Recombinant dna ensuring production of recombinant protein pbi expressing protective properties in relation to streptococcus pyogenes and streptococcus agalactiae

FIELD: medicine.

SUBSTANCE: invention can be used in manufacturing of vaccines for Streptococcus pyogenes - streptococci of group A (SGA) and Streptococcus agalactiae - streptococci of group B (SGB). Substance of the invention involves development of recombinant DNA pB1 derived from PCR with using chromosomal DNA of strain 090R Ia of serotype SGB, primers Pb1 and Pb2 and following cloning with using expression plasmid pQE-30 in E coli M15. Recombinant DNA pB1 codes recombinant protein PB1 expressing protective properties in relation to specified streptococci which has no enzymatic activity and causes synthesis of anti-Pb1 antibodies expressing protective properties in relation to Streptococcus pyogenes and Streptococcus agalactiae. In the invention there is developed recombinant plasmid DNA pQE-pB1 representing plasmid DNA pQE-30 that bears recombinant DNA pB1, and strain-producer E. coli M15-PB1 enabling to express recombinant protein PB1.

EFFECT: no enzymatic activity of produced recombinant protein allows application as an ingredient of the vaccine for Streptococcus pyogenes and Streptococcus agalactiae.

7 cl, 7 dwg, 4 tbl, 8 ex

 

The invention relates to the field of Microbiology and molecular genetics and can be used in the medical industry in the production of vaccines against Streptococcus pyogenes, Streptococcus group a (MUH), and Streptococcus agalactiae, streptococcal groups (GMT).

Streptococcus pyogenes (MUH) is a common pathogen for humans and primates, infecting mainly nasopharyngeal mucosa and skin. Streptococcus spp. infecting mucous person that cause acute sore throat, scarlatina, chronic tonsillitis and pharyngitis, often accompanied by serious complications, such as otitis media, rheumatic fever and glomerulonephritis. For skin diseases, called MUH include impetigo, vasculitis, acute post-traumatic and post burn tissue damage and erysipelas. In some cases, the infection caused MUH, go into a more generalized form: necrotizing fasciitis, streptococcal sepsis and toxic shock syndrome. These diseases are characterized by a high percentage of deaths due to the rapid development of shock on the background of the General failure of the organs of the human body.

Streptococcus agalactiae (GMT) is a major cause of serious perinatal infections, most often occurring in the form of pneumonia, sepsis and meningitis. - Child transmission occurs during delivery from mA who Yeri with carrier GMT or even antinatalism in the case of asymptomatic carriage GMT the mother. In older children streptococcal infection manifests itself in the form of osteomyelitis, arthritis, damage to eyes, skin and bladder. In adults, Streptococcus group b can also cause a number of severe diseases such as pyelonephritis, arthritis, ophthalmic, endocarditis, septicaemia and other

Currently, the disease caused by Streptococcus group a and b, considered as an important socio-economic and health problem in all countries of the world. Disease caused by Streptococcus group a and b treated with antibiotics (Stratchounski PS, S.N. Kozlov, APAR. Antimicrob. Hamiter., M: Borges, 1-432 (2002), Pole MS fundamentals of antibiotic therapy, St. Petersburg: NICP, 1-53 (2003)). The drugs of choice for treatment of MUH and GWA infections are beta-lactams: benzylpenicillin, ampicillin (Semin N.A., Sidorenko S. and others, Wedge. Microbiol. Antimicrob. Hamiter (4): 306-359 (2004)), ampicillin + sulbactam (Burbelo A.T., etc., Mo. The pharmaceutical. Funds, St. Petersburg: Neva, 332 (2003)); macrolides: erythromycin, clarithromycin, roxithromycin, azithromycin; vancomycin (Zuev, L.P., Pole MS and other Microbiological monitoring, St. Petersburg: Medical information-analytical center, 1-72 (2004)).

In order to prevent MUH and GWA infections using antibiotics such as benzathine benzylpenicillin (Burbelo A.T., etc., Mo. The pharmaceutical. Funds, St. Petersburg: Neva, 323-324 (2003)), er is thromycin (Burbelo A.T. etc., Mo. The pharmaceutical. Funds, St. Petersburg: Neva, 352 (2003)), ampicillin + sulbactam (Burbelo A.T., etc., Mo. The pharmaceutical. Funds, St. Petersburg: Neva, 332 (2003)).

Antibiotic therapy is widely used as prevention and treatment is often ineffective due to the increase in the number of antibiotic-resistant strains. Another significant disadvantage of antibiotic therapy is the occurrence of side effects for people's health. These include allergic reactions, disruption of the body's immune system, disruption of the microflora of the body and the development of co-morbidities and complications on the background of immunodeficiency, negative effect on the Central nervous and cardiovascular system, and some important internal organs.

In this regard, the need for a vaccine against streptococcal groups a and b remains an actual problem.

Almost all strains of MUH and GWA produce on the cell surface Sa peptidase - the enzyme that breaks Sa component of the complement of man, monkeys and cows, which has the properties of anaphylatoxin and is involved in the attraction of polymorphonuclear leukocytes to the infection site (Wexler D.E., and P.P.Cleary, Infect. Immun. 39:239-246 (1983); Wexler D.E., and P.P.Cleary, Infect. Immun. 50:757-764 (1985)). In addition, it was demonstrated that Sa peptidase has the ability to bind fibronectin, as well as participants of the duty to regulate in invasion of epithelial cells (Beckmann C. and others, Infect. Immun. 70: 2869-2876 (2002); Cheng Q., and others, Infect. Immun., 70: 2408-2413 (2002)).

When comparing genes scpA and scpB, coding Sa peptidase streptococci of groups a and b, was identified 95-98% homology of their nucleotide sequences (Chmouryguina I., A. Suvorov and others, Infect. Immun. Jul: 2387-2390, (1996)). It was also found that the only area that distinguishes scpA from the scpB is an additional area the size of the gene 51 P.N., localized close to the 3' end of scpA (Cleary RRI others. Infect. Immun. 60: 4239-4244 (1992)).

For the first time the gene encoding CA peptidase MUH (CS24) M12 serotype was prolongirovanne using the expression vector RT in E. coli DH 5A in 1989 American scientists P.P. Cleary and S. Chen (Chen C.C. and P. Cleary Infect. Immun, 57. 1740-1745 (1989)).

In 2000, there were prolongirovanne full-size genes scpB from two strains GMT (125 and 130) serotype III using the plasmid vector pGEX-2T and the resulting recombinant proteins SCPB (John F. Bohnsack J.F. and Infect others. Immun. 68(9): 5018-5025 (2000)).

In 2002, from GMT (SN) serotype III were prolongirovanne genes scpB, encoding full-Sa peptidase (from 1 to 1090-th amino acid residue) and a fragment Sa peptidases (116 th 227 th amino acid residue) using the plasmid vector pGEX-4T3 in E. coli BL21(DE3) (Beckmann C., and others, Infect. Immun. 70(6): 2869-2876 (2002)).

The prototype of the invention is the gene encoding CA peptidase GMT strain 78/471 II/c serotype, which was prolongirovanne in E. coli DH 5A used in the expression of the plasmid vector pGEX-4T-l in 1996 Russian scientists Smoriginas I.I. Suvorov, A.N. in collaboration with American scientists Ferrieri P. Cleary P.P. as a result of this work was expressed and purified recombinant protein SCPB molecular weight of 126 kDa. In the test for inhibition of chemotaxis of human blood cells was demonstrated biological activity obtained SCPB protein (Chmouryguina I., A. Suvorov and others, Infect. Immun. Jul: 2387-2390, (1996)).

When considering the possible use of SCPB to create vaccines a lack of this protein was the preservation of its enzymatic activity, which questioned the possibility of its application to the human body.

The objective of the invention was to obtain recombinant protein RW with no enzymatic activity with immunogenic and protective properties, and getting it on the basis GMT Ia serotype Sa peptidases, with the aim of its use as a component of a vaccine against Streptococcus pyogenes and Streptococcus agalactiae. The invention was the creation of producer strain recombinant protein RW.

The task was solved by designing a unique primers in polymerase chain reaction received fragment of the nucleotide sequence that encodes part of amino acid sequence Sa peptidases GMT, which during the formation of the tertiary structure of the be the AC had formed the centre by activity. For fast and simple preparation of recombinant protein RW for cloning the DNA fragment was used expression system plasmids pQE. To create strain-producer of recombinant protein RW was used E. coli strain M15 (The QIAexpress System, Qiagen, USA). In the experimental work of this strain has acquired new properties: the ability to Express the recombinant protein RW. The new strain was named E. coli M15-RW.

The essence of the invention is the creation of unique recombinant DNA (labeled RV)obtained by polymerase chain reaction (PCR) using chromosomal DNA of strain 090R serotype Ia GMT, unique primers Pb1 and Pb2 and the subsequent cloning using the expression plasmid pQE-30 (The QIAexpress System, Qiagen, USA). The obtained recombinant DNA RV encodes a unique recombinant protein RW.

Also the essence of the invention is the creation of recombinant plasmid DNA pQE-pB1, carrying recombinant DNA RV, and producer strain E. coli M15-PB1, which allows, under certain conditions, to Express the recombinant protein RW.

The authors have obtained a fragment of the gene encoding CA peptidase strain 090R serotype Ia GMT, with 114 BP in 1049 BP (denoted as Pb, size 936 BP) using the polymerase chain reaction used the eat primers Pb1 and Pb2 and the chromosomal DNA of strain 090R serotype Ia GMT. Also, the authors carried out the cloning radio using the expression plasmid pQE-30 and the subsequent transformation of the obtained recombinant plasmid (designated as pQE-pB1) in the heterologous system of E. coli M15. The authors have obtained the strain-producer of recombinant protein RW, designated as E. coli M15-PB1. Also, the authors implemented the expression of recombinant protein RW cells of E. coli strain M15-PB1 with the subsequent stage by affinity purification using Ni-sepharose (Amersham, USA).

The authors have obtained anti-RV antibody in a subcutaneous recombinant protein RW mammals (mice and rabbits).

The authors also found anti-RV antibodies in the sera of patients after infection GMT.

The authors also studied the protective properties of anti-RV antibodies in model experiments in vitro (opsonophagocytosis test using murine peritoneal macrophages and streptococci of groups a and b) and in vivo (exploring the dynamics of generalized GMT infection in mice, pre-preimmunization recombinant protein RW).

Presented here is a new recombinant protein RW has the desired physiological stability, has no enzymatic activity, causing the synthesis of anti-RV antibodies with protective properties against Streptococcus pyogenes and Streptococcus agalactiae. protein RW useful as a vaccine component for the prevention and treatment of bacterial infections caused by Streptococcus pyogenes and Streptococcus agalactiae. Recombinant protein RW also useful as a single component vaccine preparation, and as one of the components of a multicomponent vaccine against Streptococcus pyogenes and Streptococcus agalactiae.

The preparation of recombinant protein RW

Chromosomal DNA was isolated from the reference strain 090R serotype Ia GMT phenol-chloroform extraction. The gene encoding CA peptidase strain 090R serotype Ia GMT, was designated as scpB1. To obtain the fragment of the gene scpB1 with 114 BP in 1049 BP (denoted as Pb, size 936 BP) used the polymerase chain reaction. The resulting panorama of the DNA fragments were separated by horizontal electrophoresis in 1% agarose gel. The Pb fragment was isolated from agarose using a set of "QIAquick Gel Extraction Kit" (Qiagen, USA).

The obtained pB fragment was cloned using the expression plasmid pQE-30 (The QIAexpress System, Qiagen, USA). In preparation for the cloning was carried out by a double restriction isolated from agarose Pb (936 BP) and the plasmid pQE-30 (3462 P.N.) enzymes BamHI and SacI with the formation of sticky ends. Food restriction were separated by horizontal electrophoresis in 1% agarose gel. Restrictively Pb (fragment of the gene scpB1 after restriction: 119 1043 BP, the size of 925 BP, identified as Pb') and restricion plasmid pQE-30 (about the meant as pQE-30', size 3446 BP) was isolated from the agarose using a set of "QIAquick Gel Extraction Kit" (Qiagen, USA). As a result of the cloning was obtained recombinant plasmid DNA (designated as pQE-pB1)carrying the recombinant DNA (labeled RB and consisting of 925 BP fragment of the gene scpB1 and 50 BP fragment of the plasmid pQE-30). The nucleotide sequence RV presented in figure 1.

Recombinant plasmid DNA pQE-pB1 was transformed into E. coli M15 (The QIAexpress System, Qiagen, USA) using the calcium method.

The cloned transformants were selected after growth on solid selective media, given the marker of resistance to ampicillin, who was carrying a plasmid pQE-30. Clones of transformants were selected clones containing recombinant plasmid pQE-pB1, the presence of which was determined by PCR using the original primers Pb1 and Pb2 and subsequent electrophoretic analysis of DNA fragments in a 1.5% agarose gel.

Clones of E. coli M15 containing recombinant plasmid pQE-pB1, (denoted as E. coli M15-PB1), was tested for the ability to Express the protein RW. For the production of purified recombinant protein cells E. coli M15-PB1 were cultured broth OUT (Brain Heart Infusion Broth, Gibco, USA) supplemented with antibiotics (ampicillin (100 μg/ml) and kanamycin (25 μg/ml)) to late logarithmic growth phase (OD600=0,7÷0,9). Then is xpressio recombinant protein was induced by adding isopropyl-beta-D-thiogalactopyranoside (IPTG), and cells were cultured for another 4 hours. After that, the cells were besieged by centrifugation, washed lytic buffer A (20 mm Na2HPO4, 20 mm NaH2PO4, 500 mm NaCl, 20 mm imidazole, pH=7.4) and suspended in the same buffer. Suspension cells were exposed to ultrasound. Cell lysate released from the cell debris by centrifugation, were applied to a column Packed with Ni-separate (Amersham, USA). After the protein was associated to the matrix column, it was washed with buffer to remove nonspecific proteins bound peroxidase. Recombinant protein RW was suirable column with an eluting buffer B (20 mm Na2HPO4, 20 mm NaH2PO4, 500 mm NaCl, 500 mm imidazole, pH=7.4). Obtained after affinity chromatography RV was Valitova against 20 mm Na2HPO4, 20 mm NaH2PO4pH=7,8 with the addition of 500 mm NaCl.

The molecular weight of RF were determined using 12% SDS-PAGE, comparing mileage protein RW with mileage proteins of known molecular weight (Precision Plus Protein standards (No. 161-0373), Bio-Rad, USA). The molecular mass of the recombinant protein RW was equal (43,0±0,5) kDa.

Figure 1 (nucleotide sequence of recombinant DNA RV) represents the complete nucleotide sequence of recombinant DNA pB1, consisting of 975 BP and encoding the amino acid sequence of the recombinant protein PB1.

Figure 2 (amino acids is, the first sequence of the recombinant protein PB1) represents the amino acid sequence of the recombinant protein PB1, consisting of 325 amino acid residues.

Thus, recombinant PB1 protein contains the amino acid sequence Sa peptidases GMT strain 090R serotype Ia 39 348 amino acid residue covalently associated with sixteen amino acid residues encoded by pQE-30 (The QIAexpress System, Qiagen, USA). Amino acid sequence GMT Sa peptidases, part of the recombinant protein PB1 and coded pB', consists of 309 amino acid residues and contains only two (D130and H193of three amino acid residues involved in the formation of the center of the enzymatic activity, which guarantees the absence of enzymatic activity of recombinant protein PB1.

For a better understanding of the invention, figure 3 is a schematic representation of the position of the amino acid sequence encoded by the RV' relative to the amino acid sequence Sa peptidases GMT.

Figure 3. (Scheme amino acid sequence Sa peptidases GMT):

1 - signal peptide;

2 - amino acid sequence encoded by the fragment pB';

3 - phase, associated with the peptidoglycan;

4 - With-repeats;

5 - LPXTN-motive;

6 - hydrophobic transmembrane area;

7 - cytoplasmic area;

D130H193, S512- amino acid residues that form the center of the enzymatic activity of the.

The result of the invention is a recombinant DNA RV having the nucleotide sequence represented in figure 1, the recombinant plasmid DNA pQE-pB1, which is a plasmid pQE-30, carrying the recombinant DNA RV; E. coli strain M15 transformed with recombinant plasmid DNA pQE-pB1, and expressing the recombinant protein RW; recombinant protein RW having the amino acid sequence represented in figure 2.

Recombinant protein RW has the following properties:

A. when introduced into the organism of mammals (mice and rabbits) causes the synthesis of anti-RV antibodies;

B. synthesized anti-RV antibodies have protective properties against Streptococcus pyogenes and Streptococcus agalactiae;

century does not possess enzymatic activity.

Following are specific examples illustrating some versions of the invention, but not limiting it.

Example 1. Obtaining a DNA fragment of Pb by polymerase chain reaction.

To 0.25 microgram of genomic DNA extracted from GMT 090R serotype Ia, was added 10 mcmole each of the specific primers (Pb1, Pb2), flanking the sequence under consideration, the buffer with magnesium for the polymerase, 0.2 mm each of the 4 deoxyribonucleotides, the volume was diluted to 25 ml. Added to 0.2 ál thermostable DNA polymerase. On the surface of the liquid which was just added 40 μl of mineral oil. The tubes were placed in the amplifier (Terzic", Russia). The mixture is incubated at 94°C for 3 minutes. The device was programmed in the cycle of denaturation 94°C for 15 seconds, cycle the annealing of primers 68°C for 15 seconds, cycle of DNA synthesis and 72°C for 20 seconds. The sequence of such cycles were repeated 35 times.

After which the mixture is incubated at 72°C for 1 minute. Oligonucleotide primers used are listed in Table 1.

Table 1
Oligonucleotide primers
NameThe nucleotide sequence from the 5' to 3'Position on the nucleotide sequence of the gene scpB1Melting point
Pb1TCCTGGATCCGAACAAACCGTAGAA114-145 gel69,5°C
Pb2TCTTGGAGCTCGGCTGTTTTGACCCTAACAGT1049-1018 gel69,5°C

In the polymerase chain reaction with primers Pb1 and Pb2 was obtained DNA fragment with a 114 BP in 1049 P.N. (936 BP), denoted as Pb. In addition, at the 5'-end Prime time the s were the sites of recognition endonucleases BamHI and SacI for subsequent cloning of the DNA fragment RV. The result of PCR was evaluated using horizontal electrophoresis in 1% agarose gel (figure 4). The dimensions of the resulting DNA fragments was calculated using a computer program SEQAID on the basis of comparing their electrophoretic mobility electrophoretic mobility marker of molecular weights (100 BP DNA marker, SibEnzyme, Russia).

Figure 4. (Obtaining the DNA fragment Pb PCR):

1 - 100 BP DNA marker;

2 - PCR products obtained when the annealing temperature of the primers 67°C;

3 - the PCR product obtained when the annealing temperature of the primers 68°C.

Example 2. Cloning of the DNA fragment Pb using the expression plasmid pQE-30.

Cloning of the DNA fragment Pb was performed using gene-expression plasmid pQE-30 ("The QIAexpress System", Qiagen, USA). In preparation for the cloning was carried out by a double restriction isolated from agarose Pb (936 BP) and the plasmid pQE-30 (3462 P.N.) enzymes BamHI and SacI with the formation of sticky ends. Food restriction were separated by horizontal electrophoresis in 1% agarose gel. The dimensions of the resulting DNA fragments were counted as described in example 1. Restricion Pb (fragment of the gene scpB1 after restriction: 119 1043 BP, the size of 925 BP, identified as Pb') and the plasmid pQE-30 (designated as pQE-30', size 3446 BP) was isolated from the agarose using a set of "QIAquick Gel Extraction Ki" (Qiagen, USA).

During cloning to 30 μl of the DNA fragment RV' was added 2 μl of the plasmid pQE-30' (The QIAexpress System, Qiagen, USA) in a concentration ratio of 4:1, 5 μl of tenfold ligase buffer and 1 μl of ligase isolated from phage T4. The volume was diluted to 50 ál. The mixture is incubated for 1 hour at room temperature and at 4°C for 12 hours. As a result of the cloning was obtained recombinant plasmid DNA (designated as pQE-pB1)carrying the recombinant DNA (labeled RB and consisting of 925 BP fragment of the gene scpB1 and 50 BP fragment of the plasmid pQE-30).

Example 3. The transformation of a culture of E. coli M15 plasmid DNA pQE-RW.

Recombinant plasmid DNA pQE-pB1 transformed in a heterologous system in E. coli M15. As a positive control in parallel carried out the transformation of E. coli M15 original plasmid DNA pQE-30. Genetic marker plasmid DNA pQE-30 was a gene amp, encoding beta-lactamase, which provides resistance to ampicillin cells carrying this plasmid. Culture of cells of E. coli M15 was cultured in BHI broth (Brain Heart Infusion Broth, Gibco, USA) with kanamycin (25 μg/ml) for 12 hours at 37°C. and vigorous stirring was perseval the new volume of the same medium (1/50V) and incubated at 37°C for 2-3 hours under vigorous stirring to OD600=0,35. Grown cells in a volume of 1 ml was centrifuged for 1 min at 12000 rpm and the precipitate resuspendable in 200 ál of 0.1 M CaCl 2. The mixture was incubated in ice for 1 hour. After centrifugation the precipitate resuspendable in to 187.5 μl of 0.1 M CaCl2and 62.5 ál of deionized water. Then the tube was made of 0.2 μg of plasmid DNA and incubated the mixture in ice for 1 hour. Next, the mixture was stirred for 2 min at 42°C and again transferred to ice for 10 minutes thereafter, to the mixture was added 1 ml of BHI broth with kanamycin (25 μg/ml) and incubated 1 hour at 37°C. After sedimentation by centrifugation (8000 rpm for 1 min), the cells were sown on plates with 1% L-agar (Difco, USA)containing ampicillin (100 μg/ml) and kanamycin (25 μg/ml). The selection of clones of transformants was performed after 18 hours of growth, cells at 37°C. as negative control were sown pure culture of cells of E. coli M15.

The presence of recombinant DNA RV plasmid pQE-pB1 was determined by PCR using the original primers Pb1 and Pb2 and subsequent electrophoretic analysis of DNA fragments in a 1.5% agarose gel (figure 5). The dimensions of the resulting DNA fragments were counted as described in example 1.

Figure 5. (Electrophoresis products Poland resulting from amplification of DNA extracted from different clones of transformants):

1-7 - recombinant clones carrying the plasmid pQE-pB1;

8 - skipped track;

9 - the clone carrying the original plasmid pQE-30;

10 - the PCR product by the original chromosomal DNA of strain GMT 090R.

So the m way the data obtained allow us to conclude that as a result of cloning were obtained recombinant clones carrying the plasmid pQE-pB1 with recombinant DNA RV, which was named E. coli M15-PB1.

Example 4. Purification of recombinant protein RW.

Culture of E. coli strain M15-PB1 was grown in broth VN with the addition of ampicillin at a concentration of 100 μg/ml and kanamycin at a concentration of 25 μg/ml overnight under vigorous stirring. Cells were cultured for 12 hours, perseval 300 ml of the same medium (1/50V) and incubated at 37°C for 2-3 hours with vigorous stirring until OD600=0,7÷0,9. The expression of recombinant protein was induced by addition of a solution of isopropyl-beta-D-thiogalactopyranoside to a final concentration of 2 mm, and then incubated the cells under the same conditions for another 4 hours. The obtained cell suspension was centrifuged at 6000 rpm for 5 min. the Supernatant was decanted, and the cells resuspendable in buffer A (20 mm Na2HPO4, 20 mm NaH2PO4, 500 mm NaCl, 20 mm imidazole, pH=7.4)by adding the inhibitor of the protease phenylmethylsulfonyl (PMSF) to a final concentration of 1 mm.

The obtained cell suspension was centrifuged at 8000 rpm for 1 minute, the Supernatant was decanted, and the cells resuspendable in buffer A. For lizirovania cells was used trejqet what I ultrasonic treatment at 4°C for 20 sec with an interval of 40 seconds in an ultrasonic disintegrator (USDN-U, USSR). The cell lysate was centrifuged at 13400 rpm and 4°C for 20 minutes the Supernatant was passed through 0.2 μm filters (Millipore, USA). Next, the filtered cell lysate was applied to a column of Ni-separate (Qiagen, USA), pre-equilibrated with buffer A. Next, the column was washed with the same buffer as long as the OD values280facing the solution was less than 0.01. Protein was suirable solution of buffer B (20 mm Na2HPO4, 20 mm NaH2PO4, 500 mm NaCl, 500 mm imidazole, pH=7.4), creating a gradient of imidazole from 20 to 500 mm. The eluate was collected fractions of 500 ál and analyzed in 12% SDS-PAGE. Fractions that contained protein were dialyzed with stirring at 4°C against buffer B (20 mm Na2HPO4, 20 mm NaH2PO4, 500 mm NaCl, pH 7.8) to within 12 hours.

Figure 6 presents electrophoregram recombinant protein RW at different stages of purification.

Figure 6. (Electrophoregram recombinant protein RW at different stages of purification using Ni-sepharose):

1,8 - molecular weight markers;

2 - supernatant proteins after ultrasonic dissection of cells of E. coli M15-RW;

3 - preparation of proteins, not contacting Ni-separate;

4 - preparation of proteins in a wash buffer after washing the Ni-sepharose 30-fold volume of buffer;

5, 6, 7 - fractions of the preparation of pure protein (=0.5 mg/ml) elution gradient of the imidazole is from 20 mm to 500 mm.

The molecular weight of RF were determined using 12% SDS-PAGE, comparing mileage protein RW with pre-owned: proteins of known molecular weight (Precision Plus Protein standards (161-0373), Bio-Rad, USA). The molecular mass of the recombinant protein RW was equal (43,0±0,5) kDa.

Example 5. Dynamics of changes in the titer of antibodies to the recombinant protein RW after immunization of mammals.

Humoral immune response to recombinant protein RW studied in outbred white mice (males weighing 16-18 g), and rabbits (females weighing 2.5 kg), obtained from the kennel "Rapolano", Russian Academy of medical Sciences. Immunization was performed twice and subcutaneously with adjuvant aluminium hydroxide. In the experiment used 30 mice and 2 rabbits that were injected with 0.2 ml and 0.5 ml RV with adjuvant at the ratio of 1:1, respectively. For mice when the first injection was administered 0.2 ml RV with adjuvant in a volume ratio between 1:1 and at day 22 were botirovna 0.2 ml RV without adjuvant. When the first injection final concentration RV was 100 μg/ml and 50 μg/ml at the second injection, which was done on days 1 and 22 days, respectively. The rabbits were twice injected subcutaneously with 0.5 ml RV adjuvant in a volume ratio of 1:1. When the first injection final concentration RV was 240 μg/ml and 120 μg/ml if the second injection, which was done on the 1st and 28th days, respectively. Mouse antibodies to RV were determined from 22 to 118-th day from the beginning of immunization, using a pool of sera from 3 animals. Rabbit antibodies to RV was determined from the 28th through the 66th days from the start of immunization, using a pool of sera from 2 animals.

Anti-RV antibodies was determined using the two-layer method enzyme-linked immunosorbent assay (ELISA). In the wells of polystyrene tablet with a high sorption capacity (Costar, USA) were made in 100 μl of antigen (recombinant protein RW) at a concentration of 2 µg/ml Sorption were carried out in 100 mm bicarbonate buffer (pH=9,45) for 16-20 hours at 4°C.

After that, the content of the tablet was removed and added to the wells, 150 μl of buffered saline solution, pH of 7.4 (PBS)containing 0.05% tween-20 (PBST). Incubation was carried out at 37°C for 30 minutes the Contents of the tablet was removed and washed three times PBST. Then, wells were made immune or normal (as negative control) serum (starting dilution 1:100) with the subsequent step of breeding equal to two. All cultivation was carried out in PBST, and each sample was duplicated. Incubation was carried out for 1 hour at 37°C. Next, the contents of the tablet was removed and washed twice tablet PBST. After that, the wells were added 100 μl of A-HRP conjugate (protein a of Staphylococcus, covalently linked to horseradish peroxidase) at a concentration of 10-7mol/L. After an hour incubation at 37°C. the contents of the tablet was removed and washed three times what the tablet PBST and once with PBS, to avoid the inhibitory effect of tween-20 on the enzymatic activity of the peroxidase. Next to visualize the reaction wells were made in 100 μl of substrate mixture (0.5 μg/ml o-phenylenediamine in 150 mm phosphate-citrate buffer (pH=5.0), 10 μl of 30% hydrogen peroxide), which was prepared immediately before use. Tablet incubated for 30 min in the dark at room temperature, and the reaction was stopped by the introduction into the wells, 30 ál of 50% concentrated sulfuric acid. The reaction was detected at a wavelength of 492 nm using a device Titertek Multiskan (USA).

The titre of specific antibodies was determined at different time of immunization. Three weeks from the beginning of the experiment immunization of laboratory animals was marked by the appearance in the blood of specific antibodies to RV. The results presented on Fig.7, showed the presence of strong humoral immune response to the introduction of recombinant protein RW. The maximum titer of antibodies to protein RB was observed in 60 (1,6×10-6day 52 day (5,1×10-4from the beginning immunization in rabbits and mice, respectively.

7. (Dynamics of changes in the titer of anti-RV antibodies after immunization of mice and rabbits).

Example 6. The definition of anti-RV antibodies in sera from patients GMT.

For more docusates is in about participation in the development of the pathogenic process surface protein GMT RV sera from patients GMT, obtained from research Institute of obstetrics and gynecology name Dooto were tested for the presence of antibodies to the recombinant protein RW. Anti-RV antibodies in the sera of patients was determined using the two-layer method enzyme immunoassay as described above in example 5. The obtained data are presented in table 2.

Table 2
The titers of specific anti-RV antibodies in sera from patients GMT
Room wheyThe titer of anti-RV antibodies
Norma4×10-2
4849gl,of 1.6×10-3
3598gl,
2607gl,
5218gl
2207gl,of 3.2×10-3
3693gl,
6558gl,
2359gl,
3252gl, 297 la
2655gl,of 1.3×10-4
5150gl
5358glof 2.6×10-4

The data in table 2 show that of the 13 tested sera more than half (69%) of the sera was found to have a high titer of anti-RV antibodies. The results obtained indicate that in the sera of patients among the antibodies formed to intact cell GWA, there are antibodies to the recombinant protein RW.

Example 7. The study upanishada efficiency rabbit anti-RV antibodies.

It is well known that the main defense mechanism of the host against bacterial infection is the process of phagocytosis mediated by specific antibodies (opsonophagocytic). Opsonizing activity of rabbit anti-RV antibodies (titer = 9,6×10-5) was studied on a monolayer of mouse peritoneal macrophages. Macrophages induced for two days before receiving peritoneal exudate introduction of mice with 0.5 ml of 10% peptone intraperitoneally. Peritoneal exudate from 4-5 mice were washed in culture medium IMDM (Iscove''s Modified Dulbecco''s Media, Biolot, Russia), cell washing and, suspended at a concentration of 1 million/ml and were sown in a volume of 0.2 ml in 96-well card for tissue culture, in a volume of 1.0 ml in 24-hole Board for tissue culture containing glass cover (Sarstedt, Germany). After 1 hour incubation neprecejusies cells were washed, and macrophages continued to be cultivated in IMDM medium with 10% ETS (fetal calf serum, Biolot, Russia) in the presence of streptomycin (100 μg/ml) and penicillin (100 U/ml). A day after the monolayer was washed from antibiotics and contributed suspension GMT and MUH in IMDM medium, at a concentration of 1×107CFU/ml Bacteria pre-incubated for 30 minutes with normal and immune rabbit serum, diluted 50 times in IMDM medium. The contact of bacteria with macrophages lasted for 30 min, after which the monolayers were carefully washed from the non-adherent to the surface of cells of streptococci. All of the above steps were carried out at 37°C in an atmosphere of 5% CO2. Further, the preparations were fixed 30 min absolute alcohol and sequentially stained with azide and Azura for 30 minutes Monolayer was carefully cleaned from paint residue. If microscopy on cover glasses were investigated at least 100 cells in three parallel samples, counting the percentage of macrophages infected with Streptococcus, and the average number of cocci one cell. The degree of infection was assessed by gozitana index (PHI), which is the product of both parameters.

The results opsonophagocytosis test are presented in table 3. The rate of increase of the index of infection in two or more times (a 2.0 to 6.4) when processing streptococcal immune rabbit serum in comparison with the index of infection in the treatment of streptococcal normal rabbit serum indicates protectively anti-RV antibodies in relation to GMT, and MUH.

Table 3
The results opsonophagocytosis test on the monolayer of murine peritoneal macrophages using a normal immune rabbit sera
StrainSerumIndicators of opsonophagocytosis
Infected macrophages (%)The average number of cocks on the cellPHIThe magnification of PHI
GMT Ia (58/59)normal231,535
anti-PB1474,0188of 5.4
GWA Iac (5/70)normal502,5125
anti-RV898712the 5.7
GMT II (60/59)normal361,658
anti-RV69of 5.43736,4
GWA III (55/81)normal382,284
anti-RV513,51792,1
GWA III (72/93)normal1 10,0710
anti-RV9215,414172,0
GWA VI(2/68)normal231,023
anti-RV402,590a 3.9
MUH M49 (NZ131)normal405,8232
anti-RV8216,313375,8

Example 8. The study of protective properties of murine anti-RV antibodies in mice infected with GWA.

The protective efficacy of anti-RV antibodies in vivo has been studied in mouse models of systemic infection. It is known that under these conditions, leading protective mechanism is opsonophagocytosis reaction.

In vivo laboratory is ornago mice were first injected subcutaneously protein RW scheme immunization, mentioned previously in example 5, or saline (as control). Then both groups of mice were injected intraperitoneally suspension GMT serotype Iac (strain 5/70) in sub-lethal dose (LD50=2,7×107CFU/ml) at the time of maximum production of antibodies to a protein RW (52nd day from the beginning of the immunization). Control of infection was performed using seeding streptococci from splenic suspensions mice on Wednesday with blood agar at different periods after the introduction of GMT.

Table 4
Dynamics of streptococcal lesion in the spleen of the mouse
Time after infection, GMT, hour
135244872
The number of colonies GMT in the spleen of the mouse CFU/ml×
10-7
Control the mouse with the introduction of PBS)1,41,32,55,62,10
Experience (mouse, with the introduction of RV)1,10,20,30,20,70

As can be seen from table 4, in the control group at the first hour was the accumulation of the number of GWA in the spleen of mice, and only after 24 hours has begun the natural elimination of streptococci from the spleen. While in the experimental group almost from the first hours was the elimination of streptococci from the spleen. Thus, the results of the experiment showed that the recombinant protein RW capable of stimulating a protective humoral immune response.

1. Recombinant DNA RV encoding a recombinant protein RW with protective properties against Streptococcus pyogenes and Streptococcus agalactiae, and having a nucleotide sequence represented in figure 1.

2. Recombinant plasmid DNA pQE-pB1, representing plasmid DNA pQE-30, carrying the recombinant DNA according to claim 1.

3. The E. coli strain M15 transformed with recombinant plasmid DNA according to claim 2, and expressing the recombinant protein RW.

4. Recombinant protein RW consisting of the amino acid sequence Sa peptidases strain 090R Ia serotype of Streptococcus agalactiae 39 348 amino acid residue covalently associated with sixteen is aminokislotnye residues encoded by pQE-30 with protective properties against Streptococcus pyogenes and Streptococcus agalactiae and having the amino acid sequence represented in figure 2.

5. Recombinant protein according to claim 4, characterized in that it has no enzymatic activity against Sa component of the complement system of humans and other mammals.

6. Recombinant protein according to claim 4, characterized in that able in vivo to induce the synthesis of anti-RV antibodies.

7. Anti-RV antibodies, which are formed by introduction of a recombinant protein according to claim 4 mammals and has protective properties against Streptococcus pyogenes and Streptococcus agalactiae.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention refers to genetic engineering and can be used in medicine. The mucosal vaccine contains effective amount of hybrid protein consisting of oncoprotein E7 of human papilloma virus fused with heat-shock protein of mycobacteria Hsp70, chitosan related to hybrid protein 1:0.1-10 and additives pharmaceutically acceptable manufacturing of suppositories. The mucosal vaccine is used in therapy of the diseases associated with human papilloma virus.

EFFECT: possibility for multiple improvement of clinical effectiveness of diseases associated with human papilloma virus, considerable reduction of treatment cost in comparison with common techniques of treating cervical carcinoma and "РПК"; elimination of injection by-effects undesirable and extremely dangerous for the patent's life, eg anaphylactic shock, owing to local application; simplification of medical process - the patient can receive medical treatment out of clinic by independent introduction of the preparation.

6 cl, 4 dwg, 2 tbl, 10 ex

FIELD: medicine.

SUBSTANCE: invention concerns protein NMB1870 which represents common surface protein Neisseria meningitidis expressed with all Neisseria serogroups. Protein is subdivided into three separate families. The whey induced against antigen of a certain family, has bactericidal effect within this family, but is inactive concerning strains expressing antigens of one of other two families, i.e. there is a cross protection within family, but not between families. It is established, that NMB1870 can be subdivided into domains and that antigen domains can be recovered from NMB1870 of all three families and expressed as a polypeptide chain that is implemented by the method disclosed in the invention. Also it is discovered that NMB1870 expresses some epitopes in surface loops located between alpha spirals, and that epitope substitution of the loop of one family with that of the other family enables making chimeric NMB1870 of antigenicity characteristic for proteins of several families. In the invention there are disclosed chimeric proteins NMB1870 (versions) partially containing NMB1870 of various families.

EFFECT: proteins produced according to the invention can be used as a medical agent as a component of immunological compositions for immunization against diseases caused by Neisseria meningitidis without family specificity of protection.

22 cl, 46 dwg

FIELD: medicine; microbiology.

SUBSTANCE: way is intended for reception of functionally active LF form, the basic toxic protein defining cellular disturbances, leading to death of an organism at infection with a malignant anthrax bacterium. For realisation of the way a recombinant plasmid pETHIS-LF (7816 items) is designed, containing a full-size gene of the lethal factor (LF) of malignant anthrax under the control of the promotor of bacteriophage T7 and to a determinant of ampicillin tolerance. The plasmide provides effective synthesis of LF protein of malignant anthrax merged with sequence of six Histidinums for clearing with the metal-chelate chromatography. The strain Escherichia coli BL-HISLF is designed using transformation of the specified plasmid DNA in the strain E.coli BL21 (DE3), synthesizing active LF protein. The target product is separated with the way including clearing on a metal-chelate sorbent with the subsequent additional clearing of the LF protein by gel-filtration.

EFFECT: reception of active recombinant protein LF on the simplified technology and with a high output of synthesised protein of the lethal factor.

3 cl, 3 dwg, 3 ex

FIELD: biology.

SUBSTANCE: designed is a new recombinant plasmid pETGST-LFmin (7704 nucleotide pairs), containing a catalytically active fragment of the gene of lethal factor anthrax (LF) controlled by a bacteriophage T7 promoter, determinant of resistance to ampicillin and a glutathione-S-transferase sequence for efficient purification of the recombinant protein on a sorbent with immobilised glutathione. The plasmid provided for efficient sythensis of the protein of LF anthrax, chimerised with a sequence of glutathione-S-transferase for purification on immobilised glutathione. Escherichia coli BL-LFminGST strain is obtained from transformation of the said plasmid DNA into a E.coli BL21 (DE3) strain, which provides for output of synthesised LF protein of not less than 90 mg/l g of raw biomass. The active LF protein is obtained using a method which involves culturing the said recombinant strain, destruction of bacterial cells in a buffer solution with pH 7.4 in the presence of Triton X-100 and a protease inhibitor, and purification on a sorbent with immobilised glutathione.

EFFECT: output of proteolytic active recombinant chimeric purified protein of LF anthrax in amount of not less than 70 mg/l g of raw biomass.

3 cl, 3 dwg, 3 ex

Neisseria antigens // 2347813

FIELD: chemistry; biochemistry.

SUBSTANCE: invented here are proteins of the meningococcus bacteria Neisseria meningitides (mainly strain B), with immunogenic properties. The proteins have defined amino acid sequences, presented in the description, and are coded with corresponding nucleotide sequences. Description is also given of an antibody, specific to the indicated meningococcus proteins. These proteins, coding their nucleotide sequences, as well as the specific antibody, can be used as an active ingredient in compositions for treating or preventing infection caused by Neisseria meningitides. The presented proteins can be used as antigens for making effective vaccines, immunogenic compositions.

EFFECT: obtaining proteins, used as ingredients for making effective vaccines, immunogenic compositions.

11 cl, 2 tbl, 104 ex

FIELD: medicine; biotechnologies.

SUBSTANCE: amino-acid sequences are presented in the list of the sequences obtained from a bacterium, mainly strains A and B which show properties of an antigene. The invention includes corresponding nucleotide sequences of fragments of the nucleinic acid, coding amino-acid sequences of the specified proteins. The proteins under the invention can be used as antigenes for obtaining of specific antibodies and manufacturing of compositions for treatment, preventive maintenance or diagnostics of the infection caused Neisseria meningitidis. The compositions are prepared on the basis of a protein, a fragment of nucleinic acid or an antibody with addition of the pharmaceutically comprehensible carrier and represent vaccinal, diagnostic or pharmaceutical compositions. Sequences of the obtained proteins have no any considerable homology with sequences Neisseria gonorrhoeae, that allows to receive treatment-and-prophylactic and diagnostic compositions with high specificity in relation to N. meningitidis and also to receive Diagnostic reagents for differentiation N. meningitidis from N. gonorrhoeae.

EFFECT: efficiency of application.

12 cl, 2 tbl, 17 ex

FIELD: medicine, microbiology.

SUBSTANCE: invention concerns nucleotide sequence coding TolC, and also to certain amino-acid sequence which is built in in permissive, located from lateral aspect of a membrane area of TolC. In the invention is described a plasmid, containing a nucleotide sequence, for an expression of the merged protein or merged peptide. The invention concerns also the transformed bacterium, in particular enterobacteria, to its use as a part of a pharmaceutical composition for stimulation of the immune response and in a diagnostic set for detection of interesting substance in an organism. The framed transport system provides high efficiency of presentation of a product of an expression in an external cellular membrane of a bacterium.

EFFECT: provision of high efficiency of presentation of product of expression in external cellular membrane of a bacterium.

13 cl, 1 dwg, 5 ex

FIELD: medicine; pharmacology.

SUBSTANCE: polypeptides under the invention include amino-acid sequence, structurally related sequence SEQ ID NO:1 resulted in the text of the description, to use of such polypeptides as immunogens, including as a part of compositions. The invention opens also expression systems for producing such polypeptides. The sequence SEQ ID NO:1 represents a truncated derivative of full-size polypeptide S. aureus. This full-size polypeptide is designated in the invention as full-size "ORF0657n". It is established, that the polypeptides described in the invention and containing amino-acid sequence are SEQ ID NO:1.

EFFECT: polypeptides cause protective immune response against staphylococcus aureus.

43 cl, 56 dwg, 4 tbl, 17 ex

FIELD: chemistry.

SUBSTANCE: invention relates to polypeptides with established amino acid sequence, which have antimicrobial activity. Amino acid polypeptide sequence has 65-99% of identity with amino acid sequence of polypeptide, originating, particularly, from strain Pszudoplectania nigrella CBS 444.97. Invention also relates to polynucleotide, which has nucleotide sequence, coding said polypeptide, constructions of nucleic acid, recombinant expression vector, which contains said construction, and recombinant host-cell, intended for obtaining said polypeptide. In invention methods of obtaining polypeptide and inhibiting microbe cell growth using said polypeptide are described. According to invention polypeptides can be used for production of veterinary or therapeutic medication for treatment or prevention of microbial infection in humans and animals. According to invention polypeptide with antimicrobial properties ensures stability of antimicrobial activity when used in different forms of antimicrobial medications.

EFFECT: obtaining polypeptides with antimicrobial properties.

19 cl, 3 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: essence of the invention lies in a composition which, after introduction to an individual, is capable of inducing a humoral immune response at the given individual the humoral immune response performing bactericidal effect against two or three of supervirulent rows of generations A4, ET5 and a number of generations of the 3rd serogroup in N.meningitidis. of an external membrane. Five albuminous antigens are used, i.e. (1) protein "NadA"; (2) protein "741"; (3) protein "936"; (4) protein of "953" and (5) protein "287".

EFFECT: development of a vaccine against two or more rows of supervirulent meningococcus generations.

29 cl, 1 tbl

FIELD: medicine.

SUBSTANCE: invention is related to the field of medicine and is related to treatment of proliferative diseases with application of antisense oligomer IAP and chemotherapeutical preparation. Substance of invention includes method for treatment of patient suffering from proliferative disease with application of antisense oligomer SEQ ID NO: 151 or its pharmaceutically acceptable salt and chemotherapeutical preparation.

EFFECT: invention advantage consists in improved efficiency of treatment.

28 cl, 15 ex, 9 tbl, 25 dwg

FIELD: medicine.

SUBSTANCE: method of cultivation of pluripotential stem cells herewith conserving undifferentiated condition and pluripotency thereof without using feeder cells. The method applies fluid medium and culture bottle on the surface of which there are immobilised molecule of fused protein containing outer domain of E-cadherin and Fc-region of immunoglobulin.

EFFECT: invention can be used in regenerative medicine.

9 cl, 11 dwg, 7 ex

FIELD: medicine.

SUBSTANCE: method involves deactivation of definite VGC2 DNA sequence of Salmonella typhimurium positioned between ydhE and pykF genes or its part containing at least 50 nucleotides, or the DNA version of at least 85% identity, representing VGC2 DNA of any microbe out of Salmonella aberdeen, Salmonella gallinarum, Salmonella cubana and Salmonella typhi.

EFFECT: obtainment of microbe with reduced adaptability to specific environmental conditions.

6 cl, 12 dwg, 8 ex

FIELD: genetic engineering.

SUBSTANCE: invention can be used in monocotyledon plants selection for creation of novel sorts and hybrids by means of genetic engineering, in works insertional mutagenesis, separating and cloning of plant genes. In order to obtain transgenic monocotyledon plants in period of their active blooming flowers lacking own fertile pollen are selected. As object of genetic transformation, blooming female gametophyte is used, which is processed with suspension of strain Agrobacterium tumefaciens with activated vir-genes, pistil filaments being processed directly. After that said flowers are pollinated with pollen of fertile plants. For processing cells with strain Agrobacterium pistil filament sections, located near flower ovary, are used.

EFFECT: said operations allow to create transgenic monocotyledon plants preserving high frequency of their obtaining under conditions, that correspond to natural temperatures of blooming, and to simplify technology of obtaining transgenic plants.

4 cl, 1 dwg, 1 tbl

FIELD: medicine, microbiology.

SUBSTANCE: invention concerns biotechnology. It is described bispecific antibody which binds also the factor of blood coagulation IX or the activated factor of blood coagulation IX, and the factor of blood coagulation X, and functionally replaces the factor of blood coagulation VIII or the activated factor of blood coagulation VIII which strengthens enzymatic reaction. The pharmaceutical composition containing the described antibody is revealed. The present invention can be used as an alternative agent for functional replacement of cofactor which strengthens enzymatic reaction.

EFFECT: creation of bispecific antibody which can replace functional proteins, strengthens enzymatic reaction.

14 cl, 18 dwg, 37 ex

FIELD: biotechnology, organic chemistry, biochemistry.

SUBSTANCE: invention represents a novel method of preparing optically active 4-(indole-3-ylmethyl)-4-hydroxy-2-oxoglutaric acid (IHOG) used in preparing monatine, and a method for synthesis of optically active monatine. Also, invention relates to a novel aldolase used in these methods. 4-(Indole-3-ylmethyl)-4-hydroxy-2-oxoglutaric acid of high optical purity representing effective intermediate compound for synthesis of optically active monatine can be synthesized from indolpyruvic acid and pyruvic acid (or oxalacetic acid). Invention provides preparing 4-(indole-3-ylmethyl)-4-hydroxy-2-oxoglutaric acid and monatine with high degree of effectiveness.

EFFECT: improved preparing method.

18 cl, 12 dwg, 12 tbl, 25 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to new aldolase which catalyzes reaction of producing substituted alpha-ketoacid from oxalacetic or racemic pyrotartaric acid and indole-3-racemic pyrotartaric acid.

EFFECT: method for production of substituted alpha-ketoacids with increased effectiveness.

FIELD: gene engineering, in particular yeast strain modified by introducing of foreign genetic material.

SUBSTANCE: claimed strain is obtained by transforming of starting culture Pichia pastoris X-33 with two albumin structural genes with signals of yeast alpha-factor secretion, transcribed under control of 5'AOX1 promoter and transcription termination region of hepatitis G virus. Strain of present invention is useful in production of albumin-containing drugs.

EFFECT: strain for production of human recombinant albumin of increased yield.

3 ex

FIELD: biotechnology, in particular plant gene engineering.

SUBSTANCE: recombinant plasmid DNA pBi101-IL18 is constructed having length of 15000 n.p. and containing DNA fragment of pBi101-IL18 vector plasmide having length of 13900 n.p.; -NdeI-BamHI/BgIII DNA fragment being cDNA site of human IL-18 gene; -Nol-NdeI fragment of pET15b plasmide; encoding N-terminal polypeptide from six hystidine amino acids and site of thrombin enzyme hydrolysis, -5'URT region from genome of tobacco etch virus; double 35S CaMV promoter from genome of cauliflower mosaic virus; -3'URT region from genome of cauliflower mosaic virus. Method of present invention makes it possible to transfer nucleotide sequence of human IL-18 in plant genomic DNA.

EFFECT: method for production of mature human IL-18 having biological activity.

2 dwg, 1 tbl, 3 ex

FIELD: agriculture, in particular determination of plant material genotype and sunflower breeding.

SUBSTANCE: claimed method includes isolation of DNA from each sprout in seed group of sunflower plant followed by amplification thereof using PCR. Amplification is carried out on HA 432, HA 514, HA 1442, and ORS 5 microsatellite locuses by using primers corresponding to flanking regions of such locuses. Amplification products are separated by electrophoresis in colored, e.g. agarose gel. Visual comparison of electrephoresis spectra, e.g., in ultraviolet beam makes in possible to evaluate inbred line uniformity and hybridism level in tested sample based on number of single-type spectra.

EFFECT: method of increased accuracy.

5 cl, 3 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: there are described recombinant plasmids pL1spCBD and pL2spCBD. There are offered strains Escherichia coli that are producers of chimeric proteins L1spCBD and L2spCBD. There are described recombinant proteins L1spCBD and L2spCBD. There is disclosed method of immobilisation, concentration and purification of proteins L1spCBD and L2spCBD both cellulose and polystyrene carriers.

EFFECT: specific interaction of recombinant proteins L1spCBD and L2spCBD with specific blood serum antibodies recovered from sick and vaccinated patients and the absence of interaction with serums recovered from healthy people and immunised patients.

8 cl, 1 dwg, 6 ex

Up!