Recombinant plasmid dna pfastbac-g2r-igg, which contains fragment of smallpox virus genome, coding factor of tumour necrosis, binding protein, and fragment of human genome, coding section of heavy chain of antibody g, and strain of baculovirus bvg2rigg, which produces soluble chimeric protein, which consists of smallpox virus protein, binding factor of tumour necrosis, and fragment of heavy chain of human antibody g

FIELD: medicine.

SUBSTANCE: invention is related to preparation of protein, binding tumour necrosis factor (TNF), and may be used in medicine. Strain-producer of baculovirus BvG2RIgG is created with the help of recombinant plasmid DNA pFastBac-G2R-IgG with size of 6444 p.n. and molecular mass 4.18 mDa, which bears fragment of smallpox virus genome of strain India-1967, which codes protein that binds TNF, and fragment of human genome, which codes fragment of heavy chain of human antibody G. Produced strain produces soluble chimeric protein, which consists of smallpoz virus protein, which binds TNF, and fragment of heavy chain of human antibody G.

EFFECT: wider spectrum of new generation preparations intended for treatment of human diseases related to hyperproduction of tumour necrosis factor.

2 cl, 3 dwg, 1 tbl, 8 ex

 

The invention relates to biotechnology, in particular genetic engineering, and can find application as a drug of a new generation to fight with severe human diseases associated with overproduction of tumor necrosis factor (TNF).

The tumor necrosis factor is one of the key cytokines in the inflammatory response, it modulates the immune response of the body, plays an important role in the regulation of cell viability [1]. However, the hyperproduction of TNF leads to a number of human diseases, such as Crohn's disease, rheumatoid arthritis (RA), psoriasis, psoriatic arthritis, heart failure and other [2]. Severe pathology, caused by high levels of TNF and often ending with a fatal outcome, is endotoxic shock [2, 3]. Currently, drugs with anti-TNF effect can be attributed to four different groups according to what stage they are blocking TNF: at the stage of transcription, translation, processing (proteolytic cleavage of the membrane-bound form of the cytokine) or blocks the interaction of TNF with their receptors and signal transmission [2]. Anti-TNF drugs are used in clinical practice and undergo clinical tests shown in the table.

As you can see, one of the directions of development of terapeutiche the fir means for correcting these immunopathology is creating drugs binding of this cytokine. Such preparations can be a monoclonal antibody (MAB) and soluble cellular receptors that bind TNF. Soluble recombinant cell receptors TNF previously synthesized in Monomeric form, and, despite effective inhibition of the cytotoxic action of TNF in vitro, they practically had no protective actions in vivo in a model of endotoxic shock [24]. Adding Fc fragments of immunoglobulin G (IgG) to the ligand-binding domains of TNF receptors first (P55) [25] and the second (P75) [24] types led to their synthesis in the form of covalently linked dimers. Such chimeric molecules in 1000 times more effectively inhibited in vitro the cytotoxic action of TNF than their prototype options, and significantly increased the survival of animals in a model of endotoxic shock [24, 25]. The drug Etanercept, representing a chimeric molecule of the extracellular domain of P75 protein with Fc fragment of human IgGl, currently used for the treatment of some human diseases [2].

The creation of chimeric molecules with a fragment of the heavy chain of IgG is widespread. This class of chimeric proteins, including cytokines, receptors of cytokines, complimentative proteins, enzymes, adhesion molecules, has more than 50 members representing covalently-swazanager, reminiscent of the immunoglobulin molecule. These molecules differ from their prototype counterparts by a considerable increase in the avidity of time and half-life [26].

The closest analogue (prototype) is a TNF-binding proteins of orthopoxviruses, which effectively inhibit the cytopathic effect of TNF on the cell culture of murine L929 fibroblasts [27]. For cellular TNF receptors has been shown that with chimeric IgG human proteins are much more effective antagonists of TNF in vitro and in vivo.

However, effective means to combat severe human diseases associated with overproduction of tumor necrosis factor (TNF), is clearly not enough.

The technical result of the present invention is the extension of the range of new generation, designed for the treatment of human diseases associated with overproduction of tumor necrosis factor by adding the Fc fragment of human IgGl to TNF-binding protein EIT.

The technical result is achieved by constructing recombinant plasmid DNA pFastBac-G2R-IgG, containing a fragment of the genome of variola virus that encodes the amino acid sequence of the TNF-binding protein without termination codon, and a fragment of the human genome, encoding a fragment of the heavy chain IgGl person with 117 329 (numbering for Fc-fragm the NTA, the encoded gene AF237583(GenBank)and create it using a new recombinant strain of baculovirus - producer soluble chimeric protein consisting of protein variola virus that binds the tumor necrosis factor, and a fragment of the heavy chain of immunoglobulin G man.

The target plasmid pFastBac-G2R-IgG (figure 1) has a size 6444 gel and the molecular weight 4,18 MDA and consists of:

fragment of the genome of variola virus strain India-67 length of 1068 BP encoding TNF-binding protein;

- fragment of the human genome length 699 BP, encoding a fragment of the heavy chain IgGl person with 117 329 A.K.;

- vector plasmid pFastBacl [28], length 4677 P.N., providing site-specific transposition of the target DNA fragment into the genome of the baculovirus.

Recombinant strain of baculovirus obtained by site-specific transposition of the target DNA fragment from the donor plasmid pFastBac-G2R-IgG in a baculovirus vector (bacmid)in E. coli [28], after infection of Sf21 insect cells produce a soluble chimeric protein consisting of protein variola virus that binds the tumor necrosis factor, and a fragment of the heavy chain of immunoglobulin G man.

As a fragment of the genome of variola virus using DNA fragment length 1068 BP obtained using polymerase chain reaction Matrix for the amplification of DNA is variola virus strain India-1967. Oligonucleotide primers for amplification of TNF-binding protein variola virus have the following structure:

In the structure of primers 1 and 2 laid the recognition sites of restriction endonucleases Wamn and XbaI, respectively (highlighted in the sequence of the primers in bold italic).

As a fragment of the human genome using DNA fragment length 699 gel, isolated from the plasmid pBluescript-IgG1 after hydrolysis with restriction endonucleases XbaI and HindIII.

As a plasmid vector, providing site-specific transposition of the target DNA fragment in bacmid pMON14272 [28], using plasmid pFastBacl [28]containing baculovirus specific promoter pPolh for protein expression in insect cells, mini-Tn7-transposon, the resistance genes for ampicillin and gentamycin, polylinker for cloning the target gene and the signal for polyadenylation of the virus SV-40. Bacmid pMON14272 contains miscompiles mini-F replicon, a gene for resistance to kanamycin and the DNA fragment encoding the α-donor peptide of β-galactosidase of E. coli and provides α-complementation during the reproduction of the strain E. coli DH10Bac™ in the presence of a chromogenic substrate X-gal and the inducer IPTG.

Selected baculovirus expression system provides a high level of synthesis of the target product and its correct posttranslational is modified in comparison with other systems of expression.

The essence of the present invention is that the DNA fragment containing the gene of tumor necrosis factor binding protein G2R variola virus strain India-1967 without stop codon, is obtained by PCR from the viral genome; DNA fragment containing the gene fragment IgG1 with 117 329 A.K. person stands out from the plasmid pBluescript-IgG1 after hydrolysis with restriction endonucleases XbaI and HindIII; then, the resulting DNA fragments are cloned into the donor plasmid pFastBacl and by site-specific transposition in bacterial cells produce recombinant bacmid used for transfection of insect cells, resulting generated recombinant virus BvG2RIgG expressing the indicated chimeric gene. The nucleotide sequence of the embedded fragment is shown in figure 2.

The strain is characterized by the following features:

Morphological features. The strain has properties typical representative of baculoviruses, but unlike the vector of the virus in the environment XGa1 plaques formed by recombinant baculovirus, are the Lac phenotype-.

Physiological and biochemical characteristics and cultural properties of the strain. DNA recombinant baculovirus has a length of about 140000 P.N. the Presence in its genome of the target insertion length 1767 BP confirmed using PCR method. When the reproduction recombines the aqueous baculovirus on the culture of insect cells Spodoptera frugiperda (Sf21) his title is no different from the title, obtained by multiplication of the virus, not containing in its genome a foreign DNA fragments.

The main difference of the strain is its ability to synthesize chimeric TNF-binding protein UPE with covalently-associated fragment of the heavy chain of IgG human infection of cultures of Sf21 insect cells.

The resulting strain recombinant baculovirus BvG2RIgG deposited in the collection of microorganisms of the State research center of Virology and biotechnology "Vector" for number V-354 from 06.10.06.

The invention is illustrated by the following drawings:

Figure 1. Physical map of the plasmid pFastBac-G2R-IgG. For the first nucleotide plasmids accepted nucleotide And ministrone region phage f1; Tn7L, Tn7R-fragments of transposon Tn7; SV40polyA site of SV40 virus polyadenylation; G2R-IgG - chimeric gene consisting of the gene for tumor necrosis factor binding protein VNO strain India-67 without termination codon and the gene fragment of the heavy chain of human IgG1 with 117 329 A.K.; pPolh - polyhedrin promoter; Ori - the site of replication initiation; Apr, Gmrmarkers of resistance to ampicillin and gentamicin, respectively.

Figure 2. The nucleotide sequence of the gene G2R VNO (strain India-1967) and a fragment of the gene of the heavy chain of human IgG1, the respective coding sequences with 117 329 A.K., and location specific primers (BOCOG is explained in bold) on the matrix. Sites of restriction endonucleases Xbal, Hindlll, Vamn used in the construction of plasmid integration pFastBac-G2R-IgG, shown in bold italics. The initiating codon and stop codons shown in bold and underlined, restriction sites are printed in bold italic.

Figure 3. Electrophoretic analysis in 1% agarose, PCR fragments containing the chimeric gene is a tumor necrosis factor binding protein UPE with a fragment of the gene of the heavy chain of human IgG1, the respective coding sequences with 117 329 A.K., amplified using specific primers with the plasmid pFastBac-G2R-IgG (lanes 2, 3) and with bacmid bMON14272-G2R-IgG (lanes 4, 5). Lane 1 - marker length "bp 100 (SibEnzyme", Russia), track 6 - negative control (non-recombinant bacmid).

For a better understanding of the invention the following are examples of its implementation.

Example 1. The method of amplification of a fragment of DNA, containing the gene for TNF-binding protein EIT.

Reaction amplification is carried out in Eppendorf tubes in a volume of 50 μl in amplifiers with a hot lid. The reaction mixture contains 10 mm Tris-HCl pH 8.8, 50 mm KCl, 2.5 mm MgCl2, 0.1% Tween 20, 0.2 mm dATP, 0.2 mm dCTP, 0.2 mm dGTP, 0.2 mm dTTP, oligonucleotide primers of 10 pmol each, 2 Ada. Tth polymerase, 2-10 ng DNA template.

Amplification for 30 cycles according to the following scheme:
The cycle numberTemperature (°C)Time (min)
1932 min
481 min
721 min
2-4931 min
481 min
721 min
5-29931 min
531 min
721 min
30931 min
531 min
7010 min

The presence of the amplified product PR is oraut by electrophoresis in 1% agarose gel.

Example 2. Construction of recombinant plasmid DNA pFastBac-G2R-IgG.

5-10 μg of plasmid pFastBac [28] hydrolyzing the restriction endonucleases BamHI and HindIII; 1-5 μg of the amplified product corresponding gene G2R UPE without termination codon, hydrolyzing the restriction endonucleases BamHI and XbaI; the plasmid pBluescript-IgG1 hydrolyzing the restriction endonucleases XbaI and HindIII in standard conditions. The resulting fragments are electrophoresis in 1% agarose gel, followed by elution. 0.2 μg of the vector and 0.6 µg of fragments are ligated under standard conditions and received ligase mixture transform competent cells of E. coli strain XL-blue. Cellular Apr-clones grown at 37°C in LB medium containing 100 μg/ml ampicillin, until the stationary phase. Recombinant plasmid DNA secrete according to standard methods and analyzed by restriction endonucleases BamHI, XbaI and HindIII. Clones containing an embedded fragment, isolated plasmid DNA, whose structure in the area of building-certify definition nuleotide sequence by the method of termination of the synthesized circuit for automatic sequencing machine ABM PRISM™ 310 (Perkin Elmer, USA). Thus obtained target plasmid denote pFastBac-G2R-IgG.

Example 3. Getting backside pMON14272-G2R-IgG.

To 100 μl of competent cells of E. coli strain DH10Bac™ add 1 ng of plasmid pFastBac-G2R-IgG. Poluchenno the mixture was incubated in ice for 30 min, then at 42°C for 45 sec followed by cooling in ice for 2 minutes, the Reaction mixture was diluted 1:10 in LB-broth and pokasivaut on the rocking chair with intensive aeration at 37°C for four hours. Next, cells are plated on selective medium LB-agar containing 100 μg/ml X-ga1, 40 μg/ml IPTG, 50 μg/ml kanamycin, 7 ág/ml gentamicin, 10 μg/ml tetracycline, and incubated in a thermostat at 37°C during the day. Clones with the Lac phenotype-sow in a test tube with 5 ml LB-broth containing 50 μg/ml kanamycin, 7 ág/ml gentamicin, 10 μg/ml tetracycline and grown under intensive aeration at 37°C to stationary phase. The culture is transferred into 1.5 ml Eppendorf tubes, precipitated cells by centrifugation for 40 sec at 14000 g, remove the environment. The process of adding the culture, deposition and removal environment, repeat two more times. Sediment resuspended in 0.3 ml of solution 1 (10 mm EDTA, 15 mm Tris-HCl pH 8.0, 100 μg/ml RNase), add 0.3 ml of solution 2 (0.2 M NaOH, 1% SDS) and incubated at room temperature for 5 minutes To the mixture slowly add 0.3 ml of solution 3 (3 M CAS pH 5.2). Incubated in ice for 10 min. and Centrifuged at 14000 g for 10 min. the Supernatant transferred to a clean tube, add 0.8 ml of isopropanol, stirred and cooled at -20°C for 5 minutes, then precipitated at 14000 g for 15 minutes the Precipitate is washed two times with ethanol, dried, dissolved in 40 μl of buffer TE. Alicia in the genome backside integrated DNA fragment confirmed by PCR. Received backmenu DNA pMON14272-G2R-IgG used for transfection of insect cells line Sf21.

Example 4. Transfection of Sf21 insect cells recombinant backmenu DNA pMON14272-G2R-IgG and the preparation of recombinant virus.

The Sf21 cells seeded in wells of a 6-hole tablet based, so the next day was the monolayer (2×106cells/well). The next day, prepare two solutions: 10 μl of viral DNA + 100 ál of medium Grays and 6 μl of CellFECTIN reagent company LifeTechnologies (USA) + 100 ál environment of Grace. The solutions are mixed, incubated at room temperature for 25 minutes At this time, wash the monolayer cells twice with medium Grays. To the cells was added 0.8 ml/well of medium Grays and 200 μl of the prepared solution. Incubate cells at 28°C for 5 hours After that, select the environment and add to the cells in 2 ml medium Grace with 10% fetal serum of cows (ESC) (OOO Biolot", Russia). Cells incubated at 28°C for 2-5 days. The cells resuspended (intensive pipetting), centrifuged 5 min at 5000 g and the clear supernatant Packed in sterile tubes. The titer of the virus is determined as follows. The monolayer cells Sf21 add 200 ál of dilution of the virus and carry out adsorption for 60 min at room temperature. Next, prepare a 2% low-melting the agarose (Sigma, USA) and mix it in molten form with cf is DOI Grace with 10% ESK in the ratio of 1:1. The resulting medium is cooled in an incubator to 37°C and add 2 ml per well, and after hardening, add 2 ml per well of medium Grace with 10% ESK. Incubated in an incubator at 28°C for 5 days. Next, add 2 ml per well of the dye neutral red dissolved in an environment of Grace with 10% of the ESK, in the ratio of 1:20. Incubated at 28°C during the day. The titer is determined by counting stained plaques. The last is 107PFU/ml Suspension of recombinant virus stored at -20°C.

Example 5. Infection of Sf21 insect cells with the recombinant virus.

200 ál of thawed viral material with a titer of 107put on a monolayer of Sf21 insect cells in the mattress for the cultivation volume of 25 ml is Incubated for 30 min at room temperature. After incubation, add 2 ml of medium Grace with 10% ESK. Incubated at 28°C for 2-3 days. The cells resuspended intensive pipetting and centrifuged 5 min at 5000 g.

Example 6. Purification of recombinant chimeric protein.

Target protein isolated from the culture medium of Sf21 cells by the method of affinity chromatography. To synthesize this affinity sorbent-based cross-linked agarose matrix - sepharose CL-6B with immobilized protein A. To 2 ml sepharose CL-6B was added 20 ml of 0.1 M solution of periodate sodium and incubated at 16°C for 16 hours Activated gel about the see water and add 1 mg of highly purified preparation of the protein in 50 mm sodium carbonate buffer, pH 8.5. After 20 h incubation at 6°C the solution was added 20 mg of sodium borohydride, stirring 2 hours After this sorbent sequentially washed with water, 0.2 M solution of glycine-Hcl, pH 2.5 and balance with PBS buffer (10 mm potassium phosphate, pH 7.0, 150 mm NaCl). The content of protein And 0.4±0.1 mg/ml of gel. For purification of soluble a chimeric tumor necrosis factor binding protein variola virus with a fragment of the heavy chain of human immunoglobulin G using the culture fluid of Sf21 cells infected with recombinant baculoviruses, the cellular debris is removed by low-speed centrifugation. To reduce the volume of protein solution pre-precipitated with ammonium sulfate (50% saturation). After dissolution of the precipitate and the dialysis solution was applied to the affinity column with a speed of flow of liquid 1 column volume per hour. The sorbent is washed with buffer containing 0.2 M NaCl and elution carried out with 0.2 m solution of glycine-HCl, pH 2.5, the neutralizing solution is collected in fractions of 1 M solution of Tris-HCl, pH 8.8. The output of the homogeneous protein is 4-6 mg from 1 l of culture fluid of infected cells.

Example 7. Determination of biological activity of the product of expression of a chimeric gene G2R-IgG in vitro.

The biological activity of the chimeric TNF-binding protein UPE with a fragment of the heavy chain of human IgG was determined by its ability inhib is its cytotoxic action of TNF human and mouse cell cultures of mouse fibroblasts L929.

The L929 cells were maintained in DMEM with addition of 10% fetal bovine serum, streptomycin (50 μg/ml) and penicillin (50 units/ml) at 37°C in CO2-incubator (concentration of CO2was 5%) until the formation of the cell monolayer at 75-85% of the surface holes 96-well plate.

Upon reaching the desired density of the cell growth medium was replaced with DMEM with 2% fetal bovine serum and actinomycin D (1 µg/ml)containing 100 ng/ml recombinant TNF-binding protein UPE with a fragment of the heavy chain of IgG human and serial twofold dilution and TNF drugs (2 ng/ml).

The plates were incubated at 37°C in CO2-incubator (concentration of CO2was 5%).

After 18 hours the number of living cells was determined by staining with the dye neutral red [29]. Measurement of optical density (OD) was performed on the device Microplate Reader ELX808 (BIO-TEK INSTRUMENTS, INC, USA). The results were expressed as a percentage of surviving cells relative to the number of cells in untreated TNF control samples. Each sample was taken three times and the average value of the percent survival was calculated by the formula:

(SoTNF + TNF-binding proteinOPTNF)/(OPcellsOPTNF)×100%,

where OPTNF- background OD value in the wells containing L929 cells + TNF; OPTNF + TN is-binding protein OP in the wells containing L929 cells+TNF+TNF-binding protein; OPcellsOP in the wells containing L929 cells.

According to the inhibition of the cytotoxic effect of TNF human and mouse cell cultures of mouse fibroblasts L929 50% cell death is achieved by adding 40-100 ng/ml recombinant TNF-binding protein UPE with a fragment of the heavy chain of IgG person.

Example 8. Determination of biological activity of the product of expression of a chimeric gene G2R-IgG in vivo.

The biological activity of the chimeric variant TNF-binding protein VNO study in vivo in models of LPS-induced endotoxic shock. In use of male mice of BALB/c age 3-4 weeks, from nursery laboratory animals SRC VB "Vector", Russia. Experiments on animals carried out after two weeks of adaptation, in accordance with the Protocol approved by the Bioethical Committee of the SRC VB "Vector". Groups of 8-10 mice form for visual observation and study of survival. Control animals received twice after 16 h, injected intraperitoneally in 100 μl PBS with 1% BSA or 10 μg/mouse study of recombinant protein. To control the induction of endotoxic shock in animals injected intraperitoneally sensitizing (150 μg/mouse) and after 16 h, the resolving dose of LPS (250 μg/mouse) in 100 μl PBS. All the animals of the experimental groups injected with LPS p is the same scheme as for the control group. Recombinant chimeric TNF-binding protein UPE with a fragment of the heavy chain of human IgG injected mice intraperitoneally 30 min before the introduction of the resolving dose of LPS at doses of 0.4 and 4 mg/mouse. Observation of animals and registration of death should be performed within 72 hours

Mice received injection of bacterial LPS, became sluggish and sedentary, with ruffled and damp wool. Within 72 h of observation mortality of animals was 80-100%. These changes, as well as identify the histological pattern of the internal organs of experimental animals [30] are similar to those described in the literature with the development of experimental endotoxic shock in mice [31, 32, 33]. In the negative control groups was not recorded a single case of mortality, the appearance and behavior of the animals was not changed as compared with intact animals. As shown previously [30], in the blood serum of control animals treated with LPS for 1 h after the induction of shock, the concentration of TNF sharply increased, then decreased gradually and reached a level control samples for 24 h observation. The obtained results show that the used experimental model for the development of endotoxic shock is accompanied by a sharp increase in the production of TNF.

With the introduction of recombinant chimeric TNF-binding the th protein UPE with a fragment of the heavy chain of human IgG (0.4 or 4 mg/mouse) survival of animals has increased to 56+7.2% and 70+9,7%, respectively. As you can see, chimeric TNF-binding protein UPE with a fragment of the heavy chain of IgG man made reliable therapeutic effect.

Thus, the resulting recombinant baculovirus BvG2RIgG ensuring the expression of the chimeric gene TNF-binding protein VNO strain India-1967 with a fragment of the heavy chain of IgG human in insect cells line Sf21.

The resulting strain can be used to develop therapeutic drug of a new generation to fight human diseases associated with overproduction of tumor necrosis factor.

1. Recombinant plasmid DNA pFastBac-G2R-IgG to ensure the expression of soluble chimeric protein consisting of protein variola virus that binds the tumor necrosis factor, and a fragment of the heavy chain of human immunoglobulin G, size 6444 gel and molecular weight 4,18 hmm, containing in accordance with the physical map of the plasmid is shown in figure 1:
The PCR fragment of the genome of variola virus strain India-67 length of 1068 BP that encodes a TNF-binding protein without stop codon, obtained using primers

1. 5' CGGGATCCCTACATTATTAAATCATGAAGTCCG 3'

2. 5' GCTCTAGATAAAAAGCGGGTGGGTTTGG 3', flanked by sites of learning is of endonuclease restriction Wamn and XbaI;
a fragment of the human genome long 699 BP, encoding a fragment of the heavy chain IgGl person with 117 329 A.K., derived from the plasmid pBluescript-IgGl after hydrolysis with restriction endonucleases XbaI and HindIII;
BamHI-HindIII vector fragment of plasmid pFastBac size 4677 P.N., including baculovirus promoter pPolh, mini TP-transposon and the signal for polyadenylation of the virus SV-40, providing site-specific transposition of DNA chimeric gene G2R-IgG into the genome of the baculovirus;
genetic markers:
gene α-lactamase, which determines resistance to ampicillin;
gene aminoglycosides determining resistance to gentamicin;
unique restriction sites: AMN (4033), HindIII (5806).

2. The strain of recombinant baculovirus BvG2RIgG obtained using the recombinant plasmid DNA pFastBac-G2R-IgG according to claim 1, deposited in the Collection of microorganisms fsri SRC VB "Vector" of Rospotrebnadzor number V-354, producing a soluble chimeric protein consisting of protein variola virus that binds the tumor necrosis factor, and a fragment of the heavy chain of immunoglobulin G man.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention concerns medicine and biotechnology. There is disclosed application of coding DNA for making virus-like particles of hepatitis C virus, as well as the method for making the specified particles and a pharmaceutical composition using the same. The virus-like particles cause induction of interferon system in vivo.

EFFECT: invention can be used for making a preparation for prevention and treatment of the HCV-related conditions, as well as diagnostics thereof.

5 cl, 4 dwg, 1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention claims synthetic DNS molecule encoding L1 HPV58 protein, where codons are optimised for high expression level in yeast cell. Also invention claims expression vector, yeast host cell, HPV58 virus-like particle and method of its obtainment, and pharmaceutical composition including such VLP.

EFFECT: invention can be applied in medicine for efficient immune prevention of papillomavirus infection by neutralising antibodies and cell-mediated immunity, and for treatment of developed HPV infections.

10 cl, 10 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: invention concerns virology and medicine area. The synthetic DNA-molecule coding protein L1 HPV45 is presented. Thus DNA-molecule was Codonum-optimised for high-level protein expression in a yeast cell. The given synthetic molecules can be used for reception of virus-like particles (VLP) HPV45 and for reception of vaccines and the pharmaceutical compositions containing VLP-particles HPV45.

EFFECT: effective immunologic prophylaxis of infections with papilloma virus due to neutralised antibodies and cellular immunity.

9 cl, 6 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: there are offered recombinant protein molecule M2E-HBC, and virus-like particles formed of such molecules. The recombinant virus-like particle based on nuclear antigen of hepatitis B virus represents surface polypeptides of outer domain M2 of avian influenza virus protein. The produced virus-like particles are characterised with high immunogenicity. There is also disclosed vaccine for the infection caused by avian influenza virus, including such virus-like particles as an active agent.

EFFECT: preparations are active to various strains of avian influenza virus and can be considered as a candidate for universal avian influenza virus type A vaccine.

7 cl, 8 dwg, 4 tbl, 8 ex

FIELD: biology, genetic engineering.

SUBSTANCE: invention concerns molecular biology and genetic engineering. Invention claims synthetic DNA molecule encoding HPV31 L1 protein, virus-like HPV31 particles, vaccine and pharmaceutical composition including virus-like HPV31 particles.

EFFECT: papilloma virus therapy.

17 cl, 6 dwg, 8 ex

FIELD: chemistry, biochemistry.

SUBSTANCE: invention relates to virology and genetic engineering. Claimed is recombinant virus of fowl pox, inducing immune response against hepatitis C (HCV) virus, containing DNA-fragment obtained from HCV. Said DNA-fragment codes fragment core-E1 polyprotein or chimeric protein, containing HCV epitopes, specific to helper and cytotoxic T-cells. Also claimed is pharmaceutical composition containing such virus.

EFFECT: invention can be used in medicine.

9 cl, 8 dwg, 4 ex

FIELD: chemistry, biochemistry.

SUBSTANCE: invention refers to molecular biology, virology and genetic engineering. There are disclosed method of producing recombinant influenza virus with mutant gene NB of membrane protein, recombinant influenza virus produced by this method, and vector composition based on parts of recombinant influenza virus.

EFFECT: developed method of recombinant influenza virus with mutant gene NB of membrane protein.

24 cl, 8 dwg

FIELD: medicine; virology.

SUBSTANCE: strain expresses the VP2 protein which contacts a monoclonal antibody moab B69 and moab 67, cosecreted by the monoclonal antibody cellular lines HB-9437 and HB-11122. Contains a mutation of coding area of the classical VP2 in the position 222, coding series or threonine, and the nucleotide sequence coding amino-acid sequence, presented in any of SEQ ID No. 1-5 in position 318-323.

EFFECT: effective utilisation for bacterination against infectious bursal disease.

24 cl, 1 dwg, 5 tbl, 2 ex

FIELD: technological processes; veterinary medicine.

SUBSTANCE: method consists in the following: in cells LMH homologous recombination is performed between genomic DNA of birds adenovirus CELO with deleted right end fragment and plasmid structure, which contains the right end fragment of CELO genome with deletion in 3620 bps, in the area of which the expressing cassette with gene of birds flu virus H5N1 hemagglutinin is cloned, or with gene of birds flu virus H5N1 neuraminidase, or with both above mentioned genes.

EFFECT: creation of genetically engineered recombinant vaccines of new generation.

4 cl, 5 dwg, 7 ex

FIELD: technological processes; veterinary medicine.

SUBSTANCE: on the basis of genomic DNA of birds adenovirus CELO two plasmids are designed, one of which contains its left fragment (1-20028 bps), which includes expressing cassette under control of own main late promoter of adenovirus MLP, and the other contains the right fragment of genome CELO (17,390-43,804 bps) with zone that is homologous to nucleotide sequence of the first plasmid for performance of recombination, and also with deletion in 3,787 bps for increase of packing capacity of adenovirus CELO. Expressing cassette is cloned in the area of deletion, which consists of exogenic promoter that provides high level of expression in eukaryotic cells, polylinkers for cloning of one or more target genes and signal of polyadenylation. Homologous recombination between designed plasmids is performed in the culture of cells of leghorn rooster hepatoma (LMH), which provides preparation of recombinant birds adenovirus CELO. For cloning in expressing cassettes genes of cytokines, growth factors, antigens and oncosuppressors of human being, birds and microorganisms are used, both taken separately and in certain combinations for achievement of required genetic therapeutic effect or high level of immunisation.

EFFECT: creation of genetically engineered recombinant vaccines of new generation and preparations for genetic therapy.

32 cl, 4 dwg, 22 ex

FIELD: medicine.

SUBSTANCE: invention is related to nucleic acids and multidomain proteins, which are able to bind vessel endotheliocyte growth factor (VEGF), and may be used in medicine. Recombinant method is used to produce polypeptide, which consists of component (R1R2)X and, unnecessarily, multidomain component (MC), which represents aminoacid sequence with length from 1 to 200 of amino acids, having at least one remainder of cysteine, where X≥1, R1 means antibody-like (Ig) domain 2 of VEGF receptor Llt-1, and R2 means Ig-domain 3 of VEGF receptor Flk-1. Produced fused polypeptide does not contain multidomain component in case, when X=2, and in case when X=1, multidomain component represents aminoacid sequence with length from 1 to 15 amino acids. Produced polypeptide is used in composition of pharmaceutical compound for VEGF-mediated disease or condition.

EFFECT: invention makes it possible to produce highly efficient trap of VEGF, special structure of which is suitable for local introduction into specific organs, tissues or cells.

16 cl, 3 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention claims compositions which can include one or several mammary gland tumour proteins, their immunogenic parts or polynucleotides encoding such parts. Alternatively the therapeutic composition can include antigen-presenting cell expressing mammary gland tumour protein, or T-cell specific to cells expressing such protein. These compositions can be applied in prevention and treatment of such diseases as mammary gland cancer. Invention also claims diagnostic methods based on determination of mammary gland tumour protein or mRNA encoding such protein in sample.

EFFECT: use of peptides obtained from protein expressed from mammary gland by tumour in diagnostics and therapy of mammary gland cancer.

37 cl, 6 ex, 1 dwg

FIELD: chemistry, organic, viruses.

SUBSTANCE: invention relates to medical and molecular genetics. Three geometric constructions are proposed on the basis of vector plasmid pEGFP-N1, the constructions producing siPHK: inhibitors of reproduction of the human immune deficiency virus of the 1 type. The invention may be used in development of more efficient anti-HIV preparations on the basis of interfering RNAs (siPHK) produced in cells with the aid of administered vector expressing constructions.

EFFECT: obtaining of genetic construction for development of anti-HIV preparations.

3 cl, 1 dwg, 5 tbl, 3 ex

FIELD: biotechnology, in particular gene engineering.

SUBSTANCE: Gene of B9R protein having high homology with extracellular segment of interferon-gamma receptor is isolated by PCR method from Mankeypox virus genome of strain Zaire-96-1-16. Then said protein is cloned in donor plasmid pFastbAC and via site-specific transposition recombinant bacmid is constructed. Said bacmid is used for pest cell transfection to generate target strain.

EFFECT: new drugs for treatment of human diseases associated with hyperproduction of interferon-gamma.

2 cl, 3 dwg, 6 ex

FIELD: gene engineering.

SUBSTANCE: the present innovation deals with the ways for obtaining transgenic poultry due to introducing retroviral vectors into blastodermal cells through the fissure in the shell of nonhatching egg from the side of its blunt end. With the help of insulin syringe one should introduce gene constructions for the depth of about 2-3 cm near a germinal disk. The innovation enables to simplify the procedure of introducing gene constructions into target cells at maintaining general efficiency of transgenesis that leads to the decrease of embryonic lethality.

EFFECT: higher efficiency.

FIELD: biotechnology, virology, medicine.

SUBSTANCE: invention relates to attenuated virus derived from modified Ankara vaccina virus. Said virus are not able for reproduction by replication in human cell lines. Also disclosed are application of virus or recombinant variants thereof as drug or vaccine, as well as method for inducing of immune response in patients with defected immunity, in patients having immunity to vaccine virus, or in patient during antiviral therapy.

EFFECT: variant of Ankara vaccina virus effective in medicine and veterinary.

86 cl, 15 dwg, 1 tbl, 2 ex

FIELD: biotechnology, medicine, in particular viral disease treatment.

SUBSTANCE: invention relates to recessive dividing retroviral vector useful in inhibition of wild-type retrovirus replication. Vector contains retroviral long terminal repeat sequences; retroviral packing signal; nucleotide sequence encoding (expressing) genetic antiviral agent; and optionally the second nucleotide sequence. Disclosed are method for production of said vector and reproduction thereof. Further isolated and purified nucleic acid (NA) molecule providing of selective advantage in regard to viral generation packing into virions is disclosed. Uses of retroviral vector in particular for specific antibody production are described.

EFFECT: new genetic antiviral agents generating prolonged and stable immunological responses in regard, for example, to AIDS and cancer viruses.

97 cl, 11 ex

FIELD: biotechnology, medicine, in particular viral disease treatment.

SUBSTANCE: invention relates to recessive dividing retroviral vector useful in inhibition of wild-type retrovirus replication. Vector contains retroviral long terminal repeat sequences; retroviral packing signal; nucleotide sequence encoding (expressing) genetic antiviral agent; and optionally the second nucleotide sequence. Disclosed are method for production of said vector and reproduction thereof. Further isolated and purified nucleic acid (NA) molecule providing of selective advantage in regard to viral generation packing into virions is disclosed. Uses of retroviral vector in particular for specific antibody production are described.

EFFECT: new genetic antiviral agents generating prolonged and stable immunological responses in regard, for example, to AIDS and cancer viruses.

97 cl, 11 ex

FIELD: genetic engineering, proteins, medicine, pharmacy.

SUBSTANCE: invention relates to a method for preparing a fused protein representing immunoglobulin Fc-fragment and interferon-alpha and can be used in treatment of hepatitis. Method involves construction of a fused protein comprising immunoglobulin Fc-fragment prepared from Ig G1 or Ig G3 in direction from N-end to C-end and the end protein comprising at least one interferon-alpha. Fc-fragment and the end protein are joined directly or by a polypeptide bridge. The fused protein is used for preparing a pharmaceutical composition used in treatment of liver diseases and in a method for targeting interferon-alpha into liver tissues. Invention provides preparing the fused protein eliciting with biological activity of interferon-alpha providing its concentrating in liver and showing enhanced solubility, prolonged half-time life in serum blood and enhanced binding with specific receptors.

EFFECT: improved targeting method, valuable biological properties of fused protein.

10 cl, 5 dwg, 9 ex

FIELD: genetic engineering, proteins, medicine, pharmacy.

SUBSTANCE: invention relates to a method for preparing a fused protein representing immunoglobulin Fc-fragment and interferon-alpha and can be used in treatment of hepatitis. Method involves construction of a fused protein comprising immunoglobulin Fc-fragment prepared from Ig G1 or Ig G3 in direction from N-end to C-end and the end protein comprising at least one interferon-alpha. Fc-fragment and the end protein are joined directly or by a polypeptide bridge. The fused protein is used for preparing a pharmaceutical composition used in treatment of liver diseases and in a method for targeting interferon-alpha into liver tissues. Invention provides preparing the fused protein eliciting with biological activity of interferon-alpha providing its concentrating in liver and showing enhanced solubility, prolonged half-time life in serum blood and enhanced binding with specific receptors.

EFFECT: improved targeting method, valuable biological properties of fused protein.

10 cl, 5 dwg, 9 ex

FIELD: medicine.

SUBSTANCE: invention is related to nucleic acids and multidomain proteins, which are able to bind vessel endotheliocyte growth factor (VEGF), and may be used in medicine. Recombinant method is used to produce polypeptide, which consists of component (R1R2)X and, unnecessarily, multidomain component (MC), which represents aminoacid sequence with length from 1 to 200 of amino acids, having at least one remainder of cysteine, where X≥1, R1 means antibody-like (Ig) domain 2 of VEGF receptor Llt-1, and R2 means Ig-domain 3 of VEGF receptor Flk-1. Produced fused polypeptide does not contain multidomain component in case, when X=2, and in case when X=1, multidomain component represents aminoacid sequence with length from 1 to 15 amino acids. Produced polypeptide is used in composition of pharmaceutical compound for VEGF-mediated disease or condition.

EFFECT: invention makes it possible to produce highly efficient trap of VEGF, special structure of which is suitable for local introduction into specific organs, tissues or cells.

16 cl, 3 tbl, 7 ex

Up!