Self-activated stability protein

FIELD: medicine.

SUBSTANCE: nucleic acid coding self-activated stability protein contains a limited site of NBS-LRR-gene extended from 5'-end of coding region of NBS-LRR-gene towards 5'-3' prior to NBS-domain, and NBS-LRR-gene is not TIR-NBS-LRR-gene.

EFFECT: plants containing self-activated stability protein gain pathogen resistance.

19 cl, 24 dwg, 3 tbl

 

The present invention relates to a nucleic acid that encodes autoantibodies protein stability to achieve pathogen resistance in plants, to the use of nucleic acid to produce transgenic plants, and transgenic plants.

Fungi, viruses, nematodes and bacteria that cause known plant diseases cause large yield losses worldwide, are detrimental to the quality of the crop and make the necessary expensive chemical protection means for plants because natural protective means plants that protect them from a large number of potential pathogens or may slow their spread is often insufficient. These protective tools include reaction hypercalvinist, which controls cell death of the tissues of the host at the site of infection, the strengthening of plant cell walls using lignification and the formation of callus formation phytoalexins and products SP-(associated with pathogenesis)-proteins. Key molecules for activation-induced protection are resistance genes (resistance) plants (R-genes). In accordance with the hypothesis of the "gene-for-gene" flora (Flor), protein R-gene interacts with the corresponding microbial protein gene for avirulence (Avr gene), which is thus induced protective response.

A greater number of R-genes may, depending on the structure coded P-protein can be divided into 5 classes (Martin et al., 2003). Class 1 contains only the Pto gene of tomato, which encodes a serine/threonine kinase. The basic number of R-genes in plants belongs to the superfamily of NBS-LRR genes that encode the nucleotide-binding site (NBS - nucleotide-binding site and leucine-rich repeat (LRR - leucine rich repeat). NBS-LRR genes containing at its N-end structure "vesperale" (coiled-coil) (CC), as, for example, "lacinova lightning, will belong to the CC-NBS-LRR-class 2 genes. R-genes CC-NBS-LRR-type were found in all angiosperms. Class 3 includes R-genes TIR-NBS-LRR-type, which are on the N-end sequence having a homology to the TIR plot ("toll-interleukin-1-receptor - toll-interleukin-1-receptor") animals instead of the SS domain. TIR-NBS-LRR genes account for up to 75% of all R-genes in Arabidopsis thaliana, but not detected in cereals and sugar beet (Tian et al., 2004).

4 class R-genes are the Cf genes of tomato. The CF proteins no NBS domains, but they are transmembrane domain (TM) and extracellular leucine-rich repeat (LRR). A 5 class are Ha-rice protein consisting of the extracellular LRR domain, a transmembrane domain and an intracellular kinase domain.

Although R-genes are weakly expressed under the promoter of R-genes, a strong constitutive expression of R-genes 1, 2 and 3 classes leads to activation zametyat pathogens of plants in the absence of the corresponding gene products of avirulence and thus, to autoactivate R-proteins (Tang et al., 1999; Oldroyd and Staskawicz, 1998; Bendahmane et al., 2002).

Usually constitutive overexpression of R-genes in transgenic plants is associated with undesirable from the point of view of agronomy properties, such as micronecrosis (Tang et al., 1999) or stunting of plants (Frost et al., 2004).

Another possibility to ensure autoactivate R-proteins of classes 2 and 3 is mutagenesis in a special conservative amino acid motifs in full CC-NBS-LRR or TIR-NBS-LRR proteins. Mutagenesis of the sequence of the NBS - or LRR domain Rx-gene of potato (Bendahmane et al., 2002) and NBS-LRR domain gene of flax (Howles et al., 2005) leads to the formation of mutants, which lack the corresponding gene for avirulence after transit of expression is triggered cell death.

Experiments with tick marks at the Rx gene showed that the products deletions, consisting of SS-domain and parts of the NBS domain, after their transit overexpression can also induce cell death, which occurs more rapidly than when using a full-sized R-genes. These products deletions in addition to the CC-domain need in the P-loop, kinase-2 and full-sized kinase-3 NBS-domain. Otherwise, a further shortening of the NBS domain will result in a slower compared to the full-size R-gene inclusion hypersensitivity reactions (Bendahname et al., 2002).

Autoactivate the gene L10, one of the R-genes belonging to class 3, can be achieved by obtaining a shortened TIR-NBS-LRR protein, consisting of TIR-domain and 34 amino acids adjacent NBS domain, including the P-loop (Frost et al., 2004).

Although there are many ways of autoactivation R-genes, so far not described any of transgenic plants, in which the autoactivation R-proteins would lead to increased antifungal resistance without simultaneous damage agronomic properties. Attempt to stably transform two autoactivating full version L6 genes under the control of the native L6-promoters of sustainability or promoters induced mushrooms, flax, each time has resulted in plants with normal growth, susceptible to fungal infection, or to the appearance of stunted plants resistant to fungal infection (Howles et al., 2005).

The present invention is to modify the protective function of plants against pathogens so that the protective response of the plant with the attack of pathogens reliably activated without negative impact on agronomic properties of the plant.

In accordance with the invention the task is solved by a nucleic acid that includes a limited section of the NBS-LRR-resistance gene, which extends from the 5'-con is and coding region of NBS-LRR-resistance gene in the direction 5'-3' before NBS domain, moreover, the NBS-LRR-resistance gene is not TIR-NBS-LRR-resistance gene. Such nucleic acid may be isolated from plants or obtained synthetically.

Limited area of NBS-LRR-resistance gene, starting with the start codon for translation (ATG codon) and to NBS domain, known as basic due to the P-loop (motif kinase-1a). In order for the region NBS-LRR-resistance gene according to the invention to function, it must not include the P-loop. Also there must be no other segments NBS and LRR domains of NBS-LRR-resistance gene. However, the individual nucleotides NBS domain comprising the nucleotides of the P-loop, can be left, if they will not adversely affect the manifestation of hypersensitivity reactions.

Under autoactivates protein stability is understood in this protein, which in the absence of the corresponding gene product of the avirulence will lead to the activation of defence against pathogens in plants. In this regard, the invention has the advantage that in case of resistance against pathogens does not require any interaction between protein stability and protein for avirulence, thanks to a defense reaction of the plant is more focused and, ultimately, may be safer.

The autoactivation may be caused, for example, using transit over the xpressia resistance gene. Overexpression indicates that the strength of the expression of the native promoter of the gene of resistance will be increased so that the cascade of signal transmission, adjustable R-protein is activated in the absence of appropriate microbial products of the gene for avirulence. This will lead to activation of the protection from pathogens, which will result in partial or complete resistance to the disease.

The autoactivation of protein stability can also be achieved by shortening the full-size R-genes BvKWS3_165, BvKWS3_135, Bv13033 and Bv12069 sugar beet, as well as StR3a gene of potato in the 5'-region in which the N-end of the protein, devoid of NBS and LRR domains, is encoded in the end, random SS domain. N the end, devoid of NBS-domain means in this context that the 5'-end coding region of NBS-LRR-resistance gene extends so far to the 3'-end that the functional structure of the P-loop of NBS-LRR-resistance gene is not included in the gene. In simple cases, the P-loop is missing completely. However, in the shorter gene resistance may also be a separate nucleotides of the P-loop, if the manifestation of hypersensitivity reactions will not be delayed. When the shortening of the NBS-LRR-resistance gene with the N-end will also be deleted sequence kinase-2, kinase-3, GLPC and MHD, including flanking amino acids in accordance with the information what situation data banks "Prosit" (Prosite) (Bairoch et al., 1996) and Pfam" (Pfam) (Sonnhammer et al., 1997), and in accordance with the definition of motifs according to Bendahmane and others (Bendahmane et al., 2002).

The use of shortened R-genes 165_#176, 135_#147, 13033_#159 and Bv12069 and StR3a-#1-155 results, in comparison with a full-size R-genes, faster startup cell death in plant tissue. In combination with pathogen-inducible promoter that leads to improved induced protection against pathogens. This also applies for these R-proteins, which cannot be autoactivation due to known mutations in MHD - or VHD domain, as reflected in the gene expression 135_#147 BvKWS3 and 135-D480V.

Because the shortened R-genes are able to induce cell death significantly earlier compared with the full-size R-genes, for a shortened R-genes have low expression to achieve concentrations of protein, critical for protection against pathogens, as has been shown for R-gene 135_#147.

The p-loop or motif kinase-1a together with the motives kinase-2 and kinase-3 are characteristic of ATP - or GTP-gidroliznaya proteins (Traut, 1994) and found in the NBS domain of NBS-LRR genes. P-loop characterizes the N-terminal region NBS domain (Bendahmane et al., 2002). Consensus sequence R-loop to R-genes Prf, Rx, Rpm1, BvKWS3_135, BvKWS3_133 and BvKWS3_165 is (I/V)VG(M/I)GG(L/I/S)GKTT(L/V).

Unexpectedly, it was found that particularly good activity have nucleic key is lots encoding amino acid sequence comprising the motif of the DAE, and in particular the nucleic acid encoding the motif sequence AVLXDAE. Motives sequence DAE and AVLXDAE presents, for example. in SEQ ID NOS: 13 and 15.

Preferred sequences of nucleic acids are selected from the following groups:

a) the nucleotide sequence according to SEQ ID NO: 1 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO: 1 or a nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO: 1 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO: 1;

b) the nucleotide sequence according to SEQ ID NO: 2, or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO: 2, or a nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO: 2 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO: 2;

C) the nucleotide sequence according to SEQ ID NO: 3, or a nucleotide sequence complementary nucleot the ne sequence in accordance with SEQ ID NO: 3, or a nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO: 3 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO: 3;

g) a nucleotide sequence in accordance with SEQ ID NO: 4, or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO: 4, or a nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO: 4 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO: 4;

d) the nucleotide sequence according to SEQ ID NO: 16, or the nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO: 16, or the nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO: 16 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO: 16.

A limited section of the NBS-LRR-resistance gene is preferred nucleotide sequences shown below:

SEQ ID NO: 1 c 124 on 654

SEQ ID NO: 2 155-598

SEQ ID NO: 3 with 94 573

SEQ ID NO: 4 c po 694

Used herein, the term "hybreed" refers to hybridization in common conditions, such as described in Sambrook and others (Sambrook et al., 1989), preferably under strict conditions. Stringent hybridization conditions are, for example, hybridization in 4-fold solution of sodium chloride and sodium citrate (SSC) at 65°C, followed by repeated laundering in 0.1 times SSC at 65°C for about 1 hour. Less stringent hybridization conditions are, for example, hybridization in 4-fold SSC at 37°C, followed by repeated laundering in 0.1 times SSC at room temperature. "Stringent hybridization conditions" can also mean hybridization at 68°C in 0.25 M phosphate sodium, pH of 7.2, 7% sodium dodecyl sulfate (SDS), 1 mm etilenditiodiuksusnoi acid (EDTA) and 1% bovine serum albumin (BSA) for 16 hours, followed by double laundering in 2-fold SSC and 0.2% SDS at 68°C.

Preferably the resistance gene, encoding autoantibodies protein stability comes from sugar beets or potatoes.

Preferably, the nucleic acid of the invention encodes the amino acid sequence according to SEQ ID NO: 13 to 15. Within the consensus sequences functional equivalent amino acids can be used interchangeably, such as Asp instead of Glu, Leu instead of Ile, Ala or Val, Arg instead of Lys, Phe pax is Trp.

Both consensus sequences in accordance with SEQ ID NOS: 13 and 14 represent two functional blocks, which can be positioned relative to each other is not rigidly prescribed distance. Preferably the gap between the two blocks is a consensus sequence in accordance with SEQ ID NO: 15, and the consensus sequence in accordance with figure 10.

Nucleic acid according to the invention is preferably combined with a promoter induced by pathogens. Induced by pathogens promoter is activated in response to infection of the tissues of the host by the pathogen, such as damaging fungus, bacterium, virus or nematode. Induced by pathogens promoter is more active in the plant tissue during penetration into them of the infection, or in successfully infected tissues than in uninfected plant tissues.

Promoters induced by pathogens, mainly known in the art. Examples of promoters induced by pathogens, include jicinsky promoter (Samac and Shah, 1991), glucanase promoter (Hennig et al., 1993) and prp-1 promoter (Martini et al., 1993).

Using induced by pathogens overexpression of R-gene can prevent the negative effects of constitutive expression, such as, for example, short stature, or a lack of plants.

Special is about matching showed himself synthetic promoters. The present invention is described promoters obtained using molecular-biological methods, which in this form has not been found in nature. Synthetic promoter is a minimal promoter, which in addition to the minimal promoter contains only one or more certain way selected CIS-element. These CIS-elements are binding sites of DNA-binding proteins such as transcription factors, and they were isolated from natural promoters selected from the finished allocated CIS-elements or produced artificially using the method of random recombination and selected using an appropriate method. Compared with the natural promoter, a synthetic promoter due to its less complex structure is activated only using a small number of exogenous and endogenous factors, so it is regulated more specifically.

The minimal promoter or a core promoter is a nucleotide sequence containing the binding sites of the main complexes of transcription factors and provide accurate initiation of transcription with RNA polymerase II. The characteristic motif sequence of the minimal promoter is a TATA-box, initiation element (Inr), the control recognizes TFBII" (BRE - TATA binding factor II recognition element) and "Nigeria the third element of the crustal promoter" (DPE downstream core promoter element). These elements may occur in the minimal promoter together or separately. On sale are the minimum promoters or their motives sequence selected from any plant or viral gene.

In the scope of the present invention developed new synthetic promoters in combination with known resistance genes, not necessarily coding autoantibodies protein stability, can be used to obtain plants resistant to pathogens. The present invention describes the promoters of type n×S m×D-minimal promoters, n×W2-m×D-minimum promoters and n×Gst1-m×D-minimal promoters, thus, a synthetic promoter contains one or more than one following combination of CIS-elements:

a) n×S m×D-box;

b) n×W2-m×D-box;

in) n×Gst1-m×D-box,

where n and m are a natural number from 1 to 10

S-box (CAGCCACCAAAGAGGACCCAGAAT)having the nucleotide sequence SEQ ID NO: 6, W2-Boxing (TTATTCAGCCATCAAAAGTTGACCAATAAT)having the nucleotide sequence SEQ ID NO: 7,

D-box (TACAATTCAAACATTGTTCAAACAAGGAACC),

having the nucleotide sequence SEQ ID NO: 8 and Gst-Boxing (TTCTAGCCACCAGATTTGACCAAAC)having the nucleotide sequence SEQ ID NO: 9, described by Rushton in 2002 (Rushton et al., 2002), including functions important to nuclear sequences.

Promoters vary depending on the set of the elements (n×S m×D, n×W2-m×D or n×Gst1-m×D) according to their basic activity, the ability to be induced by pathogens, the kinetics of activation and the strength of the promoter, such as, for example, has been shown to promoters with combinations of CIS-elements of the 2×S 2×D with nucleotide sequence SEQ ID NO: 10, 2×W2-2×D with nucleotide sequence SEQ ID NO: 11 and 2×Gst1-2×D with nucleotide sequence SEQ ID NO: 12. Properties of synthetic promoter give the ability to modify gene expression by changing the number of CIS-elements (n, m=1...10) in accordance with the specific requirements. Comparison of promoters 2×S 2×D options 2×S 4×D 4×S 2×D 4×S 4×D) showed that the average strength of the promoter when using tetramers increased as compared with the promoters, consisting of dimers. In addition, the ability to inducing pathogens increases from dimer-dimer promoter (2×S 2×D) tetramer-dimer and dimer-tetramer the promoters (4×S 2×D, 2×S 4×D) and the tetramer-tetramer promoter (4×S 4×D) in all time points of measurement. Simultaneously with the increase in the strength of the promoter and the ability to inducing pathogens in the case of the examples described tetrameristaceae promoters reveals a strengthening of the underlying activity. These examples show that important properties of the promoters regulated by a number of CIS-elements and optimal promoters can be obtained and identified economony for the respective artificial rurangirwa.

The corresponding results can be obtained with combinations of CIS-elements representing a derivative of the nucleotide sequences SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12 and having properties comparable to the properties of combinations of CIS-elements in SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12.

Promoters 2×S 2×D-minimal promoter and 2×W2-2×D-minimal promoter are, for example, combined respectively with four full-size R-genes BvKWS3_133, BvKWS3_123, BvKWS3_135 and BvKWS3_165, and they can be transformed sugar beet. The test for resistance to fungi transgenic plants with the participation of the most important fungus parasite of sugar beet Cercospora beticola, the causative agent of leaf spot, if each of the structures has resulted in improved resistance to fungi and transgenic plants did not differ from nereshennyh plant growth or other agronomic properties. This result shows that the use of a promoter capable of induction by pathogens, in General it is possible to achieve overexpression of R-genes that trigger cell death, and, therefore, improved disease resistance, without adversely affecting the successful development of plants. In optimal promoters in selecting the most appropriate number of repetitions of CIS-elements in disease resistance stage is niteline improved.

The present invention also relates to transgenic plants transformed with new structures of nucleic acids, in particular to plants sugar beet, parts, such as seeds or planting material of these plants, as well as the application of new structures of nucleic acids to obtain transgenic plants.

The invention will be further explained with reference to drawings and examples.

The invention described in example sugar beet, can also easily be applied to other food plants, in which the selected resistance genes.

Graphics

Figure 1 shows a map of the binary vector pER-35Sluci used for Agrobacterium tumefaciens mediated transit in the expression of R-genes in leaves of sugar beet. The vector carries one gene luciferase with one intron Photinus pyralis, which cannot be expressed in A. tumefaciens.

Figure 2 shows the starting cell death in leaves of sugar beet after the transit of the expression of R-gene BvKWS3_133 using Agrobacterium tumefaciens. While transit expression constructs pER-35Sluci leads to enhanced activity of genes reporters in beet leaves, expression constructs pER133-35Sluci leads to cell death in such a way that it is impossible to detect any activity of genes-reporters.

Figure 3 shows the vector pCaMV-2, which applies is the very for transit balistically transformation of sugar beet leaves. Full and shortened R-genes were brought under control of the double 35S promoter, as described above.

Figure 4 shows the start cell death in leaves of sugar beet after the transit of the expression of R-genes BvKWS3_123, BvKWS3_133 and BvKWS3_165 through balistically transformation. Conducted joint transformation genes BvKWS3_123, BvKWS3_133 and BvKWS3_165 under control of the double 35S-promoter (d35S), and the design of the gene-reporter p70S-luc. The activity of a gene-reporter was measured 20 h after transformation. As seen in the launch of hypersensitivity reactions, the activity of a gene-reporter reduced compared with control (empty vector pCaMV-2 and p70S-luc). Presents the average of 3 independent duplicate Parallels at least 9 individual experiments on the construction. The error indicated by the standard error.

Figure 5 shows the amplification of the starting cell death as a result of expression of the 5'-terminal regions of R-gene BvKWS3_165 compared with expression of the full-size R-gene BvKWS3_165. Conducted biolistics transformation of sugar beet leaves N-terminal region and a full-sized R-gene under the control of the d35S promoter (p70S-165_#175 and p70S-BvKWS3_165) design p70S-luc. Presents the average of 3 independent duplicate Parallels at least 9-12 isolated experiments on the structure.

On IG shows the amplification of the starting cell death resulting from the expression of a full-sized R-gene BvKWS3_135 compared with amplification of the starting cell death through the 5'-terminal region 135_#147 R-gene BvKWS3_135. Conducted biolistics transformation of sugar beet leaves full R-gene and n-terminal region 135_#147 under the control of the d35S promoter (p70S-BvKWS3_135 and p70S-135_#147) design p70S-luc. Presents the average of 2 independent duplicate Parallels at least 9-12 isolated experiments on the structure.

7 shows the amplification of the starting cell death as a result of expression of the 5'-terminal regions 13033_#159 R-gene Bv13033 compared with expression of the full-size R-gene Bvl3033. Conducted biolistics transformation of sugar beet leaves full R-gene and N-terminal region 13033_#159 under the control of the d35S promoter (p70S-13033 and p70S-13033_#159) design p70S-luc. Presents the average of 2 independent duplicate Parallels at least 9-12 experiments on the structure.

On Fig shows the amplification of the starting cell death resulting from the expression of R-gene Bv12069.

Figure 9 shows the autoactivation of proteins BvKWS3_135 in the shortening of the 5'-region of the cDNA clone 135_#147 compared with mutation VHD motive NBS-domain.

Figure 10 (a-C)shows the comparison of amino acid sequences shortened autoactive proteins Bv12069, Bv13033_#159, BvKWS135_#147, BvKWS3_165_#175 and StR3a-#l-155 between a comparative sequences do not have autoactivate shortened proteins of potato resistance (RX-160) and SR1(355-540), and with a full R-protein NBS-LRR-type Arabidopsis thaliana (AtAB028617), beans (.vulgarisJ71), rice (O.sativa003073), soybean (G.maxKR4) tomatoes (Tomato-I2). Consensus sequences are underlined.

Figure 11 shows that the deletion of amino acids 147-175 significantly reduces the ability of proteins to autoactivate.

On Fig shown activation of synthetic promoters 2×S 2×D in transgenic sugar beet after the attack Cercospora beticola.

On Fig shown activation of synthetic promoters 2×W2-2×D in transgenic sugar beet after the attack Cercospora beticola.

On Fig shows a comparison of the activities of promoters of genes reporters 2×S 2×D 4×S 2×D, 2×S 4×D 4×S 4×D in transgenic sugar beet after the attack Cercospora beticola.

On Fig and 16 shows the combination of a full-sized R-genes 123, 133, 135, 165 with a synthetic promoter 2×S 2×D.

On Fig and 18 shows the combination of a full-sized R-genes 123, 133, 135, 165 with a synthetic promoter 2×W2-2×D.

On Fig shows the increase of the resistance of transgenic sugar beet line PR68-6 against fungus-parasite Cercospora beticola compared to nereshennymi control 3DC4156.

On Fig shows the increase of the resistance of transgenic sugar beet line PR70-32 against fungus-parasite Cercospora beticola compared to nereshennymi control 3DC4156.

On Fig and 22 shows the combination of N-terminal regions of R-genes 165_#176 and 12069 with synthetic promoters 2×S 2×D ×W2-2×D.

Examples

The evidence of the rapid reaction resistance in leaves of sugar beet as a result of overexpression of the gene BvKWS3_133

Transit overexpression of full-length cDNA clone of the gene BvKWS3_133 in leaves of sugar beet using Agrobacterium tumefaciens causes rapid cell death with no visible formation of necrosis. cDNA clone BvKWS3_133 combined with d35S-promoter and have been built into the binary vector pER-35Sluci (Figure 1). Vectors pER-35Sluci and pER133-35Sluci transformed strain SS Agrobacterium (An, 1987). Positive Agrobacterium was placed for transient expression in 50 ml LB-medium with 100 mg/ml streptomycin and 20 μm of acetosyringone 4-5 hours After that, the bacteria were centrifuged, the precipitate was placed in a solution of 10 mm MgCl2, 10 mm MES, 100 μm of acetosyringone and determined the density of bacteria in OD600=0,1. The bacterial suspension was left for 2-3 hours and then using a 2.5 ml syringe were injected with through the lower side of the sheet 10-week-old plants of sugar beet inside of the sheet. After incubation at 25°C in the culture Cabinet measured the activity of a gene-reporter luciferase Photinus pyralis transformed sheets 1, 2 and 3 days after vaccination. This was determined by luciferase activity using the system for luciferase analysis Luciferase Assay System (Promega, Mannheim, Germany) in the Sirius luminometer (Berthold Detection System GmbH, Pforzheim, Germany) in accordance with instructions what s the manufacturer. To obtain the enzymatic extract, suitable for measuring, for each dimension were cut from leaves at least 2 round fragment. Each design was performed on 8 measurements during the day. Samples of leaves homogenized in a mortar with the addition of sea sand in 10 times the volume (vol./wt.) passive lytic buffer (PLB). The liquid supernatant was transferred into a 1.5 ml tube type "Eppendorf and centrifuged for 5 min at 4°C and 20,000 g. Clear supernatant was collected and for measuring the activity of luciferase Photinus used 10 ál of extract was centrifuged. Leaves of sugar beet, which transformed control design pER-35Sluci, on the first day showed weak activity of luciferase, and on the 2nd and 3rd day, the luciferase activity was 124,000 or 116000 relative light units (EFE)/mg leaf tissue. Beet leaves, transformed design pER133-35Sluci at all 3 time points of measurement did not show activity, which was higher than in leaves inoculated MgCl2(Figure 2). During this transit the expression of the cDNA clone BvKWS3_133 manifested in a very rapid cell death in inoculated leaves of beets.

Constitutive expression of R-genes BvKWS3_123, BvKWS3_133 and BvKWS3_165 causes cell death in leaves of sugar beet

R-gene BvKWS3_133, as well as R-gene BvKWS3_165 with nucleotidyltransferase in accordance with SEQ ID NO: 5 and R-gene BvKWS3_123 combined with the double 35S promoter vector pCaMV-2 (Figure 3). Created vectors carried the label p70S-BvKWS3_133, p70S-BvKWS3_165 and p70S-BvKWS3_123. To verify the functionality of R-genes in leaves of sugar beet, made transit biolistics transformation by Schmidt and others (Schmidt et al., 2004), resulting in a realized expression design p70S-BvKWS3_133, p70S-BvKWS3_165 and p70S-BvKWS3_123 with vector gene-reporter p70S-luc. As a positive control used an empty vector pCaMV-2 in combination with a vector of gene-reporter p70S-luc. From the use of the normalized vector refused, unlike Schmidt and others (Schmidt et al., 2004). Luciferase activity was determined after 20 h after transformation using the system for luciferase analysis Luciferase Assay System (Promega, Mannheim, Germany). Experiments on transformation was repeated in 3 Parallels, and each experiment included 9 of repeated tests on the structure. Getting the average of 3 experiments, found that, compared with almost 100% activity of the positive control luciferase (empty vector), the activity of a gene-reporter is when p70S-BvKWS3_133 only 37.7 per cent, when p70S-BvKWS3_165 only 66% and p70S-BvKWS3_123 only 68.7 per cent (Figure 4). Strong expression of R-genes BvKWS3_133, BvKWS3_165 and BvKWS3_123 mediated d35S promoter, leads either to cell death or to hypersensitivity reactions in the part of transformed cells, which prevents coexpression vectors of generaterow, which together were introduced into the cells. It is shown that a strong expression of three R-genes leads to cell death or hypersensitivity reactions in the absence of the corresponding gene products of avirulence.

the 5'Region of the gene BvKWS3_165 causes more rapid cell death compared to the full-size cDNA clone BvKWS3_165

5'-Region of the full-size cDNA clone BvKWS3_165 with the nucleotide sequence according to SEQ ID NO: 5 amplified in design p70S-BvKWS3_165 using Pfu polymerase (Stratagene) using primers SS316 (CTCGAGAATTCGAGCTCCACCGCGG) and S318 (CTGGATCCTCACCTCCGTTCTTCATGTTGCTCTACC) and simultaneously introduced a stop codon in the encoded area. Amplificatory region corresponded to the nucleotide sequences according to SEQ ID NO: 1 and encodes the amino acid sequence 1-174 BvKWS3_165 (Figure 10). Amino acid sequence contained only the N-terminal region BvKWS3_165 and did not include any NBS and LRR domains (Figure 10). The product of polymerase chain reaction (PCR product) was cut with restriction enzymes SacII and BamHI and cloned in the vector pCaMV-2. The resulting vector contained the label p70S-165_#175. The ability of structures p70S-BvKWS3_165 and p70S-165_#175 to induce cell death in leaves of sugar beet quantitatively tested using transit balistically transformation. This was carried out by cotrans is ormatio each of the vectors together with the vector of gene-reporter p70S-luc. As a positive control used an empty vector pCaMV-2 in combination with a vector of gene-reporter p70S-luc. Compared to transformation with empty vector (pCaMV-2) transformation p70S-BvKWS3_165 network activity, comprising 65% of the activity of a gene-reporter, and transformation p70S-165_#175 to the activity that constitutes only 38% of the activity of a gene-reporter (Figure 5). This result shows that the expression of only the N-end 165_#175 $ 175 amino acids leads to more intensive start cell death in transformed leaves of sugar beet than using the full-size protein BvKWS3_165 consisting of 1066 amino acids. When expression 165_#175 killed more cells transformed leaves than in the case of expression BvKWS3_165. The reason for this difference is the new, more intense form of autoactivation R-proteins, the resulting shortening of the N-end.

the 5'Region of the gene BvKWS3_135 causes more rapid cell death compared to the full-size cDNA clone BvKWS3_135

5'-Region of the full-size cDNA clone BvKWS3_135 in design p70S-BvKWS3_135 amplified using Pfu polymerase (Stratagene) using primers SS316 (CTCGAGAATTCGAGCTCCACCGCGG) and S330 (CTGGATCCTCAGGGAGAACTCCATCTGGGTGGTCC) and simultaneously introduced a stop codon in the encoded area. Amplificatory region corresponded to the nucleotide sequences according to SEQ ID NO: 2 and which has audirovala amino acid sequence 1-174 BvKWS3_135 (Figure 10). Amino acid sequence contained only the N-terminal region BvKWS3_135 and did not include any NBS and LRR domains or motifs of these domains. The product of polymerase chain reaction (PCR product) was cut with restriction enzymes SacII and BamHI and cloned in the vector pCaMV-2. The resulting vector contained the label p70S-135_#147. The ability of structures p70S-BvKWS3_135 and p70S-135_#147 to induce cell death in leaves of sugar beet quantitatively tested using transit balistically transformation. For this purpose, conducted a joint transformation of each vector with the vector of the gene reporter p70S-luc. As a positive control used an empty vector pCaMV-2 in combination with a vector of gene-reporter p70S-luc. Compared to transformation with empty vector (pCaMV-2) transformation p70S-BvKWS3_135 leads to activity, component 74.5% of the activity of a gene-reporter, and transformation p70S-135_#147 - to activity that constitutes only 58.5% of the activity of a gene-reporter (Fig.6). The results show that the expression of full-length clone BvKWS3_135 causes the start cell death in transformed tissues. However, expression of only the N-end 135_#147 size of 147 amino acids leads to more intensive start cell death in transformed leaves of sugar beet compared to the full-size protein BvKWS3_135 comprising the C 844 amino acids. When expression 135_#147 killed more cells transformed leaves than in the case of expression BvKWS3_135. The reason for this difference is the new, more intensive form of autoactivation R-proteins, the resulting shortening of the N-end.

the 5'Region of the gene Bv13033 causes more rapid cell death compared to the full-size cDNA clone Bv13033

5'-Region of the full-size cDNA clone BvKWS3_135 in design p70S-BvKWS3_135 amplified using Pfu polymerase (Stratagene) using primers SS316 (CTCGAGAATTCGAGCTCCACCGCGG) and S333 (CTGGATCCTCAAGAACAAGTCTCAGGCCTTCTGTT) and simultaneously introduced a stop codon in the encoded area. Amplificatory region corresponded to the nucleotide sequences according to SEQ ID NO: 3 and encodes the amino acid sequence 1-159 Bv13033 (Figure 10). Amino acid sequence contained only the N-terminal region Bv13033 and did not include any NBS and LRR domains or motifs of these domains. The product of polymerase chain reaction (PCR product) was cut with restriction enzymes SacII and BamHI and cloned in the vector pCaMV-2. The resulting vector contained the label p70S-13033_#159. The ability of structures p70S-13033 and p70S-13033_#159 to induce cell death in leaves of sugar beet quantitatively tested using transit balistically transformation. For this purpose, conducted a joint transformation of each of vecto the s with the vector gene reporter p70S-luc. As a positive control used an empty vector pCaMV-2. Compared to transformation with empty vector (pCaMV-2) transformation p70S-13033 leads to activity that constitutes 95% of the activity of a gene-reporter, and transformation p70S-165_#175 - to activity that constitutes only 68% of the activity of a gene-reporter (Fig.7). These results indicate that the expression of full-length clone Bvl3033 leads only to a weak start cell death in transformed tissues. Expression of only the N-end 13033_#159 € 159 amino acids leads, however, to more intensive start cell death in transformed leaves of sugar beet. The reason for this difference is the new, more intensive form of autoactivation R-proteins, the resulting shortening of the N-end.

The start cell death in leaves of sugar beet using a 5'-region of the gene Bv12069

R-Gene Bv12069 with the nucleotide sequence according to SEQ ID NO: 4 encodes the N-end of the R-protein the size of 166 amino acids. Protein Bv12069, containing no NBS and LRR domains, has clear homology with N-ends autoactivating R-proteins 165_#175, 135_#147, 13033_#159 size 175, 147 and 159 amino acids, respectively (Figure 10). The cDNA clone using the double 35S promoter vector pCaMV-2 (Figure 3) combined with the vector p70S-12069. To verify the functionality of the gene Bv12069 carried out the expression con is e.g. p70S-12069 in combination with vector gene-reporter p70S-luc in leaves of sugar beet using transit balistically transformation. The activity of a gene-reporter in leaves of transformed p70S-12069 and p70S-luc, was in three independent Parallels only 51% of the activity measured for the positive control (empty vector pCaMV-2 and p70S-luc) (Fig). Thus, expression of the protein Bv12069 the size of 166 amino acids causes cell death in leaves of sugar beet.

Shortening gene BvKWS3_135 leads to the formation of autoantibodies protein, and not to mutagenesis in D-domain

The mechanism of autoactivation according to the invention using a shortening of the R-protein NBS-LRR type at the end, not having the NBS and LRR, compared with the method of autoactivation using mutagenesis MHD-motive. Mutagenesis MHD-motive Rx-gene potatoes and L6 gene flax leads to autoactivation data genes (Bendahmane et al., 2002; Howles et al., 2005). The cDNA clone BvKWS3_135 encodes VHD motif corresponding MHD-motif, which is also often found next to MHD-motif in the R-genes (Howles et al., 2005). Received the appropriate mutation full BvKWS3_135, as described by Bendahmane et al. (2002). For this purpose, the amino acid aspartate in the motive VHD gene BvKWS3_135 have been replaced with the amino acid valine. The obtained gene was marked BvKWS3J35_D480V. The efficiency of gene 135_#147, BvKWS3_135_D480V and unmodified gene BvKWS3_135 tested using transit Agrobacterium tumefaciens mediated overexpression in leaves of sugar beet. For this purpose, the cDNA clone BvKWS3_135 combined with the d35S promoter, and was built in inany vector pER-35Sluci. The resulting vector was marked pER135-35Sluci. Accordingly acted and with shorter cDNA clone 135_#147 with the nucleotide sequence according to SEQ ID NO: 2 and the mutated cDNA clone BvKWS3_135_D480V. The resulting vectors were carrying labels pER135_#147-35Sluci and pER135_D480V-35Sluci. The vectors were transformed as described for Agrobacterium strain C58C1, and together with the positive control pER-35Sluci were injected with in leaves of sugar beet. The activity of a gene-reporter luciferase Photinus pyralis transformed leaves were measured after 1, 2 and 3 days after vaccination. Leaves of sugar beet, transformed control design pER-35Sluci, on the first day showed weak activity of luciferase, and on the 2nd and 3rd day showed luciferase activity, component 190000 and 245000 EFE/mg leaf tissue, and, thus, measurable cell death compared to positive control. The activity of a gene-reporter in the design pER135_D480V-35Sluci was on the 2nd and 3rd day 188000 and 206000 EFE/mg (Fig.9). However, the imposition of MHD-mutations in the gene BvKWS3_135 not cited at all or have only led to a barely detectable autoactivate. In accordance with this method using a shortened R-gene 135_#147, on the contrary, on the 2nd and 3rd day showed the activity of a gene-reporter, component 90000 and 63000 EFE/mg (Fig.9), and, therefore, clearly a stronger manifestation of cell death and autoactivation compared the structure with the design pER-35Sluci and pER135_D480V-35Sluci.

The identification of the common amino acid motifs in the N-end R-proteins BvKWS3_165, BvKWS3_135, Bv13033 and Bv12069 and StR3a

Establishing homology between the N-end R-proteins BvKWS3_165, BvKWS3_135, Bv13033 and Bv12069 length 175, 147, 159 and 166 amino acids, and N-end R3a gene potatoes with a length of 155 amino acids (Huang et al., 2005) was performed to identify common sequence motifs. The comparison resulted in the identification of a larger number of consensus sequences in the N-end autoactivating R-proteins. Common motifs in the sequences presented in the form of consensus sequences Figa.

The consensus sequence corresponds to the amino acid sequence according to SEQ ID NO: 13: AVLXDAEXKQXX XXXLXXWLXDLKDXVYDXDDILDE. Another consensus sequence corresponds to the amino acid sequence according to SEQ ID NO: 14: IXEIXXKLDDL.

The letter X here denotes any amino acid.

Both consensus sequences described in the forms contained in such N-ends of the CC-NBS-LRR R-proteins, the expression of which leads to autoactivation. Thus, SS is the domain RX-gene length 160 amino acids are able to induce cell death or hypersensitivity reaction (Bendahmane et al., 2002). Transit the expression of N-Terminus of R-gene BvKWS3_133_e08 sugar beet length of 177 amino acids, and N-end of the R1 gene for potato length of 540 amino acids (Ballvoraet al., 2002) does not lead to increased cell death compared to the full-size R-gene BvKWS3_133_e08, and in the case of full-R1 gene does not lead to cell death (data not shown). Comparison of the amino acid N-ends autoactivating proteins BvKWS3_165_#176, BvKWS3_135_#147, Bv13033_#159, Bv12069 and StR3a-, #1-155 with amino acid sequences of SS-domains Rx, StR1 and BvKWS3_133_#177-proteins showed the absence of the above consensus sequences in pawtucketville N-ends (Figb). In particular, an important auxiliary tool for the identification of R-proteins whose N-ends of autoactive is consistent motif DAE. Using the motif of the DAE in the consensus sequence found suitable for autoactivation R-genes in many plant species, such as those shown for example in Figure 10 for Arabidopsis thaliana (AtAB028617), beans (PvulgarisJ71), rice (osativaAp003073), soybean (GmaxKR4) and tomatoes (Tomato-I2).

Amino acid sequence 147-175 important to autoactivate R-protein 165 #175

To identify amino acid segment in the protein 165_#175, important for autoactivation N-end of NBS-LRR proteins, shortened the coding region of the cDNA clone 165_#175. The cDNA clones 165_#93 and 165_#146 encode amino acids 1-93 or 1-146 protein 165_#175. Transit neoliticheskoe testing designs p70S_165_#93, p70S_165_#146 and p70S_165_#175 showed that only protein 165_#175, but not 165_#93 and not 165_#146 leads to markedly the cell death (11). Therefore, the region of the sequence 146-175 essential for autoactivation NBS-LRR proteins. In this area is the motif sequence, conservative for all tested proteins (Figa).

Rapid activation of synthetic induced by pathogens promoters 2×S 2×D 2×W2-2×D as the result of a fungal infection

For induced pathogens overexpression of full-length or partial resistance genes are particularly suitable promoters of type n×S m×D n×W2-m×D and n×Gst1-m×D, where n=1, 2, 3, 4, 5, 6, 7, 8, 9, 10 and m=1, 2, 3, 4, 5, 6, 7, 8, 9, 10. For example, the promoters of the type 2×S 2×D, in accordance with SEQ ID No. 10, 2×W2-2×D, in accordance with SEQ ID No. 11, and 2×Gst1-2×D, in accordance with SEQ ID No. 12 combined with the gene luciferase Photinus pyralis, transformed their sugar beet and analyzed the response to fungal infection.

For the transformation of plants used binary vectors 2×S 2×D-luc-kan, 2×W2-2×D-luc-kan, and 2×Gst1-2×D-luc-kan. Binary vectors were transformed strain of Agrobacterium tumefaciens C58C1 with the resident plasmid pGV2260 way direct DNA transformation (An, 1987). Selection of recombinant clones of A. tumefaciens was performed using the antibiotic kanamycin (50 mg/l).

Transformation of sugar beet was carried out according to Lindsay and others (Lindsey et al., 1991) with the use of the antibiotic kanamycin. Transgenetic plants was verified by PCR. The primers GTGGAGAGGCTATTCGGTA and CCACCATGATATTCGGCAAG led to the ampli the paths of DNA fragment size 553 base pairs (BP) of the gene nptII. PCR was performed using 10 ng of genomic DNA concentration of 0.2 μm primers when the annealing temperature 55°C in multicyclone PTC-200 (MJ Research, Watertown, USA).

For analysis of the ability of the promoter to be induced by pathogens of sugar beet infitsirovali Cercospora beticola, the causative agent of leaf spot of sugar beet in vitro. In each case, 4 plants of each transgenic line was immersed in a suspension of fragments of mycelium of C. beticola (400,000 fragments/ml) and control 4 plants were immersed in the diluted vegetable juice. Infected plants and control plants were then incubated in the culture Cabinet at 25°C exposed to light for 16 hours the Infected and non-infected leaf material was taken after 1, 2, 3, 4, and 6-7 days after inoculation and determined the activity of a gene-reporter luciferase using the Luciferase Assay System (Promega, Mannheim, Germany), as described above.

Promoter 2×S 2×D, as well as the promoter 2×W2-2×D, showed a rapid and strong ability to be induced by pathogens at an early stage of infection, differing among themselves only in the basic activity and the strength of the promoter (Fig-13). Promoter 2×S 2×D in the case of transgenic lines PR39/11, PR39/48 and PR39/49 were induced very quickly - induction was 11-59 times stronger already on day 1 after vaccination and in 21-380 times stronger on day 2 compared with uninfected plants (Fig). While in the 1-iden noted germination hyphae of fungi on the epidermis, on the 2nd day was the penetration into the leaf through the stroma and then penetration into the leaf tissues. At the late stage of infection at day 7 was found induction of the promoter in 113-792 times stronger when visible necrosis. The basic activity of promoter 2×S 2×D, measured as the activity of a gene-reporter uninfected plants, very weak, and it is only 1-10 times the value of luciferase activity in nereshennyh plants.

Activation of promoter 2×W2-2×D runs a bit slower compared to activation of promoter 2×S 2×D. on the first day of infection, the promoter 2×W2-2×D manifests in 2-17 times stronger induction in response to pathogens, on the second day of infection - 5-56 time. When the manifestation of necrosis on day 7 induction in response to pathogen reaches the maximum value in 318-672 units (Fig). The basic activity of 2×W2-2×D promoter, measured as the activity of a gene-reporter at nereshennyh plants, 10-50 times higher than in the case of 2×S 2×D promoter. 2×W2-2×D promoter is also distinctly different from the 2×S 2×D promoter, being about 10 times stronger.

Optimization of the properties of the promoter by changing the number of CIS-elements

Properties of synthetic promoter type n×S m×D n×W2-m×D and n×Gst1-m×D with n=1, 2, 3, 4, 5, 6, 7, 8, 9, 10 and m=1, 2, 3, 4, 5, 6, 7, 8, 9, 10 modulated and optimized by varying the number of CIS-elements in accordance with the needs of the awns of gene expression. This is shown, for example, promoters of type n×S m×D. Next to the binary vector 2×S 2×D-luc-kan was built binary vectors of 4×S-2×D-luc-kan, 2×S 4×D-luc-kan, and 4×S 4×D-luc-kan and transformed their sugar beets. Transgenic plants infected C. beticola, as described, and daily measured the activity of a gene-reporter after the introduction of the fungus. The measurement results for the 13 independent 2×S 2×D-luc lines 14 independent 4×S-2×D-luc lines, 15 independent 2×S 4×D-luc lines, and 15 independent 4×S 4×D-luc lines averaged and compared the average values of the strength of promoter induction by pathogens and basic activity.

Comparison of properties of promoter 2×S 2×D options 2×S 4×D 4×S 2×D 4×S 4×D) showed that the average strength of the promoter using tetramers compared to the promoter, constructed of trimers increases (Fig). Moreover, in the range dimer-dimer promoter (2×S 2×D), the tetramer-dimer, dimer, tetramer promoters (4×S 2×D 4×S 2×D) and the tetramer-tetramer promoter (4×S 4×D) increases the ability to be induced by pathogens in all time points of measurement (table 1).

Table 1
The ability to coil pathogens promoters 2×S 2×D 4×S 2×D, 2×S 4×D 4×S 4×D in transgenic sugar beet after infection with Cercospora beticola
The promoter (the number of independent transformants)1 dayday 23 dayday 4
2×S 2×D (13 lines)1,93,62759
4×S 2×D (14 lines)3,14,852135
2×S 4×D (15 lines)1,49,25487
4×S 4×D (15 lines)2,99,89093

Here presents the average value of induction by pathogen for 13-15 independent transformants (lines) in the promoter structure in 1-4 days after vaccination.

In parallel with the increasing strength of the promoter and the ability to coil pathogens increased baseline activity of promoters containing tetramer (PL. 2).

Table 2
The basic activity of promoters 2×S 2×D 4×S 2×D, 2×S 4×D 4×S 4×D in leaves of transgenic sugar beet
The promoter (the number of independent transformants)1 dayday 23 dayday 4
2×S 2×D (13 lines)the 4.75,55,22,6
4×S 2×D (14 lines)14,2217,811
2×S 4×D (15 lines)24,613,3722,3
4×S 4×D (15 lines)35,520,36,320

Here presents the average value of the underlying activity 13-15 independent transformants (lines) in the promoter construct, which was measured as uninfected controls during the four-day experiment to infection. Basic activity showed a relative activity value of the gene-reporter transgenic plant is in comparison with the non-specific background activity nereshennyh plants.

This example showed that, using the concept of the important properties of the promoter, such as the strength of the promoter, the ability of the coil pathogens and basic activity, which is regulated by a number of CIS-elements for the appropriate technical implementation can be made optimal promoters. The optimal number of CIS-elements induced by pathogens promoters in the studied examples given abilities to the induction by pathogens more than the solution of dimers described by Rushton and others, 2002 (Rushton et al., 2002).

Getting sugar beet resistant to fungi, using the transformation induced pathogen resistance genes

To enhance resistance to mushrooms sugar beet promoters 2×S 2×D 2×W2-2×D combined respectively with each of the four R genes BvKWS3_123, BvKWS3_133, BvKWS3_135 and BvKWS3_165 and transformed their sugar beets. For this binary vectors 2×S 2×D-luc-kan, and 2×W2-2×D-luc-kan size and 13959 13969 BP cut with Sacl and location of the incision was filled with treatment T4-DNA polymerase. Then the vectors Xhol cut, were separated by electrophoresis and the vector size and 12284 12294 was separated from the gene luciferase size 1675 BP and chose them.

The selection of resistance genes in sugar beet was obtained from the vectors p70S-BvKWS3_123, p70S-BvKWS3_133, p70S-BvKWS3_135 and p70S-BvKWS3_165. For this purpose, the first vectors on the Lali linear with Notl and the cutting position filled by processing the fragment maple. Then the vectors Xhol cut and insulated R-genes. The resulting vectors were marked 2×S 2×D-BvKWS3_123, 2×S 2×D-BvKWS3_133, 2×S 2×D-BvKWS3_135 and 2×S 2×D-BvKWS3_165 and 2×W2-2×D-BvKWS3_123, 2×W2-2×D-BvKWS3J33, 2×W2-2×D-BvKWS3_135 and 2×W2-2×D-BvKWS3_J65 (Fig-18). Binary vectors were used to produce transgenic sugar beet, as described above.

Identification of sugar beet resistant to fungi, using tests of resistance to fungus-parasite Cercospora beticola

Increased resistance to fungi plants was observed after the test of resistance to fungi, as described in the example, to check the stability of sugar beet to Cercospora beticola.

To infect sugar beet pathogen of leaf spots of C. beticola in the greenhouse next to transgenic plants planted sugar beets with genotype 3DC4156 used for transformation. 2 weeks before the planned inoculation tablets with vegetable juice (40% vegetable juice Albani) was inoculable aggressive isolate Ahlburg C. beticola and incubated at 25°C. Immediately prior to inoculation of the agar, overgrown mushrooms, scraped with slides and a small amount of water. The concentration of fragments of mycelium and fungal spores was determined using a counting chamber. The density of the pathogen was brought to a concentration of 20,000 fragments/ml, and diluting with water. For infection 10-12 week plants the tops dipped in 5 l jars, filled with the pathogen. In each study line was inoculable 30 plants and the plants were placed in a greenhouse at random.

After inoculation the plants were incubated in the greenhouse for 4 days at 28°C and 95% humidity. After 4 days, the humidity was reduced to 60%-70%. After two, three and four weeks after vaccination defeat leaves was evaluated optically using debatible evaluation scheme of the company Kleinwanzlebener Saatchi (Kleinwanzlebener Saatzucht (KWS)) (1970) (1 = healthy leaves, 9 = 100% damaged leaves). Transgenic lines transformed by one of the structures 2×S 2×D-BvKWS3_123, 2×S 2×D-BvKWS3_133, 2×S 2×D-BvKWS3_165, 2×W2-2×D-BvKWS3_123, 2×W2-2×D-BvKWS3_133, 2×W2-2×D-BvKWS3_135 or 2×W2-2×D-BvKWS3_165, showed increased resistance to fungi (table. 3) compared to control.

Table 3
Improving the sustainability of transgenic sugar beet to the fungus-parasite Cercospora beticola
Control (not transgenic)Transgenic line, marking the line T31Design
T31AUDPC2AUDPC2
6,0 220PR68-6 4,6 1692×S 2×D-BvKWS3-133
6,8 193PR74-73 6,1 1572×S 2×D-BvKWS3-123
4,1 167PR75-8 2,8 1322×S 2×D-BvKWS3-165
6,0 220PR69-15 5,3 1772×W2-2×D-BvKWS3-133
7,0 226PR70-32 5,5 1822×W2-2×D-BvKWS3-123
6,8 193PR77-42 5,6 1552×W2-2×D-BvKWS3-1335
6,8 229PR71-5,6 41 1822×W2-2×D-BvKWS3-163
1The third and final estimate of checking the stability (1 = healthy, 9 = 100% diseased leaf surface)
2AUDPC (area under disease progress curve - area under the curve of the progress of the disease) was calculated for the three assessment points (T1-T3). The AUDPC value allows to represent the changing forces of destruction in several time of evaluation points in a single index.

Analysis of the development in time of defeat in transformed PR68-6 and PR70-32 3-x t is the customs showed in the process of testing the difference in the development of lesions between control and transgenic line increases (Fig and 20). These results show that induced expression of different R-genes in sugar beet using pathogenspecific promoters leads to increased resistance to fungi.

Obtaining plants resistant to fungi, using the transformation N-terminal regions of R-genes under the control pathogenically promoters

To obtain plants resistant to fungi, using N-terminal segments of R-genes, shortened R-genes 13033_#159, 135_#147, 165_#175 and Bv12069 combined with promoters 2×S 2×D 2×W2-2×D, and transformed their sugar beets.

For this binary vectors 2×S 2×D-luc-kan, and 2×W2-2×D-luc-kan size and 13959 13969 BP cut Sacl and filled the cut parts using T4-processing DNA polymerase. Then the vectors Xhol cut, separated by gel electrophoresis and separated and insulated vectors of size 12284 and 12294 BP from gene luciferase size 1675 BP

The allocation of shortened R-genes was obtained from the vectors p70S-12069, p70S-13033_#159, p70S-135_#147 and p70S-165_#175. The vectors are then made linear using Xbal, the cutting position filled by processing the fragment maple and then cut vectors using Xhol. Selected fragments of R-genes are then cloned into the prepared binary vectors. POPs the data vectors contained the label 2×S 2×D-12069, 2×S 2×D-13033_#159, 2×S 2×D-135_#147, 2×S 2×D-165_#175 and 2×W2-2×D-12069, 2×W2-2×D-13033_#159, 2×W2-2×D-135_#147, 2×W2-2×D-165_#175 (Fig-22). Binary vectors were transformed sugar beet as it was described, and resistant to fungi plants identified using tests for resistance to Cercospora beticola.

Sources of information

Altschul, S.F. et al. (1990). Basic Local Alignment search tool, J.Mol. Biol. 215: 403-410.

An, G. (1987). Binary Ti vectors for plant transformation and promoter analysis. Methods Enzymol. 153, 292-305.

Bairoch et al., (1996). The PROSITE database, its status in 1995. Nucleic Acids Res 24:189-96.

Ballavora A., Ercolana M.R., Weiss j, Meksem K, Bormann that offers, Oberhagemann p, Salamini f, Gebhardt C (2002). The Rl gene for potato resistance to late blight (Phytophthora infestans) belongs to the leucine zipper/NBS/LRR class of plant resistance genes. Plant J.30(3):361-71.

Bendahmane, A., Famham G., Moffett, P., and Baulcombe, D.C. (2002). Constitutive gain-of-runction mutants in a nucleotide binding site-leucine rich repeat protein encoded at the Rx locus of potato. Plant J. Oct; 32(2):195-204.

Frost D., Way, H., Howles, P., J. Luck, Manners J., Hardham, A., Finnegan J., and Ellis, J. (2004). Tobacco transgenic for the flax rust resistance gene L expresses an allele-specific activation of defense responses. Mol Plant Microbe Interact. 17(2):224-32.

Hennig, J., Dewey, R.E., Cutt, J.R, and Klessig, D.F. (1993). Pathogen, salicylic acid and developmental dependent expression of a beta-1,3-glucanase/GUS gene fusion in transgenic tobacco plants. Plant J. 4(3):481-93.

Howles, P., Lawrence G., Finnegan J., McFadden, H., Ayliffe, M., Dodds, D., and Ellis, J. (2005). Autoactive Alleles of the Flax L6 Rust Resistance Gene Induce Non-Race-Specific Rust Resistance Associated with the Hypersensitive Response. Mol Plant Microbe Interact 18(6):570-582.

Huang, S., an der Vossen E.A., H. Kuang, Vlesshouwers V.G., Zhang n, Borm, T.J., van Eck HJ., Baker C., Jacobsen E., and Visser, R.G. (2005). Comparative genomics enabled the isolation of the R3a late blight resistance gene in potato. Plant J. 2(2):251-61.

Lindsey, K., Gallois, P., and Eady, C. (1991). Regeneration and transformation of sugar beet by Agrobacterium tumefaciens. Plant Tissue Culture Manual B7:1-13; Kluwer Academic Publishers.

Lupas, A., Van Dyke, M., and Stock, J. (1991) Predicting coiled coils from protein sequences. Science 252:1162-4.

Martin, G. C., Bogdanove, A. J., and Sessa, G. (2003). Understanding the functions of plant disease resistance proteins. Annu. Rev. Plant Biol. 54:23-61.

Martini, N., Egen, M., Rüntz, I., and Strittmatter, G. (1993). Promoter sequences of a potato pathogenesis-related gene mediate transcriptional activation selectively upon fungal infection. Mol Gen Genet 236:179-186.

Oldroyd, G. E. D., and. Staskawicz, B. J. (1998). Genetically engineered broad-spectrum disease resistance in tomato. Proc Natl Acad Sei USA. 95(17):10300-10305.

Rushton, P. J., Reinstadler, A., Lipka V, Lippok Century, Somssich I.E. (2002). Synthetic plant promoters containing defined regulatory elements provide novel insights into pathogen-and wound-induced signaling. Plant Cell 14(4):749-62.

Samac, D. A. and Shah, D.M. (1991). Developmental and Pathogen-Induced Activation of the Arabidopsis Acidic Chitinase Promoter. Plant Cell. 3(10):1063-1072.

Schmidt K., Heberle Century, Kurrasch J., Nehls R., and Stahl, D. J. (2004). Suppression of phenylalanine ammonia lyase expression in sugar beet by the fungal pathogen Cercospora beticola is mediated at the core promoter of the gene. Plant Mol. Biol., 55: 835-852.

Sonnhammer, E. L, Eddy, S. R., and Durbin, R. D. (1997) Pfam: A comprehensive database of protein domain families based on seed alignments. Proteins 28:405-20.

Tang X., Xie M., Kirn Y.J., Zhou J., Klessig D.F., Martin G.B. (1999). Overexpression of Pto activates defense responses and confers broad resistance. Plant Cell 11(1):15-29.

Tian Y., Fan L, Thurau T., Jung C, and D. Cai (2004). The absence of TIR-type resistance gene analogues in the sugar beet (Beta vulgaris L.) genome. J. Mol. Evol. 58(1):40-53.

Traut, T. W. (1994). The functions and consensus motifs of nine types of peptide segments that form different types of nucleotide binding Sites. Eur. J. Biochem. 222:9-19.

1. Autoantibodies protein stability for the development of pathogen resistance in plants, characterized in that it encodes a nucleic acid comprising a limited section of the NBS-LRR-resistance gene, which extends from the 5'-end coding region of NBS-LRR-resistance gene in the direction 5'-3' before NBS domain of NBS-LRR-resistance gene, but not including the P-loop, and NBS-LRR-resistance gene is not TIR-NBS-LRR-resistance gene.

2. Autoantibodies protein stability according to claim 1, comprising the amino acid sequence motif sequence DAE.

3. Autoantibodies protein stability according to claim 1, comprising the amino acid sequence motif sequence AVLXDAE.

4. Autoantibodies protein stability according to claim 1, wherein the nucleic acid comprises a nucleotide sequence selected from the following groups:
a) the nucleotide sequence according to SEQ ID NO:1 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:1 or a nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO:1 or a nucleotide sequence complementary to the nucleotide pic is egovernance in accordance with SEQ ID NO:1;
b) the nucleotide sequence according to SEQ ID NO:2 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:2, or a nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO:2 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:2;
C) the nucleotide sequence according to SEQ ID NO:3 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:3, or a nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO:3 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:3;
g) a nucleotide sequence in accordance with SEQ ID NO:4 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:4, or a nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO:4 go with a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:4;
d) the nucleotide sequence in the accordance with SEQ ID NO:16 or a nucleotide sequence, complementary to the nucleotide sequence according to SEQ ID NO:16, or the nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO:16 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:16.

5. Autoantibodies protein stability according to claim 1, characterized in that the resistance gene NBS-LRR is a gene resistance in sugar beet or potatoes.

6. Autoantibodies protein stability according to claim 1, comprising the amino acid sequence selected from the following groups:
a) SEQ ID NO:13
b) SEQ ID NO:14
B) SEQ ID NO:15

7. Transgenic plant comprising autoantibodies protein stability according to any one of claims 1 to 6.

8. Part of the transgenic plants, including autoantibodies protein stability according to any one of claims 1 to 6.

9. The seed or planting material of transgenic plants, including autoantibodies protein stability according to any one of claims 1 to 6.

10. Method for producing transgenic plants with increased resistance to pathogens, as well as transgenic seed or transgenic seed of such plant which is used nucleic acid, where the nucleic acid includes a limited section of the NBS-LRR-resistance gene, which extends from the 5'-end of oderwise the field of NBS-LRR-resistance gene in the direction 5'-3' before NBS domain of NBS-LRR-resistance gene, but not including the P-loop, and NBS-LRR-resistance gene is not TIR-NBS-LRR-resistance gene.

11. The method according to claim 10, wherein the nucleic acid encodes the amino acid sequence motif sequence DAE.

12. The method according to claim 10, wherein the nucleic acid encodes the amino acid sequence motif sequence AVLXDAE.

13. The method according to claim 10, wherein the nucleic acid comprises a nucleotide sequence selected from the following groups:
a) the nucleotide sequence according to SEQ ID NO:1 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:1 or a nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO:1 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:1;
b) the nucleotide sequence according to SEQ ID NO:2 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:2, or a nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO:2 or a nucleotide sequence complementary nucleotide the th sequence in accordance with SEQ ID NO:2;
C) the nucleotide sequence according to SEQ ID NO:3 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:3, or a nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO:3 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:3,
g) a nucleotide sequence in accordance with SEQ ID NO:4 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:4, or a nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO:4 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:4;
d) the nucleotide sequence according to SEQ ID NO:16 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:16, or the nucleotide sequence that can be hybridized with nucleotide sequence in accordance with SEQ ID NO:16 or a nucleotide sequence complementary to the nucleotide sequence according to SEQ ID NO:16.

14. The method according to claim 10, characterized in that is that the resistance gene NBS-LRR is a gene resistance in sugar beet or potatoes.

15. The method according to claim 10, wherein the nucleic acid encodes the amino acid sequence selected from the following groups:
a) SEQ ID NO:13
b) SEQ ID NO: 14
C) SEQ ID NO: 15

16. The method according to claim 10, characterized in that the applied design
nucleic acids, including
a) a promoter induced by pathogens, as well as
b) nucleic acid according to any one of p-15, controlled by the promoter.

17. The method according to item 16, wherein the pathogen-inducible promoter is a synthetic promoter.

18. The method according to 17, characterized in that the synthetic promoter includes one or more than one following combination of CIS-elements, where n and m are a natural number from 1 to 10:
a) n×S m×D-box
b) n×W2-m×D-box
in) n×Gstl-m×D-box

19. The way in. 18, characterized in that the combination of CIS-elements include:
a) the nucleotide sequence SEQ ID NO:10, or
b) a nucleotide sequence SEQ ID NO:11, or
C) a nucleotide sequence SEQ ID NO:12.



 

Same patents:

FIELD: agriculture.

SUBSTANCE: in plant expression is increased for at least one protein Bax inhibitor - 1 (BI1) in at least one vegetable tissue. At the same time expression in leaves epidermis is left mainly invariable. Plants are transformed by recombinant expression cassettes and vectors, which include sequence of nucleic acids that codes BI-protein under control of tissue-specific promoter, which mainly does not have activity in epidermis of leaves.

EFFECT: transformation provides for arrangement or improvement of resistance to at least one biotic or abiotic stress factor in plants, preferably to vegetable pathogens.

13 cl, 16 dwg, 7 tbl, 8 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and is a method of growing transgenic carrot plants, which produce human intereleukin-10. Recombinant plasmid DNA pBi101-IL10 is constructed, which codes synthesis of human interleukin-10, and transfers it to the Agrobacterium strain. Tylosis is obtained, which is induced from mature embryos of carrot seeds using agarised culture medium MS, which contains 0.2 mg/l 2,4-D and 0.2 mg/l kinetin. Agrobacterial transformation of tylosis with pBi101-IL10 construction is carried out, obtaining transgenic explants. The obtained explants are cultured for inducing kanamycin-resistant tylosis using culture medium MS, containing 0.2 mg/l 2,4-D, 0.2 mg/l kinetin, 100 mg/l kanamycin and 500 mg/l cefotaxime. The formed embryoids are transferred for regeneration of plants on paper bridges in test-tubes using liquid medium MS, containing 100 mg/l kanamycin, 500 mg/l cefotaxime with subsequent growing of regenerated plants in nursery conditions.

EFFECT: method allows for simple and cheap growing transgenic carrot plants, which produce human interleukin-10.

4 dwg, 3 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: expression of endogeneous reserve proteins in plant seeds is suppressed through transformation of plant cells using a genetic construct, which contains a seed-specific promoter, functionally linked with a DNA sequence which codes transcription factors of endogenous genes or part of these factors, including their different combinations. The transcribed target of the said sequence is capable of suppressing, slowing down or in some other way, lowering expression of reserve proteins of seeds in a plant cell. Further, this or another plant cell is transformed by the construct, which contains the same seed-specific promoter, functionally linked with the DNA sequence which codes the heterologous polypeptide of concern.

EFFECT: in a plant regenerated from the said cell, expression of endogenous mRNA is reduced, which enables accumulation of heterologous polypeptide in that plant.

25 cl, 5 dwg, 7 ex

FIELD: agriculture.

SUBSTANCE: into plant or its part it is introduced nucleic acid, which encodes product, capable to support plant of family Solanaceae and its posterity by stability against injury by oomycetes fungus Phytophthora infestans.

EFFECT: ability to potato and tomato kinds steady against buck eye rot.

28 cl, 26 dwg, 4 tbl, 7 ex

FIELD: genetic engineering.

SUBSTANCE: invention can be used in corn selection in creating new sorts and hybrids by means of genetic engendering, in works on insertional mutagenesis, separating and cloning of corn genes. Generative organs of corn are processed with suspension of cells of strain Agrobacterium tumefaciens with activated vir-genes. As generative organs, blooming female gametophyte is used. Before processing said suspension is mixed with substances inert with respect to strain cells and characterised by osmotic potential exceeding osmotic potential of suspension for obtaining isotonic solution. As such substances sucrose and/or glycerin are used. After procession with suspension generative organs are pollinated with pollen of fertile plants. In gametophyte pistil filaments are used, which are cut at height of 1-2 cm from corncob before processing with suspension. Processing is carried out by means of pipette into the depth of cut part of pistil filaments. Pollination is performed with pollen preliminary collected into packet, which is applied onto cut of pistil filaments with fingers or shaken onto it.

EFFECT: method allows to reduce term of obtaining transgenic corn plant and increase yield of final product, preserving high obtaining frequency.

5 cl, 1 dwg

FIELD: biology.

SUBSTANCE: plant cell is transformed by exogenous polynucleotide, expression of which provides cell with enhanced tolerance to abiotic stress, with further cultivation of grown plant from the cell. Transformation is performed by introduction of construction with constitutive or abiotic stress-induced promoter to the cell. Either the plant is infected by avirulent virus including indicated exogenous polynucleotide which, when expressed in plant, provides plant with tolerance to abiotic stress.

EFFECT: resistance to abiotic stress, such as soil salinity, water deficiency, low or high temperature etc.

37 cl, 7 dwg, 6 tbl, 8 ex

FIELD: medicine; biology.

SUBSTANCE: plant cell is transformed by DNA encoding 3Rmyb plant proteins, or RNA suppressing 3Rmyb protein expression. 3Rmyb plant protein is a factor activating transcription specific to G2/M phase, i.e. factor necessary for plant cell growth.

EFFECT: hypertrophy of specific plant organ, male sterility or stress resistance.

12 cl, 33 dwg, 26 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to novel RacB cDNA sequences obtained from barley, as well as to expression cassettes and vectors, which contain these promoter sequences. Plant transformation with these expression cassettes and vectors permits to obtain transgenic plants with enhanced pathogene immunity due to reduced expression of RacB protein or functional equivalent thereof.

EFFECT: production of transgenic plants with enhanced pathogene immunity due to reduced expression of RacB protein or functional equivalent thereof.

23 cl, 8 dwg, 7 tbl, 12 ex

FIELD: chemistry, biochemistry.

SUBSTANCE: plants are transformed with composition with nucleotide sequence including tissue- or organ-specific signs regulating transcription during chosen morphogenesis stages. Signs are linked with chimeric nucleotide sequence not having own stop codon and containing on its C-terminal end codons, coding chosen number and combination of amino-acid residues. Chimeric nucleotide sequence provides directional expression of specific vegetative carrier protein with stable amino acid chain extension. Stability of composition is determined using cell-free system in vitro applying codon cartridges with chosen combination and number of codons.

EFFECT: provided increased content of amino acids in plant tissues particularly, in membranes of seed oil corpuscles and cellular walls thus providing food and fodder compositions.

49 cl, 20 dwg, 3 tbl, 28 ex

FIELD: agriculture.

SUBSTANCE: plant seeds are treated with ethylmethanesulphonate during 16 hours, then dried or greensprouted. The resulting plants M1 are self-pollinated and their seeds are obtained, which are used for growing the M2 wheat plants. The M2 plants are treated with imazamox, and plants with higher resistance to that as compared to the wild type plants are selected. The other version implies the transformation of plants with an expression vector containing one or more nucleic acids IMI.

EFFECT: higher resistance of plants to imidazolinone and possibility to use them when controlling weeds using herbicide.

44 cl, 8 dwg, 4 ex

FIELD: biotechnologies.

SUBSTANCE: this invention is related to the field of biotechnology and may be used in production of various protein products with the help of recombinant DNA technology. New sequences of DNA are defined and generated, which are related to matrix attachment region, which are characterised by ability to improve producing of protein in eukaryotic cells.

EFFECT: methods are suggested for transfection of eukaryotic master cells, including new method of multiple transfection, based on use of active sequenes of DNA MAR according to invention and providing for substantial increase of recombinant protein expression level compared to similar cells transfected by traditional methods.

11 cl, 21 dwg, 9 tbl, 17 ex

FIELD: agriculture.

SUBSTANCE: double-null line-fertility restorer Brassica napus is obtained for the cytoplasmic male sterility (CMS) Ogura, which is a radish introgression carrying a gene-fertility restorer Rfo cut out of the radish allele Pgi-2 and exchanged with gene Pgi-2 from Brassica oleracea characterised by female fertility, a good transport level of Rfo and a high vegetative capacity. In order to characterise the obtained line-fertility restorer a combination of markers PGIol, PGIUNT, PGIint, BolJon and CP418 is used.

EFFECT: line is distinguished by a good agricultural quality.

7 cl, 24 dwg, 3 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: expression of endogeneous reserve proteins in plant seeds is suppressed through transformation of plant cells using a genetic construct, which contains a seed-specific promoter, functionally linked with a DNA sequence which codes transcription factors of endogenous genes or part of these factors, including their different combinations. The transcribed target of the said sequence is capable of suppressing, slowing down or in some other way, lowering expression of reserve proteins of seeds in a plant cell. Further, this or another plant cell is transformed by the construct, which contains the same seed-specific promoter, functionally linked with the DNA sequence which codes the heterologous polypeptide of concern.

EFFECT: in a plant regenerated from the said cell, expression of endogenous mRNA is reduced, which enables accumulation of heterologous polypeptide in that plant.

25 cl, 5 dwg, 7 ex

FIELD: medicine.

SUBSTANCE: there is provided DNA that codes protein able to transform a compound of formula (II) specified in description of invention into a compound of formula (III) specified in description of invention with an electron transport system containing an electron donor. Protein is able to metabolise herbicides.

EFFECT: introduction of DNA to plants with an expression of the specified protein provides herbicide resistance thereto.

26 cl, 66 dwg, 35 tbl, 75 ex

FIELD: medicine.

SUBSTANCE: method involves deactivation of definite VGC2 DNA sequence of Salmonella typhimurium positioned between ydhE and pykF genes or its part containing at least 50 nucleotides, or the DNA version of at least 85% identity, representing VGC2 DNA of any microbe out of Salmonella aberdeen, Salmonella gallinarum, Salmonella cubana and Salmonella typhi.

EFFECT: obtainment of microbe with reduced adaptability to specific environmental conditions.

6 cl, 12 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: according to the invention there is provided method of person's treatment in case of risk or made diagnosis of autoimmune disease or transplantate rejection, including antagonist GITR injection into the person, where antagonist prevents binding GITRL with GITR on excitatory T-cells. There is provided method of cell population proliferation inhibition, containing excitatory T-cells, including injection of antagonist GITR into the cell population, where antagonist prevents binding GITRL with GITR on excitatory T-cells. There is proposed the method of cell population suppression, containing excitatory T-cells, in the presence of CD4+ CD25+ suppressor cells, including injection of antagonist GITR into the cell population, where antagonist GITR prevents binding GITRL with GITR on excitatory T-cells. There is provided pharmaceutical composition, containing antagonist GITR and pharmaceutically acceptable carrier for autoimmune disorder treatment, inflammatory diseases and transplantate rejection, where antagonist GITR prevents binding GITRL with GITR on excitatory T-cells.

EFFECT: invention can be applied for treatment of disorders, appearing in the result of disarranged immune reactions.

16 cl, 33 dwg, 3 tbl, 16 ex

FIELD: chemistry, biochemistry.

SUBSTANCE: invention relates to biotechnology and concerns protein of protease NS3/4A HCV or its biologically active fragment, which contains succession, in which residue of amino acid, corresponding to amino acid 156 of protease NS3/4A HCV of wild type, is not the residue of alanine and, not obligatorily, residue of amino acid, which corresponds to aminocacid 168 of protease NS3/4A HCV of wild type, is not asparaginic acid. Invention also relates to polynucleotide, coding said protein, as well as application of said protein in detection of HCV presence in biological sample, as well as in method of determination if the infection, mediated by HCV, in patient is resistant to medication against HCV, in estimation method, if the infected by HCV patient has lower sensitivity or susceptibility to VX-950, as well as in method of candidate examination for inhibitor or potential inhibitor of HCV.

EFFECT: expansion of arsenal of medications for HCV treatment.

68 cl, 17 dwg, 6 tbl, 13 ex

FIELD: biotechnologies.

SUBSTANCE: invention relates to biotechnology and represents method of obtaining L-amino acid using bacteria of genus Escherichia, bacterium being modified in such way that activity of alkoholdehydrogenase, coded by gene adhE, is enhanced in said bacterium.

EFFECT: invention allows to obtain L-amino acids with high degree of efficiency.

19 cl, 5 dwg, 4 tbl, 20 ex

FIELD: medicine.

SUBSTANCE: invention concerns identification of non-peptide inhibitors of cathepsine G. The given substances immediately inhibit biological functions of the target protein. The cathepsine G-inhibiting aptamers consist of linear DNA-sequences or polynucleotide sequences which have length of a chain at least of 60 nucleotides and not subjected to effective pairing of the bases.

EFFECT: offered aptamers are characterised by high selectivity and can be used at treatment and preventive maintenance of inflammatory processes and procoagulant conditions.

7 cl, 3 dwg, 1 tbl

FIELD: biology.

SUBSTANCE: present invention pertains to biotechnology and is a mutant acetolactase synthase of bacteria (AHAS I), in which L-amino acid in positions 17, 30 and/or 33 in a small subunit of natural acetolactase synthase from Escherichia coli is substituted with another L-amino acid or several L-amino acids are integrated in the said position(s), and feedback inhibition with valine in the given subunit is weak. The invention also relates to a DNA fragment, encoding the acetolactase synthase, which is used to transform Escherichia bacteria so as to obtain branched L-amino acid.

EFFECT: invention allows for obtaining branched L-amino acid with high level of efficiency.

17 cl, 8 dwg, 5 tbl, 8 ex

FIELD: agriculture.

SUBSTANCE: in plant expression is increased for at least one protein Bax inhibitor - 1 (BI1) in at least one vegetable tissue. At the same time expression in leaves epidermis is left mainly invariable. Plants are transformed by recombinant expression cassettes and vectors, which include sequence of nucleic acids that codes BI-protein under control of tissue-specific promoter, which mainly does not have activity in epidermis of leaves.

EFFECT: transformation provides for arrangement or improvement of resistance to at least one biotic or abiotic stress factor in plants, preferably to vegetable pathogens.

13 cl, 16 dwg, 7 tbl, 8 ex

Up!