope.

[Example 1: preparation of recombinant adenovirus]

Adenoviral vectors, each of which carries CDK4 gene, cyclin D1 gene with a nucleotide sequence that encodes a nuclear localization signal (NLS), connected (D1NLS) or Skp2 gene was obtained using the kit for the preparation of recombinant adenovirus (Adenovirus Expression Vector Kit; TaKaRa Bio).

In the case of adenoviral vector carrying CDK4 gene, referred to as Ad-CDK4, plasmid pCMV-CDK4 (supplied by Dr. Sander van den Heuvel [Massachusetts General Hospital Cancer Center; USA]; van den Heuvel, et al., Science 262: 2050, 1993) was cut BamHI to obtain mouse CDK4 cDNA fragment, whose both ends were blunted using T4 DNA polymerase. The following Protocol is associated with a set of adenoviral vector expression, where the blunted fragment was inserted into the SwaI site of Comedy pAxCAwt to obtain Comedy pAd-CDK4. Subsequently, the transfection of Comedy treated with the restriction enzyme DNA-TRS (terminal peptide complex)obtained from the genomic DNA of human adenovirus type 5, in 293 cells derived from human embryonic kidney cells, allow the sludge to obtain a recombinant adenovirus Ad-CDK4.

A plasmid carrying D1NLS gene, was constructed by conjugation of mouse cyclin D1 cDNA fragment derived from pRSV-cyclin D1 (Matsushime et al., Cell 65:701, 1991) c pEF/myc/nus (Invitrogen)derived from NLS. More specifically, plasmid pEF/myc/nus were digested with restrictase NcoI and XhoI to obtain a first DNA fragment containing the sequence of the NLS. Then the plasmid pRSV-cyclin D1 was cut by the restriction enzyme NcoI to obtain a second DNA fragment containing the cyclin D1 sequence. Then PCR was performed using the plasmid pRSV-cyclin D1 as a matrix and using the following two types of primers to obtain a third DNA fragment encoding the C-end of the cDNA cyclin D1.

5'-primer: 5'-ACCCTCCATGGTAGCTGCTGGGA3' (SEQ ID NO: 2)

3'-primer: 5'-TGATCTCGAGGTCGATGTCCACATCTCGCACGT-3' (SEQ ID NO: 3)

Using T4 DNA ligase these three types of DNA-fragments were joined together to construct a plasmid carrying the nucleotide sequence encoding SV40 derived from T-antigen NLS in three Parallels on the side-end of the cDNA of murine cycline D1. DNA fragment deleted from the plasmid by restrictase PmaCI and SmaI, was inserted into the SwaI site of Comedy pAxCAwt. The resulting kosmidou (pAd-D1NLS) DNA TRS treated with restriction enzyme, was transfusional in 293 cells to obtain recombinant adenovirus Ad-D1NLS.

Adenoviral vector Ad-Skp2 carrying Skp2, were obtained on the basis mouse Skp2 cDNA. Thinking the Naya Skp2 cDNA obtained from a cDNA library of mouse thymus (Stratagene) using mouse clone EST (expressed sequence tag) (inventory number AA511897), registered in GenBank as a probe (Nakayama, et al., specification of JP-A-2001-224380). More precisely,32P-labeled probe obtained from EST clone according to the basic methods. Then, the probe hybridized with a copy of the filter derived from the cDNA library, in a buffer at 68°C for 24 hours. The resulting hybrid was washed in buffer containing 0.1% SDS at 68°C. the positive clone was subcloned into the plasmid pBluescript SK (Stratagene) for nucleotide sequencing. The nucleotide sequence of mouse Skp2 cDNA, as defined in each method, were registered in GenBank (inventory number AF083215) (Nakayama, et al., EMBO J. 19:2069, 2000; Nakayama, et al., specification of JP-A-2001-224380). Using mouse Skp2 cDNA as a template and the following two kinds of primers, PCR was performed to obtain the fragment of the mouse Skp2 cDNA sequence tag Flag (N-Asp-Tyr-Lys-Arp-Asp-Asp-Asp-Lys-C; SEQ ID NO:4) at N-end, which was then inserted into the XhoI site of the vector pkgnk-3 (Invitrogen) to obtain the vector pcDNA3-Flag-Skp2.

5'-primer: 5'-ATACTCGAGGCCACCATGGACTACAAGGACGACGATGACAAGCATAGGAAGCACCTTCAGGAGATT-3' (SEQ ID NO:5)

3'-primer: 5'-ATACTCGAGTCATAGACAACTGGGCTTTTGCAG-3' (SEQ ID NO: 6)

The fragment containing Skp2 cDNA obtained by splitting the vector pcDNA3-Flag-Skp2 with XhoI was inserted into the SwaI site of Comedy pAxCAwt. The resulting kosmidou and DNA-TRS (final peptide complex)obtained from the genomic DNA of human adenovirus type 5, was transfusional in 293 cells to obtain recombinationally Ad-Skp2.

Three types of recombinant adenoviruses obtained by the method described above (Ad-CDK4, Ad-D1NLS and Ad-Skp2), designed in every way to separate the integrated gene could be expressed under the control of the CAG promoters (CMV enhancer, promoter of β-actin chicken and polyA sequence of the gene of rat β-globin). Therefore, included genes may be highly expressed in mammalian cells.

Later, wanted to get viral solutions individual recombinant viruses in high titer. 4 μg of each of the three types of cosmid (pAd-CDK4, pAd-D1NLS and pAd-Skp2) was mixed with 2.5 ál of DNA-TRS treated with restriction enzyme attached to the kit for the preparation of recombinant adenovirus. The mixtures were separately transliterowany in 293 cells cultured in the culture Cup (diameter 60 mm), the lipofection method, using

FuGENETM6 Transfection Reagent (Roche). The next day the cells were separated, and the resulting cell suspension again separately was inoculable on the culture plate (96 wells)coated with collagen. 7-15 days the virus was grown, and the cells were killed in different holes. From each of the wells in which cells was completely dead, the culture medium was aseptically collected in sterile tube, freezing and thawing was repeated 6 times, and centrifuged at 500 rpm for 5 minutes. Supernat the options retained as the primary mother liquor virus at -80°C. 10 ál of a solution of virus infected in 293 cells cultured on the culture plate (24 wells)coated with collagen. The culture medium in the wells containing killed cells after 3-4 days aseptically transferred into a sterile tube, freezing and thawing was repeated 6 times and centrifuged at 5000 rpm for 5 minutes to obtain the resulting supernatant was retained as a secondary viral mother solution at -80°C. 15 μl of secondary viral stock solution was infected in 293 cells cultured in the culture flask (25 cm2)coated with collagen. The culture medium after 3-4 days aseptically transferred into a sterile tube, and the virus out of the cells by freezing and thawing or by homogenization of the cells using a sealed ultrasonic treatment. The supernatant obtained after centrifugation (3000 rpm, 10 minutes, 4°C), kept as tertiary viral mother solution at -80°C. 50 μl of tertiary viral stock solution was infected in 293 cells grown in the culture flask (75 cm2)coated with collagen. The culture medium is aseptically transferred into a sterile tube, and the virus was released from the cells by freeze-thawing or by homogenization of the cells using a sealed ultrasonic treatment. The supernatant, receiving the hydrated after centrifugation (3000 rpm, 10 minutes, 4°C), was retained as the fourth viral mother solution at -80°C. the Titer of the fourth viral solution was determined by analysis of plaques using 293 cells. The title was always in the range from 109up to 1011plaque-forming units/ml, without exception. In this invention a fresh number of viral units, introduced on 1 cell, expressed as multiplicity of infection (moi) here next. In other words, one viral particle, transfusiona in one cell, expressed as a moi=1.

[Example 2: the Accumulation of the protein p27Kip1in cardiomyocytes treated DNLS/CDK]

Cardiomyocytes were isolated from rats (Sprague-Dawley) at 2-4 days after birth, the fraction of cardiomyocytes were obtained by centrifugation in a gradient concentration of Percoll (Tamamori, et al., Am. J. Physiol. 275:H2036, 1998). Demonstrated by immunological staining using antibodies against actin of sarcomeres that 95% or more of the obtained cells were cardiomyocytes. Cardiomyocytes neonatal rats suspended in minimally sensitive culture medium Needle (Flow Laboratories) supplemented with 5% bovine fetal serum (FBS; Flow Laboratories) and then inoculable culture Cup for growth in the incubator with carbon dioxide for 24 hours. The next day the culture medium was replaced with serum-free minimal sensitive kulturalna the environment the Needle for another 24-hour growth. Then the recombinant virus Ad-D1NLS (moi=10 to 100) and Ad-CDK4 (moi=100)obtained in example 1 was added to the culture medium for 48 hours growth. The procedure of infection and transfection of cardiomyocytes with recombinant viruses Ad-D1NLS and Ad-CDK4 for the expression of cyclin D1 protein and CDK4 protein in the nucleus of cardiomyocytes hereinafter considered as stimulation D1NLS+CDK4 or treatment D1NLS+CDK4. The quality control was done a similar experiment using REF52 cells as a cell line of fibroblasts.

Expression of the protein p27Kip1in cardiomyocytes, transfected genes D1NLS and CDK4, was evaluated using Western blot. Cells transfetsirovannyh viruses Ad-D1NLS and Ad-CDK4, washed with phosphate-saline buffer (PBS) on ice and then scraped off the cell scraper and centrifuged with removal of the resulting supernatant. The resulting precipitate once again washed in a small volume of PBS and then transferred to 1.5-ml tubes Eppendorf type, which was added on ice with Buffer A (10 mm HEPES, pH of 7.9, 1.5 mm MgCl2, 10 mm KCl, 0.5 mm DTT). Then the mixture was shaken and left on ice for 10 minutes. Then to the mixture was added NONIDET P-40 to a final concentration of 0.2% , shook and then left the mixture on ice for 5 minutes. To the precipitate obtained by another centrifugation (5000 rpm, 5 minutes), was added an equal volume of Buffer C (20 mm HEPES, pH of 7.9, 25% glycerol, of 0.42 M NaCl, 1.5 mm MgCl2,0.2 mm EDTA) for which trachymene. The resulting mixture was left on ice for 30 minutes, centrifuged (15,000 rpm, 10 minutes) to obtain a supernatant, which was used as a nuclear protein fraction. Immediately prior to use, in addition, 1 mm DTT, 1 mm PMSF, 1 μg/ml Aprotinin, 1 μg/ml leupeptin, and 1 μg/ml of pepstatin (all from Sigma) were added to the Buffer and the Buffer described above.

Nuclear proteins obtained in each method, dubbed the volume containing 1×106cells per sample was carried out by electrophoresis in SDS-PAGE gel, transferred to nitrocellulose membrane and analyzed by Western blot. More precisely, nuclear proteins interacted with anti-cyclin D1 antibodies (Oncogene Science: Ab-3) or anti - p27Kip1antibodies (Santa Cruz; sc-528) as primary antibodies and then interacted with anti-mouse Ig antibody labeled with horseradish peroxidase (Amersham Life Science; NA931) or antibodies against rat Ig (Amersham Life Science; NA934) as a secondary antibody for detecting the presence of binding the antigen-antibody, using a chemiluminescent kit (Amersham Life Science; RPN2109).

The results are shown in figure 1. Like the previous message (Nakayama, et al., EMBO J. 19: 2069, 2000; patent reference 1 and non-patent reference 5), demonstrated that transfection of cardiomyocytes genes D1NLS and CDK increased levels of protein expression cycline D1 and CDK4 protein in the nuclei of cardiomyocytes. Then the expression of protein

p27Kip1more driven than increased level of expression of protein cycline D1. In fibroblasts (REF52 cells), meanwhile, the increase in expression of protein cycline D1 stronger reduced the expression level of the protein p27Kip1. Differences in performance protein p27Kip1during stimulation D1NLS+CDK4 was observed in two cell types.

Subsequently, the expression and localization of the protein p27Kip1in cardiomyocytes was assessed by the method of immunohistochemical staining. Like the method described above, cardiomyocytes, transfetsirovannyh viruses Ad-D1NLS and Ad-CDK4 (moi=100), were fixed by 70% ethanol for 48 hours after virus infection. Then anti-p27Kip1antibodies (same as above) (diluted 1:1000) and anti-sarcomeric actin antibody (DAKO; M0874) (diluted 1:100) interacted with the received cardiomyocytes, for staining of cardiomyocytes used labeled with Alexa FluorTMantibodies (Alexa-488 and Alexa-568; Molecular Probes) (both at a dilution of 1:200). Then the cell nucleus was stained with a solution of 4',6-diamidino-2-phenylindole (DAPI) (1 μg/ml). The picture painted by these antibodies, and the dye was observed in the fluorescence microscope (laser scanning co-focus image system; Zeiss LSM510).

The results are shown in figure 2. The expression of p27Kip1observed in nuclei of intact cardiomyocytes (cells positive with sarcomere actin figure), but not so much. Bo is favoured expression and nuclear accumulation of p27 Kip1observed in cardiomyocytes, transfected genes D1NLS and for CDK4 expression. The results in Fig. 1 and 2 show that enhanced expression of genes D1NLS and CDK4 in cardiomyocytes allowed the accumulation of protein p27Kip1to suppress the progression of the cell cycle in the nuclei of cardiomyocytes, so the possibility of the division and proliferation of cardiomyocytes induced by stimulation D1NLS+CDK4, could probably be ingibirovany.

In order to assess whether regulated the increased expression of p27Kip1due to the stimulation D1NLS+CDK4, at the level of transcription was performed Northern-blot analysis. However, in all cardiomyocytes and fibroblasts enhanced expression of genes D1NLS and CDK4 did not affect the expression level of mRNA p27Kip1. It is known that the expression level of the protein p27Kip1in proliferating cells cupressinum degrading system the ubiquitin-proteasome (Carrano, et al., Nature Cell Biol. 1:193, 1999; Tsvetkov et al., Curr. Biol. 9:661, 1999). So appreciated, is it possible to adjust the level of expression of the protein p27Kip1even in cardiomyocytes with proteasome-degrading system. After the cardiomyocytes obtained in this way, 24 hours cultured in conditions of lack of serum in culture medium was added Ad-D1NLS and Ad-CDK4 (moi=100) for 48 hours growth. In different groups cardiomyocytes were grown in conditions of serum starvation for 48 hours. Then crops the optimum environment added FBS up to 10% for 24 hours. Then to one of the groups simultaneously added lactostasis (20 μm) (Santa Cruz) as inhibitor of the proteasome, other groups inhibitor was added. The expression level of the protein p27Kip1each group was determined by Western blot testing.

Subsequently, some increase in the level of expression of the protein p27Kip1confirmed (figure 3) as for figure 1. Alternatively, the expression level of the protein p27Kip1decreased upon stimulation with FBS. The inventors have shown in previous works that the protein cyclin D1 and CDK4 protein was weakly localized in the nuclei of cardiomyocytes, although these molecules are stronger expressibility upon stimulation with FBS, so that the cell cycle is not active (see patent reference 1 and non-patent reference 5). This suggests that the increase in the number of protein p27Kip1in cardiomyocytes was specific for stimulation of nuclear transfer cyclin D1 protein and/or CDK4 protein. When functioning and proteasome activity was decreased when processing lactatemia, alternative, found no differences in the expression level of the protein p27Kip1between the group to which nothing was added, the group treated FBS, and the group treated D1NLS+CDK4. These results indicate that the functioning and activity of the protein

p27Kip1inhibited in the group treated D1NLS+CDK4, although protein p27Kip1constantly degrader tree in the group, where nothing has been added, or in the group treated FBS.

To assess the potential ubiquitination protein p27Kip1in cardiomyocytes subsequently conducted research ubiquitination in vitro. Details of the experimental method consistent with the method described in the reports of the inventors (Nakayama, et al., EMBO J. 19: 2069, 2000; Nakayama, et al., JP-A-2001-224380; Hara, et al., J. Biol. Chem. 276:48937, 2001; Ishida, et al., J. Biol. Chem. 277:14355, 2002). Cardiomyocytes derived above method, were cultured in serum starvation for 24 hours, after 48 hours in culture medium with the addition of Ad-D1NLS and Ad-CDK4 (moi=100). In the other group cardiomyocytes were cultured under conditions of low serum 48 hours, and then were grown for 24 hours in culture medium with FBS at a concentration of 10%. As control was used REF52 cells grown in culture medium with addition of 10% FBS. After that, the cells were washed by PBS on ice, the cells were scraped cell scraper and then centrifuged to remove the supernatant. To the obtained precipitate was added 2-fold volume of Buffer (described above) with the addition of 0.5% NONIDET P-40. Then the resulting mixture was stirred and left on ice for 30 minutes for ultrasonic destruction. Then the mixture was centrifuged (15,000 rpm, 20 minutes) to obtain a supernatant, which was used as a cell extract.

By using the transmitting system using the lysate of rat reticulocytes, in vitro was obtained recombinant protein p27Kip1for use as a substrate for ubiquitination. More precisely, carried out transcription and translation in vitro, using a commercial kit transcription and translation in vitro (TnT coupled Reticulocyte Lysate System; Promega) and using mouse cDNA p27Kip1sequence tags FLAG, labeled there as a matrix in accordance with the attached Protocol. The thus obtained recombinant protein p27Kip1and each sample reticulocyte lysate (20 to 40 µg of protein) were obtained with murine protein E1 (50 µg/ml), murine protein E2/Ubs5 (100 μg/ml) and protein GST-Ub (4 mg/ml) (all from Calbiochem) in the reaction solution final volume of 10 ál (4 mm Tris-HCl (pH 7.5), 6 mm NaCl, 5 mm MgCl2, 0.1 mm DTT, 0.1 mg/ml creatine phosphokinase, 10 mm phosphocreatine, 1.5 mm ATP) for their interaction together at 26°C for 30 minutes. Then there was the electrophoresis of the sample in the gel SDS-PAGE and transferred to nitrocellulose membrane for Western blotting. More specifically, the reaction with the first antibody anti-Flag antibody (Sigma; F-3165) or anti-GST antibody (Santa Crus; sc-138) (both at a dilution of 1:1000) and the reaction with the second antibody artemisinin Ig, horseradish peroxidase (as above) (dilution 1:1000) gave the possibility to determine the presence with the ides of antigen with each antibody, using a chemiluminescent kit (as described above).

The results are shown in figure 4. The protein p27Kip1, ubiquitination in vitro using cellular extracts of fibroblasts during cell proliferation (stimulation FBS) (REF to the picture) as a positive control, the presence of in vitro ubiquitination protein p27Kip1it was possible to clearly detect using recognition by antibodies peptide Flag attached to the recombinant protein p27Kip1(IB: Flag in the figure) and specific antibody (IB: GST figure), recognizing protein GST added to the recombinant protein to ubiquitin. However, when used cell extract derived from cardiomyocytes stimulated FBS, observed only a weak ubiquitination protein p27Kip1and only a very vague linking ubiquitination protein p27Kip1was determined in cardiomyocytes, transfected genes D1NLS and CDK4. The results, shown in figure 3 and 4 clearly indicate that ubiquitination protein p27Kip1significantly decreased in cardiomyocytes during stimulation D1NLS+CDK4, so proteasome degradation hardly occurs, with subsequent accumulation of the protein p27Kip1in the kernel.

[Example 3: Reduction of protein p27Kip1accumulated in cardiomyocytes due to enhanced expression of Skp2]

It is known that protein p27sup> Kip1ubiquitination in the main proliferating cells by ubiquitinate containing Skp2 as protein F-box, namely

SCFSkp2-complex, so that the protein p27Kip1destroyed by the proteasome (Carrano, et al., Nature Cell Biol. 1:193, 1999; Tsverkiv, et al., Curr. Biol. 9:661, 1999). Therefore, the expression of protein Skp2 in cardiomyocytes was determined by Western blot. Methods of obtaining cardiomyocytes, transfection of Ad-D1NLS and Ad-CDK4, obtaining a nuclear protein, Western blotting and the like were the same as described above. So, for detection of protein Skp2 used antibodies against Skp2.

The results are shown in figure 5. Expression of protein Skp2 in fibroblasts (REF52 cells), used as control cells, were significantly activated upon stimulation with FBS and stimulation D1NLS and CDK4, controlling proliferation. However, although cardiomyocytes observed no induction of expression of the protein Skp2, while in cardiomyocytes, tropicabana genes D1NLS and CDK4, it was possible to detect only a small amount of protein Skp2. The results show that inhibition of protein degradation p27Kip1that was accumulated during stimulation D1NLS+CDK4, because there was no case of induction of Skp2 expression in cardiomyocytes.

Accordingly assessed the impact of the gene on the expression of Skp2 protein p27Kip1through co-expression of Skp2 gene in cardiomyocytes, transfected genes D1NS and CDK4. Cardiomyocytes were infected with Ad-D1NLS (moi=100), Ad-CDK4 (moi=100) and Ad-Skp2 (moi=50, 100), obtained in Example 1 for 48 hours cultivation for analysis of gene cycline D1, Skp2 and p27Kip1Western blot testing. Methods of obtaining cardiomyocytes, adenuga protein, Western blot and the like were the same as the methods described above.

Three genes D1NLS, CDK4 and Skp2 competitive expressed in cardiomyocytes. The results are shown in Fig.6. When genes D1NLS and CDK4 were transfusional in cardiomyocytes, the expression of the protein p27Kip1greatly were induced as in the previous experiments (figure 1 and 3). In this case, the transfection of Ad-Skp2 in cardiomyocytes to provide competitive gene expression of Skp2 then significantly reduced the expression level of the protein p27Kip1. In cardiomyocytes infected with Ad-Skp2 in high concentrations (moi=100)observed an almost complete absence of expression of the protein p27Kip1.

In further confirmed using immunocytochemical staining, as shown in Fig. 7 that the accumulation of the protein p27Kip1in cardiomyocytes, transfected genes D1NLS and CDK4, decreased due to the mutual expression of Skp2. The way immunocytochemical staining was the same as in the experiment described above (figure 2). As shown in figure 2, significant expression of p27Kip1and nuclear accumulation was observed in cardio is iiith, Transylvania genes D1NLS and CDK4. When co-expressed gene Skp2, alternative, observed a significant decrease in protein p27Kip1in the nuclei of cells. When cardiomyocytes with genes D1NLS, CDK4 and Skp2, competitive expressed there, were treated with lactatemia, the level of expression of protein

p27Kip1it was restored almost to the level during stimulation D1NLS and CDK4. Thus, it was confirmed that the reduction of protein p27Kip1due to enhanced expression of the protein Skp2 was mediated by degrading system the ubiquitin-proteasome.

[Example 4: Effect of enhanced expression of Skp2 to the stimulation of proliferation of cardiomyocytes]

Making the calculation of Ad-D1NLS, Ad-CDK4 and Ad-Skp2 (each moi=100) for transfection of cardiomyocytes and then periodically counting the number of cells evaluated the impact of the introduction of Skp2 gene on the potential proliferation of cardiomyocytes. Similar to the results of previous messages (see patent reference 1 and non-patent reference 5). the number of cells cardiomyocytes with genes D1NLS and CDK4, expressed here, was increased about 3 times on the 7th day after cultivation (Fig). Alternative confirmed that the number of cells cardiomyocytes with three genes, called genes D1NLS, CDK4 and Skp2, downregulation there was increased 5 times or more. It is shown that the number of cells cardiomyocytes infected with the control vector, and cardiolite is s, infected one Ad-Skp2 as a negative control, almost not increased. The above results undoubtedly show that Skp2 may more significantly stimulate the potential proliferation of cardiomyocytes than stimulation D1NLS+CDK4.

[Example 5: treatment Effect siRNAs p27 to the stimulation of proliferation of cardiomyocytes]

In order to more clearly demonstrate the impact of protein p27Kip1on the cardiomyocytes treated D1NLS and CDK4, siRNAs specific to gene p27Kip1(hereafter referred to as "siRNAs p27") expressed in cardiomyocytes.

In order to create a vector for the expression of siRNAs p27, a target sequence was determined on the basis of information about the nucleotide sequence of a rat cDNA p27Kip1(inventory number D83792 in GenBank), was designed and received oligo-DNA for use in construction of expression vector of siRNAs corresponding sequence. As the target sequence of the rat p27Kip1cDNA were selected following three types:

the numbers of nucleotides: 830-847 (5'-GGCAGAAGATTCTTCTTC-3': SEQ ID NO: 7);

the numbers of nucleotides: 532-550 (5'-AGCGCAAGTGGAATTTCGA-3': SEQ ID NO: 8); and

the numbers of nucleotides: 372-390 (5'-GTGAGAGTGTCTAACGGGA -3': SEQ ID NO: 9). siRNAs based on SEQ ID nos: 7-9, listed here below as siRNAs #1, #4 and #6 respectively. Built-sequence oligo-DNA used in the design is frownie vectors, expressing siRNAs #1, #4 and #6 are as follows.

SiRNAs #1: 5'-CACCGGTAGGAGGTTCTTCTTCAACGTGTGCTGTCCGTTGAAGAAGAATC TTCTGCCTTT TT -3' (SEQ ID NO: 10) and 5'-GCATAAAAAG GCAGAAGATT CTTCTTCAAC GGACAGCACA CGTTGAAGAA GAACCTCCTACC-3' (SEQ ID NO: 11).

siRNAs #4: 5'-CACCAGTGTA AGTGGAGTTT CGAACGTGTG CTGTCCGTTC GAAATTCCAC TTGCGCTTTT TT-3' (SEQ ID NO: 12) and 5'-GCATAAAAAAGCGCAAGTGG AATTTCGAAC GGACAGCACA CGTTCGAAAC TCCACTTACA CT-3' (SEQ ID NO: 13).

siRNAs #6: 5'-CACCGTGGGA GTGTTTAATG GGAACGTGTG CTGTCCGTTC CCGTTAGACA CTCTCACTTT TT-3' (SEQ ID NO: 14) and 5'-GCATAAAAAG TGAGAGTGTC TAACGGGAAC GGACAGCACA CGTTCCCATT AAACACTCCC AC-3' (SEQ ID NO: 15).

Spent annealing three groups oligo-DNA, each of which contained a sequence-target siRNAs, and then embed them in BsmMI website expressing RNA vector (pcPURU6 β icassette, iGENE). The vector was in construction, so that transcription of RNA responsible for included genes can be generated under the control of the human U6-promoter for high level expression of labeled RNA in mammalian cells. Then the vector was digested EcoRI and HindIII for purification the fragment containing the U6-promoter and included the sequences of genes. Then all made a small mistake, using T4 DNA polymerase, and the fragment has built into the SwaI site of Comedy pAxcwit (TAKARA BIO). Subsequent transfection of 293 cells with kosmidou and DNA-TRS treated with restriction enzyme obtained from genomic DNA of human adenovirus type 5, gave the opportunity to obtain a recombinant adenovirus expressing p27Kip1siRNAs (Ad-p27 siRNAs-#1, #4, #6). Subsequently, VI is the oral solution with a high titer again received from the viral vector in the same way, as in example 1.

First, p27 siRNAs co-expressed in cardiomyocytes, transfected genes D1NLS and CDK4, to assess the impact of the expression of the protein p27Kip1using Western blot. More precisely, Ad-D1NLS, Ad-CDK4 and Ad-p27 siRNAs (each moi=100) was transfusional in cardiomyocytes 48 hours of cultivation for analysis of gene protein p27Kip1Western blot testing. Methods of obtaining cardiomyocytes, obtaining a nuclear protein, Western blot and the like are the same as the methods described above (Examples 1 and 3).

The results are shown in Fig.9. When D1NLS and CDK4 genes were transfusional in cardiomyocytes, the expression of the protein p27Kip1greatly were induced as in the experiments described above (Fig. 1, 3 and 7). The expression of P27 siRNAs(#1, #4, #6) in cardiomyocytes products of protein p27Kip1significantly decreased. In particular, it was shown almost complete absence of expression of the protein p27Kip1with P27 siRNAs-#6. Expression of P27 siRNAs activates suppressive effect of specific protein p27Kip1but never affects the intracellular fraction of P21 proteinCip1protein cyclin D1 or sarcomeric actin. Even in the immunocytochemical staining was shown almost complete absence of accumulation of protein p27Kip1in the nuclei of cardiomyocytes for the expression of P27 siRNAs.

Subsequently Ad-D1NLS, Ad-CDK4 and Ad-p27 siRNAs-#6 (each moi=100) was transfusional in Cardi is myocytes, then to periodically count the number of cells. Similar to the results in example 4, the number of cells cardiomyocytes with genes D1NLS and CDK4, downregulation there was increased 3 times in 7 days after culturing (Fig. 10). Meanwhile, verify that the number of cells cardiomyocytes with three genes, called D1NLS, CDK4 and p27 siRNAs expressed there, has increased significantly. It was shown that the number of cells cardiomyocytes infected with LacZ expressing virus, and cardiomyocytes infected with the same siRNAs Ad-p27 as a negative control, almost not increased. The above results clearly show that the expression of P27 siRNAs much more can stimulate the potential proliferation of cardiomyocytes than stimulation D1NLS+CDK4.

[Example 6: effect of enhanced expression of Skp2 gene for the treatment of heart]

In order to confirm that the effect of enhanced expression of genes D1NLS+CDK4+ Skp2 on the proliferation of cardiomyocytes had a therapeutic effect on the damaged cardiomyocytes, assessed, using a model of ischemia and reperfusion in rats. The model was obtained according to the method Dairaku, et al. (Circ. J. 66:411, 2002). Male Wistar rats (age 8 weeks) were anaesthesia pentobarbital sodium under intraperitoneally control (Nembutal: Dainippon Pharmaceutical Co., Ltd.) (55 mg/kg). Then the rat was performed thoracotomy PR is artificial lung ventilation for opening the heart. Subsequently, the left coronary artery ligated overlapping suture needle No. 5-0. Then the rat was left for 30 minutes. The ligature was released, allowing blood stream to reperfusion (reperfusion). As control was used of animals only with a seam coronary artery as the imaginary operating group (hereafter designated as "Sham-group").

An adenoviral vector was introduced into the heart in the period from 25 to 30 minutes after ischemia. Adenoviral solution of high titer (1×109plaque-forming units/ml) of the same series that are obtained and used in the above example, directly introduced into the reservoir of the heart muscle in heart ischemia and on the periphery 50 ál on one site, only 5 sites (total volume 250 μl) using injection needles 30G.

To assess the impact of processing D1NLS+CDK4, group of animals were injected with a solution of a mixture of three types of adenoviruses, called Ad-D1NLS (1×109plaque-forming units), Ad-CDK4 (1×108plaque-forming units) and Ad-LAcZ (1×109plaque-forming units), and it is referred to hereinafter as "D1NLS group". To assess the impact of processing D1NLS+LCDK4+Skp2 group of animals injected with a solution of a mixture of three types of adenoviruses, called Ad-D1NLS (1×109plaque-forming units), Ad-CDK4 (1×108plaque-forming units) and Ad-Skp2 (1×109plaque-forming a single the IC), referred to hereafter as "Skp2-group". As a negative control group received the group of animals injected with Ad-LAcZ (2×109plaque-forming units) (here referred to as "Cont-group"). In the Sham group was not conducted injections of adenoviral solution. After closing the chest, the rat was allowed to move away from the anesthesia and then fed 6 weeks in the General conditions of feeding.

As an indicator of necrosis of the heart muscle, leading to ischemia and impaired reperfusion, investigated the value of plasma troponin T cardiac muscle (stpt) (O'brien, et al., Lab. Anim. Sci. 47: 486, 1997; Morimoto, et al., J. Pharmacol. Sci. 91: 151 [Suppl. 1], 2003). 2 hours after reperfusion, the blood was collected from the lower inner part of the heart and centrifuged to obtain plasma. The value of cTnT was investigated using cardiidae (Roche Diagnostics). The result shows that the value of cTnT after ischemia and reperfusion was strongly increased in the Cont group, D1NLS group and Skp2-group compared with Sham group (Sham group: 0,2±0,0 ng/ml, Cont-group: 8,8±0.5 ng/ml, D1NLS-group: 9,1±0.7 ng/ml, Skp2-group: 9,9±1.3 ng/ml). Found no differences in the value of cTnT between the three groups except the Sham group, indicating the induction of a similar level of necrosis of the heart muscle.

6 weeks after reperfusion cardiac function measured by tomography (method B mode) and mode M mode, from ajayshah the tomogram in time, with the use of equipment for ultrasonic examination (power Vision 8000: Toshiba Medical). For anesthesia, the rat was administered intraperitoneally injected ketamine (Ketaral: Sankyo) and xylazine (Sigma). Using a linear probe with a frequency of 15 MHz was measured left ventricular korotoumou papillary muscle method M mode for measuring left ventricular konechnoparametricheskie size and left ventricular end-systolic size to calculate fractionating reduce left ventricular internal diameter (FS).

Fractionalise reduction in left ventricular internal diameter (FS)=(end-diastolic dimension - end-systolic dimension)/end-diastolic dimension × 100 (%)

For measurement of left ventricular longitudinal axis B-mode method measured left ventricular end-diastolic area and end-systolic area to calculate fractionally zone changes of the left ventricle (FAC), which was used as an indicator of systolic function.

Fractionally area changes of the left ventricle (FAC)=(end-diastolic area - end-systolic area)/end-diastolic area × 100 (%)

With the additional use of the sector probe 10 MHz measured the blood flow into the left ventricle in early diastolic phase (E) and in the atrium in the systolic phase (A) Doppler method for calculating meant is I E/A, used as an indicator of diastolic function. The above measurements were carried out blind by a way so that the test persons could not see the contents of the treatment of each animal.

6 weeks after myocardial ischemia and reperfusion, cardiac function was measured by the methods described above. In the Cont group compared with the Sham group fractionalise shortening (FS) and fractionalize the zone change (FAC) had very low values, while the ratio of the inflow of blood into the left ventricle in early diastolic phase and atrial systolic phase (E/A) was of great importance. Thus it is shown that systolic and diastolic functions undoubtedly deteriorated. In D1NLS group or Skp2-group, on the contrary, FS and FAC had the highest values in comparison with the Cont group. The most likely effect of improvement was shown in terms of values of E/A. In comparison with the Cont group, the value of E/A in Skp2-group was significantly less. E/A value in D1NLS group was less than in the Cont group, but statistically significant differences between them are not shown (Sham group: 2,30±0,25, Cont-group: 5,49±0,86, D1NLS-group: 3,69±0,68, Skp2-group: 3,44±0,57: n=9 to 12).

Subsequently, the hemodynamics of the heart was studied on the next day after ultrasonography of the heart. After injection of rat pentobarbital sodium for anesthesia administered intraperitoneally injected with a catheter with mikroC the POM pressure, equipped with transduction (SPC-320: Millar Instruments) in the left ventricle from the right carotid artery for measurement of maximum differential relations (dP/dt max), left ventricular pressure (LVP) as an indicator of left ventricular systolic potential and measurement of dp/dt/P max, is obtained by dividing dP/dt max with LVP, simultaneously measured as an indicator of left ventricular diastolic potential. In addition, the measured minimum differential relations (dP/dt min) LVP as an indicator of left ventricular diastolic potential and left ventricular end-diastolic pressure (LVEDP). The above measurements were made in a blind test, so the test persons could not identify the contents of the treatment of each animal.

The results are shown in table 1.

[Table 1]
Experimental groupShamContD1NLSSkp2
Number9101210
LVEDP (mm Hg)3,4±1,213,3±2,5* 9,5±2,38,5±1,7
LV dP/dt max
(mmHg/s)
7457±3085572±230*6022±264*of 6,183±250*
LV dP/dt min
(mmHg/s)
6492±3123631±182*4047±270*4449±248*#
LV dP/dt/P,
max (1/s)
75±540±3*51±5*54±4*#
*: p<0.05 compared with Sham-group
#: p<0.05 compared with the Cont group

Compared with the Sham group left ventricular end-diastolic pressure (LVEDP) in the Cont group was at a much higher level. In addition, the maximum differential relations (dP/dt max), the minimum differential relations (dP/dt min) or dP/dt/P max left ventricular pressure (LVP) was at a much lower level. The results show that left ventricular systolic function and diastolic function in animals deteriorated. In D1NLS group three indicator dP/dt max, dP/dt min and dP/dt/P max had higher values than in the Cont group. All individual indicators in Skp2-group had the greater value, than D1NLS group, while dP/dt min and dP/dt/P max had significantly higher values than in the Cont group.

After calculating cardiac hemodynamics produced resection of the lung for weighing wet weight (Fig. 11). Compared with Sham group, the weight is light in the Cont group was significantly longer. This suggests a possible distribution of pulmonary congestion. In comparison with the Cont group weight of the lung was less in D1NLS group, while the weight of the lung in Skp2-group had a significantly lower value, indicating that the decrease in pulmonary hyperemia.

Using remote by resection of the heart after measurement of cardiac function built graph passive (left ventricular pressure-volume. The main way consistent with the message Pfeffer, et al. (Circ. Res. 57:84, 1985). More specifically, heparin (Novo-heparin: Aventis Pharma) and saturated potassium chloride was injected into the tail vein of rats to stimulate cardiac arrest in the diastolic phase. Immediately thereafter, the heart was subjected to resection. Through the aorta into the left ventricle was injected dual catheter lumen (DP-8: Natsume Seisakusho). Combining one of the tubes of transductor pressure to measure left ventricular pressure, the rat was injected with saline speed to 0.72 ml/min of the other tube to register a curve pressure-volume graph. One remote heart was tested three times to calculate the Central value. Based on the curve of the pressure-volume individual animal was calculated amount of charge left ventricular end-diastolic pressure, measured by a catheter with a microchip equipped with transduction pressure, and then corrected based on the weight of the body, for calculating the index of left ventricular end-diastolic volume (LVEDVI).

The results are shown in Fig. As shown, compared with the Sham group curve of the passive pressure-volume in the Cont group was significantly shifted to the right side. The results show the possibility of progress in left ventricular reconstruction, such as increased left ventricular volume and thinning areas of infarction after cardiac ischemia and reperfusion. In comparison with the Cont group right shift of the curve of the passive pressure-volume decreased in D1NLS group. Compared not only with the Cont group, but also with D1NLS group right shift of the curve pressure - volume Skp2-group was significantly decreased. While the index of left ventricular end-diastolic volume (LVEDVI) was great in the Cont group, D1NLS group this index was less. In addition, Skp2-group index was less than D1NLS group and significantly less than in the Cont group (Sham group: 0,80±0,12 ml/kg, LacZ group: 2,18±0.16 ml/kg, D1NLS/CDK4-group: 1,72±0,19 ml/kg, Skp2-group: 1,54±0.17 ml/kg; n=9 to 12).

Finally assessed and the level of the heart to heart 6 weeks after ischemia and reperfusion. Remote heart was fixed in 10% pH-neutral formalin solution, was performed in paraffin, received 6 sessions with an interval of 2 mm on each sample along the transverse direction, and painted Masson Trichrome to visualize the areas of heart attacks. Then the area of infarction was measured using computerized image analysis (Lumina vision: Mitsuya Shoji). Accordingly, the message Jain, et al. (Circulation 103:1920, 2001) area of infarction was measured by measurement of the entire peripheral length of the inner membrane of the left ventricle, the entire peripheral length of the outer membrane of the same peripheral length of the scar on the side of the inner membrane of the left ventricle and peripheral length of the scar on the side of its outer membrane to calculate the area of a heart attack according to the following formula.

The infarction area=[(peripheral length of the scar on the side of the inner membrane of the left ventricle + peripheral length of the scar on the side of his outer membrane)/(a peripheral length of the inner membrane + a peripheral length of the outer membrane)] × 100%

The results are shown in Fig. In comparison with the Cont group area of infarction in D1NLS group decreased significantly. Shows a larger decrease of the area of infarction in Skp2-group than in D1NLS group. In comparison with the Cont group area of infarction was lower in Skp2-group.

Based on these results, it is confirmed that the introduction of GE is s D1NLS+CDK4+Skp2 led to relief the failure of cardiac function after the onset of myocardial infarction and increased hemodynamic inhibition of stagnation in the lungs and left ventricular reconstruction and in addition, to obtain the effect of reduction zone of myocardial infarction.

INDUSTRIAL applicability

In accordance with the method according to the invention of cell division cardiomyocytes can be more effectively induced in comparison with the known in this field ways to stimulate cell proliferation. Cardiomyocytes obtained in this way can be used as cells for screening various pharmaceuticals and for transplantation. In addition, the application of the method according to the invention in gene therapy may be expected to lead to the use of regenerative medical therapy of heart disease with a known etiology, such as the lack of cardiomyocytes.

1. The way the proliferation of cardiomyocytes which the stages of introduction
(a) Collina D,
(b) cyclin-dependent kinase that is activated by cyclin D, and
(c) one or more agents selected from the group comprising the gene encoding the factor that inhibits the production, function or activity of the protein family of Cip/Kip, and nucleic acid which inhibits productively family of Cip/Kip in cardiomyocytes, and the stage subsequent cultivation or maintenance of these cells.

2. The way the proliferation of cardiomyocytes which the stages of introduction
(a) Collina D,
(b) cyclin-dependent kinase that is activated by cyclin D, and
(c) one or more agents selected from the group comprising the gene encoding the factor that inhibits the production, function or activity of the protein family of Cip/Kip and nucleic acid, which inhibits the production of the protein family of Cip/Kip in cardiomyocytes in vitro, and
stage subsequent culturing of these cells.

3. The way the proliferation of cardiomyocytes which the stages of introduction
(a) Collina D,
(b) cyclin-dependent kinase that is activated by cyclin D, and
(c) one or more components selected from the group comprising the gene encoding the factor that inhibits the production, function or activity of the protein family of Cip/Kip and nucleic acid, which inhibits the production of the protein family of Cip/Kip in cardiomyocytes in vivo, and the stage subsequent maintenance of cells.

4. The method according to any one of claims 1 to 3, wherein said cyclin is cyclin able to activate CDK4 or CDK6 mammals.

5. The method according to claims 1 to 3, in which the specified cyclin-dependent kinase is a CDK4 or CDK6.

6. The method according to any one of claims 1 to 3, in which the protein family of Cip/Kip is with the battle P27 kipl.

7. The method according to any one of claims 1 to 3, in which the factor inhibiting the production, function or activity of the protein family of Cip/Kip, is a factor with activity, causing degradation of the protein family of Cip/Kip.

8. The method according to claim 7, in which the factor with the activity that causes the degradation of the protein family of Cip/Kip, is a component of ubiquitinate.

9. The method according to claim 8, in which the component ubiquitinate is a factor F-box capable of contact with a protein of the family of Cip/Kip.

10. The method according to claim 9, in which the factor F-box capable of contact with a protein of the family of Cip/Kip represents Skp2.

11. The method according to any one of claims 1 to 3, in which the nucleic acid that inhibits the production of the protein family of Cip/Kip, is a siPHK, specific gene encoding a protein of the family of Cip/Kip.

12. The method according to claim 11, in which the nucleic acid that inhibits the production of the protein family of Cip/Kip, is a siPHK, specific gene P27kipl.

13. The method according to any one of claims 1 to 3, providing for the introduction of genes in cardiomyocytes using viral vectors or liposomes.

14. The method according to any one of claims 1 to 3, in which at least one gene cyclina and gene cyclin-dependent kinase target nucleic acid, encoding a nuclear localization signal.

15. The expression vector containing
(a) gene cyclina,
(b) gene cyclin-dependent kinase and
(c) one or more agents selected from the group comprising the gene encoding the factor that inhibits the production, function or activity of the protein family of Cip/Kip, and the sequence of the nucleic acid, which inhibits the production of the protein family of Cip/Kip.

16. The vector according to item 15, in which cyclin is cyclin able to activate CDK4 or CDK6 mammals.

17. The vector according to clause 16, in which cyclin is cyclin D mammals.

18. The vector according to item 15, in which cyclin-dependent kinase is a cyclin-dependent kinase that is activated by cyclin D.

19. Vector on p, in which cyclin-dependent kinase is a CDK4 or CDK6.

20. The vector according to item 15, in which the factor that inhibits the production, function or activity of the protein family of Cip/Kip, is a factor with activity, causing degradation of the protein family of Cip/Kip.

21. The vector according to claim 20, in which the factor with the activity that causes the degradation of the protein family of Cip/Kip, is a component of ubiquitinate.

22. The vector according to item 21, in which the component ubiquitinate is a factor F-box capable of contact with a protein of the family of Cip/Kip.

23. The vector according to item 22, in which the factor F-box capable of contact with a protein of the family of Cip/Kip represents Skp2.

24. The vector according to item 15, inwhich nucleic acid, which inhibits the production of the protein family of Cip/Kip, is a siPHK, specific gene encoding a protein of the family of Cip/Kip.

25. The vector according to paragraph 24, in which the nucleic acid that inhibits the production of the protein family of Cip/Kip, is a siPHK, specific gene
P27kipl.

26. The vector according to item 15, in which at least one gene cyclina and gene cyclin-dependent kinase labeled nucleic acid that encodes a nuclear localization signal.

27. The pharmaceutical composition used for treatment of diseases of the heart, containing an effective amount of a vector according to any one of p-26 and a pharmaceutically acceptable carrier.

28. The pharmaceutical composition according to item 27, where heart disease is a myocardial infarction, ischemic heart disease, congestive heart failure, hypertrophic cardiomyopathy, dilated cardiomyopathy, myocarditis, or chronic heart failure.

29. The cardiomyocyte obtained by the method according to any one of claims 1 to 14.

30. A method of treating heart disease, involving the injection of a pharmaceutical composition according to item 27 or transplantation of cardiomyocytes in clause 29 in the plot disorders in individuals suffering from heart disease, and the maintenance and proliferation of cardiomyocytes in the specified section.

31. Ways is by item 30, in which heart disease is a myocardial infarction, ischemic heart disease, congestive heart failure, hypertrophic cardiomyopathy, dilated cardiomyopathy, myocarditis, or chronic heart failure.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: invention relates to clinical biochemistry and pertains to a method of extracting extracellular DNA from blood. Nonidet P-40 or triton X-100 is added to the analysed blood sample until final concentration of 0.5 to 1.5%. The mixture is incubated in ice for 1 to 15 minutes. Lysed blood is divided into supernatant and a nuclear fraction of cells by centrifuging. The supernatant is then treated with a RNA-hydrolysing enzyme and extracellular DNA is extracted from the obtained fraction using a fibre-glass sorbent.

EFFECT: use of the method simplifies the procedure of extracting extracellular DNA, simultaneously extract extracellular DNA, which is free and which is bonded to the surface of blood cells, from blood lysate, which allows for significantly increasing reliability and sensitivity of further amplification analysis for early detection of oncological and other diseases.

2 cl, 4 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method of detection and evaluation of biotype, serogroup and toxigenicity of cholera agent with using the multipoint polymerase chain reaction (PCR) technique includes: DNA separation from the analysed object, one stage PCR production with using three pairs of the synthesised primers to a site of wbeN gene of wbf cluster, coding 01-antigen synthesis, to a site of ctxA gene coding synthesis of subunit A of cholera enterotoxin and to a site specific for comma bacillus of biovar eltor hlyA gene coding hemolysin synthesis; annealing of primers at temperature 95°-60°C during 13.5 min at number of amplification cycles 35; gel-electrophoresis; analysis of PCR results from electrophoregram and estimated results of detection and evaluation of required characteristics of comma bacillus from the presence or absence of specific strips of amplified DNA. A kit used in relation to the method comprises a complete set of reagents for DNA separation from a material, a complete set for amplification containing the primers specific to wbeN gene, hlyA gene and ctxA gene of comma bacillus, positive and negative control samples, a complete set for analysis of the products.

EFFECT: method with using the kit provides rapid, simple and precise detection of cholera agent and evaluation of its three basic properties.

3 cl, 5 dwg, 3 tbl

FIELD: chemistry, biochemistry.

SUBSTANCE: invention refers to molecular biology, can be used in medicine and represents process of DNA separation from paraffin block cut with histological material. The given cut is processed with aqueous solution Twin 20, proteinase K, aqueous solutions Chelex 100, Tris and ethylendiaminetetraacetic acid. Paraffin is removed from produced mixture. End product is separated form produced mixture by chloroform and ethyl alcohol.

EFFECT: production of high-yield DNA applicable in PCR.

1 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: present invention pertains to biotechnology, and particularly to genetic engineering. Proposal is given of synthetic oligonucleotide primers, complementary of the high conserved region of the genome of the virus for mucosal disease of cattle of the region of the NS5B gene, and a method of exposing RNA virus of mucosal disease in mucus of cattle. The method can be used in veterinary virology for diagnosing infectious diseases in farm animals, particularly mucosal disease of cattle, as well as differentiation of virus strains to genetic groups (genotypes).

EFFECT: obtaining synthetic oligonucleotide primers, complementary of the high conserved region of the genome of the virus for mucosal disease of cattle of the region of the gene, and design of a method of exposing RNA virus of mucosal disease in mucus of cattle.

3 cl, 2 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention refers to medical microbiology, specifically to laboratory diagnostics of pertussis agent. Method provides that clinical material is sampled from oral pharynx of the patient, with DNA separation, polymerase chain reaction and electrophoresis. Herewith clinical material is consistently warmed up at 95°C during 30 min, processed with lysozyme at 37°C±2°C during 30 min and proteinase K at 70°C within 2 hours. DNA separation is enabled through processing with lysing reagent and incubation at 65°C during 5 min, thereafter processing with sorbent at room temperature during 7 min, wash solution and elution with TE-buffer at 65°C within 5 minutes. PCR is performed with PCR reaction mixture, containing 10×PCR buffer with (NH4)2SO4, 2mM mixed nucleotides (dNTPs), 25mM MgCl2, 5% DMSO, three primer pairs BP-F3 5'-CCGCATACGTGTTGGCA-3' BP-B3 5'-TGCGTTTTGATGGTGCCT-3' BP-FIP5'- TTGGATTGC AGTAGCGGGATGTGC ATGCGTGCAGATTCGTC-3', BP-BIP5'-CGCAAAGTCGCGCGATGGTAACGGATCACACCATGGCA-3', BP-LF 5'-ACGGAAGAATCGAGGGTTTTGTAC-3' BP-LB 5'- GTCACCGTCCGGACCGTG-3' and Bst polymerase. Herewith amplification is cycling, at first at 65°C during 60 min, then at 80°C during 2 min, thereafter the cycle is repeated. After electrophoresis, PCR products are differentiated by comparing electrophoretic mobility of produced DNA fragments and mobility of DNA check samples of strains Bordetella pertussis. If specific luminous profile similar to check sample is found, DNA sample is recorded to contain DNA of strain B.pertussis, thus pertussis is diagnosed. Method is ensured by application of the set containing reagents listed above and check sample of DNA B.pertussis.

EFFECT: possibility to reveal disease agent within 9-10 hours from analysis beginning directly in the material from the patient that reduces diagnosis time, prescribing timely and adequate therapy.

2 cl, 2 tbl, 1 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to molecular biology. Method for DNA immobilisation is suggested, which implies immobilisation of purified DNA with 96° alcohol on paper medium, protective coating being applied by lamination. Method provides for long-term storage of DNA at room temperature.

EFFECT: provides for DNA long-term storage at room temperature.

3 tbl, 1 dwg

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. Version of solvable dependent on pyrroloquinolinquinone (PQQ) glucosodehydrogenase (s-GDH), containing insertion of amino acid residual between positions 428 and 429, which correspond to amino acid sequence of wild type known for Acinetobacter calcoaceticus and can contain one or several additional amino acid substitutions, is described. Represented is polynucleotide, coding described s-GDH version. Expression vector is described. It containes represented polynucleotide. Host-cell E.coli, containing described vector is described. Method of obtaining said s-GDH version, including cultivation of host-cell E.coli in conditions, suitable for obtaining enzyme version is described. Method of detection is described. It determines or measuring glucose in sample by means of described s-GDH version, which includes bringing sample in contact with said version.

EFFECT: obtaining possibility to determine concentration of sugars, especially glucose in sample efficiently.

20 cl, 8 ex, 4 dwg, 1 tbl

FIELD: medicine.

SUBSTANCE: invention relates to genetic engineering area and can be applied to medicine in diagnostics of several diseases, associated with metabolic syndrome. For determination of polymorphism Thr312Ala α-fibrinogen (FGA) gene the DNA from investigated sample is isolated and subject to amplification by polymerase chain reaction using allele-specific primers. For prevailing allele FGA T identification reverse primer 5'-TCC-CAG-AGT-TCC-AGC-TTC-CAG-T-3' is used; for rare allele FGA A identification reverse primer 5'-CCC-AGA-GTT-CCA-GCT-TCC-AGC-3' is used; as a direct primer in both cases serves the sequence 5'-TGT-CGA-GGG-TCA-TGC-AGT-AGG-G-3'. The invention makes it possible to carry out high-accuracy, simple, and low-cost analysis of fibrinogen polymorphism, suitable for clinico-diagnostic laboratories.

EFFECT: possibility to carry out high-accuracy, simple, and low-cost analysis of fibrinogen polymorphism, suitable for clinico-diagnostic laboratories.

2 dwg, 1 tbl

FIELD: organic chemistry, genetics.

SUBSTANCE: invention refers to genetic engineering. Recombinant plasmid DNA pYAll-39 contains: - Pstl-Pstl-DNA vector fragment pUC19 sized 2700 nucleotide pairs, - Pstl- Pstl - alphoid DNA fragment of human lymphocytes high-specific for centromeric areas of 4th and 9th human chromosomes sized 680 nucleotide pairs. The latter is produced from Pstl restriction fragments of alphoid DNA total fraction as chromosomes hybridization in situ under special conditions of high stiffness with standard saline solution with 55% phormamide. Genetic marker is -Ampr - gen of ampicillin-resistance. Invention enables to reliably identify 4th and 9th human chromosomes in norm and pathology, including preimplantation, prenatal and postnatal diagnostics of chromosome anomaly including aneuploidy at various cancer types, as well as for cytogenetic human genome mapping.

EFFECT: identification of 4th and 9th human chromosomes in norm and pathology.

1 cl, 4 ex

FIELD: technological processess.

SUBSTANCE: oligomeric polypeptide dimmers include ligand-binding leptyne domains. Domains are connected by means of flexible polypeptide linker molecules. Linker molecules might possibly include sites of sensitivity to proteases.

EFFECT: releases biologically active cytokines when injecting to human being or animal.

31 cl, 13 dwg

FIELD: medicine.

SUBSTANCE: invention can be used in manufacturing of vaccines for Streptococcus pyogenes - streptococci of group A (SGA) and Streptococcus agalactiae - streptococci of group B (SGB). Substance of the invention involves development of recombinant DNA pB1 derived from PCR with using chromosomal DNA of strain 090R Ia of serotype SGB, primers Pb1 and Pb2 and following cloning with using expression plasmid pQE-30 in E coli M15. Recombinant DNA pB1 codes recombinant protein PB1 expressing protective properties in relation to specified streptococci which has no enzymatic activity and causes synthesis of anti-Pb1 antibodies expressing protective properties in relation to Streptococcus pyogenes and Streptococcus agalactiae. In the invention there is developed recombinant plasmid DNA pQE-pB1 representing plasmid DNA pQE-30 that bears recombinant DNA pB1, and strain-producer E. coli M15-PB1 enabling to express recombinant protein PB1.

EFFECT: no enzymatic activity of produced recombinant protein allows application as an ingredient of the vaccine for Streptococcus pyogenes and Streptococcus agalactiae.

7 cl, 7 dwg, 4 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention is related to the field of medicine and is related to treatment of proliferative diseases with application of antisense oligomer IAP and chemotherapeutical preparation. Substance of invention includes method for treatment of patient suffering from proliferative disease with application of antisense oligomer SEQ ID NO: 151 or its pharmaceutically acceptable salt and chemotherapeutical preparation.

EFFECT: invention advantage consists in improved efficiency of treatment.

28 cl, 15 ex, 9 tbl, 25 dwg

FIELD: medicine.

SUBSTANCE: method of cultivation of pluripotential stem cells herewith conserving undifferentiated condition and pluripotency thereof without using feeder cells. The method applies fluid medium and culture bottle on the surface of which there are immobilised molecule of fused protein containing outer domain of E-cadherin and Fc-region of immunoglobulin.

EFFECT: invention can be used in regenerative medicine.

9 cl, 11 dwg, 7 ex

FIELD: medicine.

SUBSTANCE: method involves deactivation of definite VGC2 DNA sequence of Salmonella typhimurium positioned between ydhE and pykF genes or its part containing at least 50 nucleotides, or the DNA version of at least 85% identity, representing VGC2 DNA of any microbe out of Salmonella aberdeen, Salmonella gallinarum, Salmonella cubana and Salmonella typhi.

EFFECT: obtainment of microbe with reduced adaptability to specific environmental conditions.

6 cl, 12 dwg, 8 ex

FIELD: genetic engineering.

SUBSTANCE: invention can be used in monocotyledon plants selection for creation of novel sorts and hybrids by means of genetic engineering, in works insertional mutagenesis, separating and cloning of plant genes. In order to obtain transgenic monocotyledon plants in period of their active blooming flowers lacking own fertile pollen are selected. As object of genetic transformation, blooming female gametophyte is used, which is processed with suspension of strain Agrobacterium tumefaciens with activated vir-genes, pistil filaments being processed directly. After that said flowers are pollinated with pollen of fertile plants. For processing cells with strain Agrobacterium pistil filament sections, located near flower ovary, are used.

EFFECT: said operations allow to create transgenic monocotyledon plants preserving high frequency of their obtaining under conditions, that correspond to natural temperatures of blooming, and to simplify technology of obtaining transgenic plants.

4 cl, 1 dwg, 1 tbl

FIELD: medicine, microbiology.

SUBSTANCE: invention concerns biotechnology. It is described bispecific antibody which binds also the factor of blood coagulation IX or the activated factor of blood coagulation IX, and the factor of blood coagulation X, and functionally replaces the factor of blood coagulation VIII or the activated factor of blood coagulation VIII which strengthens enzymatic reaction. The pharmaceutical composition containing the described antibody is revealed. The present invention can be used as an alternative agent for functional replacement of cofactor which strengthens enzymatic reaction.

EFFECT: creation of bispecific antibody which can replace functional proteins, strengthens enzymatic reaction.

14 cl, 18 dwg, 37 ex

FIELD: biotechnology, organic chemistry, biochemistry.

SUBSTANCE: invention represents a novel method of preparing optically active 4-(indole-3-ylmethyl)-4-hydroxy-2-oxoglutaric acid (IHOG) used in preparing monatine, and a method for synthesis of optically active monatine. Also, invention relates to a novel aldolase used in these methods. 4-(Indole-3-ylmethyl)-4-hydroxy-2-oxoglutaric acid of high optical purity representing effective intermediate compound for synthesis of optically active monatine can be synthesized from indolpyruvic acid and pyruvic acid (or oxalacetic acid). Invention provides preparing 4-(indole-3-ylmethyl)-4-hydroxy-2-oxoglutaric acid and monatine with high degree of effectiveness.

EFFECT: improved preparing method.

18 cl, 12 dwg, 12 tbl, 25 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to new aldolase which catalyzes reaction of producing substituted alpha-ketoacid from oxalacetic or racemic pyrotartaric acid and indole-3-racemic pyrotartaric acid.

EFFECT: method for production of substituted alpha-ketoacids with increased effectiveness.

FIELD: gene engineering, in particular yeast strain modified by introducing of foreign genetic material.

SUBSTANCE: claimed strain is obtained by transforming of starting culture Pichia pastoris X-33 with two albumin structural genes with signals of yeast alpha-factor secretion, transcribed under control of 5'AOX1 promoter and transcription termination region of hepatitis G virus. Strain of present invention is useful in production of albumin-containing drugs.

EFFECT: strain for production of human recombinant albumin of increased yield.

3 ex

FIELD: biotechnology, in particular plant gene engineering.

SUBSTANCE: recombinant plasmid DNA pBi101-IL18 is constructed having length of 15000 n.p. and containing DNA fragment of pBi101-IL18 vector plasmide having length of 13900 n.p.; -NdeI-BamHI/BgIII DNA fragment being cDNA site of human IL-18 gene; -Nol-NdeI fragment of pET15b plasmide; encoding N-terminal polypeptide from six hystidine amino acids and site of thrombin enzyme hydrolysis, -5'URT region from genome of tobacco etch virus; double 35S CaMV promoter from genome of cauliflower mosaic virus; -3'URT region from genome of cauliflower mosaic virus. Method of present invention makes it possible to transfer nucleotide sequence of human IL-18 in plant genomic DNA.

EFFECT: method for production of mature human IL-18 having biological activity.

2 dwg, 1 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: invention is related to biotechnology, namely to method for production of chondro-osteogenous cells in vitro and their application. Chondro-osteogenous cells are produced from mesenchyme stem cells of a human being. Mesenchyme stem cells of a human being are cultivated in medium with additives of human blood serum and beta -1 transforming factor of growth, having molecular domain, which provides for interaction with collagen I (TGF-β1-CBD). Then stem cells are exposed to further proliferation by means of addition of human blood serum and TGF-β1-CBD. In the end chondro-osteogenous induction is carried out by dexamethasone and -β-glycerophosphate. Chondro-osteogenous cells may be used in composition that is able to induce osteogenesis.

EFFECT: invention makes it possible to make medical preparations for recovery of bone and/or chondral tissue.

20 cl, 3 dwg, 3 tbl, 7 ex

Up!