New composition and methods for therapy of immnune-associated diseases with immunity

FIELD: medicine.

SUBSTANCE: invention refers to antibody specifically getting bound with PRO87299 version. In addition, the antibody according to the invention has ability to block interaction HVEM and PRO87299 and to function as PRO87299 agonist. The antibody of agonist nature is produced by hybridoma Btig5F5.1 or Btig3B1.9. For the antibody, there is established amino acid sequence given in the description. The invention discloses the methods of using the antibodies to stimulate or reduction of immune response in immune-associated diseases connected, to relieve lymphoma, and inflammatory disease in requiring mammal, to detect polypeptide PRO87299 in a sample and to manage rejection of grafted cells.

EFFECT: antibody is an immunomodulator that allows applying therapeutically identical medicinal agents both to intensify and reduce immune response.

16 cl, 34 dwg, 7 tbl, 20 ex

 

The scope of the invention

The present invention relates to compositions and methods applicable to the diagnosis and treatment of immune-related diseases.

Background of the invention

Associated with immune and inflammatory diseases are a manifestation or consequence of quite complicated, often repeatedly interconnected biological pathways, which in normal physiology are critical to answer the lesion or injury, initiate recovery after injury or trauma and install innate and acquired defense against foreign organisms. Disease or pathology arise when these normal physiological pathways cause additional damage or injury either directly related to the intensity of the response, either as a result of abnormal regulation or excessive stimulation or in response to, or as a combination of these mechanisms.

Although the occurrence of these diseases often involves multi-path, and often many different biological systems/pathways, intervention at critical points in one or more of these pathways can cause or improve therapeutic effect. Therapeutic intervention can occur through antagonism malicious process/path or through the incentive is acii favorable process/path.

There are many immune-related diseases, and their study intensively. Such diseases include immune inflammatory diseases, nimmanoradee inflammatory diseases, infectious diseases, immunodeficiency diseases, neoplasia, etc

T-lymphocytes (T-cells) are an important component of the immune response of mammals. T cells recognize antigens associated with the molecule's own body, encoded by genes in the major histocompatibility complex (MHC). The antigen can be presented together with MHC molecules on the surface of antigen presenting cells, virus infected cells, cancer cells, transplants, etc. T-cells destroys these altered cells that represent a threat to the health of a mammal host. T-cells include helper T cells and cytotoxic T cells. Helper T-cells extensively proliferate after recognition of complex antigen-MHC on antigen presenting cells. Helper T cells also secrete a variety of cytokines, i.e. lymphokines, which play a Central role in the activation of B-cells, cytotoxic T-cells and other cells involved in immune response.

Associated with immune diseases can be treated by suppressing the immune response. The use of neutralizing anti-Christ. ate, inhibitory molecules having immunostimulatory activity, it would be advantageous in the treatment of immunopositive and inflammatory diseases. You can use molecules that suppress the immune response (proteins directly or indirectly using antibody-agonists) to suppress the immune response and, thus, facilitate immunopositive disease.

It is known that CD4+ T cells are important regulators of inflammation. Here activated CD4+ T cells and analyzed the profile of genes differentially expressed during activation. Actually-specific activation of genes may represent a potential therapeutic target. Costimulate in vivo necessary for productive immunoproliferative answer. The list of co-stimulating molecules are very large, and still not even clear what kind of co-stimulating molecules play critical roles in various types and stages of inflammation.

The term inflammatory bowel disease ("IBD") refers to a group of chronic inflammatory disorders with unknown reasons under which the gut (digestive tract becomes inflamed, often causing cramping or diarrhea. The distribution of IBD in the United States appreciate constituting approximately 200 per 100,000 population. Patients with IBD can be divided into two main groups who: patients with ulcerative colitis ("UC") and patients with Crohn's disease ("CD").

In patients with UC is an inflammatory reaction, initially involving the mucous membrane of the colon. Inflammation, as a rule, is uniform and continuous, without any intervening areas of normal mucosa. Superficial cells of the mucosa, as well as the crypt epithelium and submucosal membrane, involved in the inflammatory response with infiltration of neutrophils. Ultimately, this situation usually progresses to destruction of the epithelium with loss of epithelial cells, leading to multiple ulceration, fibrosis dysplasia and longitudinal retraction of the colon.

CD differs from the UC to the fact that the inflammation extends through all layers of the intestinal wall and engages the mesentery, as well as lymph nodes. CD can affect any part of the digestive tract, from the mouth to the anus. The disease is often periodic, i.e. segments severe diseases of the intestines separated, seemingly free from the disease. In CD intestinal wall is also thicker, which can lead to obstruction. In addition, there are fistulas and fissures.

Clinically IBD is characterized by a variety of symptoms, often leading to chronic, unpredictable course. Hemorrhagic diarrhea and abdominal pain often accompanied by fever and weight loss. Frequent anemia, as the heavy exhaustion. Often with IBD associated articular manifestations, ranging from arthralgia to acute arthritis, the train and pathology of the kidney. Patients with IBD are also at increased risk of colon carcinomas compared with the General population. During acute "attacks" IBD work and other normal activity is usually impossible, and often the patient is hospitalized.

Although the cause of IBD remains unknown, involved several factors, such as genetic, infectious and immunological predisposition. IBD is most common among Europeans, especially among Europeans of Jewish origin. Chronic inflammatory nature of the condition leads to an intensive search for possible infectious causes. Although discovered agents that stimulate the acute inflammation, for none of them shows the initiation of chronic inflammation associated with IBD. The hypothesis that IBD is an autoimmune disease, is supported by the previously mentioned extraintestinal manifestation of IBD, such as arthritis of the joints, and known positive response IBD treatment such therapies as adrenal glucocorticoids, cyclosporine, and azathioprine, known as suppressing the immune response. In addition, the LCD tract more than any other organ of the body is constantly exposed to the potential antigenic substances, such as proteins from food, by-products of bacteria (LPS), etc.

In addition, the risk of colon cancer is greatly increased in patients with severe ulcerative colitis, especially if the disease has existed for several years. Approximately 20-25% of patients with IBD eventually need surgery to remove the colon due to extensive bleeding, chronic debilitating disease, perforation of the colon, or risk of cancer. Surgery is also sometimes carried out when other forms of medical treatment is ineffective or when the side effects of steroids or other drugs threaten the health of the patient. Because the surgery is invasive and significantly life-changing, it is not a very desirable treatment regimen and, as a rule, is a last resort treatment. To better understand this disease and possibly treat it, experimentally determined, regulation of a gene is increased as in CD and UC compared with normal tissue.

Despite the above progress in the study of immune disorders, there is a great need for additional diagnostic and therapeutic tools able to detect the presence of immune disorders in mammals and effectively reduce these disorders. Accordingly, the present invention is Eden who eficacia and characterization of the polypeptide, sverkhekspressiya in various immune cells involved in various immune disorders, and application of the specified polypeptide and the coding of its nucleic acid to obtain a mixture of chemically related substances, applicable in therapeutic treatment and diagnostic detection of immune disorders in mammals.

The INVENTION

A. implementation Options

The present invention relates to compositions and methods that are applicable for the diagnosis and treatment associated with immune diseases in mammals, including humans. The present invention is based on the identification of proteins (including antibodies, agonists and antagonists)that appear as a result of stimulation of the immune response in mammals. Associated with immune diseases can be treated by suppressing or enhancing the immune response. Molecules that enhance the immune response, stimulate or enhance the immune response to the antigen. Molecules that stimulate the immune response, can be used therapeutically, when increasing the immune response is favorable. Alternative molecules that suppress the immune response, weaken or reduce the immune response to an antigen (e.g., neutralizing antibodies), can be used therapeutically, when the weakening of the immune response is favorable (for example, vocale the s). Accordingly, a PRO87299 polypeptide, agonists and antagonists are also applicable to obtain drugs and medicines for the treatment of immune-related and inflammatory diseases. In a particular aspect of such drugs and medicines contain therapeutically effective amount of PRO87299 polypeptide, agonist or antagonist with a pharmaceutically acceptable carrier. Preferably the mixture is sterile.

In an additional embodiment, the invention relates to a method of identifying agonists or antagonists of PRO87299 polypeptide, including contact PRO87299 polypeptide with a molecule candidate and monitoring a biological activity mediated by the specified PRO87299 polypeptide. Preferably PRO87299 polypeptide is a natural sequence of PRO87299 polypeptide. In a particular aspect, the agonist or antagonist is a PRO87299 anti-PRO87299 antibody.

In another embodiment, the invention relates to a mixture of chemically related substances containing a PRO87299 polypeptide or antibody agonist or antagonist that binds to the polypeptide in a mixture with a carrier or excipient. In one aspect the composition comprises a therapeutically effective amount of the polypeptide or antibody. In another aspect, where the composition contains immunostim yuushuu molecule, the composition is applicable for: (a) increasing infiltration of inflammatory cells into a tissue in need thereof of a mammal, (b) stimulating or enhancing an immune response in in need thereof of a mammal, (c) increasing the proliferation of immune cells in response to antigen in need of this mammal, (d) stimulating the activity of immune cells or (e) increase vascular permeability. In an additional aspect, when the composition contains an immunosuppressive molecule, the composition is applicable for: (a) reducing infiltration of inflammatory cells into a tissue in need thereof of a mammal, (b) suppress or reduce an immune response in in need thereof of a mammal, (c) decreasing the activity of immune cells, or (d) decrease proliferation of immune cells in response to antigen in need of this mammal. In another aspect, the composition comprises an additional active ingredient, which may be, for example, the additional antibody or cytotoxic or chemotherapeutic agent. Preferably the composition is sterile.

In another embodiment, the invention relates to a method of treatment associated with immune disorders in need of this mammal, comprising administration to the mammal of an effective amount of polypeptid is and PRO87299, its agonist or antagonist. In a preferred aspect associated with the immune disorder is selected from the group consisting of: systemic lupus erythematosus, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, spondyloarthropathy, systemic sclerosis, idiopathic inflammatory myopathies, Sjogren syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, thyroiditis, diabetes mellitus, immunopositive renal disease, demyelinating diseases of the Central and peripheral nervous systems such as multiple sclerosis, idiopathic demyelinizing polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinizing polyneuropathy, hepatobiliary diseases such as infectious, autoimmune chronic active hepatitis primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis, inflammatory bowel disease, glutensensitive enteropathy, and Whipple's disease, autoimmune or immunopositive skin diseases, polymorphic erythema, and contact dermatitis, psoriasis, allergic diseases such as asthma, allergic rhinitis, atopic dermatitis, hypersensitivity to food and urticaria, immunological diseases, Legkov is, such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitive pneumonitis associated with transplantation of diseases including graft rejection and graft-versus-host.

In another embodiment, the invention relates to an antibody specifically binding with any of the above or below polypeptides. Not necessarily, the antibody is a monoclonal antibody, humanitariannet antibody, antibody fragment or single-chain antibody. In one aspect the present invention relates to the selected antibody, binding polypeptide PRO87299. In another aspect, the antibody mimicries activity of PRO87299 polypeptide (antibody agonist) or, on the contrary, the antibody inhibits or neutralizes the activity of PRO87299 polypeptide (antibody antagonist). In another aspect, the antibody is a monoclonal antibody, preferably having non-human residues complementarity determining region (CDR) and related to the human remains to the framework region (FR). The antibody may be labeled and may be immobilized on a solid substrate. In an additional aspect, the antibody is a fragment of the antibody, monoclonal antibody, single-chain antibody or antiidiotypic antibody.

In dragomiresti implement the present invention relates to compositions, contains anti-PRO87299 antibody in a mixture with a pharmaceutically acceptable carrier. In one aspect the composition comprises a therapeutically effective amount of the antibody. Preferably the composition is sterile. The composition can be introduced in the form of a liquid pharmaceutical composition, which can conserve to achieve increased stability during storage. An alternative antibody is a monoclonal antibody, antibody fragment, humanitariannet antibody or single-chain antibody.

In an additional embodiment, the invention relates to a product containing:

(a) a mixture of chemically related substances containing a PRO87299 polypeptide or agonist or antagonist;

(b) a container containing the above composition; and

(c) a label attached to the specified container, or liner in the package, contained in the specified container relating to the application of the specified PRO87299 polypeptide or agonist or antagonist in treatment-related immune diseases. The composition may contain a therapeutically effective amount of PRO87299 polypeptide or agonist or antagonist.

In another embodiment, the present invention relates to a method of diagnosis is associated with immune disease in a mammal, comprising detecting the level of the I gene expression, coding a PRO87299 polypeptide, (a) in a test sample of tissue cells obtained from the mammal, and (b) in a control sample of known normal tissue cells of the same cell type, where a higher or lower level of expression in the test sample compared to a control sample indicates the presence associated with immune disease in a mammal, which received the test tissue cells.

In another embodiment, the present invention relates to a method of diagnosing an immune disease in a mammal, comprising (a) contact anti-PRO87299 antibody with a test sample of tissue cells obtained from the mammal, and (b) detecting formation of a complex between the antibody and a PRO87299 polypeptide in the test sample; where the formation of this complex indicates the presence or absence of the specified diseases. The detection may be qualitative or quantitative and can be compared to monitoring the formation of the complex in a control sample of known normal tissue cells of the same cell type. Increased the number of complexes in the test sample indicates the presence or absence of an immune disease in a mammal, which received the test tissue cells. The antibody preferably carries amenable de is ecchi tag. The formation of complexes can be monitored, for example, by light microscopy, flow cytometry, fluorometry or other methods known in this field. The test sample is usually obtained from an individual suspected of having a deficiency or abnormality of the immune system.

In another embodiment, the invention relates to a method of determining the presence of PRO87299 polypeptide in the sample, including the impact on the test sample of cells suspected of containing a PRO87299 polypeptide, anti-PRO87299 antibody and determining binding of the indicated antibodies with the specified sample of cells. In a particular aspect, the sample contains a cell suspected of containing a PRO87299 polypeptide, and antibody binds to the cell. The antibody is preferably labeled amenable to detection label and/or associated with a solid substrate.

In another embodiment, the present invention relates to a diagnostic kit for the associated immune diseases, containing anti-PRO87299 antibody and a carrier in an appropriate package. The kit preferably contains instructions for using the antibodies for detection of the presence of PRO87299 polypeptide. Preferably the carrier is pharmaceutically acceptable.

In another embodiment, the present invention relative to the Xia to the diagnostic set, contains anti-PRO87299 antibody in an appropriate package. The kit preferably contains instructions for using the antibodies for detection of the presence of PRO87299 polypeptide.

In another embodiment, the invention relates to method of diagnosis is associated with immune disease in a mammal, comprising the detection of the presence or absence of PRO87299 polypeptide in the test sample of tissue cells obtained from the mammal, where the presence or absence of PRO87299 polypeptide in the test sample indicates the presence associated with immune disease in a specified mammal.

In another embodiment, the present invention relates to a method of identifying agonists of PRO87299 polypeptide, including:

(a) contact of the cells and test compounds to be screened under conditions suitable for the induction of a cellular response normally induced by a PRO87299 polypeptide; and

(b) determining the induction of the specified cell response to determine whether the test compound effective agonist, where the induction of the specified cell response indicates that the test compound is an effective agonist.

In another embodiment, the invention relates to a method of identifying a compound capable of ingibiruet the activity of PRO87299 polypeptide, includes contact connection candidate with a PRO87299 polypeptide in appropriate conditions and for a sufficient time to allow you to interact with these two components, and the definition ingibirovany whether the activity of PRO87299 polypeptide. In a particular aspect or connection candidate, or a PRO87299 polypeptide immobilized on a solid substrate. In another aspect neemalirovannym component has a measurable detection label. In a preferred aspect of this method involves the following stages:

(a) contact of the cells and test compounds to be screened in the presence of PRO87299 polypeptide under conditions suitable for the induction of a cellular response normally induced by a PRO87299 polypeptide; and

(b) determining the induction of the specified cell response to determine whether the test compound effective antagonist.

In another embodiment, the invention relates to a method of identifying a compound that inhibits the expression of PRO87299 polypeptide in cells normally expressing the polypeptide, where the method includes bringing the cells into contact with a test compound and determining ingibirovany whether the expression of PRO87299 polypeptide. In a preferred aspect of this method involves the following stages:

(a) contact of the cells and test compound to be screened under conditions suitable the x, to allow the expression of PRO87299 polypeptide; and

(b) determining the inhibition of the expression of the specified polypeptide.

In another embodiment, the present invention relates to a method of treatment associated with immune disorders among them suffering a mammal, comprising administration to the mammal of a nucleic acid molecule that encodes a or (a) a PRO87299 polypeptide, (b) an agonist of PRO87299 polypeptide, or (c) an antagonist of PRO87299 polypeptide, where the said agonist or antagonist may be an anti-PRO87299 antibody. In a preferred embodiment, the mammal is a human. In another preferred embodiment, the nucleic acid is administered via gene therapy ex vivo. In an additional preferred embodiment, the nucleic acid contains a vector, preferably an adenoviral, adeno-associated virus, lentivirusnyi or retroviral vector.

In another aspect the invention relates to recombinant viral particle containing the viral vector, essentially consisting of a promoter, nucleic acid encoding (a) a PRO87299 polypeptide, (b) a polypeptide agonist of PRO87299 polypeptide, or (c) a polypeptide antagonist of PRO87299 polypeptide, and a signal sequence for cellular secretion of the polypeptide, where the viral vector SV is associated with the viral structural proteins. Preferably the signal sequence refers to a mammal, such as from natural PRO87299 polypeptide.

In an additional embodiment, the invention relates to producing ex vivo cell containing the design of nucleic acid that expresses retroviral structural proteins and also containing retroviral vector, essentially consisting of a promoter, nucleic acid encoding (a) a PRO87299 polypeptide, (b) a polypeptide agonist of PRO87299 polypeptide, or (c) a polypeptide antagonist of PRO87299 polypeptide, and a signal sequence for cellular secretion of the polypeptide, where this producing cell packs retroviral vector in conjunction with the structural proteins for the production of recombinant retroviral particles.

In an additional embodiment, the invention relates to a method of increasing the activity of immune cells in a mammal, comprising an introduction to the specified mammal (a) a PRO87299 polypeptide, (b) agonist PRO87299 polypeptide, or (c) an antagonist of PRO87299 polypeptide, where the activity of immune cells in the mammal is increased.

In an additional embodiment, the invention relates to a method of increasing proliferation of immune cells in a mammal, comprising an introduction to the specified mammal (a) a PRO87299 polypeptide, (b) agonist polyp is ptid PRO87299 or (c) an antagonist of PRO87299 polypeptide, where the proliferation of immune cells in the mammal is increased.

In an additional embodiment, the invention relates to a method of reducing proliferation of immune cells in mammals, including the introduction of a given mammal (a) a PRO87299 polypeptide, (b) agonist PRO87299 polypeptide, or (c) an antagonist of PRO87299 polypeptide, where the proliferation of immune cells in the mammal is decreased.

B. Additional embodiments of

In other embodiments, implementation of the present invention the invention relates to vectors containing DNA encoding any of the polypeptides described herein. Also provided a host cell containing any such vector. As an example, cell host may constitute CHO cells, E. coli or yeast. Additionally provided is a method of obtaining any of these polypeptides comprising culturing host cells under conditions suitable for expression of the desired polypeptide and isolating the desired polypeptide from the cell culture.

In other embodiments implementing the invention relates to chimeric molecules containing any of the polypeptides described herein, fused with a heterologous polypeptide or amino acid sequence. Examples of such chimeric molecules include any of the features described here polypeptide is, merged with the sequence of the epitope tags or Fc region of the immunoglobulin.

In another embodiment, the invention relates to an antibody specifically binding any of the above or below polypeptides. Not necessarily, the antibody is a monoclonal antibody, humanitariannet antibody, antibody fragment or single-chain antibody.

In other embodiments implementing the invention relates to oligonucleotide probes that are applicable for the selection of the nucleotide sequences, genomic and cDNA, or as antisense probes, where these probes can be obtained from any of the above or below the nucleotide sequences.

In other embodiments implementing the invention relates to the selected nucleic acid molecule containing the nucleotide sequence encoding the polypeptide PRO87299.

In one aspect of the selected nucleic acid molecule contains a nucleotide sequence having at least about 80% identity nucleic acid sequence, alternatively at least about 81% sequence identity of the nucleic acid, alternatively at least about 82% sequence identity of the nucleic acid, alternative, at least, is roughly 83% identity nucleic acid sequence, alternatively, at least about 84% sequence identity of the nucleic acid, alternatively at least about 85% identity nucleic acid sequence, alternatively at least about 86% sequence identity of the nucleic acid, alternatively at least about 87% sequence identity of the nucleic acid, alternatively at least about 88% identity nucleic acid sequence, alternatively at least about 89% sequence identity of the nucleic acid, alternatively at least about 90% identity nucleic acid sequence, alternative, at least about 91% sequence identity of the nucleic acid, alternatively at least about 92% identity nucleic acid sequence, alternatively at least about 93% identity nucleic acid sequence, alternatively at least about 94% sequence identity of the nucleic acid, alternatively at least about 95% identity nucleic acid sequence, alternative, at least approx the positive 96% identity nucleic acid sequence, alternatively, at least about 97% identity nucleic acid sequence, alternatively at least about 98% identity to the nucleic acid sequence and alternatively, at least about 99% identity to the sequence of the nucleic acid of (a) a DNA molecule that encodes a PRO87299 polypeptide having a full-sized amino acid sequence as described herein, the amino acid sequence without the signal peptide, as described herein, an extracellular domain, a transmembrane protein with signal peptide, as described herein or any other specifically defined fragment of the full amino acid sequence as described herein, or (b) a DNA molecule complementary to (a).

In other aspects of the selected nucleic acid molecule contains a nucleotide sequence having at least about 80% identity nucleic acid sequence, alternatively at least about 81% sequence identity of the nucleic acid, alternatively at least about 82% sequence identity of the nucleic acid, alternatively at least about 83% identity to the nucleic acid sequences which, alternatively, at least about 84% sequence identity of the nucleic acid, alternatively at least about 85% identity nucleic acid sequence, alternatively at least about 86% sequence identity of the nucleic acid, alternatively at least about 87% sequence identity of the nucleic acid, alternatively at least about 88% identity nucleic acid sequence, alternatively at least about 89% sequence identity of the nucleic acid, alternatively at least about 90% identity nucleic acid sequence, alternative, at least about 91% sequence identity of the nucleic acid, alternatively at least about 92% identity nucleic acid sequence, alternatively at least about 93% identity nucleic acid sequence, alternatively at least about 94% sequence identity of the nucleic acid, alternatively at least about 95% identity nucleic acid sequence, alternative, at least approx the positive 96% identity nucleic acid sequence, alternatively, at least about 97% identity nucleic acid sequence, alternatively at least about 98% identity to the nucleic acid sequence and alternatively, at least about 99% identity to the sequence of the nucleic acid of (a) a DNA molecule containing the coding sequence of full-length cDNA PRO87299 polypeptide, as described herein, the coding sequence of PRO87299 polypeptide without the signal peptide, as described herein, the coding sequence of the extracellular domain of transmembrane PRO87299 polypeptide with the signal peptide, as described herein or the coding sequence of any other specifically defined fragment of the full amino acid sequence as described herein, or (b) molecule, complementary DNA (a).

In an additional aspect, the invention relates to the selected nucleic acid molecule containing a nucleotide sequence having at least about 80% identity nucleic acid sequence, alternatively at least about 81% sequence identity of the nucleic acid, alternatively at least about 82% sequence identity nuclein the howling acid, alternatively, at least about 83% sequence identity of the nucleic acid, alternatively at least about 84% sequence identity of the nucleic acid, alternatively at least about 85% identity nucleic acid sequence, alternatively at least about 86% sequence identity of the nucleic acid, alternatively at least about 87% sequence identity of the nucleic acid, alternatively at least about 88% identity nucleic acid sequence, alternatively at least about 89% sequence identity of the nucleic acid, alternative, least about 90% identity nucleic acid sequence, alternatively at least about 91% sequence identity of the nucleic acid, alternatively at least about 92% identity nucleic acid sequence, alternatively at least about 93% identity nucleic acid sequence, alternatively at least about 94% identity nucleic acid sequence, alternative, at least approx the positive 95% identity to the sequence of the nucleic acid, alternatively, at least about 96% identity nucleic acid sequence, alternatively at least about 97% identity nucleic acid sequence, alternatively at least about 98% identity to the nucleic acid sequence and alternatively, at least about 99% identity to the sequence of the nucleic acid with a DNA molecule that encodes the same Mature polypeptide as shown in Fig. 2 (SEQ ID NO:2).

In another aspect the invention relates to the selected nucleic acid molecule containing the nucleotide sequence encoding a PRO87299 polypeptide, which has or deletionism transmembrane domain, or inaktivirovannye transmembrane domain, or which is complementary to such encoding nucleotide sequence, where the transmembrane domain(s) of such polypeptide are described here. Thus, considering the soluble extracellular domains of the polypeptides PRO87299.

Another variant of implementation refers to the sequence that encodes fragments of PRO87299 polypeptide or complementray her, which can be used, for example, as probes for hybridization, for encoding fragments of a PRO87299 polypeptide, which may not necessarily encode polypep is d, contains the binding site for antibodies anti-PRO87299 or as antisense oligonucleotide probes. Such fragments of nucleic acids typically have a length of at least about 20 nucleotides, alternative length at least about 30 nucleotides, alternative length of at least about 40 nucleotides, alternative length of at least about 50 nucleotides, alternative length of at least about 60 nucleotides, alternative length, at least about 70 nucleotides, alternative length, at least about 80 nucleotides, alternative length, at least about 90 nucleotides, alternative length at least approximately 100 nucleotides, alternative length of at least about 110 nucleotides, alternative length of at least about 120 nucleotides, alternative length of at least about 130 nucleotides, alternative length of at least approximately 140 nucleotides, alternative length of at least about 150 nucleotides, alternative length of at least about 160 nucleotides, alternative length of at least about 170 nucleotides, alternative length at least approximately the additional 180 nucleotides, alternative length of at least about 190 nucleotides, alternative length of at least about 200 nucleotides, alternative length of at least about 250 nucleotides, alternative length of at least about 300 nucleotides, alternative length of at least about 350 nucleotides, alternative length of at least about 400 nucleotides, alternative length of at least about 450 nucleotides, alternative length of at least about 500 nucleotides, alternative length of at least about 600 nucleotides, alternative in length, at least about 700 nucleotides, alternative length of at least about 800 nucleotides, alternative length of at least about 900 nucleotides and alternative length of at least about 1000 nucleotides, where in this context the term "approximately" means specified length nucleotide sequence of plus or minus 10% of the specified length. Note that the new fragments of the nucleotide sequence that encodes a PRO87299 polypeptide, you can define an accepted way through alignment of the nucleotide sequence that encodes a PRO87299 polypeptide, with other known nuclear DNAME sequences using any of a variety of well-known programs for sequence alignment and definitions what part(s) of the nucleotide sequence that encodes a PRO87299 polypeptide, is new. All such nucleotide sequence encoding a PRO87299 polypeptide, consider here. Also consider the fragments of PRO87299 polypeptide encoded data fragments of a nucleotide molecule, preferably those fragments of PRO87299 polypeptide, which contain the binding site of anti-PRO87299 antibodies.

In another embodiment, the invention relates to selected PRO87299 polypeptide encoded by any of the selected nucleic acid sequences, referred to here above.

In a specific aspect the invention relates to selected PRO87299 polypeptide containing an amino acid sequence having at least about 80% amino acid sequence identity, alternatively at least about 81% amino acid sequence identity, alternatively at least about 82% amino acid sequence identity, alternatively at least about 83% amino acid sequence identity, alternatively at least about 84% amino acid sequence identity, alternatively at least about 85% identity with amino acid sequence is lnasty, alternatively, at least about 86% amino acid sequence identity, alternatively at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about 90% amino acid sequence identity, alternatively at least about 91% amino acid sequence identity, alternatively at least about 92% amino acid sequence identity, alternatively at least about 93% the amino acid sequence identity, alternatively at least about 94% amino acid sequence identity, alternatively at least about 95% amino acid sequence identity, alternatively at least about 96% amino acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98% amino acid identity posledovatelno and alternative at least about 99% amino acid sequence identity with a PRO87299 polypeptide having a full-sized amino acid sequence as described herein, the amino acid sequence without the signal peptide, as described herein, an extracellular domain, a transmembrane protein with signal peptide, as described herein or any other specifically defined fragment of the full amino acid sequence, as described here.

In an additional aspect, the invention relates to selected PRO87299 polypeptide containing an amino acid sequence having at least about 80% amino acid sequence identity, alternatively at least about 81% amino acid sequence identity, alternatively at least about 82% amino acid sequence identity, alternatively at least about 83% amino acid sequence identity, alternatively at least about 84% amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86 percent identity of amino acid PEFC is the sequences, alternatively, at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about 90% amino acid sequence identity, alternatively at least about 91% amino acid sequence identity, alternatively at least about 92% amino acid sequence identity, alternatively at least about 93% amino acid sequence identity, alternatively at least about 94% the amino acid sequence identity, alternatively at least about 95% amino acid sequence identity, alternatively at least about 96% amino acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98% amino acid sequence identity and alternatively, at least about 99% amino acid identity consistently the tee with the amino acid sequence, it is shown in Fig. 2 (SEQ ID NO:2).

In a specific aspect the invention relates to selected PRO87299 polypeptide without the N-terminal signal sequence and/or the initial methionine and is encoded by a nucleotide sequence that encodes such an amino acid sequence as described herein previously. Also described methods for producing polypeptide, where these methods include culturing the host cell containing the nucleic acid, under conditions suitable for expression of PRO87299 polypeptide, and allocation of PRO87299 polypeptide from the cell culture.

In another aspect the invention relates to selected PRO87299 polypeptide, with or deletionism transmembrane domain, or inaktivirovannye transmembrane domain. Here is described how to obtain the polypeptide, where these methods include culturing the host cell containing the vector containing the appropriate encoding nucleic acid molecule under conditions suitable for expression of PRO87299 polypeptide, and selection of PRO87299 polypeptide from the cell culture.

In another embodiment, the invention relates to agonists and antagonists of the natural PRO87299 polypeptide, as described herein. In a particular embodiment, the agonist or antagonist is an anti-PRO87299 antibody or a small molecule.

In the other embodiment, the invention relates to a method of identifying agonists or antagonists of PRO87299 polypeptide, which includes bringing into contact of PRO87299 polypeptide with a molecule candidate and monitoring a biological activity mediated by the specified PRO87299 polypeptide. Preferably PRO87299 polypeptide is a native PRO87299 polypeptide.

In an additional embodiment, the invention relates to a mixture of chemically related substances containing a PRO87299 polypeptide, or agonist or antagonist of PRO87299 polypeptide, as described herein, or an anti-PRO87299 antibody in combination with a carrier. Not necessarily, the carrier is a pharmaceutically acceptable carrier.

Another variant of implementation of the present invention relates to the application of PRO87299 polypeptide or agonist or antagonist, as described herein before, or anti-PRO87299 antibodies, to obtain medicines, applicable to the treatment condition, meet on a PRO87299 polypeptide, agonist or antagonist, or anti-PRO87299 antibody.

BRIEF DESCRIPTION of DRAWINGS

Figure 1 shows the nucleotide sequence (SEQ ID NO:1) natural sequence of cDNA PRO87299, where SEQ ID NO:1 is a clone designated here "DNC".

Figure 2 shows the amino acid sequence (SEQ ID NO:2)derived from the coding sequence of SEQ ID NO:1, shown in figure 1.

Figure 3 shows the nucleotide consistently is th (SEQ ID NO:3) natural sequence HVEM cDNA (HVEM), where SEQ ID NO:3 is a clone, designated here "HVEM".

Figure 4 shows the amino acid sequence (SEQ ID NO:4)derived from the coding sequence of SEQ ID NO:3, shown in Fig. 3.

Figure 5 shows the nucleotide sequence (SEQ ID NO:5) natural LIGHT sequence where SEQ ID NO:5 is a clone, designated here "LIGHT".

Figure 6 shows the amino acid sequence (SEQ ID NO:6)derived from the coding sequence of SEQ ID NO:5 shown in Fig. 5.

7 shows the nucleotide sequence (SEQ ID NO:7) variant sequence PRO87299, where SEQ ID NO:7 is a clone, designated here "PRO87299.short".

On Fig shows the amino acid sequence (SEQ ID NO:8)derived from the coding sequence of SEQ ID NO:7, shown in Fig.7.

Figure 9 shows the nucleotide sequence (SEQ ID NO:9) variant sequence PRO87299, where SEQ ID NO:9 is a clone, designated here "PRO87299.AFTNIP".

Figure 10 shows the amino acid sequence (SEQ ID NO: 10)derived from the coding sequence of SEQ ID NO:9 shown in Fig.9.

Figure 11 shows variants of nucleic acid cDNA PRO87299.

On Fig variants broadcast of PRO87299 polypeptide.

On Fig shows the inhibition of proliferation of CD4+ T-cells through antibody-ago is earnest.

On Fig shows specific binding of PRO87299 with HVEM.

On Fig shows the binding PRO87299 with HVEM when compared with other members of the family.

On Fig shown that binding of PRO87299 with HVEM is sensitive to pH.

On Fig shows the binding PRO87299 with HVEM in cells transfected with HVEM.

On Fig shown that antibodies to PRO87299 can block the interaction with HVEM.

On Fig shown that PRO87299 and LIGHT can simultaneously bind HVEM

On Fig shown that PRO87299 not blocked by the interaction of LIGHT with HVEM.

On Fig shows the peptide BP-2 and gD, blocking the interaction of PRO87299/HVEM.

On Fig shows the inhibiting effect of PRO87299 on CD4+ T cells.

On Fig shown that the activation of PRO87299 HVEM-Fc promotes survival in a model of GVHR.

A DETAILED DESCRIPTION of the PREFERRED embodiments

I. Definitions

A PRO87299 polypeptide, described herein, can be isolated from a variety of sources, such as types of human tissue, or from another source, or to obtain recombinant or synthetic methods. As described herein, when referring to "a PRO87299 polypeptide"refer to each of the polypeptides individually as well as collectively. For example, descriptions of obtaining, purifying, removing, obtaining antibodies to or against the introduction of compositions containing them, treatment of diseases by means of, and so on, relative to the tsya to each polypeptide according to the invention individually. The term "PRO87299 polypeptide" also includes variants of PRO87299 polypeptide described herein.

"Natural sequence of PRO87299 polypeptide" includes a polypeptide having the same amino acid sequence as the corresponding PRO87299 polypeptide, obtained from natural sources. Such natural sequence of PRO87299 polypeptide can be isolated from natural sources or to obtain recombinant or synthetic methods. The term "natural sequence of PRO87299 polypeptide" specifically encompasses existing in nature truncated or secreted forms of the specific PRO87299 polypeptide (for example, the sequence of the extracellular domain), options existing in nature forms (e.g., alternative splicing) and existing in nature allelic variants of the polypeptide. In various embodiments, the implementation according to the invention the natural sequence of PRO87299 polypeptide, described herein are Mature or full-size natural sequence of polypeptides containing the full amino acid sequences shown in the accompanying figures. Start - and stop-codons on the figures shown in bold and underlined. However, while it is shown that a PRO87299 polypeptide, described in the accompanying figures, begins with residues is of ethionine, shown here in the figures as amino acid position 1 is estimated and possible that other methionine residues, localized above or below the position of amino acids 1 to the figures, can serve as the starting amino acid residue for a PRO87299 polypeptide.

"Extracellular domain"or "ECD", PRO87299 polypeptide refers to a form of PRO87299 polypeptide, which is mostly free of the transmembrane and cytoplasmic domains. Usually a PRO87299 polypeptide ECD will have less than 1% of such transmembrane and/or cytoplasmic domains and preferably, will have less than 0.5% of such domains. It is clear that any transmembrane domains identified for PRO87299 polypeptide of the present invention, identified in accordance with the criteria normally used in this field to identify the hydrophobic domain of this type. The exact boundaries of the transmembrane domain can vary, but most likely not more than about 5 amino acids at either end of the domain, as originally identified here. Thus, it is not necessarily the extracellular domain of PRO87299 polypeptide may contain from about 5 or fewer amino acids on either side of the boundaries of the transmembrane domain/extracellular domain, as indicated in the examples or description, and such polypeptides, with PR is connected to the signal peptide or not and their coding nucleic acid related to the present invention.

"Variant of PRO87299 polypeptide" means an active PRO87299 polypeptide as defined above or below having at least about 80% amino acid sequence identity with a full-sized natural sequence of PRO87299 polypeptide, as described herein, the sequence of PRO87299 polypeptide without the signal peptide, as described herein, the extracellular domain of PRO87299 polypeptide with the signal peptide, as described herein or any other fragment of a full-sized sequence of PRO87299 polypeptide, as described herein. Such variants of PRO87299 polypeptide include, for example, a PRO87299 polypeptide, where added or deleterow one or more amino acid residues at the N - or C-end full-size natural amino acid sequence. Usually the option of PRO87299 polypeptide will have at least about 80% amino acid sequence identity, alternatively at least about 81% amino acid sequence identity, alternatively at least about 82% amino acid sequence identity, alternatively at least about 83% amino acid sequence identity, alternatively at least about 84% amino acid sequence identity, and iterative, at least about 85% amino acid sequence identity, alternatively at least about 86% amino acid sequence identity, alternatively at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about 90% amino acid sequence identity, alternatively at least about 91% amino acid sequence identity, alternatively at least about 92% amino acid identity sequence, alternatively, at least about 93% amino acid sequence identity, alternatively at least about 94% amino acid sequence identity, alternatively at least about 95% amino acid sequence identity, alternatively at least about 96% amino acid sequence identity, alternatively at least about 97% identity of amino acid sequence of alternatives is about, at least about 98% amino acid sequence identity and alternatively, at least about 99% amino acid sequence identity with a full-sized natural sequence of PRO87299 polypeptide, as described herein, the sequence of PRO87299 polypeptide without the signal peptide, as described herein, an extracellular domain of PRO87299 polypeptide with the signal peptide, as described herein or any other specifically defined fragment of the full sequence of PRO87299 polypeptide, as described herein. Usually variants of PRO87299 polypeptide have a length of at least about 10 amino acids, alternative length of at least about 20 amino acids, an alternative length of at least about 30 amino acids, alternative length of at least about 40 amino acids, alternative length of at least about 50 amino acids, alternative length of at least about 60 amino acids, alternative length, at least about 70 amino acids, alternative length, at least about 80 amino acids, alternative length of at least approximately 90 amino acids, alternative length of at least about 100 amino acids, alternative length is Oh, at least about 150 amino acids, alternative length of at least about 200 amino acids, alternative length of at least about 300 amino acids, or more.

"Percent (%) amino acid sequence identity" with respect to sequences of PRO87299 polypeptide specified in this document, is defined as the percentage of amino acid residues in the sequence candidate, identical with amino acid residues of a particular sequence of PRO87299 polypeptide, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the identity sequence. Alignment to determine the percent identity of amino acid sequences can be performed in various ways known to the experts in this field, for example using a publicly available software, such as software BLAST, BLAST-2, ALIGN or Megalign (DNASTAR). Specialists in this field can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the compared sequences. However, DL the purposes here, the value of the % identity of amino acid sequences were obtained using the computer program comparison sequence ALIGN-2, where the full source code of the program ALIGN-2 are shown in table 1 below. The authorship of computer programs compare sequences ALIGN-2 belongs Genentech, Inc., and the source code shown in table 1 below, filed with user documentation in the copyright Office of USA, Washington D.C., 20559, where it is registered under registration number US copyright law No. TXU510087. The program ALIGN-2 publicly available from Genentech, Inc., South San Francisco, California or may be compiled from the source code provided in table 1 below. The program ALIGN-2 should be compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All parameters comparison of the sequences set in the program ALIGN-2 and do not change.

In situations where ALIGN-2 is used for amino acid sequence comparisons, the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which alternative can be expressed as a given amino acid sequence A that has or contains a specific % amino acid identity to, with, or against a given amino acid sequence B) is calculated as follows:

100 times the fraction X/Y

where X represents the number of amino acid residues that are marked as identical souped is of the diff program sequence ALIGN-2 when comparing this program A and B, where Y represents the total number of amino acid residues in B. note that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A. as examples of computing % identity of amino acid sequences using this method, tables 2 and 3 shows how to calculate the % identity of amino acid sequence the amino acid sequence designated "Comparison protein"to the amino acid sequence designated "PRO87299", where "PRO87299" represents the amino acid sequence of interest to a hypothetical PRO87299 polypeptide, "Comparison protein" represents the amino acid sequence of a polypeptide against which to compare the desired polypeptide "PRO87299", and each "X", "Y" and "Z" represent different hypothetical amino acid residues.

While not specifically stated otherwise, all values % identity of amino acid sequences used here are obtained, as described in the immediately preceding paragraph using the computer program ALIGN-2. However, the magnitude of the % identity of amino acid sequences can is about to receive the same as described below, using a computer program WU-BLAST-2 (Altschul et al, Methods in Enzvmology 266:460-480 (1996)). Most of the parameters of the search of WU-BLAST-2 set to the default values. For parameters that are not installed on the default values, i.e. adjustable parameters were set to the following values: overlap span = 1, overlap fraction = a 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. When using WU-BLAST-2, value % identity of amino acid sequences is determined by dividing (a) the number of matching identical amino acid residues between the amino acid sequence of interest PRO87299 polypeptide having a sequence derived from natural PRO87299 polypeptide, and compare interest amino acid sequence (i.e. the sequence against which to compare interest PRO87299 polypeptide, which may be a variant of PRO87299 polypeptide)as determined by WU-BLAST-2 by (b) the total number of amino acid residues of interest PRO87299 polypeptide. For example, in the statement "a polypeptide containing the amino acid sequence A which has or having at least 80% amino acid sequence identity with the amino acid sequence B", the amino acid sequence A is the comparison of interest, the amino acid is ing sequence, and amino acid sequence B is the amino acid sequence of interest PRO87299 polypeptide.

Percent identity of amino acid sequences can be determined using software to compare sequences NCBI-BLAST2 (Altschul et al., Nucleic acids Res. 25:3389-3402 (1997)). Program to compare sequences NCBI-BLAST2 can be downloaded from http://www.ncbi.nlm.nih.gov or otherwise obtained from the National Institute of Health, Bethesda, MD. In NCBI-BLAST2 uses several search parameters, where all these search parameters set to default values including, for example, unmask = yes, strand = all, expected occurrences = 10, minimum low complexity length = 15/5, multi-pass e-value value = 0.01, constant for multi-pass = 25, dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62.

In situations where for comparison of amino acid sequences used NCBI-BLAST2, % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which alternative can be expressed as a given amino acid sequence A that has or contains a specific % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows:

100 times the fraction X/Y

where X represents the number of amino acid residues, mark is obtained as identical matches by the program compare sequences NCBI-BLAST2 when comparing this program A and B, where Y represents the total number of amino acid residues in B. note that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A.

"Polynucleotide RO87299 or variant nucleic acid sequence PRO87299" means a nucleic acid molecule encoding an active PRO87299 polypeptide as defined below having at least about 80% identity to the sequence of the nucleic acid sequence of nucleic acid that encodes a full-sized natural sequence of PRO87299 polypeptide, as described herein, a full-sized natural sequence of PRO87299 polypeptide without the signal peptide, as described herein, the extracellular domain of PRO87299 polypeptide, with the signal peptide, as described herein or any other fragment of a full sequence of PRO87299 polypeptide, as described herein. Usually the option of polynucleotide PRO87299 will possess at least about 80% identity nucleic acid sequence, alternatively at least about 81% identity nucleic acid sequence, alternative, Myung is our least approximately 82% identity nucleic acid sequence, alternatively at least about 83% sequence identity of the nucleic acid, alternatively at least about 84% sequence identity of the nucleic acid, alternatively at least about 85% identity nucleic acid sequence, alternatively at least about 86% sequence identity of the nucleic acid, alternatively at least about 87% sequence identity of the nucleic acid, alternatively at least about 88% identity nucleic acid sequence, alternatively at least about 89% identity nucleic acid sequence, alternatively at least about 90% identity nucleic acid sequence, alternatively at least about 91% sequence identity of the nucleic acid, alternatively at least about 92% identity nucleic acid sequence, alternatively at least about 93% identity nucleic acid sequence, alternatively at least about 94% identity last the successive nucleic acid, alternatively, at least about 95% identity nucleic acid sequence, alternatively at least about 96% identity nucleic acid sequence, alternatively at least about 97% identity nucleic acid sequence, alternatively at least about 98% identity to the nucleic acid sequence and alternatively, at least about 99% identity to the sequence of the nucleic acid sequence of the nucleic acid coding sequence of a full-sized natural PRO87299 polypeptide, as described herein, the sequence of the full-sized natural PRO87299 polypeptide without the signal peptide, as described herein, an extracellular domain PRO87299 polypeptide with signal sequence, or without, as described herein or any other fragment of a full sequence of PRO87299 polypeptide, as described herein. Options do not cover the natural nucleotide sequence.

Usually options polynucleotide PRO87299 have a length of at least about 30 nucleotides, alternative length of at least about 60 nucleotides, alternatively at least about 90 nucleotides, alternative length, m is Nisha least approximately 120 nucleotides, alternative length of at least about 150 nucleotides, alternative length of at least about 180 nucleotides, alternative length of at least about 210 nucleotides, alternative length of at least about 240 nucleotides, alternative length of at least about 270 nucleotides, alternative length of at least about 300 nucleotides, alternative length of at least about 450 nucleotides, alternative length of at least about 600 nucleotides, alternative length of at least approximately 900 nucleotides or more.

"Percent (%) identity to the sequence of a nucleic acid" in relation to nucleic acid sequence that encodes a PRO87299 defined here, is defined as the percentage of nucleotides in the sequence is the candidate that is identical with the nucleotides in the corresponding nucleic acid sequence PRO87299 after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity of the nucleic acid can be performed in various ways known in this area is, for example, using publicly available computer software, such as software BLAST, BLAST-2, ALIGN or Megalign (DNASTAR). For the purposes here, however, the value of the % sequence identity of the nucleic acid was obtained using a computer program to compare the sequence ALIGN-2, where the complete source code for the program ALIGN-2 are presented in table 1 below. The authorship of computer programs compare sequences ALIGN-2 belongs Genentech, Inc., and the source code shown in table 1 below, filed with user documentation in the copyright Office of USA, Washington D.C., 20559, where it is registered under registration number US copyright law No. TXU510087. The program ALIGN-2 publicly available from Genentech, Inc., South San Francisco, California or may be compiled from the source code provided in table 1 below. The program ALIGN-2 should be compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All parameters comparison of the sequences set in the program ALIGN-2 and do not change.

In situations where ALIGN-2 is used for comparisons nucleic acid sequence, the percent identity of the nucleic acid sequence of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D (which is an alternative mo is but the expression as given nucleic acid sequence C, which has or contains a specific percent identity of the nucleic acid sequence to, with, or against a given nucleic acid sequence D) is calculated as follows:

100 times the fraction W/Z

where W represents the number of nucleotides that are marked as identical matches by the diff program sequence ALIGN-2 when comparing this program, C and D, where Z represents the total number of nucleotides in D. it Should be considered that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % identity of nucleic acid sequence C to D will not equal the % identity of nucleic acid sequence D to C. as examples of computing % identity nucleic acid sequence in tables 4 and 5 shows how to calculate the % identity of the nucleic acid sequence designated "Comparison DNA"with the nucleic acid sequence designated "PRO87299-DNA", where "PRO87299-DNA" represents a sequence of interest to a hypothetical nucleic acid that encodes a PRO87299, "Comparison DNA" represents the nucleotide sequence of the nucleic acid molecule against which to compare interest molecule nucleic acid "PRO87299-DNA, and each N is, "L" and "V" represent different hypothetical nucleotides.

Unless specifically stated otherwise, all values % identity nucleic acid sequence used here are obtained, as described in the immediately preceding paragraph using the computer program ALIGN-2. However, the magnitude of the percent identity of the nucleic acid sequence can be obtained as described below, using a computer program WU-BLAST-2 (Altschul et al., Methods in Enzvmology 266:460-480 (1996)). Most of the parameters of the search of WU-BLAST-2 set to the default values. For parameters that are not installed on the default values, i.e. adjustable parameters were set to the following values: overlap span = 1, overlap fraction = a 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. When using WU-BLAST-2, value % identity nucleic acid sequence is determined by dividing (a) the number of matching identical nucleotides between the nucleic acid sequence of interest of a nucleic acid molecule that encodes a PRO87299 polypeptide having a sequence derived from a natural nucleic acid sequence that encodes a PRO87299 polypeptide, and of interest to compare the nucleic acid molecule (i.e. the sequence against which to compare interest molecule nucleic acid code is th a PRO87299 polypeptide, which may be a variant of polynucleotide PRO87299)as determined by WU-BLAST-2 by (b) the total number of nucleotides of interest of a nucleic acid molecule that encodes a polypeptide PRO87299. For example, in the statement "the selected nucleic acid molecule containing a nucleic acid sequence A which has or having at least 80% identity to the sequence of the nucleic acid with the nucleic acid sequence B", the nucleic acid sequence A is the comparison of interest, the nucleic acid molecule and the nucleic acid sequence B is the nucleic acid sequence of interest of a nucleic acid molecule that encodes a polypeptide PRO87299.

The percentage identity of the nucleic acid sequence can be defined also using the program to compare sequences NCBI-BLAST2 (Altschul et al., Nucleic acids Res. 25:3389-3402 (1997)). Program to compare sequences NCBI-BLAST2 can be downloaded from http://www.ncbi.nlm.nih.gov or otherwise obtained from the National Institute of Health, Bethesda, MD. In NCBI-BLAST2 sportsouth multiple search options, where all these search parameters set to default values including, for example, unmask = yes, strand = all, expected occurrences = 10, minimum low complexity length = 15/5, multi-pass e-value = 0,01, constnt for multi-pass = 25, dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62.

In situations where comparisons of sequences used NCBI-BLAST2, % identity nucleic acid sequence of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D (which alternative can be expressed as a given nucleic acid sequence C that has or contains a specific percent identity of the nucleic acid sequence to, with, or against a given nucleic acid sequence D) is calculated as follows:

100 times the fraction W/Z

where W represents the number of nucleotides that are marked as identical matches by the program compare sequences NCBI-BLAST2 when comparing this program, C and D, where Z represents the total number of nucleotides in D. it Should be considered that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % identity of nucleic acid sequence C to D will not equal the % identity of nucleic acid sequence D C.

In other embodiments, the exercise of options polynucleotide PRO87299 represent nucleic acid molecule that encodes an active PRO87299 polypeptide and capable of gibridizatsiya, preferably stringent hybridization conditions and is tlyvci, with nucleotide sequences encoding the full-PRO87299 polypeptide, as described herein. Variants of PRO87299 polypeptide may represent variants encoded by variant polynucleotide PRO87299.

"Isolated" when applied here to describe the various polypeptides described herein, means polypeptide that has been identified and separated and/or isolated from a component of its natural environment. Contaminant components of its natural environment are materials that typically interfere with diagnostic or therapeutic uses of the polypeptide, and may include enzymes, hormones and other protein or non-protein solutions. In preferred embodiments, the implementation of the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence using sequencing machine with rotating glass, or (2) to homogeneity in SDS-PAGE in non or reducing conditions using colour, Kumasi preferably blue or silver. The selected polypeptide includes polypeptide in situ within recombinant cells, yet will be present, at least one of the components of the natural environment of PRO87299 polypeptide. Usually, however, highlighted polypeptid who will get through, at least one stage of cleaning.

"Isolated" nucleic acid encoding a PRO87299 polypeptide or nucleic acid encoding another polypeptide, is a nucleic acid molecule that is identified and separated from at least one contaminating nucleic acid molecule with which it is normally associated in the natural source of the nucleic acid that encodes a polypeptide. The selected nucleic acid molecule that encodes a polypeptide that is different from the form or the environment in which it is found in nature. Thus, the selected nucleic acid molecules differ from the nucleic acid molecules coding for a specific polypeptide, as they are present in natural cells. However, the selected nucleic acid molecule that encodes a polypeptide that includes a nucleic acid molecule encoding the polypeptide contained in cells that normally Express the polypeptide where, for example, chromosomal localization of the nucleic acid molecule differs from the localization in natural cells.

The term "control sequences" refers to DNA sequences necessary for the expression of the operatively linked coding sequence in a particular organism, the host. Control sequences that are suitable for procar is from, for example, include a promoter sequence, optional, operator and binding site of the ribosome. It is known that eukaryotic cells utilize promoters, polyadenylation signals, and enhancers.

Nucleic acid is operatively linked"when it is placed in the functional interaction with another nucleic acid sequence. For example, DNA for proposedvalue or secretory leader is functionally linked to DNA for a polypeptide if it is expressed as preblock that participates in the secretion of the polypeptide; a promoter or enhancer is functionally associated with codereuse sequence if it affects the transcription of the sequence; or the binding site of the ribosome is functionally associated with codereuse sequence, if it is located so as to facilitate translation. As a rule, "functionally linked" means a DNA sequence, linked in the neighborhood, and in the case of a secretory leader in the neighborhood and in the phase of reading. However, enhancers do not have to be adjacent. The binding is implemented by ligation into the appropriate restriction sites. If such sites do not exist, use synthetic oligonucleotide adapters or linkers in accordance with obsheprinyatoye.

The term "antibody" is used in its broadest sense, and it specifically covers, for example, single anti-PRO87299 monoclonal antibodies (including antibodies, agonists, antagonists and neutralizing), the composition of anti-PRO87299 antibodies with polyepitopic specificity, single-stranded anti-PRO87299 antibodies, and fragments of anti-PRO87299 antibodies (see below). The term "monoclonal antibody", as used here, refers to an antibody obtained from a population essentially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts.

"Stringency" of hybridization reactions can easily determine an ordinary person skilled in the art, and, as a rule, it is an empirical calculation dependent upon probe length, temperature, washing and concentration of salt. Typically, longer probes for proper annealing require higher temperatures, while for shorter probes require lower temperatures. Hybridization generally depends on the ability of denatured DNA re-annealing with complementary circuits that are present in the environment at a temperature below their melting point. The higher the desired degree of homology between the probe and Gebr disease sequence, the higher the relative temperature that can be applied. The result implies that higher relative temperatures will tend to make the reaction conditions more stringent, while lower temperatures are less strict. Additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

"Stringent conditions" or "highly stringent conditions", as determined here can be identified as those in which: (1) employ low ionic strength and high temperature for washing, for example of 0.015 M sodium chloride /0,0015 M sodium citrate /0.1% sodium dodecyl sulphate at 50°C; (2) during the hybridization used denaturing agent, such as formamide, for example, 50% (vol./about.) of formamide with 0.1% bovine serum albumin/0.1% ficoll/0.1% polyvinylpyrrolidone/50 mm sodium phosphate buffer at pH 6.5 with 750 mm sodium chloride, 75 mm sodium citrate at 42°C; or (3) employ 50% of formamide, 5×SSC (0,75 M NaCl, of 0.075 M sodium citrate), 50 mm sodium phosphate (pH of 6.8), 0.1% sodium pyrophosphate, 5 × denhardt's solution, processed by the ultrasound DNA salmon sperm (50 µg/ml), 0.1% of SDS, and 10% extrasolar at 42°C, with cleaning at 42°C in 0.2 × SSC (sodium chloride/sodium citrate) and 50% formamide at 55°C, followed highly stringent wash consisting of 0.1×SSC containing EDTA at 55°C.

"Moderately trogii conditions, you can determine as described in Sambrook et al., Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Press, 1989, and they include-use solution for cleaning and hybridization conditions (e.g., temperature, ionic strength and % SDS)less stringent than described above. An example of moderately stringent conditions is incubation over night at 37°C in a solution comprising: 20% formamide, 5×SSC (150 mm NaCl, 15 mm trisodium citrate), 50 mm sodium phosphate (pH of 7.6), 5 × denhardt's solution, 10% textresult, and 20 mg/ml denatured DNA salmon sperm, followed by washing the filters in 1 × SSC at about 37-50°C. the Skilled person skilled in the art will understand how to adjust the temperature, ionic strength, etc. as necessary to comply with such factors such as probe length and the like

The term "labeled epitope" in the application here refers to the chimeric polypeptide containing a PRO87299 polypeptide, fused with polypeptide-tagged". Polypeptide-label has enough residues to provide an epitope against which to obtain the antibody, however, is short enough not to interfere with the activity of the polypeptide with which it is merged. Polypeptide-label preferably is sufficiently unique so that the antibody basically does not cross react with other epitopes. Suitable polypeptides tags typically contain at least six aminoxy the pilot residue, and usually between about 8 and 50 amino acid residues (preferably between approximately 10 and 20 amino acid residues).

As used here, the term "immunoadhesin" designates antibody-like molecules which combine the binding specificity of a heterologous protein (adhesin") with the effector functions of the constant domain of immunoglobulin. Structural immunoadhesin contain fused amino acid sequence with the desired binding specificity different from the plot of the recognition and binding of the antigen from the antibody (i.e. are "heterologous"), and the sequence of the constant domain of immunoglobulin. Part of adhesin molecules immunoadhesin typically is a contiguous amino acid sequence containing at least the binding site of the receptor or ligand. The sequence of the constant domain of immunoglobulin in immunoadhesin can be obtained from any immunoglobulin, such as an immunoglobulin subtypes of IgG-1, IgG-2, IgG-3, or IgG-4, IgA (including IgA-I and IgA-2), IgE, IgD or IgM.

"Active" or "activity" for the purposes here refers to the shape (form) of PRO87299 polypeptide that retains the biological and/or immunological activity of native or natural PRO87299, where "biological" activity refers to a biological function (or inhibitorsa is, or stimulatory)caused native or natural PRO87299 other than the ability to induce the production of antibodies against an antigenic epitope possessed by a native or natural PRO87299, and an "immunological" activity refers to the ability to induce the production of antibodies against an antigenic epitope possessed by a native or natural PRO87299.

The term "antagonist" is used in its broadest sense and includes any molecule that partially or fully blocks, inhibits or neutralizes a biological activity described herein native PRO87299 polypeptide. Similarly, the term "agonist" is used in its broadest sense and includes any molecule that mimicries biological activity described herein native PRO87299 polypeptide. Suitable molecule agonist or antagonist specifically include antibodies or fragments of antibodies, agonists or antagonists, fragments or amino acid sequence variants of native PRO87299 polypeptide, peptides, antisense oligonucleotides, small organic molecules, etc. Methods of identifying agonists or antagonists of PRO87299 polypeptide can include prepgenie in contact PRO87299 polypeptide molecule with a candidate agonist or antagonist and the measurement is subject to change detection od the CSO or more types of biological activity, normally associated with a PRO87299 polypeptide.

"Treatment" refers to both therapeutic treatment and prophylactic or preventative measures, where the goal is to prevent or slow down (lessen) the planned pathological condition or disorder. Those in need of treatment include those who already have the disorder, as well as those who are predisposed to the disorder, or those who need to prevent disorder.

"Chronic" introduction refers to the introduction of money (funds) in continuous mode, in contrast to the impact mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time. "Periodic" introduction is a treatment, which is performed sequentially without interruption, but is rather cyclical in nature.

"Mammal" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and animals in the zoo, sports, or room, such as dogs, cats, cattle, horses, sheep, pigs, goats, rabbits, etc. Preferably the mammal is a human. Introduction "in combination with" one or more dopolnitelnye therapeutic means includes SEB is simultaneous (joint) and sequential introduction in any order.

"The media", as used here, include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal exposed in the applied doses and concentrations. Often physiologically acceptable carrier is an aqueous solution with a buffered pH. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; hepatoblastoma agents such as EDTA; sugar alcohols such as mannitol or sorbitol; soleobrazutaya counterions, such as sodium; and/or nonionic surfactants such as TWEEN™, polyethylene glycol (PEG), and PLURONICS™.

"Antibody fragments" comprise a portion of an intact antibody, preferably antigennegative or variable region of the intact antibody. Examples of fragments of antibodies include Fab fragments, Fab', F(ab')2and Fv; dyatel; whether anie antibodies (Zapata et al., Protein Eng. 8(10): 1057-1062 [1995]); single-stranded molecules antibodies; and multispecific antibodies formed from fragments of antibodies.

The cleavage of antibodies with papain get two identical antigenspecific fragment, called "Fab"fragments, each with a separate antigennegative plot, and the remaining "Fc"fragment, a designation reflecting the ability to easily crystallize. Treatment with pepsin get F(ab')2a fragment with two connecting antigen sites and is still capable of cross-link the antigen.

"Fv" is the minimum antibody fragment that contains a complete plot, capable of recognizing and binding the antigen. This site consists of a variable domain of the dimer of one heavy and one light chain in a tight, non-covalent linkages. In this configuration, it is reflected in the fact that the three CDRs of each variable domain interact, defining antigennegative area on the surface of the dimer VH-VL. Six CDR jointly provide antigennegative specificity of the antibodies. However, even a single variable domain (or half of an Fv, containing only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although with lower affinity than the entire binding site.

Fab-fragment also contains the constant domain of leglize and the first constant domain (CH1) of the heavy chain. Fab-fragments differ from Fab'-fragments of the addition of a few residues at the C-end of the CH1 domain of the heavy chain, including one or more cysteines from the hinge region of the antibody. F(ab')2-fragments of the antibodies were initially obtained as pairs of Fab'fragments with swivel cysteine between them. There are also other chemical joining fragments of antibodies.

The "light chains" of antibodies (immunoglobulins) from any vertebrate species can be attributed to one of two clearly distinct types, called Kappa and lambda, based on the amino acid sequences of their constant domains.

Depending on the amino acid sequence of the constant domain of their heavy chains, antibodies can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, and several of them can be further divided into subclasses (isotypes), e.g., IgGl, IgG2, IgG3, IgG4, IgA, and IgA2.

"Single-chain Fv" or "sFv"-fragments of the antibodies contain VHand VLdomains of antibodies, where these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between domains VHand VLwhich enables the sFv to form the desired structure for antigen binding. A review of sFv see Pluckthun in The Pharmacology of Monoclonal antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, Ne York, pp. 269-315 (1994).

The term "diately" refers to small antibody fragments with two antihistamine areas where the fragments contain the variable domain of the heavy chain (VH)connected to the variable domain light chain (VL) in the same polypeptide chain (VH-VL). The use of a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with complementary domains of another chain and create two antigenspecific plot. Diately more fully described, for example, in EP 404097; WO 93/11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993).

"Isolated" antibody is a fact that is identified and separated and/or removed from its natural environment. Contaminant components of its natural environment are substances which would interfere with diagnostic or therapeutic applications of the antagonist or antibody, and may include enzymes, hormones and other protein and non-protein solutions. In preferred embodiments, the implementation of the antibody will be clear (1) to more than 95% by weight of antibody as determined by the Lowry method, and most preferably to more than 99% by weight, (2) to a degree sufficient to obtain the amino acid sequence of at least 15 OST the Cove, from N-Terminus or internal using sequencing machine with rotating cups, or (3) to homogeneity in SDS-PAGE in reducing and non conditions using colour, Kumasi blue or, preferably, silver. The selected antibody includes the antibody in situ within recombinant cells, since ceases to be present, at least one component of the natural environment antibodies. Typically, however, the selected antibody will get through at least one stage of cleaning.

An antibody that "specifically binds to" or is "specific for" a particular polypeptide or epitope on a particular polypeptide, is that binds to that particular polypeptide or epitope on a particular polypeptide without substantially binding to any other polypeptide or polypeptide epitope.

The word "label" when used there refers to a compound or composition that can be used to detect, conjugated directly or indirectly with the antibody, so that you get the "labeled" antibody. The label may be amenable to detection by itself (e.g., radioisotope labels or fluorescent labels)or, in the case of an enzymatic label, may catalyze chemical alteration of the composition of the substrate or composition, to the which can be detected.

By "solid phase" is understood non-aqueous matrix to which you can join the antibody of the present invention. Examples of solid phases covered here include solid phase, partially or entirely of glass (e.g., glass, controlled pore size), polysaccharides (e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol and silicones. In a specific implementation options depending on the context, the solid phase may be in the form of wells for analysis; in others, it is a column for purification (for example, a column for affinity chromatography). This term also include perivious solid phase of discrete particles, such as described in U.S. patent No 4275149.

"Liposome" is a small vesicle composed of reslicing types of lipids, phospholipids and/or surfactant, which javljaetsja applicable for delivery to the mammal a drug (such as a PRO87299 polypeptide

or antibody thereto). Components of liposomes are usually arranged in a two-layer structure like the ordering of lipids in biological membranes.

"Small molecule", as determined here, has a molecular weight less than about 500 daltons.

The term "associated with immune disease" means a disease, etc is which component of the immune system of a mammal calls, mediates the incidence of a mammal or otherwise contributes to it. Also included are diseases in which stimulation of the immune response or intervention it has a relieving effect on the progression of the disease. In this term included immune inflammatory diseases, nimmanoradee inflammatory diseases, infectious diseases, immunodeficiency diseases, neoplasia, etc

The term "mediated T-cell disease" means a disease in which T cells directly or indirectly promote or otherwise contribute to the incidence of mammals. Mediated T-cell disease can be associated with mediated cell effects, mediated by lymphokines effects, etc. and even effects associated with B-cells when B cells are stimulated, for example, lymphokines, sekretiruemyi T-cells.

Examples of immune-related and inflammatory diseases, some of which are immune or mediated by T-cells that can be treated according to the present invention include systemic lupus erythematosus, rheumatoid arthritis, juvenile chronic arthritis, spondyloarthropathies, systemic sclerosis (scleroderma), idiopathic inflammatory myopathies (dermatomyositis, Paul is myositis), Sjogren syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia (immune pancytopenia, paroxysmal night hemoglobinuria), autoimmune thrombocytopenia (idiopathic thrombocytopenic purple, immunopositive thrombocytopenia), thyroiditis (diffuse toxic goiter, Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic thyroiditis), diabetes mellitus, immunopositive renal disease (glomerulonephritis, tubulointerstitial nephritis), demyelinating diseases of the Central and peripheral nervous systems such as multiple sclerosis, idiopathic demyelinizing polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinizing polyneuropathy, hepatobiliary diseases such as infectious hepatitis (hepatitis A, B, C, D, E and other hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis, inflammatory bowel disease (ulcerative colitis: Crohn's disease), patentability enteropathy, and Whipple's disease, autoimmune or immune skin diseases including bullous skin disease, polymorphic erythema, and contact dermatitis, psoriasis, allergic diseases such as asthma, all rychecky rhinitis, atopic dermatitis, hypersensitivity to food and urticaria, immunologic diseases of the lung such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and hypersensitive pneumonitis, diseases associated with transplantation, including graft rejection and graft-versus-host. Infectious diseases include viral diseases such as AIDS (HIV infection), hepatitis A, B, C, D and E, herpes, etc., bacterial infections, fungal infections, protozoal infections and parasitic infections.

The term "effective amount" is a concentration or amount of PRO87299 polypeptide and/or agonist/antagonist, which leads to the achievement of specific goals. "Effective amount" of PRO87299 polypeptide or agonist or antagonist can be determined empirically. In addition, a "therapeutically effective amount" is a concentration or amount of PRO87299 polypeptide and/or agonist/antagonist that is effective to achieve a particular claimed therapeutic effect. This number can also be determined empirically.

The term "cytotoxic agent"as used here, refers to a substance inhibiting or warning functioning of cells and/or causes destruction of cells, the Term is intended, to include radioactive isotopes (e.g., At211I131I125, Y90That Re186That Re188Sm153Bi212, P32and radioactive isotopes of Lu), chemotherapeutic drugs, such as methotrexate, adriamicin, Vinca alkaloids (vincristine, vinblastine, etoposide), doxorubicin, melphalan, mitomycin C, chlorambucil, daunorubicin or other intercalating tools, enzymes and fragments thereof such as nucleotidase enzymes, antibiotics, and toxins such as small molecule toxins or enzymatically active toxins of bacterial, fungal, plant or animal, including fragments and/or variants, and the various antitumor or anticancer means described below. The following are other cytotoxic funds. Destroys tumor cells means causes destruction of tumor cells. Cytotoxins can be covalently attached to the antibody for targeting the toxin to specific cell expressing the antigen. Applicable toxins are linkers which include, without limitation, the following:

LINKERS:

MC=maleimidomethyl

Val Cit=valine-citrulline, dipeptide site in cleaved by the protease linker.

The citrulline=2-amino-5-breedopedia acid

PAB=p-aminobenzoylamino ("salonitana" part of the linker)

Me=N-valine, citrulline, where the linker peptide bond has been modified to prevent its cleavage by cathepsin B

MC(PEG)6-OH = maleimidomethyl-polyethylene glycol is attached to zisteinom antibodies.

SPP=N-Succinimidyl-4-(2-pyridylthio)pentanoate

SMCC=N-Succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate

CYTOTOXIC DRUGS:

MMAE=monomethylaniline E (MW 718)

MMAF=option auristatin E (MMAE) with a phenylalanine at the C-end medicines (MW 731,5)

MMAF-DMAEA=MMAF with DMAEA (diethylaminoethylamine) in amide bond with a C-terminal phenylalanine (MW 801,5)

MMAF-TEG=MMAF with tetraethylene glycol, esterified with phenylalanine

MMAF-NtBu=N-t-butyl, attached in the form of an amide to the C-end of MMAF

AEVB=valerianaceae of auristatin E, colorability linker via C-end AE (MW 732)

AFP=phenylenediamine of auristatin F; (phenylalanine option attached to the antibody through C-end through phenylendiamine spacer) (MW 732).

"Growth inhibitory agent" when applied here means a compound or composition, inhibiting growth of cells, either in vitro or in vivo. Thus, the growth inhibitory agent can be a fact, which significantly reduces the percentage of cells in S-phase. Examples of inhibiting growth means include means blocking the passage of the cell cycle (in point is e, other than S phase), such as a means of inducing Gl-arrest and arrest in M-phase. Classic blockers M-phase include the Vinca alkaloids (vincristine and vinblastine), taxanes and topoisomerase II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin. The funds that are arrested Gl, also apply to the arrest S-phase, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and Ara-C. further information can be found in The Molecular Basis of Cancer, Mendelsohn and Israel, eds., part 1, entitled "Cell cycle regulation, oncogens, and antineoplastic drugs" by Murakami et al. (WB Saunders: Philadelphia, 1995), especially p. 13. Taxanes (paclitaxel and docetaxel) are anticancer drugs, both obtained from both derived from the yew. Docetaxel (TAXOTERE®, Rhone-Poulenc Rorer), derived from the European yew, is a semisynthetic analogue of paclitaxel (TAXOL®, Bristol-Myers Squibb). Paclitaxel and docetaxel activate the Assembly of microtubules from tubulin dimers and stabilizes microtubules by preventing depolymerization, resulting in the inhibition of mitosis in cells.

"Chemotherapeutic agent" is a chemical compound used in the treatment of cancer. Examples of chemotherapeutic agents include, adriamycin is, doxorubicin, epirubicin, 5-fluorouracil, cytosine arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cytoxin, taxoid, for example, paclitaxel (Taxol, Bristol-Myers Squibb Oncology, Princeton, NJ), and docetaxel (Taxotere, Rhone-Poulenc Rorer, Antony, France), Taxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, karminomitsin, aminopterin, dactinomycin, mitomycin, espiramicina (see U.S. patent No. 4675187), melphalan and other related nitrogen mustard gases. This definition also includes hormonal drugs, which act by regulating or inhibiting hormonal action of tumors, such as tamoxifen and onapristone.

The term "cytokine" is a generic term for proteins released by one population of cells, which act on another cell as intercellular mediators. Examples of such cytokines are lymphokines, Monokini and conventional polypeptide hormones. Among the cytokines include growth hormone such as human growth hormone, N-methionyl the human growth hormone and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prolactin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyrostimulin hormone (TSH), and luteinizing hormone (LH); the actor growth of hepatocytes; the fibroblast growth factor; prolactin; placental lactogenic; tumor necrosis factor-α and-β; müller inhibiting substance; gonadotropin-associated peptide mouse; inhibin; activin, growth factor vascular endothelial; integrin; thrombopoietin (TPO); nerve growth factors such as NGF-β; platelet growth factor; transforming growth factors (TGF)such as TGF-α and TGF-β; insulin-like growth factor-I and-II; erythropoietin

(EPO);osteoinductive factors; interferons such as interferon-α, -β and-γ; colony stimulating factors (CSFs)such as macrophage-CSF (M-CSF); granulocyte-macrophage-CSF (GM-CSF) and granulocyte-CSF (G-CSF); interleukins (IL)such as IL-1, IL-1α, IL-2, IL-3, IL - 4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12; a tumor necrosis factor such as TNF-α or TNF-β; and other polypeptide factors including LIF and kit ligand (KL). As used here, the term cytokine includes proteins from natural sources or from a culture of recombinant cells and biologically active equivalents of the cytokines with the natural sequence.

As used here, the term "immunoadhesin" means antitelephone molecules, which combine the binding specificity of a heterologous protein (adhesin") with the effector functions of the constant domain of immunoglobulin. Structural immunoadhesin contain amino acid sequence with the desired binding specificn the stew, other than the area of the recognition and binding of the antigen from the antibody (i.e. which is "heterologous"), merged with the sequence of the constant domain of immunoglobulin. Part of adhesin molecules immunoadhesin typically is a contiguous amino acid sequence containing at least the binding site of the receptor or ligand. The sequence of the constant domain of immunoglobulin in immunoadhesin can be obtained from any immunoglobulin, such as an immunoglobulin subtypes of IgG-1, IgG-2, IgG-3, or IgG-4, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.

As used here, the term "inflammatory cells" refers to cells that amplify the inflammatory response, such as mononuclear cells, eosinophils, macrophages, and polymorphonuclear neutrophils (PMN).

Table 1

Table 1(continued)

Table 1(continued)

Table 1(continued)

Table 1(continued)

Table 1(continued)

Table 1(continued)

Table 1(continued)

Table 1(PR is the continuation)

Table 1(continued)

Table 1(continued)

Table 1(continued)

Table 1(continued)

Table 1(continued)

Table 1(continued)

Table 1(continued)
Table 1(continued)

Table 2
PRO87200XXXXXXXXXXXXXXX(Length = 15 amino acids)
Compare proteinXXXXXYYYYYYY(Length = 12 amino acids)
% amino acid sequence identity =
(the number of identically matching amino acid residues between the two sequences of the polypeptides, as determined by ALIGN-2)divided by (the total number of amino acid residues of PRO87299 polypeptide)
5 divided by 15 = 3,3%

Table 3
PRO87299XXXXXXXXXX(Length = 10 amino acids)
Compare proteinXXXXXYYYYYYZZYZ(Length = 15 amino acids)
% amino acid sequence identity =
(the number of identically matching amino acid residues between the two sequences of the polypeptides, as determined by ALIGN-2)divided by (the total number of amino acid residues of PRO87299 polypeptide)
5 divided by 10 = 50%

Table 4
PRO87299-DNANNNNNNNNNNNNNN(Length = 14 nucleotides)
Compare DNANNNNNNLLLLLLLLLL(Length = 16 nucleotides)
percent identity of amino acid sequence
(the number of identically matching nucleotides between the two nucleic acid sequences as determined by ALIGN-2)divided by (the total number of nucleotides of the nucleic acid sequence PRO87299-DNA)
6 divided by 14 = 42.9%of

Table 5
PRO87299-DNANNNNNNNNNNNN(Length = 12 nucleotides)
Compare DNANNNNLLLVV(Length = 9 nucleotides)
% amino acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid sequences as determined by ALIGN-2)divided by (the total number of nucleotides of the nucleic acid sequence PRO87299-DNA)
4 divided by 12 = 33.3%of

II. Compositions and methods according to the invention

A. Full sized PRO87299 polypeptide

The present invention relates to a new identified and selected nucleotide sequences coding for the polypeptides indicated in this application as polypeptide PRO87299. In particular, identified and selected cDNA encoding a variety of PRO87299 polypeptide, as described in more detail in the examples below.

The actual nucleotide sequence of these clones experienced specialist in this field can easily determine the sequencing stored in the Bank clone using generally accepted methods. The estimated amino acid sequence can be determined from the nucleotide sequence with common experience. Described here PRO87299 polypeptide and encoding nucleic acids of the present invention have identified what is believed to be the reading frame best identifiable by sequence information available at the time.

B. Variants of PRO87299 polypeptide

In addition to a full-sized native sequence polypeptides PRO87299 described here assume that you can get options PRO87299. Options PRO87299 can be obtained by introducing appropriate nucleotide substitutions in DNA PRO87299 and/or by synthesis of the desired polypeptide PRO87299. Specialists in this field it is clear that amino acid substitutions can alter post-translational processes PRO87299, such as changing the number or position of glycosylation sites, or changing the characteristics of zakalivanie in the membrane.

About vannie here changes in the native full-size sequence PRO87299 or in different domains PRO87299 can be obtained, for example, using any of the techniques and guidelines for conservative and non-conservative mutations described, for example, in U.S. patent No. 5364934. Change can be a substitution, deletion or insertion of one or more codons encoding PRO87299, which leads to changes in the amino acid sequence of PRO87299 compared with the native sequence PRO87299. Optional modification is a substitution of at least one amino acid to another amino acid in one or more domains PRO87299. Guidance for determining which amino acid residue may be inserted, substituted or deleteroute without adversely affecting the desired activity may be found by comparing the sequence of PRO87299 with sequences of molecules known homologous proteins and minimizing the number of changes of amino acid sequence, is made in regions of high homology. Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the substitution of leucine for serine, i.e. conservative amino acid substitutions. Insertions or deletions may not necessarily lie in the range from approximately 1 to 5 amino acids. Acceptable changes, you can define systematic the mere execution of inserts, deletions or substitutions of amino acids in the sequence and testing of the resulting variants for activity, which has a full-length or Mature native sequence.

Here are fragments of PRO87299 polypeptide. Such fragments may be truncated at the N-end or C-end, or they may lack internal residues, for example, compared with full-sized native protein. In certain fragments lack amino acid residues that are not essential for a desired biological activity of PRO87299 polypeptide.

Fragments of PRO87299 you can get any of the many conventional ways. The desired fragments of the peptide can be synthesized chemically. An alternative method includes receiving fragments of PRO87299 enzymatic cleavage, for example by treatment of the protein with an enzyme known as cleave proteins at sites defined by particular amino acid residues, or by cleavage of the DNA with suitable restriction enzymes and isolation of the desired fragment. Another suitable method involves the selection and amplification of a DNA fragment encoding the desired polypeptide fragment by polymerase chain reaction (PCR). Oligonucleotides that define the desired ends of the DNA fragment used as 5'- and 3'-primers for PCR. Preferably fragm the options of PRO87299 polypeptide have, at least one General biological and/or immunological activity with the native PRO87299 polypeptide described herein.

In specific embodiments, the implementation of interest to conservative substitutions are shown in table 6 under the heading of "preferred substitutions". If such substitutions result in a change in biological activity, then introduce more substantial changes, indicated by "exemplary substitutions" in table 6 and described further below in relation to classes of amino acids, and sceneroot products.

Table 6
The original balanceApproximate replacementPreferred replacement

Significant modification of a function or immunological identity of PRO87299 polypeptide perform by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, in the form conformation sheet or helix, (b) the charge or hydrophobicity of the molecule at the site of the target or (c) the volume of the side chain. Naturally occurring residues are divided into groups based on common properties of the side chain:

(1) hydrophobic: norl Itin, met, ala, val, leu, ile;

(2) neutral hydrophilic: cys, ser, thr;

(3) acidic: asp, glu;

(4) basic: asn, gin, his, lys, arg;

(5) residues that influence chain orientation: gly, pro; and

(6) aromatic: trp, tyr, phe.

Non-conservative substitutions will cause the replacement of a member of one of these classes for another class. Such substituted residues can also be entered in the plots conservative substitutions, or more preferably in the remaining (non-conservative) areas.

Changes can be performed using methods known in the field as oligonucleotide-mediated (site-specific) mutagenesis, alanine scanning, and PCR mutagenesis. Site-specific mutagenesis [Carter et al., Nucl. Acids Res., 13:4331 (1986); Zoller et al., Nucl. Acids Res., 10:6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34:315 (1985)], defined by the restriction mutagenesis [Wells et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986)] or other known methods can be performed on the cloned DNA to obtain the variant DNA PRO87299.

Scanning amino acid analysis can also be used to identify one or more amino acids in a continuous sequence. Among the preferred scanning amino acids are relatively small neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is typically a preferred scanning of the ith amino acid among this group, because it eliminates the side chain after the beta-carbon and is less likely alters the conformation of the main chain variant [Cunningham and Wells, Science, 244: 1081-1085 (1989)]. Alanine also, as a rule, is preferred since it is the most common amino acid. Furthermore, it is often find in-depth and exposed position [Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. MoI. Biol., 150:1 (1976)]. If the substitution of alanine does not have enough options, you can use isothermic amino acid.

C. modification of PRO87299

Covalent modification of PRO87299 also included in the scope of this invention. One type of covalent modification includes a reaction outlined amino acid residues of PRO87299 polypeptide with an organic derivatization tool, capable of reacting with selected side chains or the N - or C-terminal residues of PRO87299. The derivatization bifunctional means used, for example, to cross-stitching PRO87299 with water-insoluble matrix or surface-substrate for use in the method of purification anti-PRO87299 antibodies and Vice versa. Commonly used cross-linking means include, for example, 1,1-bis(diazoacetate)-2-Penilaian, glutaraldehyde, esters of N-hydroxysuccinimide, for example, esters with 4-azidoaniline acid is one homobifunctional complex kidnie esters, including esters of disuccinimidyl, such as 3,3'-dithiobis(succinimidylester), bifunctional maleinimide, such as bis-N-maleimido-1,8-octane; and tools such as methyl-3-[(p-azidophenyl)dithio]propionamide.

Other modifications include desametasone residues glutamine and asparagine to the corresponding residues of glutamine and aspartyl respectively, hydroxylation of Proline and lysine, phosphorylation of hydroxyl groups of the residues was serila or threonyl, methylation of the side chains of α-amino groups of lysine, arginine and histidine [T.E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, pp. 79-86 (1983)], acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group.

Another type of covalent modification of PRO87299 polypeptide, are included in the scope of the present invention, involves changing the nature of the natural glycosylation of the polypeptide. "The changing nature of natural glycosylation of the polypeptide for the purpose here is to describe the removal of one or more hydrocarbon groups found in natural sequence PRO87299 (or removing underlying the glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or the addition of a single and multiple sites of glycosylation which are not present in the natural sequence PRO87299. In addition, the phrase includes qualitative changes in the glycosylation of natural proteins, including the changing nature and relations present different hydrocarbon groups.

Addition of glycosylation sites to PRO87299 polypeptide may involve a change in amino acid sequence. The change can be made, for example, by adding or replacing one or more residues of serine or threonine in the natural sequence PRO87299 (for parcel O-linked glycosylation). Amino acid sequence of PRO87299 can optionally be changed by substitutions at the DNA level, particularly by the introduction of mutations in the DNA encoding a PRO87299 polypeptide, at a pre-selected basis, so get codons that are translated into the desired amino acids.

Other ways of increasing the number of hydrocarbon groups in the PRO87299 polypeptide is by chemical or enzymatic joining of glycosides to the polypeptide. Such methods are described in this area, for example, in WO 87/05330, published on September 11, 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981). Removal of the hydrocarbon groups present in the PRO87299 polypeptide, may be accomplished chemically or enzymatically or mutational substitution of codons that code is the dominant amino acid residues, serve as targets for glycosylation. Methods of chemical deglycosylation known in this field and are described, for example, Hakimuddin, et al., Arch. Biochem. Biophvs., 259:52 (1987) and Edge et al., Anal. Biochem., 118:131 (1981). Enzymatic cleavage of the hydrocarbon groups on the polypeptide can be accomplished using a variety of endo - and Exo - field of glycosidase inhibition, as described in Thotakura et al., Meth. Enzvmol., 138:350 (1987).

Another type of covalent modification of PRO87299 includes associating a PRO87299 polypeptide with one of the many non-protein polymers, e.g. polyethylene glycol (PEG), polypropyleneglycol, or polyoxyalkylene, the method described in U.S. patent No. 4640835; 4496689; 4301144; 4670417; 4791192 or 4179337.

PRO87299 of the present invention can be modified also in this way to obtain chimeric molecule containing PRO87299, merged with another, the heterologous polypeptide or amino acid sequence.

In one embodiment, the implementation of such a chimeric molecule contains protein PRO87299 polypeptide with-tag, which provides an epitope to which can selectively bind antibody against the tag. The epitope-tag, usually placed at the N - or C-end of PRO87299. The presence of such labeled epitope forms PRO87299 can be detected using antibodies against the polypeptide tags. Supply of epitope-tagged allows also easy to clean and the ku PRO87299 by affinity purification using antibodies against the tag or another type of affinity resin, which binds to the epitope tag. Various polypeptides tags and their respective antibodies are well known in this field. Examples include tags polyhistidine (poly-his) or polyhistidine-glycine (poly-his-gly); a polypeptide tag influenza HA and antibody to it 12CA5 [Field et al., MoI. Cell. Biol., 8:2159-2165 (1988)]; the label of c-myc and antibodies thereto 8F9, 3C7, 6E10, G4, B7 and 9E10 [Evan et al., Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the label of glycoprotein D of herpes simplex virus (gD), and antibody to it [Paborsky et al., Pprotein Engineering, 3(6):547-553 (1990)]. Other polypeptides tags include the Flag-peptide [Hopp et al., BioTechnology, 6:1204-1210 (1988)]; peptide epitope KT3 [Martin et al., Science, 255:192-194 (1992)]; peptide epitope of alpha-tubulin [Skinner et al., J. Biol. Chem., 266:15163-15166 (1991)]; and the peptide tag protein gene 10 T7 [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA. 87:6393-6397 (1990)].

In an alternative embodiment, the chimeric molecule may contain protein PRO87299, fused with an immunoglobulin or a particular region of an immunoglobulin. For bivalent Thomas chimeric molecule (also referred to as "immunoadhesin") such a protein can be obtained with the Fc-region of IgG molecules. Slit proteins Ig preferably include the substitution of a soluble form of PRO87299 polypeptide (deletionism or inaktivirovannye transmembrane domain) instead of the at least one variable region of the Ig molecule. In a particularly preferred embodiment, the molten with immunoglobulin protein contains the hinge CH2 and CH3 or CH1 hinge, CH2 and CH3 region of an IgG1 molecule. Getting fused with the immunoglobulin protein, see also U.S. patent No. 5428130, filed June 27, 1995

D. Obtaining PRO87299

The description below primarily relates to the production of PRO87299 cultured cells, transformed or transfitsirovannykh a vector containing a nucleic acid PRO87299. This, of course, provides that alternative methods, which are well known in this field can be used to obtain PRO87299. For example, the sequence PRO87299 or its part can be obtained by direct peptide synthesis using solid-phase methods [see, for example, Stewart et al., Solid-Phase Peptide Synthesis, W.H. Freeman Co., San Francisco, CA (1969); Merrifield, J. Am. Chem. Soc, 85:2149-2154 (1963)]. Protein synthesis in vitro can be performed using manual methods or automatically. Automated synthesis can be performed, for example, using a peptide synthesizer, Applied Biosystems (Foster City, CA) using the manufacturer's instructions. Different parts of PRO87299 can be chemically synthesized separately and combined using chemical or enzymatic methods to retrieve full-PRO87299.

1. The isolation of the DNA that encodes a PRO87299

DNA encoding PRO87299, can be obtained from cDNA libraries derived from tissues that are considered with mRNA PRO87299 mRNA and expressing it on amenable to detection in the Aries. Accordingly DNA PRO87299 person can be conveniently obtained from a cDNA library derived from human tissue, such as described in the examples. Encoding PRO87299 gene can also be obtained from a genomic library or by known synthetic methods (for example, automatic synthesis of nucleic acids).

Libraries can be skanirovat probes (such as antibodies to PRO87299 or oligonucleotides of at least about 20-80 bases)designed to identify the gene of interest or to encode them with protein. Screening of the cDNA library or genomic library of the selected probe may be conducted using conventional methods, such as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989). An alternative method of selection of the gene encoding PRO87299, is the application of the PCR method [Sambrook et al., above; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995)].

In the examples described below are methods of screening the cDNA library. Oligonucleotide sequences selected as probes should have sufficient length and sufficiently unambiguous to minimize false positive signals. The oligonucleotide probe is preferably labeled, so it can be detected by hybridization with DNA in scrinium the library. Methods of labeling are well is swesty in this area and include the use of radioactive labels, such32P-labeled ATP, biotinylation or enzymatic labels. Conditions of hybridization, including moderately strict and highly stringent presented in Sambrook et al., above.

Sequences identified by such methods of screening libraries, can be compared and aligned to other known sequences stored and available in public databases such as GenBank or other private database sequences. Identity sequence (or amino acid or nucleotide level) to specific areas of the molecule or from edge to edge full sequence can be determined using methods known in this field, and as described here.

Nucleic acid having protein coding sequence can be obtained by screening selected cDNA libraries or genomic libraries using the derived amino acid sequence described herein, for the first time, and, if necessary, using conventional methods of primer extension as described in Sambrook et al., above, for the detection of precursors and processing intermediates of mRNA that may not be back transcribed into cDNA.

2. The selection and transformation of host cells

Cell households who Eva was transfusional or transformed expressing or cloning vectors, described herein, for the production of PRO87299 and cultured in conventional nutrient media modified as appropriate for induction of promoters, selecting transformants or amplificati genes encoding the desired sequences. Experienced specialist in this field can, without undue experimentation to choose the cultivation conditions, such as environment, temperature, pH, etc. As a rule, principles, protocols, and practical ways to maximize the productivity of cell cultures can be found in Mammalian Cell Biotechnology: a Practical Approach, M. Butler, ed. (IRL Press, 1991) and Sambrook et al., above.

Methods of transfection of eukaryotic cells and transformation of prokaryotic cells are known to the ordinary person skilled in the art, for example, c CaCl2c CaPO4mediated by liposomes and electroporation. Depending on the host cell transformation is performed using generally accepted methods appropriate to such cells. For prokaryotes, as a rule, use the treatment with calcium using calcium chloride as described in Sambrook et al., above, or electroporation. For the specific transformation of plant cells using Agrobacterium tumefaciens infection, as described in Shaw et al., Gene, 23:315 (1983) and WO 89/05859 published 29 June 1989 For mammalian cells without such cell walls, you can use the method of calcium-phosphate PR is capitali Graham and van der Eb, Virology, 52:456-457 (1978). General aspects of transpency in the system host mammalian cells are described in U.S. patent No 4399216. Transformation in yeast, as a rule, carried out by the methods of Van Solingen et al., J. Bact, 130:946 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA), 76:3829 (1979). However, for the introduction of DNA into cells, you can also use other methods, such as microinjection into the nucleus, electroporation, fusion of bacterial protoplasts with intact cells or polycation, such as polybrene, poliorcetes. Different ways of transforming mammalian cells, see Keown et al., Methods in Enzymology, 185:527-537 (1990) and Mansour et al., Nature, 336:348-352 (1988).

Appropriate cell hosts for cloning or expression of the DNA in the vectors herein include cells prokaryotes, yeast or higher eukaryotes. Suitable prokaryotes include as non-limiting examples of eubacteria, such as gram-negative or gram-positive organisms, for example, Enterobacteriaceae such as E. coli. Publicly available in various strains of E. coli, such as E. coli K12 MM294 (ATCC 31446); E. coli X1776 (ATCC 31537), E. coli strain W3110 (ATCC 27325) and K5 772 (ATCC 53635). Other suitable prokaryotic cell hosts include Enterobacteriaceae such as Escherichia, such as E. coli, Enterohacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and Shigella, as well as Bacilli such as B. subtilis and B. licheniformis (e.g., B. licheniformis 41P described in DD266710, published 12 April 1989), Pseudomonas such as P. aeruginosa, and Streptomyces. These examples are illustrative rather than limiting. Strain W3110 is one of the especially preferred owners or owners of the parent, because it is a commonly used strain-host for fermentati product of recombinant DNA. Preferably a host cell secretes a minimum number of proteolytic enzymes. For example, strain W3110 may be modified to effect a genetic mutation in the genes encoding proteins endogenous to the host, where examples of such hosts include E. coli strain W3110 1A2, which has the complete genotype tonA; E. coli strain W3110 9E4, which has the complete genotype tonA ptr3; E. coli strain W3110 27C7 (ATCC 55244), which has the complete genotype tonA ptr3 phoA E15 (argF-lac)169 degP ompT kanr; E. coli strain W3110 37D6, which has the complete genotype tonA ptr3 phoA E15 (argF-lac)169 degP ompT rbs7 ilvG kanr; E. coli strain W3110 40B4, which is strain 37D6 with deletion degP mutation and instability to kanamycin; and an E. coli strain having mutant periplasmic the protease described in U.S. patent No 4946783, published on 7 August 1990. Alternative suitable methods of cloning in vitro, such as PCR or other reactions with the polymerase nucleic acids.

In addition to prokaryotes, suitable cloning or expressing ozaenae for coding PR087299 vectors are eukaryotic microorganisms, such as filamentous fungi or yeast. Saccharomyces cerevisiae is a commonly used microorganism host of lower eukaryotes. Others include Schizosaccharomyces pombe (Beach and Nurse, Nature, 290: 140 [1981]; EP 139383, published 2 may 1985); Kluyveromyces hosts (U.S. patent No 4943529; Fleer et al., Bio/Technology, 9:968-975 (1991)) such as, e.g., K. lactis (MW98-8C, CBS683, CBS4574; Louvencourt et al., J. Bacteril, 154(2):737-742 [1983]), K. fragilis (ATCC 12424), K. bulgaricus (ATCC 16045), K. wickeramii (ATCC 24178), K. waltii (ATCC 56500), K. drosophilarum (ATCC 36906; Van den Berg et al., Bio/Technology, 8:135 (1990)), K. thermotolerans, and K. marxianus; yarrowia (EP 402226); Pichia pastoris (EP 183070; Sreekrishna et al., J. Basic Environ., 28:265-278 [1988]); Candida; Trichoderma reesia (EP 244234); Neurospora crassa (Case et al., Proc. Natl. Acad. Sci. USA, 76:5259-5263 [1979]); Schwanniomyces such as Schwanniomyces occidentalis (EP 394538 published 31 October 1990); and filamentous fungi such as, e.g., Neurospora, Penicillium, Tolypocladium (WO 91/00357 published 10 January 1991), and Aspergillus hosts such as A. nidulans (Ballance et al., Biochem. Biophys. Res. Commun.. 112:284-289 [1983]; Tilburn et al., Gene, 26:205-221 [1983]; Yelton et al., Proc. Natl. Acad. Sci. USA. 81: 1470-1474 [1984]) and A. niger (Kelly and Hynes, EMBO J., 4:475-479 [1985]). The methylotrophic yeast come here and include as non-limiting examples of yeast able to grow on methanol selected from the genera consisting of Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis, and Rhodotorula. A list of specific species that are examples of this class of yeasts may be found in C. Anthony, The Biochemistry of Methylotrophs, 269 (1982).

Appropriate cell hosts for the expression of g is isosilybin PRO87299 come from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9, as well as plant cells. Examples of suitable cell lines of mammalian hosts include cells of the Chinese hamster ovary (CHO) and COS cells. More specific examples include a line of monkey kidney CV1 transformed by SV40 (COS-7, ATCC CRL 1651); a line of embryonic human kidney (293 or 293 cells, subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59 (1977)); cells Chinese hamster ovary/-DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA. 77:4216 (1980)); the Sertoli cells of the mouse (TM4, Mather, Biol. Reprod., 23:243-251 (1980)); human lung cells (W138, ATCC CCL 75); the cells of the human liver (Hep G2, HB 8065); and tumors of the mammary gland of the mouse (MMT 060562, ATCC CCL51). Assume that the selection of a suitable host cell lies within the competence of specialists in this field.

3. The choice and application of the vector can replicate

Nucleic acid (e.g., cDNA or genomic DNA)encoding a PRO87299, you can insert can replicate in the vector for cloning (amplification of the DNA) or for expression. Various vectors are publicly available. The vector may, for example, be present in the form of plasmids, Comedy, viral particles or phage. A suitable nucleic acid sequence can be inserted into the vector by a variety of methods. As the government is about, DNA is inserted into a suitable plot(plots) restriction endonuclease using methods known in this field. Vector components generally include, as non-limiting examples of one or more signal sequences, the origin of replication, one or more marker genes, an enhancer element, a promoter and termination sequence transcription. For the construction of suitable vectors containing one or more of these components, use conventional ligating known experienced specialist in this field.

Recombinant PRO87299 you can get not only directly, but also, as a fusion polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N-end of the Mature protein or polypeptide. Typically, the signal sequence may be a component of the vector, or it may be part of the DNA that encodes a PRO87299, which is inserted into the vector. The signal sequence may be a prokaryotic signal sequence selected, for example, from the group of the leaders of the alkaline phosphatase, penitsillinazy, lpp, or thermostable enterotoxin II. For secretion in yeast signal is supplemented flax sequence can be represented as, for example, the leader of the yeast invertase leader, alpha factor (including the leaders of the α-factors Saccharomyces and Kluyveromyces, the latter described in U.S. patent No 5010182), or acid phosphatase leader, the leader of glucoamylase C. albicans (EP 362179, published 4 April 1990), or the signal described in WO 90/13646, published November 15, 1990, When the expression in mammalian cells to direct secretion of the protein, you can use the signal sequence mammals, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders.

Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected cells of the host. Such sequences are well known to many bacteria, draugija and viruses. The replication origin of the plasmid pBR322 is suitable for most gram-negative bacteria, the replication origin of the plasmid 2μ suitable for yeast, and various viral starting point of replication (SV40, polyoma, adenovirus, VSV or BPV) are applicable for cloning vectors in mammalian cells. Expressing and cloning vectors usually contain a gene for breeding, also known as selective marker. Typical genes for breeding encode the tree, which (a) provide resistance to antibiotics or other toxins, e.g. ampicillin, neomycin, methotrexate, or tetracycline, (b) complementary auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g. the gene encoding D-alanine-racemase for Bacilli.

An example of a suitable selective markers for mammalian cells are markers, providing identification of cells competent for the uptake of the nucleic acid that encodes a PRO87299, such as DHFR or thymidine kinase. When using wild-type DHFR suitable cell host is a line of CHO cells defective in the activity of DHFR obtained and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77:4216 (1980). Suitable gene for selection for use in yeast is the trp1 gene present in the yeast plasmid YRp7 [Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al., Gene. 7:141 (1979); Tschemper et al., Gene, 10:157 (1980)]. Gene trp1 provides a selective marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No 44076 or PEP4-1 [Jones, Genetics, 85:12 (1977)].

Expressing and cloning vectors usually contain a promoter functionally linked to a nucleic acid sequence that encodes a PRO87299 to direct mRNA synthesis. The promoters recognized by many sweat the social host cells, well known. Promoters suitable for use with prokaryotic hosts include the promoter system β-lactamase and lactose [Chang et al., Nature, 275:615 (1978); Goeddel et al., Nature, 281:544 (1979)], alkaline phosphatase, promotor system of tryptophan (trp) [Goeddel, Nucleic acids Res., 8:4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [deBoer et al., Proc Natl. Acad. Sci. USA, 80: 21-25 (1983)]. Promoters for use in bacterial systems will also contain a Shine-dalgarno sequence (S.D.), functionally linked to DNA that encodes a PRO87299.

Examples of suitable promoter sequences for use with yeast hosts include the promoters for 3-phosphoglycerate [Hitzeman et al., J. Biol. Chem.. 255:2073 (1980)] or other glycolytic enzymes [Hess et al., J. Adv. Enzyme Reg., 7:149 (1968); Holland, Biochemistry, 17:4900 (1978)], such as enolase, glyceraldehyde-3-phosphatedehydrogenase, glucokinase, the pyruvate decarboxylase, phosphofructokinase, glucose-6-fortismere, 3-phosphoglyceromutase, piruwatkinaza, triazolopyrimidine, the isomerase of postglucose and glucokinase.

Other yeast promoters, predstavlyayushie an inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter region of the alcohol dehydrogenase 2, sociogram C, acid phosphatase, enzymes of degradation, links the data with the metabolism of nitrogen, metallothionein, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for the utilization of maltose and galactose. Suitable vectors and promoters for expression in yeast are additionally described in EP 73657.

Transcription PRO87299 with vectors in the cells-the owners of mammals is controlled, for example, by promoters obtained from the genomes of viruses such as virus polyoma, the smallpox virus-diphtheria birds (UK 2211504, published 5 July 1989), adenovirus (such as adenovirus 2), the virus bovine papilloma virus sarcoma birds, cytomegalovirus, a retrovirus, hepatitis B virus and the monkey virus 40 (SV40), heterologous mammalian promoters, e.g. the actin promoters or immunoglobulin, and the promoters of heat shock, provided such promoters are compatible with the systems of the host cell.

Transcription of DNA encoding PRO87299, in higher eukaryotes can be increased by inserting into a vector enhancer sequence. Enhancers are CIS-acting elements of DNA, usually about from 10 to 300 BP that act on a promoter to increase its transcription. Currently, there are many enhancer sequences from mammalian genes (globin, elastase, albumin, α - fetoprotein, and insulin). As a rule, however, will use the enhancer from a eukaryotic virus klecker include the SV40 enhancer on the late side from the starting point of replication (P.N. 100-270), enhancer of early cytomegalovirus promoter, enhancer of polyoma on the late side from the starting point of replication, and adenovirus enhancers. The enhancer can be inserted into the vector at a position 5' or 3' to PRO87299 coding sequence, but preferably locate in site 5' from the promoter.

Expressing the vectors used in eukaryotic cells-the masters (yeast cells, fungi, insects, plants, animals, humans, or containing the kernel cells from other multicellular organisms)will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences of 5' and, occasionally 3'-untranslated regions of eukaryotic or viral DNA or cDNA, are publicly available. These regions contain nucleotide fragments transcribed as polyadenylated fragments in the untranslated portion of the mRNA that encodes a PRO87299.

Other methods, vectors and cells of the hosts that are suitable for adaptation to the synthesis of PRO87299 in the culture of recombinant cells of vertebrates, are described in Gething et al., Nature. 293:620-625 (1981); Mantei et al., Nature, 281:40-46 (1979); EP 117060; and EP 117058.

4. Detection of amplification/gene expression

Amplification and/or gene expression can be measured in a sample directly, for example, by conventional southern blotting, Northern blotting DL the quantitative evaluation of the transcription of mRNA [Thomas, Proc. Natl. Acad. Sci. USA, 77:5201-5205 (1980)], dot blotting (DNA analysis), or in situ hybridization using appropriately labeled probe based on the sequence presented here. Alternatively, you can use antibodies that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and hybrid duplexes, DNA-RNA or DNA duplexes protein. The antibodies, in turn, can be marked and analysis can be carried out where the duplex is bound to the substrate, so that during the formation of duplex on the substrate can be used to detect antibody bound to the duplex.

Alternative gene expression can be measured by immunological methods, such as immunohistochemical staining of cells or tissue slices and analysis of cell culture or body fluids for direct quantitative assessment of the expression of the gene product. Antibodies applicable for immunohistochemical staining and/or analysis of body fluids may be either monoclonal or polyclonal, and can be obtained from any mammal. You can easily obtain antibodies against native sequence PRO87299 polypeptide or against a synthetic peptide based on the DNA sequences presented herein or against exogenous sequence fused to DNA PRO87299 and coding specific epitope of the antibodies is A.

5. Purification of polypeptide

Form PRO87299 can be distinguished from the culture medium or lysate of the host cell. If they are associated with the membrane, they can be released from the membrane using a solution of a suitable detergent (such as Triton-X 100) or by enzymatic cleavage. Cells used for the expression of PRO87299, you can destroy various physical or chemical means, such as cycles of freezing and thawing, sonication, mechanical disruption, or lyse cells means.

It may be desirable to clean PRO87299 from recombinant cell proteins or polypeptides. The following methods are examples of suitable purification methods: fractionation on an ion-exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; precipitation ammonium sulfate; gel filtration using, for example, Sephadex G-75; column with protein separate to remove contaminants such as IgG; and metal chelating columns to bind labeled epitope forms PRO87299. You can apply various methods of protein purification, and such methods are known in this field and are described for example in Deutscher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, Springer-Verlag, New York (1982). Selected stage(the stage of) the cleaning will depend for example, on the nature of the applied method of obtaining and received specific PRO87299.

E. tissue Distribution

Localization of tissue expressing PRO87299, can be identified by determining the mRNA expression in various human tissues. Localization of these genes get information about which fabric is most likely affected by stimulating and inhibiting activity of polypeptides PRO87299. Localization of a gene in a specific tissue also receive a tissue sample for analyses blocking activity, as discussed below.

As indicated previously, the expression of genes in different tissues can be measured common southern-blotting, Northern-blotting to quantify the transcription of mRNA (Thomas, Proc. Natl. Acad. ScL USA, 77:5201-5205 [1980]), dot-blotting (DNA analysis), or in situ hybridization using appropriately labeled probe based on the sequence presented here. Alternatively, you can use antibodies that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and hybrid duplexes, DNA-RNA or DNA duplexes protein.

Alternative gene expression in different tissues can be measured by immunological methods, such as immunohistochemical staining of tissue sections and analysis of cell culture or body fluids for direct quantitative is the first evaluation of the expression product of the gene. Antibodies applicable for immunohistochemical staining and/or analysis of body fluids may be either monoclonal or polyclonal, and can be obtained from any mammal. You can easily obtain antibodies against native sequence PRO87299 polypeptide or against a synthetic peptide based on the DNA sequence that encodes a PRO87299 polypeptide, or against exogenous sequence fused to DNA PRO87299 and coding specific epitope antibodies. General methods for producing antibodies and specific protocols for Northern blot and in situ hybridization are shown below.

F. Studies of antibody binding sites

The activity of PRO87299 polypeptide can be further verified by studies of antibody binding sites that test the ability of anti-PRO87299 antibodies to inhibit the effect of PRO87299 polypeptide, respectively, in tissue cells. Exemplary antibodies include polyclonal, monoclonal, humanized, bespecifically, and heteroconjugate antibodies, which will be described here below. Studies of binding of antibodies can be performed by any known method of analysis, such as analysis of competitive binding, direct and indirect sandwich assays, and analyses thus. Zola, Monoclonal Antibodies: A Manual of Techniques, pp.147-158 (CRC Press, Inc., 1987).

The analyses show jumping is nnogo binding based on the ability of a labeled standard to compete with the analyte, the test sample for binding to a limited number of antibodies. The amount of protein target in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies. To facilitate determining the amount of standard that becomes bound, preferably lower solubility of antibodies before or after the competition, so that the standard and analyte that are associated with the antibodies may conveniently be separated from Standart and analyte, which remain unbound.

Sandwich assays involve the use of two antibodies, each of which is able to communicate with various immunogenic part, or epitope subject to detection of the protein. In the sandwich-the analysis of the analyte in the test sample is bound with the primary antibody immobilized on a solid substrate, and then the secondary antibody svjazyvetsja with the analyte, thus forming an insoluble complex of three parts. See, for example, U.S. patent No 4376110. Secondary antibody itself can be labeled with detectable group (direct sandwich assays)or may be measured using antiimmunoglobulin antibodies labeled with detectable group (indirect sandwich assay). For example, one type of sandwich-analysis is an analysis of ELISA, in this case, the detected group is an enzyme.

A sample of tissue for immunochemistry can be fresh or frozen or you can dive the ü in paraffin and fixed with a preservative, such as, for example, formaldehyde.

G. Analysis based on cells

Analyses of cell-based and animal models for immune-related diseases could be used to further understand the relationship between genes and polypeptides identified herein, and the development and pathogenesis-related immune diseases.

In another method, the cells of the cell type, known to be involved in specific associated with immune disease, transfusional cDNA described here, and analyzed the ability of these cDNA to stimulate or inhibit immune function. Suitable cells can be transliterate desired gene and control the activity of immune function. Such transfetsirovannyh cell line can then be used to test the ability of the compositions of poly - or monoclonal antibodies or antibodies to inhibit or stimulate immune function, for example, to regulate the proliferation of T-cells or infiltration of inflammatory cells. Cells transfetsirovannyh coding sequences of the genes identified herein can further be used to identify drug candidates for the treatment of immune-related diseases.

In addition, primary cultures derived from transgenic animals (as described below) mo is but to use in the analysis of cell-based here, although preferred are stable cell line. Methods of obtaining continuous cell lines are well known in the art (see, e.g., Small et al, MoI. Cell. Biol. 5: 642-648 [1985]).

One appropriate analyses based cells is the reaction of mixed lymphocytes (MLR). Current Protocols in Immunology, unit 3.12; edited by J E Coligan, A M Kruisbeek, D H Marglies, E M Shevach, W Strober, National Institutes of Health, Published by John Wiley & Sons, Inc. In this anilize investigate the ability of the test compound to stimulate or inhibit the proliferation of activated T-cells. Suspension of responding T-cells cultured with allogeneic stimulating cells and the proliferation of T-cells was measured by the absorption of tritium-labeled thymidine. This analysis represents the total measurement of the reactivity of T-cells. Since most T-cells are responsible and when activated, produce IL-2, the differences in autochemistry in this analysis partly reflect differences in the production of IL-2 corresponding cells. The results of the MLR can be verified conventional analysis detection of lymphokine (IL-2). Current Protocols in Immunology, above, 3.15, 6.3.

The proliferative response of T-cells in the MLR analysis may be due to a direct mitogenic properties of the analyzed molecules or activation induced by an external antigen. Activation of T cells requires antigen-specific signal, mediated by T-cells is CNY receptor (TCR), and co-stimulating signal, mediated through a binding interaction with a second ligand, for example, a binding interaction with B7 (CD80, CD86)/CD28. Cross-linking CD28 increases secretion of lymphokine activated T-cells. Activation of T-cells has both negative and positive controls through the binding of ligands with negative or positive effect. CD28 and CTLA-4 are related glycoproteins of the Ig superfamily that bind to B7. The binding of CD28 to B7 has a positive co-stimulating effect on the activation of T cells; binding of CTLA-4 with B7 on the contrary, by contrast, has a deactivating effect on T-cell. Chambers, C. A. and Allison, J. P., Curr. Opin. Immunol. (1997) 9:396. Schwartz, R. H., Cell (1992) 71; 1065; Linsey, P. S., and Ledbetter, J. A., Annu. Rev. Immunol. (1993) JUL: 191; June, C. H. et al, Immunol. Today (1994) 15:321; Jenkins, M. K., Immunity (1994) 1:405. In the study of costimulation were analyzed by co-stimulating or inhibitory activity of PRO87299 polypeptide for T-cells.

Direct application of stimulating compounds according to the invention, was confirmed in experiments with glycoprotein 4-IBB, a member of the family of receptor tumor necrosis factor, which binds to the ligand (4-IBBL), expressed on premirovany T-cells, and transmits the signal activation and growth of T-cells. Alderson, M. E. et al., J. Immunol. (1994) 24:2219.

Use stimulating the th connection-agonist also confirmed experimentally. Activation of 4-1BB treatment with anti-4-1BB antibody-agonist enhances the eradication of tumors. Hellstrom, I. and Hellstrom, K. E., Crit. Rev. Immunol. (1998) 18:l. Therapy immunoadjuvants for the treatment of tumors, described in more detail below, is another example of the use of stimulant compounds according to the invention.

Alternative immunostimulating or reinforcing effect can be achieved by the introduction of PRO87299, which has properties that enhance the properties of vascular permeability. Enhanced vascular permeability may be beneficial for disorders that can reduce local infiltration of immune cells (e.g. monocytes, eosinophils, PMN) and inflammation.

On the other hand, a PRO87299 polypeptide, as well as other compounds according to the invention which are direct inhibitors of cell proliferation/activation of T-cells, secretion of lymphokines and/or vascular permeability, can directly be used for suppressing the immune response. These compounds are applicable to decrease the immune response and to treat immune-related diseases characterized by hyperactive, soroptimism or autoimmune response. Such use of the compounds according to the invention is confirmed by the experiments described above, in which the binding of CTLA-4 with B7 receptor inactivates T cells. Direct the military inhibiting compounds according to the invention operate in a similar way. Expect the use of compounds that inhibit vascular permeability, to reduce inflammation. Such applications will be favorable for treatment conditions associated with excessive inflammation.

Alternative compounds, such as antibodies that bind with stimulating PRO87299 polypeptide and blocking the stimulating effect of these molecules exert a network inhibitory effect and can be used for suppression mediated by T-cell mediated immune response by inhibiting proliferation/activation of T-cells and/or by inhibiting the secretion of lymphokines. Blocking the stimulating effect of the polypeptide suppresses the immune response of a mammal. This application was confirmed in experiments using anti-IL2 antibodies. In these experiments, the antibody binds with IL2 and blocks the binding of IL2 to its receptor, thus providing an inhibiting T-cell effect.

H. Models with animals

The results of the analyses based on the cells in vitro can be further verified using animal models in vivo and analyses the functioning of T-cells. Lots of well known animal models can be used to further understanding of the role of the genes identified herein in the development and pathogenesis associated with immune diseases, and for testireba the Oia effectiveness of therapeutic agents, including antibodies and other antagonists of the natural polypeptides, including low molecular weight antagonists. The essence of such models in vivo makes their predictive for response of patients-people. Models of immune-related diseases in animals include both non-recombinant and recombinant (transgenic) animals. Non-recombinant animal models include, for example, models in rodents, such as mouse model. Such models can be obtained by injecting the cells into syngeneic mice using conventional methods, such as subcutaneous injection, injection into the tail vein, implantation of spleen, intraperitoneally implantation, implantation under the kidney capsule, etc.

Graft-versus-host occurs when immune cells transplanted patients with a weakened immune system or tolerant patients. The donor cells recognize the antigens of the host and answer them. The answer can range from life threatening severe inflammation to moderate cases of diarrhea and weight loss. Model reaction, graft versus host provide ways to assess the reactivity of T cells against antigens MHC and minor antigens of the graft. Suitable methods are described in detail in Current Protocols in Immunology, above, section 4.3.

Model animal for exclusion skin alltrans is antata are a means of testing the ability of T cells to mediate tissue destruction in vivo and measuring their role in graft rejection. In the most common and accepted models use mouse grafts tail-skin. In repeated experiments showed that the rejection of skin allografts mediated by T-cells, T-cells helper T-cells killers-effectors, and not antibodies. Auchincloss, H. Jr. and Sachs, D. H., Fundamental Immunology, 2nd ed., W. E. Paul ed., Raven Press, NY, 1989, 889-992. Suitable methods are described in detail in Current Protocols in Immunology, above, section 4.4. Other models of transplant rejection, which can be used to test the compounds according to the invention, are models of allogeneic heart transplant, described Tanabe, M. et al, Transplantation (1994) 58:23 and Tinubu, S. A. et al, J. Immunol. (1994) 4330-4338.

Model animal for hypersensitivity of the delayed type also provide an analysis mediated by cells of the immune function. Hypersensitivity reactions of the delayed type represent an immune response mediated by T-cells in vivo, characterized by inflammation, which is not peak until the period of time after antigenic stimulus. These reactions occur when tissue-specific autoimmune diseases such as multiple sclerosis (MS) and experimental autoimmune encephalomyelitis (EAE, a model of MS). A suitable method is described in detail in Current Protocols in Immunology, above, part 4.5.

EAE is an autoimmune disease is s, mediated by T cells, characterized by inflammation involving T-cells and mononuclear cells and subsequent demyelination of axons in the Central nervous system. EAE mainly considered a suitable animal model for MS in humans. Bolton, C, Multiple sclerosis (1995) 1:143. Designed as a model with aggravation and models with exacerbation-remission. Compounds according to the invention can be tested by stimulating or inhibiting T-cell activity against immunopositive demyelinating disease using the method described in Current Protocols in Immunology, above, part 15.1 and 15.2. See also models of the disease of myelin, in which oligodendrocytes or Schwann cells transplanted into the Central nervous system, as described in Duncan, I. D. et al, Molec. Med. Today (1997) 554-561.

Contact hypersensitivity is a simple analysis of the in vivo delayed-type hypersensitivity to mediated by cells of the immune function. In this way the skin is exposed to exogenous haptens that causes a reaction of hypersensitivity of the delayed type, which is measured and evaluated quantitatively. Contact sensitivity includes the initial phase of sensitization and subsequent activation phase. Phase activation occurs when T cells encounter antigen, they contact Aravali earlier. Is swelling and inflammation, which makes it a perfect model of allergic contact dermatitis of the person. A suitable method is described in detail in Current Protocols in Immunology, Eds. J. E. Cologan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach and W. Strober, John Wiley & Sons, Inc., 1994, unit 4.2. See also Grabbe, S. and Schwarz, T, Immun. Today 19 (1): 37-44 (1998).

Model of arthritis in animals is collagen-induced arthritis. This model has an overall clinical, histological and immunological features with autoimmune rheumatoid arthritis is an acceptable model of autoimmune arthritis person. Models in the mouse and rat are characterized by synovitis, erosion of cartilage and subchondral bone. Compounds according to the invention can be tested for activity against autoimmune arthritis using methods described in Current Protocols in Immunology, above, part 15.5. Cm. also the model with the use of monoclonal antibodies to CD18 and integrins VLA-4, described in Issekutz, A.C. et al, Immunology (1996) 88:569.

The described model of asthma, in which antigen-induced Hyper-reactivity, pulmonary eosinophilia and inflammation induced sensitization of the animal by ovalbumin and then stimulation of the same animal protein, is introduced into the aerosol. For some animal models (Guinea pig, rat, non-human Primate) shows symptoms similar to symptoms at the microscopic bronchial asthma during stimulation aerosol antigens. Models in mice have many of the properties of asthma people. Suitable methods of test compounds according to the invention on the activity and effectiveness for the treatment of asthma are described in Wolyniec, W. W. et al, Am. J. Respir. Cell MoI. Biol. (1998) 18:777 and cited in the references.

In addition, the compounds according to the invention can be tested in animal models for diseases such as psoriasis. The facts suggest for psoriasis, T-cell pathogenesis. Compounds according to the invention can be tested in the model in mice scid/scid described Schon, M. P. et al, Nat. Med. (1997) 3:183, in which mice are shown histopathological damage to the skin similar to psoriasis. Another suitable model is a Chimera human skin/scid mouse, obtained as described Nickoloff, B. J. et al, Am. J. Path. (1995) 146:580.

Recombinant (transgenic) animal models can be designed by introducing the coding parts of the genes identified herein into the genome of interest animals using conventional methods for producing transgenic animals. Animals that can be used as targets for transgenic manipulation, include as non-limiting examples of mice, rats, rabbits, Guinea pigs, sheep, goats, pigs and non-human primates, such as baboons, chimpanzees and monkeys. In this area known methods of introducing the transgene is in such animals, including microinjection into the pronucleus (Hoppe and Wanger, U.S. patent No 4873191); retrovirus-mediated transfer into germ lines (e.g., Van der Putten et al., Proc. Natl. Acad. Sci USA 82, 6148-615 [1985]); directed action on the gene in embryonic stem cells (Thompson et al., Cell 56, 313-321 [1989]); electroporation of embryos (Lo, Mol. Cel. Biol. 3, 1803-1814 [1983]); mediated sperm gene transfer (Lavitrano et al., Cell 57, 717-73 [1989]). Overview see, for example, in U.S. patent No 4736866.

For the purposes of the present invention transgenic animals include those that carry the transgene only in terms of their cells ("mosaic animals"). The transgene can be entered or as a single transgene or in concatamers, such as the tandem head-to-head or head-to-tail. Selective introduction of a transgene into a specific cell type is also possible, for example, in the following way Lasko et al., Proc. Natl. Acad. ScL USA 89, 6232-636 (1992).

Transgene expression in transgenic animals can be controlled by using common methods. For example, analyses of the southern-blotting or by PCR amplification can be used to test integration of the transgene. You can then analyze the level of mRNA expression using techniques such as in situ hybridization, Northern blot analyses-blotting, PCR or immunocytokine. Animals can continue to explore patologicheskie symptoms of immune diseases, for example, histological, and the following to determine the infiltration of immune cells in a particular tissue. It is possible to also carry out experiments on the block, in which transgenic animals treated with compounds according to the invention for determining the degree of stimulation or suppression compounds proliferation of T-cells. In these experiments, the animal is injected blocking antibodies which are associated with a PRO87299 polypeptide, obtained as described above, and determine the effect on immune function.

Alternatively, you can construct animals with "knockout", which has a defective or altered gene encoding the polypeptide, identified here as the result of homologous recombination between the endogenous gene encoding the polypeptide and altered genomic DNA encoding the same polypeptide introduced into an embryonic cell of the animal. For example, cDNA encoding a specific polypeptide can be used to clone genomic DNA encoding that polypeptide in accordance with conventional ways. Part of the genomic DNA that encodes a particular polypeptide can be deleteroute or replaced with another gene, such as the gene encoding a selective marker, which can be used to monitor integration. Typically, the vector comprises several thousand base pairs unaltered flanking DNA (both at the 5'-and 3'-ends) [see, for example, the description vectors for homologous recombination in Thomas and Capecchi, Cell, 51:503 (1987]. The vector is introduced into a line of embryonic stem cells (e.g., by electroporation) and select the cells which have undergone homologous recombination of introduced DNA with endogenous DNA [see, for example, Li et al., Cell 69:915 (1992)]. Then the selected cell is injected into a blastocyst of an animal (e.g. mouse or rat) to obtain aggregated chimeras [see, e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152]. Then chimeric embryo can be implanted in a suitable loebermann foster female animal, which carries the embryo to term to obtain animal "knockout". Offspring carrying homologous recombinative DNA in germ cells can be identified in a common manner and used for breeding animals in which all cells contain homologous recombinative DNA. Animals with knockout can be characterized, for example, by their ability to defend against certain pathological conditions and for the development of pathological conditions due to absence of the polypeptide.

I. Immunoadjuvant therapy

In one embodiment, the implementation of immunostimulatory compounds according to the invention can be used in immunoadjuvant therapy for the treatment of tumors (cancer). Currently, it is widely accepted that T cells recognize ofwholesale is their antigens person. One group of tumor antigens encoded by gene families MAGE, BAGE and GAGE, is silent in all normal adult tissues, but in significant amounts expressed in tumors, such as melanoma, tumors of the lung, head and neck tumors, and carcinoma of the bladder. DeSmet, C. et ah, (1996) Proc. Natl. Acad. Sci. USA, 93:7149. It is shown that costimulate T-cells induces tumor regression and antitumor response both in vitro and in vivo. Melero, I. et al, Nature Medicine (1997) 3:682; Kwon, E. D. et al, Proc. Natl. Acad. Sci. USA (1997) 94: 8099; Lynch, D. H. et al, Nature Medicine (1997) 3:625; Finn, O. J. and Lotze, M. T., J. Immunol. (1998) 21:114. Stimulating compounds according to the invention it is possible to enter as adjuvants, alone or together with growth regulators agent, cytotoxic agent or chemotherapeutic agent for the stimulation of cell proliferation/activation of T cells and antitumor response to tumor antigens. Growth regulators, cytotoxic or chemotherapeutic agent can be introduced in conventional quantities using known modes of administration. Immunostimulirutuyu activity of the compounds according to the invention allows to reduce the number of growth regulators, cytotoxic or chemotherapeutic agents, thus potentially reducing toxicity for the patient.

J. Analyses of screening candidates for drug

Analyses of screening Kahn is Ipatov on drug developed to identify compounds which bind or form a complex with the polypeptides encoded by specified herein genes, or their biologically active fragments, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins. These screening tests will include tests, suitable for high-throughput screening of chemical libraries, making them particularly suitable for the identification of low-molecular candidates for the drug. Consider small molecules include synthetic organic or inorganic compounds, including peptides, preferably soluble peptides fused proteins (poly)peptide-immunoglobulin, and, in particular, antibodies including, without limitation, poly - and monoclonal antibodies and fragments of antibodies, single-chain antibodies, antiidiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as antibodies and antibody fragments of the person. The analyses may be performed in a variety of formats, including analyses of protein-protein binding assays, biochemical screening, immunoassays and analyses on the basis of cells, a well characterized in this field. Common to all analyses is that they include a contact of a candidate drug with polypeptid the Ohm, encoded as specified in this document nucleic acid under conditions and for a time allowing for the interaction of these two components.

In the analysis of binding interaction is a binding, and the formed complex can be selected or detected in the reaction mixture. In a specific embodiment, the polypeptide encoded by specified herein genome or candidate drug immobilized on the solid phase, for example on the tablet for micrometrology, through covalent or non-covalent attachments. Non-covalent connection, normally carried out by coating the solid surface with a solution of polypeptide and drying. Alternative immobilized antibody, such as monoclonal antibody, specific for the subject to immobilization of the polypeptide, can be used to zakalivanie on a solid surface. The analysis carried out by adding neimmunizirovannah component that can be marked amenable to detection label, to the immobilized component, for example coated surface containing the anchored component. After completion of the reaction, unreacted components are removed, e.g. by washing, and complexes anchored on the solid surface, detects. When initially not immobilizovana the component carries detektiruya tag the detection of label immobilized on the surface indicates the formation of complexes. When not initially immobilized component shall not be detectable label, the formation of the complex can be detected, for example, using a labeled antibody that specifically binds immobilized complex.

If the connection candidate communicates, but not associated with a specific protein, encoded as specified in this document genome, its interaction with this protein can be analyzed by methods well known for detecting protein-protein interactions. Such analyses include conventional methods such as cross-linking, co-immunoprecipitation and joint cleaning on gradients or chromatographic columns. In addition, protein-protein interactions can be monitored using a genetic system based on the yeast described by Fields and co-workers [Fields and Song, Nature (London) 340, 245-246 (1989); Chien et al, Proc. Natl. Acad. ScL USA 88, 9578-9582 (1991)], as described Chevray and Nathans, Proc. Natl. Acad. Sci USA 89, 5789-5793 (1991). Many transcriptional activators, such as yeast GAL4, consist of two physically separate modular domains, one acting as the DNA-binding domain, while the other functions as an activating transcription domain. In the expression system in yeast, as described in upomjanutyh publications (generally referred to as two-hybrid system"), take advantage of this property and apply two hybrid proteins, one in which the protein target is merged with the DNA-binding domain of GAL4, and another, in which candidate activating proteins are fused to the activating domain. The expression of reporter gene GAL1-lacZ under the control of the activated GAL4 promoter depends on the recovery of GAL4 activity via protein-protein interactions. Colonies containing interacting polypeptides, detects a chromogenic substrate for β-galactosidase. Full set (MATCHMAKER™) for identifying protein-protein interactions between two specific proteins using the two-hybrid method, commercially available from Clontech. This system can also be extended to the mapping of protein domains involved in specific protein interactions, as well as on the precise definition of amino acid residues that are critical for these interactions.

To find and test compounds that interfere with the interaction specified in this document gene and other intra - or extracellular components typically get a reaction mixture containing the product of the gene and the intra - or extracellular component under conditions and for a time allowing for the interaction and binding of the two products. To test the ability of test compounds to inhibit svyazyvanie is, the reaction is performed in the absence and presence of test compounds. In addition, in a third reaction mixture, you can add a placebo, which serves as a positive control. The binding (complex formation) between the test compound and the intra - or extracellular component present in the mixture, is controlled, as described above. The formation of a complex in the control reaction mixture (mixes), but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction between the test compound and its reaction partner.

K. Compositions and methods for treating immune-related diseases

Composition applicable for the treatment of immune-related diseases include without limitation proteins, antibodies, small organic molecules, peptides, phosphopeptides, antisense and ribozyme molecules, molecules with triple spiral, etc. that inhibit or stimulate immune function, such as proliferation/activation of T-cells release lymphokines or infiltration of immune cells.

For example, antisense RNA molecules and DNA act to directly block the translation of mRNA by hybridization with targeted mRNA and preventing protein translation. When using antisense DNA, predpochtitelnye oligodeoxyribonucleotide, obtained from the site of initiation of translation, for example, between positions approximately -10 and +10 in the nucleotide sequence of the target genes.

Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act by specific sequences for hybridization with the complementary RNA target, followed endonucleolytic splitting. Specific sites of cleavage by the ribozyme in the potential RNA target can be identified by known methods. For more details see, for example, Rossi, Current Biology 4, 469-471 (1994), and PCT publication No WO 97/33551 (published 18 September 1997).

Molecules of nucleic acid molecules for the formation of the triple helix, used for suppressing the transcription should be single-stranded and composed of deoxynucleotides. Part of the reason these oligonucleotides expect so that it contributed to the formation of a triple helix by the rules of the mating grounds Hogsten that basically requires extensive areas of purines or pyrimidines on one strand of the duplex. For more details see, for example, in PCT publication No WO 97/33551, above.

These molecules can be identified by any of the screening tests, or any combination of any of the screening tests, absurd is utilized above, and/or by any of the screening methods, well known to specialists in this field.

L. Anti-PRO87299 antibodies

The present invention further relates to anti-PRO87299 antibodies. Examples of antibodies include polyclonal, monoclonal, humanized, bespecifically and heteroconjugate antibodies.

1. Polyclonal antibodies

Anti-PRO87299 antibodies may comprise polyclonal antibodies. Methods of obtaining polyclonal antibodies known to experienced specialist in this field. Education polyclonal antibodies can be induced in mammals, for example, one or more injection immunizing substances and, if desirable, the adjuvant. Typically, the immunizing agent and/or adjuvant can be injected to the mammal by multiple subcutaneous or intraperitoneal injections. Immunizing substance may include a PRO87299 polypeptide, or merged with it protein. May be useful to konjugierte immunizing substance with the protein, known as immunogenic for the immunized mammal. Examples of such immunogenic proteins include as non-limiting examples hemocyanin marine saucer, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants that can skin the th include full beta-blockers and adjuvant MPL-TDM (monophosphoryl lipid A, synthetic dikarenakan trehalose). The person skilled in the art can choose the way immunization without undue experimentation.

2. Monoclonal antibodies

Anti-PRO87299 antibody alternative can be a monoclonal antibody. Monoclonal antibodies can be obtained using methods hybridoma, such as described in Kohler and Milstein, Nature, 256:495 (1975). In the way hybridoma mouse, hamster, or other appropriate animal host, as a rule, subjected to immunization immunization substance to activate the lymphocytes that produce or are capable of producing antibodies that will specifically bind with the immunizing agent. Alternatively, you can immunize lymphocytes in vitro.

Immunizing substance, typically, will include a PRO87299 polypeptide, or merged with it protein. As a rule, use or peripheral blood lymphocytes ("PBL"), if desired cells of human origin, or spleen cells or lymph node cells, if desired sources from non-human mammals. Then lymphocytes merge with immortalizing a cell line using a suitable causes cell fusion agents, such as polyethylene glycol, to obtain glue the Ki hybridoma [Goding, Monoclonal antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells related to rodents, bull and man. Commonly used cell line myeloma rat or mouse. Cell hybridoma can be grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival is not merged immortalized cells. For example, if the parental cells lacking the enzyme gipoksantin-guanine-phosphoribosyltransferase (HGPRT or HPRT), the culture medium for hybridoma, as a rule, will contain gipoksantin, aminopterin and thymidine ("medium HAT") - substances that prevent the growth of HGPRT-deficient cells.

Preferred termed the cell lines are cells that effectively merge, maintain a high level of expression of antibodies selected producing the antibody by cells and are sensitive to the environment, such as environment HAT. More preferred termed the cell lines are lines myeloma mice, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California, and American Type Culture Collection, Manassas, Virginia. It also describes the production of monoclonal antibodies in cell lines of human myeloma and heteromyinae mouse-man [Kozbor, J. Immunol., 133:3001 (1984); Brodeur et al., Monoclonal antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63].

Then in a culture medium in which granulosa cells hybridoma, you can analyze the presence of monoclonal antibodies directed against PRO87299. Preferably, the binding specificity of monoclonal antibodies produced by cells of hybridoma determine immunoprecipitate or analysis of binding in vitro, such as radioimmune assay (RIA) or enzyme-linked immunosorbent assay (ELISA). Such methods and assays known in the field. The binding affinity of the monoclonal antibody can, for example, be determined by analysis of Scatchard by Munson and Pollard, Anal. Biochem., 107:220 (1980).

After identifying the desired cells hybridoma clones can be subclinical ways of limiting dilutions and grow conventional methods [Goding, above]. Suitable for this purpose, the culture medium includes, for example, a Needle, modified, Dulbecco and medium RPMI-1640. Alternative cell hybridoma can be grown in vivo in the form of ascites in a mammal.

Monoclonal antibodies secreted by the subclones, you can select or clear from the culture medium or ascitic fluid conventional immunoglobulin purification methods, such as, for example, purification on protein A-sepharose, chromatography on guide is oxyapatite, gel electrophoresis, dialysis, or affinity chromatography.

Monoclonal antibodies can also be obtained by means of recombinant DNA, such as described in U.S. patent No. 4816567. DNA encoding the monoclonal antibodies according to the invention can be easily isolated and sequenced using conventional methods (e.g., using oligonucleotide probes that can specifically bind to genes encoding the heavy and light chains of murine antibodies). Cell hybridoma according to the invention are suitable source of such DNA. After DNA extraction can be placed in expressing vectors, which are then transferout cell host, such as simian COS cells, ovarian cells of the Chinese hamster (CHO) or myeloma cells that do not otherwise produce protein immunoglobulin, to obtain the synthesis of monoclonal antibodies in the recombinant cell host. DNA also can be modified, for example, by replacing the coding sequences of the constant domains of the heavy and light chains of human homologous murine sequences [U.S. patent No. 4816567; Morrison et al., above] or covalent joining the coding sequence of the immunoglobulin whole or part of the coding sequence of the non-immunoglobulin polypeptide. Such non-immunoglobulin polypeptide is m it is possible to replace the constant domains of the antibodies according to the invention or to replace their variable domains combine with the antigen site of the antibodies according to the invention for obtaining a chimeric bivalent antibody.

Antibodies may represent a monovalent antibody. Methods of obtaining monovalent antibodies are well known in this field. For example, one method involves recombinant expression of light chain immunoglobulin and a modified heavy chain. Typically, a heavy chain shortening in any point of the Fc-region to prevent cross-stitching heavy chains. Alternative essential cysteine residues substituted with other amino acid residue or deleteroute to prevent cross-stitching.

In vitro methods are also suitable for the production of a monovalent antibody. Cleavage of the antibodies for their fragments, especially Fab fragments, can be accomplished using conventional methods known in this field.

3. Human and humanized antibodies

Anti-PRO87299 antibodies according to the invention can additionally be treated with humanized antibodies or human antibodies. Humanized forms of non-human (e.g. murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2or other antigen binding sequences of antibodies)that contain minimal sequence derived from non-human immunoglobulin is on. Humanized antibodies include human immunoglobulins (antibody-recipient), in which residues from a complementarity determining region (CDR) of the recipient replace residues from the CDR of non-human species (the antibody-donor), such as a mouse, rat or rabbit having the desired specificity, affinity and capacity. In some cases, the frame remains Fv human immunoglobulin replace the corresponding non-human residues. Humanized antibodies may also comprise residues that are not found either in the antibody-recipient, nor in the imported CDR sequences or frame. As a rule, humanitariannet antibody contains basically all of at least one, and typically two, variable domains, in which all or substantially all of the CDR field correspond to non-human immunoglobulin and all or substantially all areas FR constitute the region of the consensus sequence of human immunoglobulin. Optimally, humanitariannet antibody will contain also at least part of a constant region of immunoglobulin (Fc), typically from a human immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].

Methods of humanizing non-human antibodies Ho who Osho is known in this field. As a rule, humanitariannet antibody has one or more amino acid residues introduced into it from a non-human source. These non-human amino acid residues are commonly referred to as "import" residues, which are typically taken from an "import" variable domain. Humanization essentially you can spend according to the method of Winter and co-workers [Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)] by replacing the replacement CDRs or CDR sequences of rodents corresponding sequences of human antibodies. Therefore, such "humanized" antibodies are chimeric antibodies (U.S. patent No 4816567), where essentially less than an intact human variable domain replaced with a corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues replaced by residues from analogous sites of antibodies rodents.

Human antibodies can also be obtained using various methods known in this field, including libraries of phage display [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)]. Methods Cole et al. and Boerner et al. she is also available for obtaining human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(1):86-95 (1991)]. Similarly, human antibodies can be obtained by the introduction of loci of human antibodies in transgenic animals, such as mice in which the endogenous immunoglobulin genes partially or completely inactivated. When the stimulation was detected production of human antibodies, closely similar to that found in human products in all respects, including rearrangeable genes, the Assembly and the repertoire of antibodies. This method is described, for example, in U.S. patent No 5545807, 5545806, 5569825, 5625126, 5633425, 5661016 and in the following scientific publications: Marks et al., Bio/Technology 10, 779-783 (1992); Lonberg et al., Nature 368 856-859 (1994); Morrison, Nature 368, 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995).

You can also affinity maturation of antibodies using known methods of selection and/or mutagenesis, as described above. Preferably affine Mature antibodies have affinity to five times, more preferably 10 times, even more preferably 20 or 30 times greater than that of the original antibody (usually mouse, gumanitarnogo or human), from which the Mature antibody.

4. Bespecifically antibodies

Bespecifically antibodies are monoclonal, preferably human or humanitarian, antibodies with specificnosti binding at least two different antigens. In this case, there is one binding specificdate for domain PRO87299, the other is for any other antigen, and preferably for a protein on the cell surface or receptor or receptor subunit.

Methods of obtaining bespecifically antibodies known in the field. Typically, recombinant products bespecifically antibodies is based on the co-expression of two pairs of heavy chain/light chain immunoglobulin, where the two heavy chains have different specificnosti. [Milstein and Cuello, Nature, 305:537-539 (1983)]. Because of the random assortment of heavy and light chains of immunoglobulins data hybridoma (quadroma) produce a potential mixture of ten different antibody molecules, of which only one has the correct bespecifically structure. The selection of the correct molecule typically includes stage affinity chromatography. Such procedures are described in WO 93/08829, published 13 may 1993, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).

The variable domains of the antibodies with the desired binding specificnosti (plots combining the antibody-antigen) can be attached to the sequences of the constant domains of immunoglobulins. Protein preferably contains the constant domain of the heavy chain of immunoglobulin is a, containing at least part of the hinge regions CH2 and CH3. Preferably, the first constant region of the heavy chain (CH1)containing the site necessary for binding to the light chain was present in at least one of the fused proteins. DNA encoding the fused protein with heavy chains of immunoglobulins and, if desirable, with the light chains of immunoglobulins, insert different expressing vectors and cotransfected in a suitable organism, the host. For more details get bespecifically antibodies see, for example, Suresh et al., Methods in Enzymology, 121:210 (1986).

According to another method described in WO 96/27011, the boundary between a pair of antibody molecules can be modified to maximize the percentage of heterodimers isolated from the culture of recombinant cells. The preferred boundary contains at least a part of the CH3 region of the constant domain of the antibody. In this way one or more small side chains of the amino acids from the interface of the first antibody molecules replace the larger side chains (e.g. tyrosine or tryptophan). Compensatory "cavities" of the same size as a large side chain (chain), or similar in size to create the interface of the second antibody molecules by replacing the large side chains of amino acids into smaller (e.g., alanine or ronin). It provides a mechanism to increase the output of heterodimer higher than that of other unwanted end-products such as homodimers.

Bespecifically antibodies can be obtained as full-length antibodies or antibody fragments (for example, F(ab')2bespecifically antibodies). Methods of obtaining bespecifically antibody fragments of the antibodies described in the literature. For example, bespecifically antibodies can be obtained by chemical binding. Brennan et al., Science 229:81 (1985) describe how, where intact antibodies proteoliticeski split to obtain F(ab')2-fragments. These fragments regenerate in the presence of complexing agents with a dithiol of sodium arsenite to stabilize neighboring dithioles and prevent the formation of intermolecular disulfides. The obtained Fab'-fragments are then transferred to the derivative of dinitrobenzoate (TNB). One of the derivatives of Fab'-TNB then transferred back to the Fab'-thiol by reduction with mercaptoethylamine and mixed with equimolar amounts of the other derived Fab'-TNB for forming especifismo antibodies. Received bespecifically antibodies can be used as tools for selective immobilization of enzymes.

Fab'fragments can be distinguished directly from E. coli and combine chemically to obtain bespecifically is NITEL. Shalaby et al., J. Exp. Med. 175:217-225 (1992) describe obtaining molecules completely gumanitarnogo especifismo antibody F(ab')2. Each Fab'fragment separately secretively from E. coli and subjected to direct chemical binding in vitro to obtain especifismo antibodies. Bespecifically antibody thus obtained, capable of contacting cells, sverkhekspressiya receptor ErbB2, and normal T-cells, as well as to run the lytic activity of human cytotoxic lymphocytes against targets breast cancer person.

Also described various methods for obtaining and allocating fragments bespecifically antibodies directly from a culture of recombinant cells. For example, bespecifically antibody was obtained with the application of latinovich lightning. Kostelny et al., J. Immunol. 148(5):1547-1553 (1992). Peptides with latinboy lightning from proteins Fos and Jun merge genes were added to the Fab'-portions of two different antibodies. Homodimeric antibodies were restored in the hinge region to obtain monomers and then re-oxidized to form heterodimeric antibodies. This method can also be used to obtain homodimeric antibodies. The way to "datel"described by Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993), represents an alternative mechanism for obtaining fragments bespecifically antibodies. Fragments of the gain variable domain of the heavy chain (V H)connected to the variable domain light chain (VL) a linker that is too short to allow pairing of the two domains of the same chain. Accordingly, VHand VLdomains of one fragment are forced to mate with a complementary VHand VL-domains of another fragment, thereby forming two antigenspecific plot. Published also another strategy to obtain fragments especifismo antibodies through the use of single-chain Fv dimers (sFv). See Gruber et al., J. Immunol. 152:5368 (1994). Consider antibodies with more than two valencies. For example, you can get thespecification antibodies. Tutt et al., J. Immunol. 147:60 (1991).

Approximate bespecifically antibodies may bind to two different epitopes on the polypeptide PRO87299 here. Alternative shoulder against PRO87299 polypeptide can be combined with an arm that binds to a triggering molecule on a leukocyte such as a molecule T-cell receptor (e.g., CD2, CD3, CD28, or B7), or Fc receptors for IgG (FcγR), such as FcγRI (CD64), FcγRII (CD32) and FcγRIII (CD16), so as to focus cellular defense mechanisms to the cell expressing the particular PRO87299 polypeptide. Bespecifically antibodies can also be used to localize cytotoxic agents to cells expressing specific PRO87299 polypeptide. These antibodies possess the up shoulder, linking PRO87299, and the arm that binds the cytotoxic agent or a radionuclide chelating agent, such as EOTUBE, DPTA, DOTA, or TETA. Another interesting bespecifically the antibody binds to PRO87299 polypeptide, and optionally binds tissue factor (TF).

5. Heteroconjugate antibodies

The present invention relates also to heteroconjugate antibodies. Heteroconjugate antibodies composed of two covalently United antibodies. Such antibodies are, for example, to target immune system cells to unwanted cells [U.S. patent No 4676980] and for the treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089]. Assume that antibodies can be obtained in vitro using known methods in synthetic chemistry of proteins, including means comprising means for cross-stitching. For example, it is possible to construct immunotoxins using reaction disulfide exchange or by formation of a thioester linkages. Examples suitable for this purpose reagents include aminothiols, methyl-4-mercaptopyrimidine and reagents described, for example, in U.S. patent No 4676980.

6. Modification of effector functions

It may be desirable to modify the antibody of the invention with respect to effector function, so that, for example, to improve the efficiency of antibodies for Leche is of cancer. For example, in the Fc-region, you can enter the balance (remainder) of cysteine, thus allowing the formation of messagewall disulfide bond in this field. Thus obtained homodimeric antibody may have an improved ability to internalize and/or increased complement-dependent cytolysis and antibody-dependent cellular cytotoxicity (ADCC). Cm. Caron et al., J. Exp Med., 176: 1191-1195 (1992) and Shopes, J. Immunol., 148: 2918-2922 (1992). Homodimeric antibodies with enhanced anti-tumor activity can also be obtained using heterobifunctional cross-linking means, as described in Wolff et al. Cancer Research 53: 2560-2565 (1993). Alternatively, you can construct antibody with dual Fc regions and, thus, to increase the lysis by complement and ability to ADCC. See Stevenson et al., Anti-Cancer Drug Design, 3: 219-230 (1989).

7. Immunoconjugate

The invention relates also to immunoconjugates containing antibody conjugated with a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., enzymatically active toxin of bacterial, fungal, plant or animal or its fragment), or a radioactive isotope (i.e radioconjugates).

Chemotherapeutic applicable for such immunoconjugates described above. Enzymatically active toxins and fragments thereof that can is to apply, include A chain of diphtheria, nesviazana active fragments of diphtheria toxin a chain, exotoxin A (from Pseudomonas aeruginosa), chain A of ricin chain abrina, A chain of medecine, alpha sarcin, proteins Aleurites fordii proteins with giantino, proteins, Phytolaca americana (PAPI, PAPII, and PAP-S), the inhibitor from momordica charantia, Curtin, krotin, inhibitor of sapaonaria officinalis, gelonin, mitogillin, restrictocin, vanomycin, inomycin and trichothecenes. Many radioactive isotopes are available for the production of radioconjugates antibodies. Examples include212Bi131I131In90Y and186Re.

Conjugates of the antibody and cytotoxic receive funds using a variety of bifunctional binding proteins funds, such as N-Succinimidyl-3-(2-pyridyldithio)propionate (SPDP), aminothiols (IT), bifunctional derivatives of imidapril (such as dimethylacetamide HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis-(p-azidobenzoyl)hexanediamine), derivatives of bis -, page (such as bis-(p-diezani-benzoyl)-Ethylenediamine), diisocyanates (such as toluene 2,6-diisocyanate), and bis-active fluorine compounds (such as 1,5-Diptera-2,4-dinitrobenzene). For example, rezinovy immunotoxin can be obtained as described in Vitetta et al., Science, 238: 1098 (1987). Labelled with carbon-14 1 - isothiocyanato SIL-3-metallienjalostuksessa acid (MX-DTPA) is an example of a chelating substances for conjugation of radioactive isotopes with the antibody. Cm. WO94/11026.

In another embodiment, the antibody can be konjugierte with the "receptor" (such as streptavidin) for use in pre-targeting the tumor, where the patient is injected with the conjugate of the antibody-receptor, followed by removal of unbound conjugate from the circulation using a cleanser and then the introduction of a "ligand" (e.g., avidin)conjugated to a cytotoxic agent (e.g. a radioactive isotope).

8. Immunoliposome

These antibodies can also be as immunoliposome. Liposomes containing the antibody are obtained by methods known in this field, such as described in Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688 (1985); Hwang et al., Proc. Natl Acad. Sci. USA, 77: 4030 (1980); and U.S. patent No 4485045 and 4544545. Liposomes with enhanced circulation time is described in U.S. patent No. 5013556.

Particularly useful liposomes can be obtained by way of reverse-phase evaporation with a mixture of lipids containing phosphatidylcholine, cholesterol and PEG-derivationally the phosphatidylethanolamine (PEG-PE). Liposomes extruded through filters with defined pore size to obtain liposomes of the desired diameter. Fab'-fragments of the antibodies of the present invention can be konjugierte with liposomes as described in Martin et al., J. Biol. Chem., 257: 286-288 (1982), by dyslipidemias reaction. Inside the liposomes is not necessary, signed chemotherapeutic agent (such as doxorubicin). See Gabizon et al., J. National Cancer Inst., 81(19): 1484 (1989).

M. Pharmaceutical composition

Active molecules PRO87299 according to the invention (for example, a PRO87299 polypeptide, anti-PRO87299 antibodies, and/or variants of each), as well as other molecules identified by the screening tests described here previously, you can enter for the treatment of immune-related diseases in the form of pharmaceutical compositions.

Therapeutic formulations of the active molecule PRO87299, preferably the polypeptide or antibody according to the invention, prepared for storage by mixing the active molecule having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington''s Pharmaceutical Sciences 16th edition, Osol, A. Ed. [1980]), in the form in the form of lyophilized formulations or aqueous mud. Acceptable carriers, excipients or stabilizers are nontoxic to recipients at the dosages and concentrations, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecylsilane ammonium chloride; the chloride of hexane; benzalkonium chloride, chloride benzene; phenol, butyl or benzyl alcohol; al is elbarbary, such as methyl or propyl paraben; catechin; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; hepatoblastoma agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; soleobrazutaya counterions such as sodium; metal complexes (e.g., complexes of Zn-protein); and/or nonionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG).

Compounds identified in the screening assays described herein, it is possible to make a similar manner using conventional methods, well known in this field. For delivery of molecules PRO87299 in cells, you can use lipofectin or liposomes. When using fragments of antibodies preferred is the smallest inhibitory fragment that specifically bind with the binding domain of the protein target. For example, on the basis of sequences of the variable regions of the antibodies can be constructed peptide molecules that retain the ability to tie the to the planned sequence of the protein. Such peptides can be synthesized chemically and/or receive by way of recombinant DNA (see, e.g., Marasco et al., Proc. Natl. Acad. ScL USA 90, 7889-7893 [1993]).

The compositions herein may also contain more than one active ingredient, as required for a specific symptom to be treated, preferably components with complementary action that do not have a negative influence on each other. Alternative or additionally, the composition may contain a cytotoxic agent, cytokine, chemotherapeutic agent or an agent with the vast growth. Such molecules, respectively, are present in combination in amounts that are effective for the intended purpose.

Active molecules PRO87299 you can capture in microcapsules obtained, for example, ways koatservatsii or interfacial polymerization, for example hydroxymethylcellulose or gelatin microcapsules and poly-(methylmethacrylate) microcapsules, respectively, in colloidal drug-delivery systems (e.g. liposomes, albumen the microspheres, microemulsions, nanoparticles and nanocapsules) or in microemulsion. Such methods are described in Remington''s Pharmaceutical Sciences, 16th edition, Osol, A. Ed. (1980).

The compositions used for the introduction in vivo, must be sterile. This is easily achieved by filtration through sterile filtration membranes.

you Can obtain drugs molecules PRO87299 with prolonged action. Suitable examples of preparations with prolonged action include semi-permeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g. films, or microcapsules. Examples of matrices with prolonged action include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinyl alcohol)), polylactide (U.S. patent No 3773919), copolymers of L-glutamic acid and γ-ethyl-L-glutamate, non-biodegradable, the ethylene vinyl acetate, degradable copolymers of lactic acid - glycolic acid such as the LUPRON DEPOT™ (suitable for injection of microspheres comprising a copolymer of lactic acid - glycolic acid and acetate leuprolide), and poly-D-(-)-3-hydroxybutiric the acid. While polymers such as ethylene vinyl acetate and lactic acid - glycolic acid capable of releasing molecules for over 100 days, specific hydrogels release proteins for shorter time periods. When encapsulated antibodies remain in the body for a long time, they can denaturing or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. You can develop a reasonable strategy for stabilization depending on the involved fur the mechanism. For example, if you discovered that the mechanism of aggregation is the formation of intermolecular S-S linkages via thiol-disulfide exchange, it is possible to achieve stabilization by modifying sulfhydryl residues, lyophilisation from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.

N. treatment

Assume that the polypeptides, antibodies and other active compounds of the present invention can be used to treat various immune-related diseases and conditions, such as mediated T-cell diseases, including diseases characterized by infiltration of inflammatory cells in the tissue, stimulation of proliferation of T cells, by suppressing the proliferation of T-cells, increases or decreases vascular permeability or deceleration.

Condition or disorder to be treated with the polypeptides, antibodies and other compounds of the invention include as non-limiting examples of systemic lupus erythematosus, rheumatoid arthritis, juvenile chronic arthritis, osteoarthritis, spondyloarthropathies, systemic sclerosis (scleroderma), idiopathic inflammatory myopathies (dermatomyositis, polymyositis), Sjogren syndrome, systemic vasculitis, sarcoidosis, is utoimmune hemolytic anemia (immune pancytopenia, paroxysmal night hemoglobinuria), autoimmune thrombocytopenia (idiopathic thrombocytopenic purple, immunopositive thrombocytopenia), thyroiditis (graves ' disease, Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic thyroiditis), diabetes mellitus, immunopositive kidney disease (glomerulonephritis, tubulointerstitial nephritis), demyelinating diseases of the Central and peripheral nervous systems such as multiple sclerosis, idiopathic demyelinizing polyneuropathy or Guillain - Barre syndrome, and chronic inflammatory demyelinizing polyneuropathy, hepatobiliary diseases such as infectious hepatitis (hepatitis A, B, C, D, E and other nagapattanam viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis, inflammatory bowel disease (ulcerative colitis: Crohn's disease), patentability enteropathy, and Whipple's disease, autoimmune or immune skin diseases including bullous skin diseases, polymorphic erythema, and contact dermatitis, psoriasis, allergic diseases such as asthma, allergic rhinitis, atopic dermatitis, hypersensitivity to food and urticaria, immunological diseases easily, such makeuseroffline pneumonia, idiopathic pulmonary fibrosis and hypersensitive pneumonitis associated with transplantation diseases including graft rejection and graft-versus-host.

In systemic lupus erythematosus with Central mediator of disease is the production of self-reactive antibodies to native proteins/tissues and the subsequent emergence of immunopositive inflammation. Antibodies directly or indirectly mediate tissue damage. Although it has not been shown that T-lymphocytes directly involved in tissue destruction, T-lymphocytes is necessary for the formation of self-reactive antibodies. Thus, the Genesis of the disease is dependent on T-lymphocytes. Many organs and systems are clinically affected, including kidney, lung, skeletal-muscular system, the skin and mucous membranes, eyes, Central nervous system, cardiovascular system, gastrointestinal tract, bone marrow and blood.

Rheumatoid arthritis (RA) is a chronic systemic autoimmune inflammatory disease that primarily affects the synovial membranes of multiple joints, which leads to damage to the articular cartilage. Pathogenesis depends on T-lymphocytes and is associated with the production of rheumatoid factors are autoantibodies directed against IgG, with the formation in accordance with the ATA immune complexes, reaching high levels in synovial fluid and blood. These complexes in the joint can induce a marked infiltration of lymphocytes and monocytes in the synovial membrane and subsequent changes noticeably Zinoviy; joint crack/liquid infiltrated same cells with the addition of numerous neutrophils. Damaged tissues are primarily the joints, often in a symmetric manner. However, there are also extra-articular disease two main forms. One form is the development of cartilage lesions in continuing to progress the disease of the joints and typical lesions of pulmonary fibrosis, vasculitis, and cutaneous ulcers. The second form of extra-articular disease is a so-called syndrome still's that occur late in the course of the disease, sometimes after sustavnoi disease becomes inactive, and including the presence of neutropenia, thrombocytopenia and splenomegaly. This may be accompanied by vasculitis in multiple organs with the occurrence of heart attacks, skin ulcers and gangrene. Patients often develop rheumatoid nodules in the subcutaneous layer, which is above the damaged joints; at a later stage nodules have necrotic centers surrounded by a mixed infiltrate of inflammatory cells. Other manifestations that can occur in RA include all the I: pericarditis, pleural effusion, coronary Takayasu, interstitial pneumonitis with fibrosis of the lungs, dry conjunctivitis and rheumatoid nodules.

Juvenile chronic arthritis is a chronic idiopathic inflammatory disease that often begins at the age of 16 years. Its phenotype has some similarities with RA; some patients positive for rheumatoid factor, are classified as suffering from juvenile chronic arthritis. The disease is divided into three main categories: oligoarticular, polyarticular and systemic. Arthritis can be severe and, as a rule, is destructive and leads to ankylosis of the joints and stunted growth. Other symptoms may include chronic anterior uveitis and systemic amyloidosis.

Spondyloarthropathies are a group of disorders with some common clinical signs and a common connection with the expression product of the gene HLA-B27. Disorders include: ankylosing spondylitis, Reiter syndrome (reactive arthritis), arthritis associated with inflammatory bowel disease, spondylitis associated with psoriasis, spondyloarthropathy with early debut and undifferentiated spondyloarthropathy. Distinctive features include sacroiliac with or without spondylitis; inflammatory asymmetric arthritis; tie is with HLA-B27 (serologically defined by the allele at locus HLA-B MHC class I); inflammation of the eyes and the absence of autoantibodies associated with other rheumatoid disease. Cell, the most involved as a key for the induction of the disease, is CD8+ T-lymphocyte, cell, focused on the antigen, pretentiously molecules MHC I class. CD8+ T cells may react against the allele HLA-B27 MHC class I, as if he was an alien peptide molecule expressed MHC I class. He hypothesized that the epitope of HLA-B27 can simulate bacterial or other microbial antigenic epitope, and thus to induce the response of CD8+T-cells.

Systemic sclerosis (scleroderma) has an unknown etiology. The criterion of disease is a thickening of the skin; probably, it induced an active inflammatory process. Scleroderma may be local or systemic; are common lesions in blood vessels, and damage to endothelial cells in the microvasculature is an early and important event in the development of systemic sclerosis; vascular damage may be immunopositive. Immunological basis is expressed in the presence of infiltrates of mononuclear cells in skin lesions and in the presence of many patients antinuclear antibodies. Regulation of ICAM-1 on the cell surface of fibroblasts often increased in the lesions on the skin, suggesting that usaimage is the result of T-cells these cells may play a role in the pathogenesis of the disease. Other affected organs include: digestive tract: atrophy of smooth muscle and fibrosis, leading to abnormal peristalsis/contractility; kidney: concentric subendothelial intimal proliferation, affecting small interlobular and arc artery with resulting reduced renal cortical blood flow, leading to proteinuria, azotemii and hypertension; skeletal muscle: atrophy, interstitial fibrosis; inflammation; lung: interstitial pneumonitis and interstitial fibrosis; and the heart: necrosis strip cuts, scarring/fibrosis.

Idiopathic inflammatory myopathies including dermatomyositis, polymyositis, and other, represent a disorder of chronic muscle inflammation of unknown etiology leading to muscle weakness. Damage/inflammation of the muscles is often symmetrical and progressive. With most forms associated autoantibodies. These myositis-specific autoantibodies directed against the protein and RNA components involved in protein synthesis, and inhibit their function.

Sjogren syndrome is caused immunopositive inflammation and subsequent functional damage to the tear glands and salivary glands. The disease may be associated with inflammatory diseases of the connective tissue and or be accompanied them. The disease is associated with the production of autoantibodies against antigens Ro and La, both of which are small complexes of RNA-protein. Lesions lead to dry conjunctivitis, xerostomia, with other demonstrations or related lesions, including biliary cirrhosis, peripheral or sensory neuropathy and palpable purple.

Systemic vasculitis are diseases in which the primary lesion is inflammation and subsequent destruction of blood vessels, leading to ischemia/necrosis/degeneration of the tissues supplied by the affected vessels, and possible in some cases dysfunction the end of the motor nerve. Vasculitis can also occur as a secondary damage or residual phenomenon due to other immune inflammation diseases, such as rheumatoid arthritis, systemic sclerosis, etc., particularly diseases associated with the formation of immune complexes. The disease group of primary systemic vasculitis include: systemic necrotizing vasculitis: Nowotny polyarteritis, allergic vasculitis, and Wegener, polyangiitis; Wegener's granulomatosis; lymphoid Wegener; and giant cell arteritis diagnostics. Mixed vasculitis includes: Muco-cutaneous lymphosarcomas syndrome (MLNS or Kawasaki disease), isolated CNS vasculitis Behcet's disease, thromboangiitis obliterans (Buerger's disease) and cutaneous necrotising venulet. Consider that the pathogenic mechanism of most types of vasculitis primarily due to the deposition of immunoglobulin complexes in the vessel wall and subsequent induction of inflammatory response or by ADCC, or through activation of complement, or both.

Sarcoidosis is a condition of unknown etiology characterized by the presence epithelioid granulomas in almost any tissue of the body; the most common is the involvement of the lung. The pathogenesis involves the persistence of activated macrophages and lymphocytes to sites of disease with subsequent chronic residual effects from the release of topically and systemically active products released by these cell types.

Autoimmune hemolytic anemia including autoimmune hemolytic anemia, immune pancytopenia and paroxysmal night hemoglobinuria, is the result of the production of antibodies that react with antigens expressed on the surface of red blood cells (and in some cases, other blood cells, including platelets), and is a reflection of the removal of these antibody coated cells mediated by complement is of ISIS and/or ADCC/Fc-receptor-mediated mechanisms.

In autoimmune thrombocytopenia, including thrombocytopenic purple and immunopositive thrombocytopenia, destruction/destruction of platelets is the result of joining the platelets or antibodies or complement and subsequent removal through mechanisms of lysis by complement, ADCC or mediated by FC-receptor mechanism.

Thyroiditis, including graves ' disease, Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis and atrophic thyroiditis, is the result of an autoimmune response against antigens of the thyroid gland with the production of antibodies that react with proteins present in the thyroid gland, and often specific to it. There are experimental models, including spontaneous model: rats (rats BUF and BB) and chickens (line chickens with obesity); induced model: immunization of animals or thyroglobulin, or antigen microsomal fraction of the thyroid gland (thyroid peroxidase).

Diabetes mellitus type I or insulin-dependent diabetes is an autoimmune destruction of the pancreatic islets and β-cells; this destruction is mediated by autoantibodies and self-reactive T-cells. Antibodies to insulin or the insulin receptor can also cause the phenotype insensitivity to insulin.

Immune renal disease, including glomerulo Ifrit and tubulointerstitial jade, result mediated by antibodies or T lymphocytes damage to renal tissue or directly in the production of self-reactive antibodies or T cells against renal antigens, or indirectly as the result of deposition in the kidney of antibodies and/or immune complexes, reactive against other non-kidney antigens. Thus, other immune diseases, leading to the formation of immune complexes, can also induce immunopositive renal disease as an indirect residual. Both direct and mediated immune mechanisms leading to inflammatory response, leading to the development/inducing the development of damage in renal tissue, which leads to dysfunction of the body and in some cases progression to renal failure. Both humoral and cellular immune mechanisms may be involved in the pathogenesis of the lesions.

Believe that demyelinating diseases of the Central and peripheral nervous systems, including multiple sclerosis; idiopathic demyelinizing a polyneuropathy or Guillain-Barre syndrome; chronic inflammatory demyelinizing PN are autoimmune in nature and lead to demyelination of the nerve as a result of the destruction of oligodon is Rozinov directly or myelin. In MS, there is evidence to suggest that the induction and progression of the disease depends on T-lymphocytes. Multiple sclerosis is demyelinizing disease, which is the T-lymphocyte-dependent and with or during exacerbation-remission, or chronically progressive course. The etiology is unknown; however, viral infection, genetic predisposition, environment and autoimmunity - all contribute. Plaques contain infiltrate, predominantly mediated by T-lymphocytes, microglial cells and infiltrated by macrophages; CD4+T-lymphocytes are the predominant cell type in the plaques. The mechanism of cell death of oligodendrocytes and subsequent demyelination is unknown, but probably running it on T-lymphocytes.

Inflammatory and fibrotic lung disease, including eosinophilic pneumonia; idiopathic pulmonary fibrosis and hypersensitive pneumonitis, may include deregulirovanye immune-inflammatory response. The suppression of this response may be therapeutically beneficial.

Autoimmune or immune skin diseases including bullous skin diseases, polymorphic erythema, and contact dermatitis mediated by autoantibodies, the formation of which depends on T-lymphocytes.

Psoria which is mediated by T-lymphocytes inflammatory disease. The pockets contain infiltrates of T-lymphocytes, macrophages and antigen-processorbased cells and some neutrophils.

Allergic diseases, including asthma, allergic rhinitis, atopic dermatitis, hypersensitivity to food, and urticaria are dependent on T-lymphocytes. These diseases are predominantly mediated by induced T-lymphocyte inflammation, IgE-mediated inflammation, or a combination of both.

Diseases associated with transplantation, including graft rejection and graft-versus-host (GVHD), are dependent on T-lymphocytes; the suppression of the function of T-lymphocytes is improving.

Other diseases in which intervention in the immune and/or inflammatory response are useful include as non-limiting examples of viral infection (including as non-limiting examples of AIDS, hepatitis A, B, C, D, E and herpes) bacterial infection, fungal infections, and protozoal infections and parasitic infections (molecules (or derivatives/agonists), MLR stimulating, can be used therapeutically to enhance the immune response to infectious agents), immunodeficiency diseases (molecules/derivatives/agonists), MLR stimulating, can be used therapeutically to enhance immune response in States VRO is established, purchased induced by infection (as in HIV infection), or iatrogenic (i.e. as from chemotherapy) immunodeficiency and neoplasia.

It is shown that some patients with cancer man develops answer antibodies and/or T-lymphocyte antigens on neoplastic cells. In models of neoplasia in animals shows that increasing the immune response may result in rejection or regression of this particular neoplasm. Molecules, amplifying the response of T-lymphocytes in MLR, have application in vivo to enhance the immune response against neoplasia. Molecules that enhance the proliferative response of T-lymphocytes in MLR (or low molecular weight agonists or antibodies that affect the same receptor as the agonist), can be used therapeutically for the treatment of cancer. Molecules that suppress the response of lymphocytes in MLR, there are also in vivo during neoplasia to suppress the immune response to neoplasm; or such molecules can be actually expressed by neoplastic cells, or their expression in other cells can be induced neoplasms. Antagonism of such inhibitory molecules (or antibody, a small molecule antagonists or other means) increases immunopositive tumor rejection.

In addition, suppression of molecules with proinflammatory properties may have therapeutically the advantage in reperfusion injury, stroke, myocardial infarction, atherosclerosis, acute lung injury, hemorrhagic shock, burn, sepsis/septic shock, acute tubular necrosis, endometriosis, degenerative joint disease and pancreatitis. Compounds of the present invention, for example, the polypeptide or antibody, is administered to a mammal, preferably human, according to known methods, such as intravenous bolus or prolonged infusion over a period of time, by intramuscular, intraperitoneal, intracerebral, subcutaneous, intra-articular, intra-articular, intrathecal, oral, ways or methods of inhalation (intranasal, intra-lungs). It is preferable to intravenous or inhalation introduction polypeptides and antibodies.

In immunoadjuvant therapy, other therapeutic regimes like the introduction of anti-cancer tools can be combined with the introduction of proteins, antibodies or compounds of the present invention. For example, the patient to be treated by immunoadjuvant according to the invention can be administered as an anti-cancer agent (chemotherapeutic agent) or radiotherapy. For such chemotherapeutic agents can be applied drugs and dosing regimens according to the manufacturer's instructions or by empirical determination of experienced technicians is East practice in this area. Drugs and dosing schedules for such chemotherapy are also described in Chemotherapy Seiyice Ed., M.C. Perry, Williams & Wilkins, Baltimore, MD (1992). Chemotherapeutic agent may be entered before or after the introduction of immunoadjuvant or you can enter at the same time. In addition, you can enter antiestrogenic compounds such as tamoxifen or antiprogesterone, such as onapristone (see, EP 616812)in dosages known for such molecules.

It may be desirable to introduce antibodies against other immune-related diseases associated with tumor antigens, such as antibodies which bind to CD20, CD11a, CD18, ErbB2, EGFR, ErbB3, ErbB4, or a growth factor, vascular endothelial (VEGF). Alternative or additionally, two or more antibodies that bind the same antigen, or two or more different antigens described herein, it is possible to enter the patient. Sometimes it may be favorable to enter the patient one or more cytokines. In one embodiment, the implementation of a PRO87299 polypeptide is administered jointly with the overwhelming growth medium. For example, the vast growth tool you can enter first, then a PRO87299 polypeptide. However, also provide for simultaneous introduction or the introduction first. Suitable doses for the vast growth funds are the doses currently used, and can reduce the C-for joint action (synergy) of the vast growth funds and PRO87299 polypeptide.

To treat or reduce the severity associated with immune disease, the appropriate dosage of the compounds according to the invention will depend on the type of disease to be treated, as defined above, the severity and course of the disease, the introduction of tools for preventive or therapeutic purposes, previous therapy, the patient's medical history and sensitivity to the compound and the discretion of the attending physician. The connection is applicable for introduction to the patient at one time or over a series of treatments.

For example, depending on the type and severity of the disease, about 1 μg/kg to 15 mg/kg (for example, 0.1 to 20 mg/kg) of polypeptide or antibody is an initial possible dose for administration to a patient, for example, through one or more separate injections or by prolonged infusion. The usual daily dose can be between about 1 μg/kg to 100 mg/kg or more, depending on the factors mentioned above. With repeated introductions for several days or longer depending on the condition, treatment continues until it is the desired suppression of disease symptoms. However, you can use other dosing regimens. The progress of this therapy is easily monitored by using common methods and analysis.

O. Products

In another embodiment, realized is I the invention relates to a product, containing substances (e.g., containing molecule PRO87299), suitable for diagnosis or treatment of the above disorders. The product includes a container and instructions. Suitable containers include, for example, vials, ampoules, syringes, and test tubes. The containers can be manufactured from many materials, such as glass or plastic. The container contains a composition effective for the diagnosis or treatment of the condition, and may have a sterile access hole (for example, the container may be a package solution for intravenous or bottle with stopper, sharp sterile needle for subcutaneous injection). The active substance in the composition, generally, is a polypeptide or antibody according to the invention. On the label or the leaflet / insert indicates that the composition is used to treat the selected state, such as cancer. In the manual or the label on the container or attached to the container indicates that the composition is used for diagnosing or treating a selected state. The product may also contain a second container containing a pharmaceutically suitable buffer, such as phosphate-saline buffer, ringer's solution and a glucose solution. It may additionally contain other materials desirable from a commercial or user standpoint, including other is affected buffers, solvents, filters, needles, syringes and inserts packaged with instructions for use.

P. Diagnosis and prognosis associated with immune disease

Proteins on the cell surface, such as proteins, sverhagressivny with specific immune-related diseases, are excellent targets for drug candidates or for the treatment of the disease. The same proteins along with sekretiruemyi proteins, encoded by the genes, amplificatoare when immune-related painful conditions, find an alternate use for the diagnosis and prognosis of these diseases. For example, antibodies directed against the protein products of genes, amplified, multiple sclerosis, rheumatoid arthritis or other related immune disease, can be used as diagnostic or prognostic.

For example, antibodies, including antibody fragments, can be used for qualitative or quantitative detection of the expression of proteins encoded amplificatoare or sverhagressivnym genes ("the products of the marker gene"). The antibody preferably provide amenable to detection, for example, a fluorescent label and the binding can be monitored by light microscopy, flow cytometry, fluorometry, or other methods known in Dan the Oh region. These methods are particularly suitable, if sverhagressivny gene encodes a protein on the cell surface. Such analyses linking carried out basically as described above.

The in situ detection of antibodies associated with the products of the marker gene can be, for example, by immunofluorescence or immunoelectron microscopy. For this purpose, the patient is taken for histological preparation and on it put a labeled antibody, preferably by coating a biological sample with an antibody. This method also allows to determine the distribution of the product of the marker gene in the tissue studied. Specialists in this field will be obvious that a wide variety of histological methods readily available for detection in situ.

The following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention in any way.

The full contents of all patents and references cited in this application are hereby incorporated by reference.

EXAMPLES

Commercially available reagents referred to in the examples were used according to manufacturer's instructions, unless otherwise indicated. Source of cells indicated in the following examples, and throughout the description under inventory numbers ATCC is the American collection t is powerful cultures, Manassas, VA.

EXAMPLE 1: Cloning of PRO87299

Conducted a search in the database of a nucleotide sequence transcribed DNA segments (EST) (Merck/Washington University) and identified EST containing domains of interest, specifically, the domain(s) of immunoglobulin (Ig) and immunoreceptor tyrosine-binding inhibitory motif(s) (ITIM). The search was performed using the computer program BLAST or BLAST2 [Altschul et al., Methods in Enzvmology. 266:460-480 (1996)] using as a comparison of interest domains in 6 frames broadcast sequence. Compare leading to the BLAST score of 70 (or in some cases 90) or greater that do not encode known proteins were clusterseven and, if necessary, were combined into a consensus DNA sequence with the program "phrap" (Phil Green, University of Washington, Seattle, Washington).

On the basis of sequence, as described above, the synthesized oligonucleotides: 1) to identify by PCR cDNA library containing the sequence of interest, and 2) for use as probes for isolation of clone of the full coding sequence for PRO87299. Forward and reverse primers for PCR, typically lying in the range from 20 to 30 nucleotides and are often designed to obtain PCR product length of approximately 100-1000 BP Sequence probes typically have a length of 40-55 P.N. In some of the cases synthesized additional oligonucleotides, when the consensus sequence of more than approximately l-1,5 TPN to skanirovat several libraries for a full-sized clone, DNA from the libraries was skanirovali by PCR amplification, as in Ausubel et al., Current Protocols in Molecular Biology, supra, with a pair of primers for PCR. Then a positive library was used to select clones encoding the gene of interest using oligonucleotide probe and one of the primer pairs.

Used the following oligonucleotide probes:

Direct primer:

hBTig.EcoRI.F2 5' TTGAATTCATGAAGACATTGCCTGCCATGC 3'

(SEQ ID NO 11)

Reverse primer:

hBTig.BamHI.R2 5' TTGGATCCTTAACTCCTCACACATATGGATGCATATTC 3'

(SEQ ID NO 12)

To clone used a cDNA library from human blood. The cDNA library used for selection of cDNA clones, designed conventional methods using commercially available reagents, such as reagents from Invitrogen, San Diego, CA. cDNA was primiraly oligo-dT containing a NotI site, linked with zatuplenie with SalI-adapters, half processed kinase, cut NotI, appropriately sorted according to size by gel-electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the SfiI site; see, Holmes et al., Science, 253:1278-1280 (1991)) on unique sites XhoI and NotI.

Full Amu is echidna sequence of clone designated here as DNC shown in figure 1 (SEQ ID NO: 1). Clone DNC contains a single open reading frame with an apparent site of initiation of translation in terms of 24-26 nucleotides and a stop signal to the provisions of the nucleotide positions 891-893 (Fig 1, SEQ ID NO: 1). Estimated polypeptide precursor has a length of 289 amino acids, has a calculated molecular weight of approximately 32781 daltons and calculated pI of approximately 6,27. Analysis of the full sequence PRO87299 shown in figure 2 (SEQ ID NO: 2) proves the presence of a variety of important polypeptide domains as shown in Fig. 2, where the provisions of these polypeptide domains are approximate as as described.

The analysis of the existing database of proteins by analysis of sequence alignment ALIGN-2 for full-length sequence shown in figure 2 (SEQ ID NO: 2), revealed sequence identity between the amino acid sequence PRO87299 and an unknown protein sequence.

EXAMPLE 2: Cloning options PRO87299

Was skanirovali sequences PRO87299 in RNA B-cells from 16 different donors. This RNA was performed RT-PCR to obtain full-PRO87299. The PCR products were cloned into vectors, allowing high-performance sequencing, and analysis is listed by sequencing with dual passage. For several variants of PRO87299 showed minimal change (11 A-F). However, found truncated variant with exon 3 with deletionism transmembrane domain (7, SEQ ID NO: 7 ). In a truncated version deleterows nucleic acid 403-547 of the native protein, which leads to the option of PRO87299 polypeptide (Fig, SEQ ID NO: 8) with a length of only 241 amino acids, while native PRO87299 has a length of 289 amino acids. The absence of the transmembrane domain may indicate that this option is a PRO87299 secreterial form.

Found additional option PRO87299 containing box 18 pairs of nucleotide bases at the 5'end of exon 3 (figure 9, SEQ ID NO: 9). These inserted 18 base pairs encode additional 6 amino acids (AFTNIP) and inserted into the coding PRO87299 nucleic acid reading frame, leading to a variant of PRO87299 polypeptide (Fig. 10, SEQ ID NO: 10), having a length of 295 amino acids. And short form, and the form AFTNIP shown together with other options on figa-b Domain of IgG found in the amino acids 51-117 all PRO87299 polypeptide, may be important for the functioning of PRO87299 polypeptide.

EXAMPLE 3: Analysis of stimulated T-cells on microchips

Microarrays of nucleic acids, often containing thousands of gene sequences, are applicable for the identification of differentially Express wusasa gene diseases in the affected tissues compared with their normal counterparts. Using a microarray of nucleic acids test and control samples of mRNA from the test and control tissue samples were subjected to reverse transcription and enthusiasm to obtain cDNA probes. Then the cDNA probes hybridized with the array of nucleic acids immobilized on a solid substrate. The array is designed so that the sequence and position of each member of the array is known. For example, the selection of genes, known as expressed at specific stages of the disease can be arranged on a solid substrate. Hybridisable labeled probe with a specific member of the array indicates the expression of this gene in the sample from which the probe. If the hybridization signal with the probe of the test specimen (in this case, the activated CD4+ T-cells) is stronger than the signal of hybridization of the probe from the control sample (in this case, not stimulated CD4+ T-cells), identified a gene or genes, sverhagressivny in the tested tissue. A consequence of this result is that sverhagressivny protein in the test sample is not only applicable as a diagnostic marker for the presence status of the disease, but also a therapeutic target for the treatment of a disease state.

Methods of hybridization of nucleic acids, Spaso the microarray is well known in this field. In one specific example of obtaining nucleic acids for hybridization and probes, slides, and hybridization conditions, all described in detail in the patent application PCT serial No PCT/USOl/10482, filed March 30, 2001 and are listed here as a reference. In this experiment, using the method RossetteSep™ (Stem Cell Technologies, Vancouver BC) was purified CD4+ T cells from a single donor, containing anti-CD8, anti-CD16, anti-CD19, anti-CD36 and anti-CD56 antibodies, applying to obtain the selected CD4 + T-cells. Selected CD4+ T cells activated by anti-CD3 antibody (used at a concentration of not stimulating proliferation) or together with ICAM-I, or with anti-CD28 antibody. After 24 or 72 hours, cells were harvested, RNA was isolated and perform the analysis on the microarray Affimax™ (Affymetrix Inc. Santa Clara, CA). Estimulando (resting) cells were collected immediately after treatment and subjected to the same analysis. Compared genes, the expression of which had increased regulation in any of the two time points in the activated cells compared with resting.

The result of these experiments is that a PRO87299 polypeptide of the present invention significantly sverkhekspressiya in selected CD4 + T-cells activated with anti-CD3/ICAM-1 and anti-CD3/anti-CD28, in comparison with a dedicated resting CD4+ T cells. As described above, these data show that a PRO87299 polypeptide in us is oedema invention are not only applicable as a diagnostic marker for the presence of one or more immune disorders, but also serve as therapeutic targets for the treatment of these immune disorders.

EXAMPLE 4: PRO87299 for lymphoma

Lymphoma is the 6th of the most common malignancies in the United States. In 1990, the United States was 43000 estimated new cases of lymphoma. Nehodgkinski lymphoma is most cases, and Hodgkin's takes a distant second place. The incidence of nehodgkinski lymphoma gradually increases with age. However, for Hodgkin's disease there is a high incidence in patients aged 20-30, plateau between 30-55 and another rise after age 55. Men are more at risk as Hodgkin's disease and non Hodgkin lymphoms than women. The main clinical manifestation of malignant lymphoma is swelling of the lymph node and symptoms, including fever, restlessness and loss of weight. Normal primary foci of lymphoma are supraclavicular, axillary, mediastinal, periorale, cervical and inguinal lymph nodes. Lymphoma also has the ability to metastasize to other organs.

Hodgkin's disease was first described by Thomas Hodgkin's lymphoma in 1832. Hodgkin's disease is an unlimited proliferation of lymphocytes, which become more abundant pale cytoplasm and two sludge is more oval makedoncite cores, with large nucleoli. Cells of this type are known as cells, reed-Sternberg. Cells, reed-Sternberg are important for the diagnosis of Hodgkin's disease, but their presence in itself is not sufficient for diagnosis. Hodgkin's disease is different from nehodgkinski lymphoma type cells, histology of lymph nodes and symptomatology, such as fever. Hodgkin's disease usually manifests as an increase in individual groups of peripheral lymph nodes and may affect nearby lymph nodes, but rarely is newslove. The cause of Hodgkin's disease is unknown, but previous infection with Epstein-Barr and translocation of bcl-2 are associated with the development of Hodgkin's disease.

Nehodgkinski lymphomas are neoplasms of the immune system that occur in the lymph nodes, however, they differ from Hodgkin's disease factors such as cell type and the symptomatology manifested in the patient. Most nehodgkinski lymphomas have a B-cell phenotype and are positive for the markers CD19 and CD20. Fewer are T-cell lymphomas are positive for the markers CD2 and CD3.

Proprietary database containing information on gene expression (spatial structures®, Gene Logic Inc., Gaithersburg, MD), were analyzed to ascertain whether increased regulation is polypeptide PRO87299 (and coding him nucleic acids) in lymphoma compared to normal lymphatic tissues. Specifically, the database analysis spatial structures® was performed using or software that are available at Gene Logic Inc., Gaithersburg, MD for use with a database of spatial structures® or proprietary software, written and razrabotannogo at Genentech, Inc. for use with database spatial structures®. Rating of positive responses in the analysis based on several criteria, including, for example, tissue specificity, tumor specificity and the level of expression in normal essential and/or normal proliferating tissues. The result showed high expression of PRO87299 in lymphoma compared with other tumors and normal tissues.

EXAMPLE 5: PRO87299 in inflammatory bowel disease

In this experiment, the analysis on the microarray used to search for genes, sverhagressivnym with IBD compared to normal tissue of the intestine. Received biopsy samples from patients with IBD. For each patient with IBD received samples of tissue affected by the disease (or UC or Crohn's disease) and from healthy bowel so that it can be better to compare the pattern of expression. All samples were stored at -70°C until preparation for the isolation of RNA. Biopsy samples homogenized in 600 μl of buffer RLT (+ BME) and RNA was isolated using Rneasy columns Qiagen Mini™ (Qiagen) treatment Dnazol on column according to recom is presented to the manufacturer. After RNA extraction, the amount of RNA was estimated using RiboGreen™ (Molecular Probes)following the manufacturer's recommendations, and checked its safety in agarose gels. Appropriate amounts of RNA were labeled for analysis of microarrays and samples were analyzed on a proprietary microchip Genentech and microchips Affymetrics™. Compared genes, regulation of expression of which is increased in tissues affected IBD, compared with normal intestines, picking up a pair of biopsy samples of normal bowel and IBD affected tissue from the same patient. The results of this experiment showed that the identified significant overexpression of PRO87299 samples in Crohn's disease compared to normal tissue of the intestine.

EXAMPLE 6: Expression of PRO87299 in NK-cells

Cells natural killer cells (NK) are important effector cells of the innate immune system. They specialize in effect cytolysis against host cells that are infected with the virus, parasites, or have become cancerous. Phenotypic NK cells are large granular lymphocytes that constitute priblizitelno 2 % of the circulating population of lymphocytes. They are usually identified by expression of the cell surface CD56 and CD16. They Mature in the bone marrow of progenitor cells CD34+, they are shared with T-cells is AMI. Mature NK-cells divide with T-cell expression of CD8, cytolytic mechanism and some KIR, but remain distinct from T cells by the absence of CD3 and T-cell receptors. Like cytotoxic T cells, they contain granules filled with a pore-forming protein, cytotoxins, serine esterase and proteoglycans, which mediate lysis of target cells. And cytotoxic T-cells and NK-cells are destroyed upon contact by binding to their targets and deliver their lethal release of chemicals that leads to holes in the membrane of target cells. In contrast to cytotoxic T-cells NK-cells do not require the recognition of a specific antigen prior to initiating lysis. Rather, the activation of NK cells may be mediated by growth factors and cytokines (in particular, it is shown that IL-2, IL-12 and IL-15 mediates proliferative and cytotoxic activity) or unstable equilibrium between the two classes of receptors of NK-cells, one of which activates cells, and the other inhibits. Ig-like receptors of killers (KIR) are receptors of NK-cells carrying an inhibiting signal when meeting with molecules of MHC class I on the cell surface. It is important for the destruction of both malignant cells and virus-infected cells. Because viruses often inhibit the expression of MHC class in infected their cells, virus-infected cells become sensitive to the destruction of NK-cells. Similarly in malignant cells is reduced or absent expression of MHC class I, and they also become sensitive to the destruction of NK-cells. Natural cytotoxicity receptors (NCR) form a family of activating receptors on NK cells. In some effector systems surface density NCR correlates cytolytic activity of NK-cells, while in other systems the destruction requires interaction between NCR, other activating receptor NKG2D and its adapter polypeptide DAP10. In addition, the signal strength can influence the attraction can be used, such as 2B4 and NTB-A. Ligands for NCRS and NKG2D, hemagglutinin and MICA, MICB, respectively, is not expressed by most normal cells, but is induced in most lines of tumor cells. The expression of ligands by tumor cells triggers a strong immune response leading to rejection of tumor cells. It is shown that the activation of NK cells by IL-15 or IL-12 induces both cytotoxic and proliferative effects. It is shown that the contact adhesion molecule 2 (JAM2) associated with NK cells, and put forward a hypothesis about its role in the extravasation of lymphocytes to areas of inflammation.

Thus, an experiment with DNA microarray comparing the maps in anchialine gene expression with three of these methods of activation compared with resting NK cells, allows you to identify new genes or new associations of genes with the activity of NK-cells. You can develop antibodies, peptides or small molecules that target specific genes identified by these microchips to ensure immunopositive inflammatory diseases and malignant neoplasms. NK-cells peripheral blood was isolated from leukaphereses mass by negative selection using set for the allocation of NK cells with magnetic sorting system cells MACS™ (Miltenyi Biotec). Cleaning of the cells was confirmed by staining with PE anti-CD56 for FACS analysis. The purity of the preparations of cells lying in the range from 89% to 96%. Cell culture: started culture in vitro 6-hole tablets 5 ml culture/well. Medium: RPMI 1640, 10% V / V heat inactivated FBS, 100 units/ml penicillin, 100 mg/ml streptomycin, 2 mm L-glutamine, and 5.5×10-5 beta mercaptoethanol. Experimental treatment: time 0 hour, raw CD56(+) cells. Time 16 hours. Untreated, stimulated IL2 (10 nm), IL15(10 nm), JAM-IT(10 nm). Activation of NK-cells was monitored by FACS for expression on the cell surface CD56 and CD69. In this series of experiments determined that CD56+ NK-cells Express a PRO87299 compared with normal resting NK cells.

EXAMPLE 7: Use of PRO87299 as a probe for hybridization

The following method describes use is their nucleotide sequence, coding PRO87299, as a probe for hybridization.

DNA containing the coding sequence of full-length or Mature PRO87299 (such as DNA encoding a naturally occurring variants of PRO87299), as described here, was used as a probe to screen for homologous DNA in the cDNA libraries from human tissue or genomic libraries from human tissue.

Hybridization and washing of filters containing any of the library DNA was performed in the following vysokostojkih conditions. Hybridization of radioactively labelled obtained from PRO87299 probe to the filters was performed in a solution of 50% formamide, 5×SSC, 0,1% SDS, 0.1% sodium pyrophosphate, 50 mm sodium phosphate, pH of 6.8, 2× denhardt's solution and 10% doctranslate at 42°C for 20 hours. Washing of the filters was performed in aqueous solution of 0.1×SSC and 0.1% SDS at 42°C.

DNA with the desired sequence identity with the DNA encoding full-sized native sequence PRO87299 can then be identified using conventional methods known in this field.

EXAMPLE 8: Expression of PRO87299 in E. coli

This example illustrates obtaining deglycosylation form PRO87299 recombinant expression in E. coli.

First DNA sequence encoding a PRO87299, amplified using selected primers for PCR. The primers is to get the sites for enzymes selected from expressing vector. You can apply many expressing vectors. An example of a suitable vector is pBR322 (obtained from E. coli; see Bolivar et al., Gene, 2:95 (1977)), containing the genes for resistance to ampicillin and tetracycline. The vector was digested with restriction enzyme and dephosphorylated. Then amplificatoare PCR sequence ligated to the vector. The vector will preferably include sequences encoding the gene of resistance to the antibiotic, a trp promoter, a poly-his leader (including the first six STII codons, the sequence of the poly-his, and the site of cleavage by enterokinase), the coding region PRO87299, the terminator of transcription of the lambda and argU gene.

Then the mixture for ligation was used to transform a selected E. coli strain using the methods described in Sambrook et al., above. Transformants were identified by their ability to grow on plates with LB and then selected colonies that are resistant to the antibiotic. Plasmid DNA can be extracted and confirm restriction analysis and DNA sequencing.

Selected clones can be grown overnight in liquid culture medium, such as LB-medium supplemented with antibiotics. Night culture can then be used for inoculation of the culture of a larger volume. The cells are then raised to the desired optical density, during which the promoter for expression is enabled the output.

After culturing the cells for several hours the cells can be collected by centrifugation. Sediment cells obtained by centrifugation, can be solubilisate using various means known in the field, and then the solubilized protein PRO87299 can be purified using a metal chelating column under conditions that allow tight binding of the protein.

PRO87299 you can Express in E. coli in labeled poly-His form using the following method. First, DNA encoding PRO87299, amplified using selected primers for PCR. The primers will contain lots of enzymes, appropriate sites for enzymes in selected expressing vector, and other useful sequences providing for efficient and reliable translation initiation of the rapid purification on metal-chelate column and proteolytic removal enterokinase. Then amplificatoare PCR, labeled poly-His sequence is ligated in expressing the vector used for transformation of host E. coli based on strain 52 (W3110 fuhA(tonA) lon galE rpoHts(htpRts) clpP(lacIq). First, the transformants were grown in LB containing 50 mg/ml carbenicillin at 30°C with shaking until reaching O.D.600 of 3-5. Then the culture was diluted in 50-100 times the environment CRAP (which is obtained by mixing 3.57 g(NH 4)2SO4, 0.71 g sodium citrate·2H2O, 1.07 g KCl, are 5.36 g yeast extract Difco, are 5.36 g Sheffield hycase SF in 500 ml water, as well as 110 nm MPOS, pH 7.3, 0.55%, respectively (wt./about.) glucose and 7 mm MgSO4) and grown for approximately 20-30 hours at 30°C with shaking. Taking samples to confirm expression analysis in SDS-PAGE and the mixed culture was centrifuged to precipitate the cells. The precipitated cells were frozen prior to cleaning and re-folding.

The mass of E. coli after fermentati in from 0.5 to 1 l (precipitation 6-10 g) resuspendable in 10 volumes (wt./about.) buffer 7 M guanidine, 20 mm Tris, pH 8. Added solid sodium sulfite and tetrathionate sodium to obtain a final concentration of 0.1 M and 0.02 M, respectively, and was stirred solution over night at 4°C. In this stage get a denatured protein with all cysteine residues blocked by alfaisaliah. The solution is centrifuged at 40,000 rpm in ultracentrifuge Beckman within 30 minutes the Supernatant is diluted 3-5 volumes of buffer for metal-chelate column (6 M guanidine, 20 mm Tris, pH of 7.4) and filtered through a 0.22 micron filters for the clarification. The clarified extract was applied to a 5 ml metal-chelate column Qiagen Ni-NTA, balanced buffer for metal-chelate column. The column was washed with additional buffer containing 50 mm imidazole (Calbiochem, Utrol grade), pH of 7.4. Protein was suirable buffer containing 250 mm imidazole. The fractions containing the desired protein were pulirula and kept at 4°C. the protein Concentration was estimated by optical density at 280 nm using the absorption coefficient, calculated on the basis of its amino acid sequence.

Proteins re-rolled by the slow dissolution of the sample in freshly prepared buffer to re-collapse, consisting of: 20 mm Tris, pH of 8.6, a 0.3 M NaCl, 2.5 M urea, 5 mm cysteine, 20 mm glycine and 1 mm EDTA. Volumes for re-folding was chosen so that the final protein concentration is between 50 and 100 micrograms/ml Solution for re-folding gently stirred at 4°C for 12-36 hours. The reaction is repeated collapse was stopped by adding TFA to a final concentration of 0.4% (pH of approximately 3). Before further purification of the protein solution was filtered through a filter of 0.22 μm was added in acetonitrile to a final concentration of 2-10%. Re-folded protein was subjected to chromatography on a reversed-phase column (Poros Rl/H using a mobile phase buffer of 0.1% TFA with elution with a gradient of acetonitrile from 10 to 80%. Aliquots of fractions with optical absorption at A280 were analyzed in SDS-polyacrylamide gels and were pulirula faction, Sodertalje homogeneous re-folded protein. As a rule, correctly-folded form of most proteins is is lirovannye at least acetonitrile, since these forms are the most compact with their hydrophobic internal parts are protected from interaction with reversed-phase resin. Aggregated forms usually elute at higher concentrations of acetonitrile. In addition, the Department incorrectly folded forms of proteins from the desired form on reverse-phase stage also remove endotoxin from the samples.

The fractions containing forms of PRO87299 polypeptide with the desired folding, are combined and the acetonitrile removed using a gentle stream of nitrogen directed at the solution. Proteins made in 20 mm Hepes, pH 6,8 from 0.14 M sodium chloride and 4% mannitol by dialysis or gel filtration using resins G25 Superfine (Pharmacia), equilibrated in buffer composition, and sterilized by filtration.

A PRO87299 polypeptide, described herein, successfully expressed, as described above.

EXAMPLE 9: Expression of PRO87299 in mammalian cells

In this example, illustrated by the receipt of a potentially glycosylated form of PRO87299 by recombinant expression in mammalian cells.

Vector pRK5 (see EP 307247, published March 15, 1989) was used as expressing vector. Optional DNA PRO87299 ligated into pRK5 with selected restriction enzymes to ensure that the insert DNA PRO87299 using the way the ligating, such as described in Sambrook et al., above. The resulting vector is called pRK5-PRO87299.

In one embodiment, the implementation of the selected cells masters can be 293 cells. Cells 293 people (ATCC CCL 1573) were grown to confluently in cups for culturing cells in medium such as DMEM, supplemented with fetal calf serum and, optionally, nutrient components and/or antibiotics. Approximately 10 μg of DNA pRK5-PRO87299 mixed with about 1 μg DNA encoding the gene VA RNA [Thimmappaya et al., Cell, 31:543 (1982)] and dissolved in 500 μl of 1 mm Tris-HCl, 0.1 mm EDTA, 0,227 M CaCl2. To this mixture are added dropwise to 500 μl of 50 mm HEPES (pH to 7.35), 280 mm NaCl, 1.5 mm NaPO4and allow the formation of a precipitate for 10 minutes at 25°C. the Precipitate is suspended, added to the 293 cells and allow to settle for about four hours at 37°C. the Culture medium was collected and added 2 ml of 20% glycerol in PBS for 30 seconds. Then 293 cells were washed in serum-free medium was added to fresh medium and incubated the cells for approximately 5 days.

Approximately 24 hours after transfection the culture medium was removed and replaced by culture medium (in pure form) or culture medium containing 200 µci/ml35S-cysteine and 200 µci/ml35S-methionine. After 12 hours of incubation, conditioned medium was collected, conc is listed on centrifugation the filter and put on 15% SDS-gel. The processed gel may be dried and exposed to film for a selected period of time to identify the presence of PRO87299 polypeptide. Culture containing transfetsirovannyh cells can be subjected to further incubation (in serum-free medium) and test environment in selected biological tests.

An alternative way PRO87299 you can temporarily enter into 293 cells using the method doctranslate described Somparyrac et al., Proc. Natl. Acad. Sci 12:7575 (1981). 293 grown to maximal density in a rotating flask and add 700 µg DNA pRK5-PRO87299. First cell concentrate from the rotating flask by centrifugation and washed with PBS. The precipitate DNA-dextran incubated on lees cells for four hours. Cells treated with 20% glycerol for 90 seconds, washed with medium for the cultivation of cells and injected back into the rotating flask containing medium for cultivation of cells, 5 μg/ml bovine insulin and 0.1 μg/ml bovine transferrin. After approximately four days, air-conditioned environment centrifuged and filtered to remove cells and debris. The sample containing expressed PRO87299, you can then concentrate and purify by any selected method, such as dialysis and/or chromatography on a column.

In another embodiment, it is possible to Express the PRO8729 in CHO cells. pRK5-PRO87299 you can transliterate in CHO cells using known reagents such as CaPO4or DEAE-dextran. As described above, the cell cultures can be incubated and replace environment cultural environment (in pure form) or culture medium containing radioactive tag, such as35S-methionine. After determining the presence of PRO87299 polypeptide culture medium may be replaced with serum-free medium. Preferably the culture is incubated for about 6 days and then the conditioned medium is collected. The medium containing the expressed PRO87299, you can then concentrate and purify by any selected method.

Labeled epitope PRO87299 you can also Express in the cells of the host CHO. PRO87299 you can subclinical from the vector pRK5. Insert subclone can be subjected to PCR for fusion in frame with a selected epitope-tag, such as tag poly-his, expressing the Baculovirus vector. Labeled poly-his box PRO87299 can then be subclinical in a vector containing the promoter/enhancer of SV40 containing a selective marker such as DHFR for selection of stable clones. Finally, CHO cells can be transliterate (as described above) vector containing the promoter/enhancer of SV40. To confirm the expression, you can perform tagging, as described above. Then the culture medium containing the expressed PRO87299, the sword of the config poly-His, you can concentrate and purify by any selected method, such as Ni2+-chelate affinity chromatography.

PRO87299 you can Express in cells of CHO and/or COS of the way and temporal expression or in CHO cells by another stable way of expression.

Stable expression in CHO cells was carried out using the following method. Proteins expressed in the form of IgG-design (immunoadhesin), in which the coding sequences for the soluble forms (e.g. extracellular domains) of the respective proteins fused with a sequence of a constant region IgG1 containing the hinge, CH2 and CH2 domains and/or representing labeled poly-His form.

After PCR amplification the DNA was subcloned into expressing vector for CHO using conventional methods, as described in Ausubel et al., Current Protocols of Molecular Biology, Unit of 3.16, John Wiley and Sons (1997). Expressing vectors for CHO designed with compatible restriction sites 5' and 3' DNA of interest, in order to provide a suitable recharging dropship cDNA. The vector used for expression in CHO cells is as described in Lucas et al., Nucl. Acids Res. 24:9 (1774-1779 (1996), using early promoter/enhancer SV40 to control the expression of the cDNA of interest and digidrofolatreduktazy (DHFR). Expression of DHFR allows the selection of stability in the th maintenance of the plasmid after transfection.

Twelve micrograms of the desired plasmid DNA is introduced into approximately 10 million CHO cells using commercially available reagents for transfection with Superfect® (Quiagen), Dosper® or Fugene® (Boehringer Mannheim). Cells were grown as described in Lucas et al., above. Approximately 3×107cells were frozen in vials for further growth and production as described below.

Ampoules containing plasmid DNA, thawed by placing in a water bath and stirred with shaking. The contents were poured pipette into centrifuge tube containing 10 ml of medium, and centrifuged at 1000 rpm for 5 minutes. Supernatant was collected and cells resuspendable in 10 ml of selective medium (PS20, filtered through 0.2 μm to 5% diafiltration through 0.2 μm). Then the cells were Liquefiable in rotating a capacity of 100 ml, containing 90 ml of selective medium. After 1-2 days, the cells are transferred into the rotating capacity of 250 ml, filled with 150 ml selective growth medium and incubated at 37°C. After another 2-3 days rotating capacity 250 ml, 500 ml and 2000 ml were seeded at 3×105cells/ml of Medium to the cells was replaced with fresh medium by centrifugation and resuspending in the environment for production. Although you can apply any appropriate medium for CHO, now you can use the environment for the products described in U.S. patent No 5122469, published on June 16, 992, Rotating the capacity for product 3 were seeded at 1.2×106cells/ml On day 0 was determined by pH. On day 1 of the rotating vessel was selected sample and started splashing filtered air. On day 2 of the rotating vessel was selected sample, the temperature was changed to 33°C was added 30 ml of 500 g/l glucose and 0.6 ml of 10% antifoam (e.g., 35% polydimethylsiloxane emulsion, emulsion medical quality Dow Corning 365). Throughout the product pH was adjusted as needed to maintain about 7.2. After 10 days or when the viability dropped below 70%, the cell culture was collected by centrifugation and filtered through a 0.22 μm filter. The filtrate or kept at 4°C, or immediately put on cleanup columns.

In the case of structures, labeled poly-His proteins were purified using a column of Ni-NTA (Qiagen). Before cleaning to air-conditioned environment was added imidazole concentrations up to 5 mm. Conditioned medium was applied by the pump 6 ml column of Ni-NTA, balanced 20 mm Hepes, pH of 7.4, buffer containing 0.3 M NaCl and 5 mm imidazole at a flow rate of 4-5 ml/min. at 4°C. After application the column was washed with additional buffer to balance and suirable protein buffer for equilibration, containing 0.25 M imidazole. Then highly purified protein was absoluely buffer for storing, containing 10 mm Hepes, of 0.14 M NaCl and 4% of the annite, pH of 6.8, 25 ml column G25 Superfine (Pharmacia) and stored at -80°C.

Design with immunoadhesin (Fc-containing) was purified from the conditioned medium as follows. Conditioned medium was applied by the pump to a 5 ml column of protein A (Pharmacia), equilibrated in 20 mm Na phosphate buffer, pH of 6.8. After application, the column was intensively washed with buffer for equilibration before elution with 100 mm citric acid, pH 3.5. Suirvey protein is immediately neutralized by collecting fractions of 1 ml in tubes containing 275 μl of 1 M Tris buffer, pH 9. Then highly purified protein was absoluely buffer for storing, as described above for proteins labeled poly-His. Homogeneity was assessed in SDS polyacrylamide gels and N-terminal amino acid sequencing degradation by Admino.

Many of PRO87299 polypeptide described herein, successfully expressed, as described above.

EXAMPLE 10: Expression of PRO87299 in yeast

The following method describes recombinant expression of PRO87299 in yeast.

First designed expressing vectors for yeast for intracellular production or secretion of PRO87299 with promoter ADH2/GAPDH. DNA encoding PRO87299 and the promoter is inserted into suitable restriction sites of the enzymes in the selected plasmid to control intracellular expression of PRO87299. For secretion, DNA encoding PRO87299, you can clone to select the bacterial plasmid, together with DNA, coding promoter ADH2/GAPDH signal peptide native PRO87299 or other signal peptide mammals or, for example, a secretory signal/leader sequence of the alpha-factor or invertase yeast, and linker sequences (if neohodimo) for the expression of PRO87299.

Then the yeast cells, such as the strain of yeast AB110, you can transform expressing plasmids described above and cultured in the selected environment for fermentation. Supernatant transformed yeast can be analyzed by precipitation with 10% trichloroacetic acid and separation of SDS-PAGE followed by staining of the gels Kumasi blue.

Recombinant PRO87299 you can then select and clear by removing the yeast cells from the medium for fermentation by centrifugation and then concentrating the medium using selected cartridge filters. The concentrate containing PRO87299, can be cleaned further using the selected resins for chromatography columns.

Many of PRO87299 polypeptide described herein, successfully expressed, as described above.

EXAMPLE 11: Expression of PRO87299 in insect cells infected with baculovirus

The following method describes recombinant expression of PRO87299 in insect cells infected with baculovirus.

Sequence encoding a PRO87299, inserted above epitopes, contained in baculovirus expressing vector. Such epitope tags include poly labels-his and immunoglobulin tags (like Fc regions of IgG). You can apply a variety of plasmids, including plasmids derived from commercially available plasmids such as pVL1393 (Novagen). Briefly, the sequence encoding a PRO87299 or the desired portion of the coding sequence PRO87299, such as the sequence encoding the extracellular domain of a transmembrane protein or the sequence encoding the Mature protein if the protein is extracellular, PCR amplified with primers complementary to the 5'- and 3'-regions. 5'-primer may contain flanking (selected) sites for enzymes. The product is then split these selected enzymes and subcloning in expressing vector.

Recombinant baculovirus is produced by cotransfection the above plasmid and BaculoGold virus DNA™ (Pharmingen) into cells of Spodoptera frugiperda ("Sf9") (ATCC CRL 1711) using lipofectin (commercially available from GIBCO-BRL). After 4-5 days of incubation at 28°C, the released viruses are harvested and used for further amplifications. Viral infection and protein expression is carried out, as described in O Reilley et al., Baculovirus expression vectors: A Laboratory Manual. Oxford: Oxford University Press (1994).

Downregulation of labeled poly-his PRO87299 can then clear the te, for example, Ni2+-chelate affinity chromatography as follows. From infected with recombinant virus Sf9 cells were obtained extracts, as described in Rupert et al., Nature, 362:175-179 (1993). Briefly, Sf9 cells are washed, resuspendable in the buffer for processing by ultrasound (25 ml Hepes, pH of 7.9; 12.5 mm MgCl2; 0.1 mm EDTA; 10% glycerol; 0.1% of NP-40; and 0.4 M KCl) and treated twice for 20 seconds on ice. Received the influence of ultrasound homogenates were osvetleni by centrifugation and the supernatant was diluted 50-fold in buffer for drawing (50 mm phosphate, 300 mm NaCl, 10% glycerol, pH 7.8) and filtered through 0.45 µm filter. Got a column with Ni2+-NTA agarose (commercially available from Qiagen) with the volume of a layer of 5 ml, washed with 25 ml of water and balanced 25 ml buffer for drawing. The filtered extract of the cells was applied onto the column at 0.5 ml / min. The column was washed to baseline A280the buffer for the application and in this point he started collecting fractions. Then the column was washed a second buffer for washing (50 mm phosphate; 300 mm NaCl, 10% glycerol, pH 6,0), eluting nonspecific bound peroxidase protein. After re-achieve the background of A280, the column was treated with imidazole gradient 0-500 mm in the second buffer for washing. Collected fractions one ml and were analyzed by SDS - PAGE and silver staining or Western blotting with Ni2+-NTA, conjugated with Melo the Noah phosphatase (Qiagen). The fractions containing suirvey suirvey marked His10PRO87299, were combined and were dialyzed against buffer for drawing.

Alternative cleaning labeled IgG (or labeled Fc) PRO87299 can be performed using known methods, chromatography, including, for example, chromatography on a column of protein A or protein G.

Many of PRO87299 polypeptide described herein, successfully expressed, as described above.

EXAMPLE 12: to Obtain antibodies that bind PRO87299

Antibodies specifically binding PRO87299, was obtained by immunization of a mouse design PRO87299-Fc. This design received legirovaniem region that encodes the extracellular domain of PRO87299 (amino acids 1-155), a plasmid containing the Fc domain of a human, thus getting the Chimera PRO87299(ECD)-Fc. This protein was produced, purified and injected with a foot pad mouse.

Methods for obtaining monoclonal antibodies are known in this field and are described, for instance, in Goding, supra. Mice, such as Balb/c were immunized chimeric PRO87299(ECD)-Fc, emulsified in complete Freund's adjuvant and injected subcutaneously or intraperitoneally in an amount from 1-100 micrograms. Alternative immunogen emuleret in Freund MPL-TDM (Ribi Immunochemical Research, Hamilton, MT) and injected into the cushion of the rear legs of the animal. Immunized mice stimulated 10-12 days later an additional Chimera PRO8299(ECD)-Fc, emulsified in the selected Freund. Then in a few weeks, mice can also stimulate additional immunization injections. Serum samples were periodically obtained from the mice by retroorbital blood sampling for testing in ELISA assays for detection of anti-PRO87299 antibodies.

After detection of a suitable titer antibodies to the animals "positive" for antibodies were injected with the last intravenous injection chimeras PRO87299(ECD)-Fc. Three to four days later, mice were killed and collected cells of the spleen. Then the spleen cells were merged (using 35% polyethylene glycol) to a selected line of murine myeloma cells, such as P3X63AgU.l, available from ATCC, No. CRL 1597. Merge received cell hybridoma, which are then subcultured in 96-well culture plates, containing environment HAT (gipoksantin, aminopterin and thymidine) to suppress proliferation Nikitich cells, myeloma hybrids, and hybrids of spleen cells.

Cell hybridoma was skanirovali in ELISA for reactivity against PRO87299. Received nine antibodies that specifically bind to the PRO87299. Positive cells hybridoma were intraperitoneally injected with syngeneic to Balb/c mice to obtain ascites containing anti-PRO87299 monoclonal antibodies. Alternative cell hybridoma can be grown in bottles for cell culture or ro is larnach bottles. Purification of monoclonal antibodies produced in the ascites was carried out using ammonium sulfate precipitation and subsequent exclusion chromatography. Alternatively, you can use affinity chromatography based on binding of antibody to protein A or protein G.

As indicated previously, received nine (9) antibodies that specifically bind to the PRO87299. Determined that of these nine antibody labeled 5F5.1, is an antibody-agonist. The agonist activity was determined by suppression of proliferation of CD4+ T-cells. CD 4+ T cells were isolated from human blood as described previously in example 2, and cultured with cross-linked antibodies associated with placecom. 96-well tablets were prepared by incubation over night at 37 °C with antibodies goat against mouse IgG at a concentration of 10 μg/ml and washed with PBS to remove excess. Anti-CD3/anti-CD28 antibodies were added to coated with IgG tablets with anti-PRO87229 antibody or without him. The combination of anti-CD3(0.1 ág/ml) and anti-CD28 (0.25 microgram/ml) stimulates the proliferation of CD4+ T-cells, and adding anti-PRO87299 antibodies reduces proliferation in 5 times, as measured by thymidine uptake (Fig). For one anti-CD3 antibodies did not show proliferation and control antibodies also showed no proliferation. The activity of the agonist anti-PRO87299 antibodies 5F5.1 you can stop heat inactivation hybridoma 5F5.1 deposited in the ATCC under the Budapest agreement (see example 19).

The second experiment was performed using a soluble antibody. For anti-CD3 (10 μg/ml) and anti-CD28 (5 μg/ml) when added to kulturalny environment also showed an increase in the proliferation of CD 4+ T-cells. For anti-PRO87299 antibodies added to the culture medium with two stimulating antibodies, showed suppression of proliferation of CD4+ T-cells up to 50%. Anti-PRO87299 antibody used in the range of 5-200 μg/ml, and the suppression of proliferation of CD4+ cells was dependent on the dose in this range.

Antibody 5E10 is an antibody specifically binding to PRO87299, but not with agonistic effect. It is shown that this antibody recognizes PRO87299 on primary B-cells and CD4+ T-cells. It can also recognize transfetsirovannyh PRO87299 cells using FACS analysis. Antibody 5E10 reproducibly has no agonistic effect.

Thus, the antibodies specifically bind PRO87299. Anti-PRO87299 antibody antagonists are useful for stimulating an immune response, which may be useful for the treatment of immunodeficiencies and reflections infection by pathogens. Anti-PRO87299 antibody agonists are useful for reducing the proliferation of CD4+ T-cells, thus reducing the immune response, and may be useful for treatment of autoimmune diseases, lymphoma and pospolite inogo bowel disease.

EXAMPLE 13: Purification of PRO87299 polypeptide using specific antibodies

Natural or recombinant polypeptides PRO87299 you can clear many generally accepted in the field of methods of protein purification. For example, propolypeptide PRO87299, Mature PRO87299 polypeptide, or propolypeptide PRO87299 clear immunoaffinity chromatography using antibodies specific for the polypeptide of interest PRO87299. As a rule, immunoaffinity column receive covalent attach antibodies against PRO87299 polypeptide to an activated chromatographic resin.

Polyclonal immunoglobulins are obtained from the immune serum, or precipitation with ammonium sulfate or by purification on immobilized protein A (Pharmacia LKB Biotechnology, Piscataway, N.J.). Similarly, monoclonal antibodies obtained from ascitic fluid of a mouse precipitation with ammonium sulfate or chromatography on immobilized protein A. Partially purified immunoglobulin is covalently attached to a chromatographic resin such as CnBr-activated SEPHAROSE™ (Pharmacia LKB Biotechnology). The antibody is combined with a resin, the resin is blocked and derived resin was washed according to the manufacturer's instructions.

Such immunoaffinity column used for purification of PRO87299 polypeptide by obtaining a fraction from cells containing a PRO87299 polypeptide in a soluble f is RME. This preparation was obtained by solubilization of the whole cells or subcellular fractions obtained by differential centrifugation, addition of detergent or by other methods well known in the field. Alternative soluble PRO87299 polypeptide containing a signal sequence may be secreted in an acceptable amount in the environment in which growing cells.

The product containing soluble PRO87299 polypeptide, was passed through immunoaffinity column and the column was washed under conditions that allow the preferred absorption of PRO87299 polypeptide (for example, buffers of high ionic strength in the presence of detergent). Then elution was performed with a column under conditions that violate the binding of the antibody/PR087299 polypeptide (for example, a buffer with low pH, such as approximately pH 2-3, or a high concentration chaotropes tools, such as urea or thiocyanate ion), and collected a PRO87299 polypeptide.

EXAMPLE 14: Screening drug

The present invention is particularly useful for screening compounds by using a PRO87299 polypeptide or binding fragments of any of the many methods of screening drugs. PRO87299 polypeptide or fragment employed in such a test may be present, or free in solution, attached to the solid substrate, borne on a cell surface or localized inside the cell. In one method of screening drugs using eukaryotic or prokaryotic cells-owners, stably transformed with recombinant nucleic acids expressing the polypeptide or fragment PRO87299. Conduct screening of drugs against such transformed cells in the analysis of competitive binding. These cells in viable or fixed form, can be used for conventional analyses of the binding. Can be measured, for example, formation of complexes between the polypeptide fragment of PRO87299 or test tool. Alternatively, you can explore the reduction of the formation of the complex between PRO87299 polypeptide and its cell-target or receptor target caused by the test tool.

Thus, the present invention relates to methods of screening for drugs or any other means, which may affect associated with a PRO87299 polypeptide disease or disorder. These methods comprise contacting such funds with the polypeptide or fragment PRO87299 and analysis (i) the presence of a complex between the agent and the polypeptide or fragment PRO87299, or (ii) the presence of a complex between the polypeptide or fragment PRO87299 and cell pursue the AMI, well known in this field. In such assays, competitive-binding polypeptide or a fragment PRO87299, as a rule, is labeled. After suitable incubation, free polypeptide or fragment PRO87299 separated from the polypeptide or fragment PRO87299 present in bound form, and the amount of free or not included in the complex of the label is an indicator of the ability of a specific means to associate a PRO87299 polypeptide or to interfere with the complex PRO87299 polypeptide/cell.

Another method of screening drugs include high-throughput screening of compounds having suitable binding affinity of with the polypeptide and is described in detail in WO84/03564, published on September 13, 1984 In summary, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic needles or any other surface. With regard to PRO87299 polypeptide carry out the reaction of the tested peptide compounds with PRO87299 polypeptide and rinse. Related PRO87299 polypeptide detected by methods well known in the field. Purified PRO87299 polypeptide can also directly cover the tablets for use in the above methods of screening drugs. In addition, you can use a non-neutralizing anti-Christ. ate to capture the peptide and immobilize it on a solid substrate.

The present invention relates also to the use of competitive analysis screening of drugs in which neutralizing antibodies capable of binding a PRO87299 polypeptide specifically compete with a test compound for binding to a PRO87299 polypeptide or its fragments. In this way, antibodies can be used for detection of any peptide separating one or more antigenic determinants with a PRO87299 polypeptide.

EXAMPLE 15: the Rational design of drugs

Rational design of drugs is to obtain structural analogues of interest biologically active polypeptide (i.e PRO87299 polypeptide) or of small molecules with which they interact, such as agonists, antagonists or inhibitors. Any of these examples can be used to model the drugs which are more active or stable forms of PRO87299 polypeptide or which enhance or impede the functioning of PRO87299 polypeptide in vivo (c.f., Hodgson, Bio/Technology, 9: 19-21 (1991)).

One sposobu three-dimensional structure of PRO87299 polypeptide or complex PRO87299 polypeptide - inhibitor is determined by roentgenocinematography, computer modeling or, more usually, a combination of the two methods. You should install and shape, and charges polypep the IDA PRO87299 to determine patterns and identify the active site(sites) of the molecule. Less often, useful information regarding the structure of PRO87299 polypeptide can be obtained by modeling based on the structure of homologous proteins. In both cases, important information about the structure used for the design of similar molecules, such PRO87299 polypeptide, or to identify efficient inhibitors. Useful examples of rational design of drugs may include molecules with improved activity or stability as shown by Braxton and Wells, Biochemistry. 3_l:7796-7801 (1992), or acting as inhibitors, agonists or antagonists of the natural peptides as shown by Athauda et at, J. Biochem., 113:742-746 (1993).

It is also possible to select specific target antibody, selected by a functional analysis, as described above, and then to solve its crystal structure. In this way, in principle, receive Pharmacor on which you can base subsequent design of the medicinal product. It is possible to completely avoid protein crystallography, getting antiidiotypic antibodies (anti-IDs) to a functional, pharmacologically active antibody. Expect as specular reflection specular reflection area of the binding of anti-id is similar to the original receptor. Anti-id can then be used to identify and isolate peptides from banks of chemically or biologically by the scientists of the peptides. Then the selected peptides will play the role of Pharmacare.

Thanks to the present invention can be made available significant amounts of PRO87299 polypeptide to perform such analytical studies as roentgenocinematography. In addition, knowledge of the amino acid sequence of PRO87299 polypeptide, presented here, will provide guidance for use of methods of computer modeling instead of or in addition to rentgenocraniology.

EXAMPLE 16 - PRO87299 specifically binds HVEM

Screening libraries of proteins were identified that specifically binds to PRO87299 HVEM. The extracellular domain PRO87299 was merged with Fc man to get PRO87299(ECD)-Fc. This protein was added at the amino group to the sensor chip CM5 Biacore™ (BIAcore, Inc., Piscataway, NJ) at approximately 9000 units of the answer, as broadly described in Chen, Y. et al., J. MoI Biol 293:865-881 (1999). Briefly, karboksimetilirovaniya dextranase biosensor chips (CM5, BIAcore™ Inc.) activated hydrochloride N-ethyl-N'-(3-dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxysuccinimide (NHS) according to the supplier's instructions. PRO87299(ECD)-Fc was dissolved and injected at a flow rate to achieve approximately 9000 units response (RU) attached protein. The second flow cell on the same chip was attached at the amino group of the control protein, PRO4346-Fc people the century (inventory number in Genbank AK057097), at approximately 18500 units of the answer. Performed the injection of 1M ethanolamine to block unreacted groups. Then separate proteins from a library of proteins SPDI, consisting of approximately 2000 proteins were injected with concentration mcg/ml and evaluated the binding to change the units of the response as a function of time. Found that HVEM binds to PRO87299(ECD)-Fc, but not control PRO4346-Fc. As shown in Fig, linking PRO87299 and HVEM leads to highly reliable increase of 1200 units of the response compared to control. Speed link (konand the rate of dissociation (koff) was calculated using a simple model linking the Langmuir one-to-one (software BIAcore™ Evaluation version 3.2) by simultaneous selection curve points for sensogram Association and dissociation. The equilibrium dissociation constant (Kd) was calculated as the ratio of koff/kon.

PRO87299 selectively binds to HVEM, as shown in Fig. In this experiment PRO87299(ECD)-Fc and members of the CD28 family hCTLA4-Fc, hPD-l-Fc, hICOS-Fc or hCD28-Fc was added at the amino group to chip in Biacore™ CM5 on approximately 8000 units of the answer. Then each was analyzed for ability to bind HVEM. Protein HVEM-Fc was obtained by legirovaniem nucleic acid encoding amino acids 1-199 HVEM, Fc, getting protein HVEM-Fc. This HVEM-Fc cloned in expressyou the vector, producing a fused protein with a stable transfection in CHO cells. All labeled Fc proteins were purified to more than 90% purity by affinity chromatography using protein A Sepharose™ (Amersham). The result was that mcg/ml HVEM-Fc injected at 5µl/min, selectively binds to PRO87299, but not with other tested members of the CD28 family. The positive activity of each member of the CD28 family was confirmed by testing the response of bonding with their known ligands (data not shown) (members of the CD28 family and ligands bought in R&D systems).

Linking PRO87299 with HVEM is dependent on pH, but independent of the NaCl concentration. When using Biacore analysis™, as described above, two independent drug HVEM-Fc was associated with PRO87299 attached at the amino group to chip in Biacore™ CM5. As shown in Fig, the link is not broken during processing 2,5M NaCl; however, the complex PRO87299/HVEM can be dissociativity 10 mm glycine at pH 3.0.

The interaction of PRO87299/HVEM can be blocked by antibodies to PRO87299. In this experiment, HVEM-Fc was added at the amino group to the sensor chip, Biacore™ CM5 about 7500 units of the answer. Injection PRO87299(ECD)-Fc was performed for two minutes at a flow rate of 5µl/min response Unit (RU) read through 105 seconds after injection. For PRO87299(ECD)-Fc (8 nm) got a response of 100 RU. Each antibody in increasing the concentration of then pre-mixed with PRO87299(ECD)-Fc (8 nm) and incubated for 1 hour. The binding of each sample was measured in a random order and in two iterations and 10 mm glycine pH of 2.5 was used for the regeneration of the connecting surface after each injection. As shown in Fig, anti-PRO87299 antibody 5E10 and 3Bl.9 block the binding of PRO87299 with HVEM-dependent concentration of the way, while antibody agonist 5F5.1 does not have a blocking effect. For the injected antibody alone showed no binding to immobilized HVEM (data not shown). Concentration was calculated on the basis of the apparent reduced molecular weight of PRO87299(ECD)-Fc (55 kDa) and mass antibodies 150 kDa.

PRO87299 binds to HVEM in the analysis of cell-based. In this experiment, cells 293 people (ATCC CCL 1573) are grown to confluently plates for culturing cells in medium such as DMEM, supplemented with fetal calf serum and, optionally, nutrient components and/or antibiotics. Approximately 10 μg of DNA pRK5-HVEM is mixed with about 1 μg DNA encoding the gene VA RNA [Thimmappaya et al., Cell, 3_1:543 (1982)]and dissolved in 500 μl of 1 mm Tris-HCl, 0.1 mm EDTA, 0,227 M CaCl2. To this mixture are added dropwise to 500 μl of 50 mm HEPES (pH to 7.35), 280 mm NaCl, 1.5 mm NaPO4and draught allow you to form for 10 minutes at 25°C. the Precipitate is suspended and added to the 293 cells and allow to settle for about four hours at 37°. The culture medium is taken and 2 ml of 20% glycerol in PBS is added for 30 seconds. Then 293 cells washed in serum-free medium, add fresh medium and cells incubated for about 5 days. Alternative approximately 10 μg of DNA pRK5-HVEM is mixed with reagent Lipofectamine™ (Gibco/BRL, Gaithersburg MD) and spend the transfection following the manufacturer's instructions. After transfection of 293 cells HVEM were incubated with radioactively labeled with I125PRO87299(ECD)-Fc and was allowed to happen binding. Then radioactively labeled PRO87299 competed with unlabeled PRO87299(ECD)-Fc, and the expected number of total binding sites and the dissociation constant (Kd) was determined by analysis of Scatchard. Fig(A) is a graph of Scatchard, and Fig. 17(B) is a graph showing the displacement, showing the binding of PRO87299(ECD)-Fc cells, temporarily transfitsirovannykh HVEM. These data show that the Kd for PRO87299 is approximately 25 nm. The total binding of radioactively labeled PRO87299(ECD)-Fc cells HEK 293 transfection with empty accounted for 2.5% of the binding transfitsirovannykh HVEM cells (data not shown). Using this method, we determined the affinity of interactions HVEM/LIGHT/PRO87299. It is indicated in table 7 below.

Table 7
Downregulation of proteinThe ligandKd (nm)
HVEMI-125-PRO87299-Fc25
HVEMI-125-LIGHT-FLAG2,5
PRO87299I-125-HVEM-Fc5,5
LIGHTI-125-HVEM-Fc7
PRO87299/LIGHTI-125-HVEM-Fc0,5

Anti-PRO87299 antibody (3B1.9) dose-dependent way competes with HVEM for binding to PRO87299(ECD)-Fc, as discussed earlier in this example.

Taken together, these data show that specifically binds to PRO87299 HVEM, as determined by protein-protein interactions, blocking protein-antibody and analysis in vivo.

EXAMPLE 17 - PRO87299 and LIGHT can bind HVEM at the same time

Published that LIGHT (GenBank Accession No: NM_172014, SEQ ID NO:5, SEQ ID NO:6) can communicate with HVEM (Marsters, S.A. et al., Curr. Biol. 8 (9), 525-528 (1998). Mauri D.N. et al, Immunity (8), 21-30, (1998)). To confirm that LIGHT and PRO87299 can bind HVEM at the same time, the authors of the present invention conducted an experiment on joint binding. HVEM-Fc was added at the amino group to behold the weed chip Biacore™ CM5 approximately 150 units of the answer. Fewer immobilized HVEM-Fc was important to achieve a nearly saturated binding PRO87299-Fc. On Fig shown that LIGHT (25 nm) and PRO87299-Fc (17 nm) were injected independently with 5µl/min for 1200 seconds (red and blue curves, respectively). Then inject the mixture is LIGHT and PRO87299-Fc in the same final concentrations (green curve). Calculated amount sensogram separately injected LIGHT and PRO87299-Fc (grey curve) closely coincides with the experimental data, confirming that LIGHT and PRO87299 able to bind HVEM at the same time. Concentration is based on the molecular mass of the monomer LIGHT 25 kDa and low molecular weight PRO87299-Fc (55 kDa).

LIGHT does not block the interaction of PRO87299 with HVEM. PRO87299-Fc was added at the amino group to the sensor chip, Biacore™ CM5 at approximately 9,800 units of the answer. LIGHT (purchased from Alexis™, Cat.#552-018 - C010) were incubated in increasing concentrations of 4 nm HVEM within 1 hour. As shown in Fig, increasing the concentration of LIGHT to a final concentration of 300 nm does not block the binding of PRO87299-Fc/HVEM. The activity LIGHT was confirmed by binding to immobilized HVEM-Fc on the sensor chip CM5 (data not shown). LIGHT one is not bound to the immobilized PRO87299-Fc (data not shown). All sensogram binding were performed in random order and in two repetitions. Response unit recording the Wali as the difference between the background response and the response for 15 seconds before the end of 2 min injection at 5 ál/min Concentration is based on the molecular mass of 25 kDa for the monomer LIGHT and 55 kDa for the monomer HVEM. These data show that LIGHT does not block the binding of HVEM to PRO87299.

HVEM originally identified as the cellular receptor for entry into the cell of herpes simplex virus - 1 (HSV-1), and showed that it binds to the glycoprotein D (gD) of HSV-I (Mongomery et al., Cell 87:427-436 (1996)). HVEM contains three cysteine-rich domain (CRD), which are common structural property of all members of the TNFR family. Solution of the crystal structure of gD protein in complex with HVEM showed that the first CRD HVEM binds protein gD, while the second CRD provides structural support to the first CRD (Carfi et al., MoI. Cell 8: 169-179 (2001)). The result is that PRO87299 interacts with the LIGHT and does not compete for binding to HVEM, leads to the hypothesis that PRO87299 interacts with the external surface of the complex HVEM/LIGHT. To test this hypothesis constructed derived from phage peptide (BP-2)that can block the binding of HVEM with glycoprotein D (gD) of herpes, but not with LIGHT (Sarrias et al., Mol. Measurement. 37:665-673: (2000)). At concentrations inhibiting the binding of gD, BP-2 inhibits the binding of PRO87299 with HVEM (figa). When a direct comparison of recombinant protein gD (form Δ290-299, Milne et al., J Virology. 77:8962-8972 (2003)) also inhibits the binding of HVEM to PRO87299 (pigv). These results were repeated in the analysis of the binding of the cells, showing that recombinant gD (Δ 290-299 inhibits the binding of soluble PRO87299-Fc and HVEM-Fc with 293 cells, expressing HVEM or PRO87299 (figs and D, respectively). These results show that PRO87299 interacts with the first CRD HVEM in the area, distant from the binding site LIGHT. The discovery that PRO87299 interacts with LIGHT and HVEM, will allow obtaining antibodies or small molecules against HVEM, which can selectively inhibit the interaction of PRO87299/HVEM without violating interaction PRO87299/LIGHT. Another type of antibodies or small molecules considered in this discovery is the one that will inhibit and interaction PRO87299/HVEM, and the interaction of PRO87299/LIGHT. These two classes of molecules can have different therapeutic effects.

EXAMPLE 18: PRO87299 inhibits the activation of T-cells

As mentioned in example 1, PRO87299 cloned for further studies of proteins containing ITIM domain. The intracellular domain PRO87299 contains two ITIM domain, which are inducible phosphorylated, which allows the recruitment and binding of SHP I and SHP-2, which indicates that the function PRO87299 is overwhelming (Watanabe N., et al., Nature Measurement. 1-10 (2003)). In this experiment, primary CD4+ T cells stimulated by different concentrations of immobilized anti-CD3 antibody. Fc-labeled control protein, HVEM-Fc or DcR3-Fc, also cross was made with the tablet using a pre-coating anti-Fc antitelomerase CD4+ T-cells was measured by incorporation of H3-thymidine after 72-hour incubation. This experiment was carried out in three repetitions of the hole, and the suppression is specified as secondary (figa). He hypothesized that HVEM is overwhelming for the proliferation of T-cells due to its blocking LIGHT. This experiment showed that natalina HVEM/LIGHT, activation of HVEM PRO87299 causes a decrease in proliferation of T-cells.

To further show that PRO87299 is overwhelming for the proliferation of T-cells, we conducted an experiment, as described above, but including the vast anti-PRO87299 antibody 3Bl.9. It is shown that the antibody 3B1.9 blocks the binding of PRO87299 with HVEM (see example 16), when CD4+ T cells stimulated by immobilized on tablets of anti-CD3 and +/- HVEM. Then the medium was added to the antibody 3B1.9 and control antibody. The data show that the antibody 3B1.9 may interfere PRO87299/HVEM and, thus, releases the cage from overwhelming the signal. In the processed 3B1.9 proliferate at the same rate as untreated cells (pigv). Only when using large concentrations of HVEM antibody 3B1.9 was ineffective. These data show that PRO87299 or antibody agonists can be used for suppression associated with T-cell autoimmune diseases or, on the contrary, antibodies, antagonists, such as 3B1.9 will be applicable to stimulate T-cells to reflect infection with pathogens.

EXAMPLE 19: the Reaction Tran who lancat-versus-host

The reaction transplantat versus host occurs when immune cells transplanted patients with weakened immune systems. T-cells of the donor recognize the antigens of the host and become activated, secrete cytokines, proliferate and differentiate into effector cells. This response is known as the reaction transplantat versus host (GVHR). Answer GVHR include the syndrome of multiple organ failure, and the effects can range from life threatening severe inflammation to moderate cases of diarrhea and weight loss. Model reaction of graft-versus-host on mice used for modeling clinical disorders acute and chronic GVHR, which can occur after bone marrow transplantation and autoimmune diseases. The General method is described in detail in Current Protocols in Immunology, above, section 4.3. In this case, human PBMC were purified from leukaphereses mass normal donor gradient Pichola. CD8 and NK overburden using sets to exhaustion MACS CD8 NK-cells. 40×106cells were injected with the female mouse SCID Beige at the age of 8-10 weeks on day 0. 100 mcg HVEM-Fc or a control protein were injected with intravenous on day 0, 2, 4, 6, 8, 10. As shown in Fig, activation PRO87299 through HVEM-Fc in the model GVHR was significantly prolonged survival. Mouse not treated HVEM-Fc, had 100% mortality at 13 days post-reconstruction therapy. Mice treated with HVEM-Fc, remained alive on the 19th day after rehabilitation therapy in a single procedure, and up to 30 days after regenerative therapy in another. This result indicates that activation of PRO87299 agonist will be applicable in the transplantation of the tissue, where the introduction of agonist PRO87299 will prevent or reduce rejection of transplanted tissue by the host.

EXAMPLE 20: the Pick of materials

The following line of cells hybridoma deposited in the American type culture collection, 10801 University Blvd., Manassas, VA 20110-2209, USA (ATCC):

Designation hybridoma/antibodiesATTCC No.Date Deposit
Btig5F5.1unassigned PTANovember 10, 2004
Btig3B1.9unassigned PTANovember 10, 2004

This Deposit is made under the terms of the Budapest Agreement on the international recognition of the Deposit of microorganisms for purposes of patent procedure and regulations in force of this agreement (the Budapest Treaty). This assures maintenance of a viable culture for 30 years from the date of deposited is Finance. The cell line will be made available at ATCC under the Budapest Agreement and is subject to the agreement between Genentech, Inc. and ATCC, which assures that (a) access to the culture will be provided during examination of a patent application for any particular member of the Commission as specified for this purpose in accordance with 37 CFR § 1.14 and 35 U.S.C. § 122, and (b) all data limit public access to the culture so deposited will be irrevocably removed upon granting of the patent. The patent of this application agrees that if the culture Deposit will perish or be lost or destroyed when cultivated under appropriate conditions, it will promptly replaced on notification with a viable specimen of the same culture. Availability of the deposited cell line should not be viewed as a license for carrying out the invention in practice, in violation of the rights granted under the authority of any government in accordance with its patent laws.

The above written description is believed sufficient to ensure implementation of the invention in practice, a specialist in this field. Scope of the present invention is not limited to the deposited material, deposited as an implementation option is intended as a single illustration to the particular aspects of the invention and any constructs which is functionally equivalent, are included in the scope of the present invention. Deposition of material here does not constitute recognition that the written description herein contained is not adequate to allow the practical application of any aspect of the invention, including its best option, and it should not be interpreted as limiting the scope of the claims to the particular the illustrations. Indeed, various modifications of the invention in addition to the shown and described herein, will become apparent to experts in this field from the above description and fall within the scope of the attached claims.

1. The antibody specifically binding to a variant of PRO87299 shown in figure 10 (SEQ ID NO:10).

2. The antibody specifically binding to PRO87299 and blocking interaction with HVEM PRO87299.

3. The antibody specifically binding to PRO87299, where the aforementioned antibody is an agonist PRO87299.

4. The antibody according to claim 3, where the specified antibody inhibits the proliferation of CD4+T cells.

5. The antibody according to claim 3, where the specified antibody inhibits proliferation of the cell lymphoma.

6. The antibody according to claim 3, where the specified antibody inhibits proliferation of NK-cells.

7. The antibody according to any one of claims 1 to 6, where the aforementioned antibody is a monoclonal antibody, international narcotics the new antibody, chimeric antibody, antibody fragment or single-chain antibody.

8. The selected antibody according to claim 3, produced by hybridomas Btig5F5.1 (No inventory in ATSC 6302).

9. The selected antibody according to claim 3, having the biological activity of the antibody produced by hybridomas Btig5F5.1 (No inventory in ATSC 6302), where biological activity is inhibition of proliferation of CD4+T cells.

10. A method of stimulating an immune response in in need thereof a mammal, comprising the introduction of a given mammal a therapeutically effective amount of the antibody of claim 2.

11. A method of reducing an immune response in in need thereof a mammal, comprising the introduction of a given mammal a therapeutically effective amount of the antibody according to claim 3.

12. The method according to claim 11, where the animal suffers from a disorder selected from systemic lupus erythematosus, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, spondyloarthropathies, systemic sclerosis, idiopathic inflammatory myopathies, Sjogren syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, thyroiditis, diabetes mellitus, immunopositive renal disease, demyelinating diseases of the Central or peripheral nervous system, ideoptions the th demyelinative polyneuropathy, of Guillain-Barre syndrome, chronic inflammatory demyelinative polyneuropathy, a hepatobiliary disease, infectious or autoimmune chronic active hepatitis, primary biliarnogo cirrhosis, granulomatous hepatitis, sclerosing cholangitis, inflammatory bowel disease, glutensensitive enteropathy, Whipple's disease, autoimmune or immunopositive skin diseases, bullous skin diseases, polymorphic erythema, and contact dermatitis, psoriasis, allergic diseases, asthma, allergic rhinitis, atopic dermatitis, hypersensitivity to food, urtikarii, immunologic diseases of the lung, eosinophilic pneumonias, idiopathic pulmonary fibrosis, hypersensitive pneumonitis associated with transplantation diseases, transplant rejection and graft reaction against owner.

13. The method of determining the presence of PRO87299 polypeptide in a sample suspected of containing the specified polypeptide, where the method includes the impact on the specified pattern anti-RO87299 antibody according to claim 1 and by the presence of binding of the specified antibodies to PRO87299 determine the presence in the sample of the polypeptide.

14. Way easier lymphomas in need of this mammal, which includes the introduction of specified mlekopitayushchikh effective amount of anti-RO87299 antibodies according to claim 3, which specifically binds to PRO87299 polypeptide.

15. Method of facilitating inflammatory bowel disease in need of this mammal, which includes the introduction of the specified mammal a therapeutically effective amount of anti-RO87299 antibodies according to claim 3, which specifically binds to PRO87299 polypeptide.

16. Method of reducing rejection of the transplanted cells in a mammal, comprising introducing an effective amount of anti-RO87299 antibodies according to claim 3.



 

Same patents:

FIELD: medicine.

SUBSTANCE: lysozyme as an activator of complement alternative path is sorbed wells of a microarray. Then a solution containing reagent RB and a tested sample containing human complement factor B of unknown activity is added. It is followed with incubation process with Mg2+ ions added and without Ca2+ ions. Then conjugated enzyme with antibodies against human component "C3" and substratum of this enzyme. The factor B activity is derived from the amount of formed enzymatic reaction product. A kit for assaying functional activity of human complement factor B comprises a flat-bottomed microarray with sorbed lysozyme, reagent RB (human blood serum free from factor B activity), conjugated peroxidase with antibodies to human complement component "C3", substrate buffer and donor blood serum as a reference.

EFFECT: method is characterised with good reproducibility of results and the absence of necessity to use hard-to-reach high-purity preparations of alternative path activators poorly maintaining its activating ability.

1 dwg, 2 ex

FIELD: chemistry.

SUBSTANCE: test system for immunoenzymometric determination of toxicants contains a column, inside of which there is a test layer in form of an immunoaffinity gel with implanted toxicant-specific antibodies, held above and below by porous filters. According to the invention, the test system also contains a control layer in form of an immunoaffinity gel with implanted enzymatic mark specific antibodies, held above and below by porous filters.

EFFECT: easier interpretation of analysis results without complicating the sample preparation procedure, concentration and immunoenzymometric determination of toxicants.

2 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of medicine, in particular to medical genetics, oncology and oncohematology. Method is technically simpler and less consumptive in terms of time and means. Genotype of gene XRCC1 399-th codon is studied. If in examined person genotype Gln/Gln is detected, conclusion about their predisposition to development of aggressive non-Hodgkin's lymphomas, in particular, of diffuse B- large cell lymphoma is made, if in examined person genotype Arg/Arg is detected, conclusion about lower in comparison with population risk of development of aggressive versions of NHL in said examined patient is made.

EFFECT: method is technically simple and less consumptive in terms of time and means, and provides possibility to determine person's predisposition to development of aggressive NHL in the cases when other methods do not allow to realise said determination.

5 dwg, 5 tbl

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biochemistry, more specifically to methods of carrying out immunoenzymometric and DNA-hybridisation analysis. A conjugate is proposed for bioluminescent molecular microanalysis, obtained from an enzyme, which is bonded to a biospecific reagent, where the enzyme used is Ca2+ regulated photoprotein obelin with an altered bioluminescent spectrum: recombinant obelin W92F; H22E or recombinant obelin Y138F. The method for simultaneous detection of two analytes through bioluminescent molecular microanalysis involves treating a solid phase with biospecific reagents, separation of unreacted liquid phase, treatment of the solid phase with an enzyme containing conjugate, separation of the liquid and solid phases and analysis of the solid phase. The biospecific reagent used for the first treatment of the solid phase is two immumoglobulins or one immunoglobulin with double specificity or two different oligonucleotides. Final treatment of the solid phase is done simultaneously with two conjugates, which respectively consist of recombinant obelins with different bioluminescent spectra and molecules with different biospecificity, where the recombinant obelins used are W92F;H22E and recombinant obelin Y138F with subsequent analysis on a double-channel bioluminometre with broad-band light filters.

EFFECT: use of this invention allows for accurate, fast, universal and easy realisation of the method of bioluminescent molecular microanalysis.

4 ex, 3 dwg, 2 cl

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to orthopaedics, and can be used to predict hip replacement results in early postoperative period. To implement said method, the patient's blood is sampled prior to and 1.5 months after operation to evaluate biochemical markers bone resorption and formations. If in postoperative period as compared to preoperative one, Cross-Laps level increases at least twice, while osteocalcin increases no more than half as much, apparent prevalence of resorption processes not compensated by intensified osteogenesis is diagnosed, while high risk of aseptic instability of endoprosthesis is predicted.

EFFECT: application of the invention allows accelerating, simplifying and improving accuracy of prediction of hip replacement results.

1 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biochemistry and can be used in enzymology, microbiology, pharmacology, clinical biochemistry for screening and quantitative evaluation of activity of proteolytic enzymes. The method is realised as follows: immunoglobulin G (IgG) is sorbed in cavities of a microplate, a solution is then placed in cavities of the microplate, containing proteolytic enzymes. Incubation is done, resulting in splitting of immunoglobulin molecules and their desorption. Contents of the cavities are removed. The conjugate of the enzyme with protein A staphylococcus, a substrate of this enzyme, is added and incubation is repeated. The result of this reaction is analysed with a spectrometre with a vertical beam by measuring absorption of light at 492 nm and activity of IgG-proteinase is calculated from the amount of hydrolysed substrate of the enzymic reaction.

EFFECT: design of a method which is simple to implement, provides for good reproducibility of results, has high sensitivity, does not require use bacteria antigens, in which there is low consumption of substrate, possibility of using immunoglobulins regardless of their specificity.

1 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, specifically to medical diagnostic agents (allergenic preparations) applied to diagnose hypersensibility to a foodstuff in children and adults by application skin testing. A ready form of food allergen represents a dispersive system in the form of gel produced by gelation of the melted gel in pockets of an applicator mould fixed on a plaster surface. The dispersive system consists of suspended powdered allergen made of fresh integral foodstuff not conditioned in an adjuvant which is represented with microbial polysaccharide.

EFFECT: there is provided gel state, stability and safety of the form of food allergenic preparation.

2 dwg

FIELD: chemistry.

SUBSTANCE: description is given of polyaniline in form of an emaraldine base of formula [(-C6 H4-NH)2-(NH=C6·H4=NH-)]n n=20 to 10000 or interpolymer of a complex of polyaniline with poly-(2-acrylamido-2-methyl-1-propane-sulphonic acid), i.e. salt of emaraldine with poly-2-acryloamido-2-methyl-1-propane sulphonic acid of formula , n=50 to 50000 as a sorbent for removing viruses, non-viral proteins and for making an immunoasorbent based on said sorbent for isolating antiviral antibodies.

EFFECT: following methods are also described: method of removing viruses through immobilisation on a sorbent; immunoadsorption method; method of sorption of non-viral proteins from complex mixtures using sorbent.

20 cl, 2 ex, 4 tbl, 2 dwg

FIELD: chemistry.

SUBSTANCE: description is given of polyaniline in form of an emaraldine base of formula [(-C6 H4-NH)2-(NH=C6·H4=NH-)]n n=20 to 10000 or interpolymer of a complex of polyaniline with poly-(2-acrylamido-2-methyl-1-propane-sulphonic acid), i.e. salt of emaraldine with poly-2-acryloamido-2-methyl-1-propane sulphonic acid of formula , n=50 to 50000 as a sorbent for removing viruses, non-viral proteins and for making an immunoasorbent based on said sorbent for isolating antiviral antibodies.

EFFECT: following methods are also described: method of removing viruses through immobilisation on a sorbent; immunoadsorption method; method of sorption of non-viral proteins from complex mixtures using sorbent.

20 cl, 2 ex, 4 tbl, 2 dwg

FIELD: medicine.

SUBSTANCE: invention can be used in the patients manifesting high risk of colonic diverticula development to verify diverticular enteropathy (DE). It is ensured by analysing 1 mm of mucous membrane of rectosigmoid intestine for count of colonocyte immunopositive to P substance and to vasointestinal peptide (VIP). If the density of colonocyte immunopositive to P substance P is within 16.0±1.2 and to VIP within 2.3±0.3, diverticular enteropathy is diagnosed.

EFFECT: higher safety of diagnostics and usability in contraindications to X-ray and endoscopic examinations at patients suspected in DE.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: strain A-4A7 is prepared by fusion of mouse myeloma cells of line SP2/0.Agl4 with mouse lymphocytes of line Balb/c immunised by introduction in pads of a purified preparation AMGF (alpha2-microglobulin of fertility) separated from amniotic fluid, and deposited in the transplantable mammal cell culture collection of the Research Institute of Human morphology of the Russian Academy of Medical Science numbered 131/2002. Strain A-4A7 synthesises monoclonal antibodies (MCA) of IgGI class specifically reacting in solid-phase immune-enzyme analysis (IEA) with AMGF isoforms of endometrial, follicular and sperm nature. Activity of the strain: cultural supernatant contains MCA 3-5 mkg/ml, while ascetic fluid contains MCA 2-5 mg/ml. The antibody titre in cultural fluid is 1:500-1:1000, in ascetic fluid up to 1:1×107. A-4A7 bonds various AMGF protein glycoforms produced in male and female reproductive organs. Application of MCA A-4A7 as an immunodiagnosis test systems allows for high-specific and high-sensitive (1 ng/ml) quantitative analysis of various AMGF/glykodeline isoforms in biological liquids.

EFFECT: new compounds are characterised with valuable biological properties.

2 ex

FIELD: medicine.

SUBSTANCE: according to the present invention, there are disclosed disease diagnostic techniques and sets characterised by nonphysiological content of protein Hepsidin in mammals. Substance of the invention lies in binding antibody and polypeptide, where antibody or its fragment is specifically bound with one or more average epitopes or epitopes of carboxyl termination of sequence SEQ ID NO: 2. Additionally, there are disclosed relevant antibodies.

EFFECT: disease screening characterised by nonphysiological content of protein Hepsidin in organism.

19 cl, 2 ex, 16 dwg, 2 tbl

FIELD: medicine.

SUBSTANCE: method for making polyclonal Nogo protein antibodies by protein immunisation of an animal, with at least 6 amino-acid residues of active area Nogo A, free from any other myelin material of central nervous system whereto bound in natural conditions. Said active area covers position 1-171, 260-974, 1163-1178 of the corresponding amino acid sequence of protein Nogo A. There is disclosed separated antiserum based on polyclonal antibodies made under said method. There are disclosed methods for immunisation of a non-human animal to make polyclonal antibodies, as well as method for making monoclonal antibody, and the specified monoclonal antibody.

EFFECT: making active protein Nogo A antibodies to be applied in medicine for neurite growth activation.

26 cl, 18 dwg, 2 tbl, 8 ex

FIELD: biology.

SUBSTANCE: present invention relates to biotechnology. An A-5D1 strain is obtained from fusing mouse myeloma cell line SP2/0.Ag14 with mouse lymphocyte line Balb/c, immunised by introduction into pouches of a purified preparation of alpha 2-fertility microglobulin, extracted from amniotic fluid, and deposited in the collection of passaged culture of mammal cells of the state research institute of human morphology (Russian Academy of Medical Sciences) under the number 144/2002. The strain of hybredome A-5D1 synthesises the IgG1 class monoclonal antibody, which specifically interacts in enzyme-linked immunosorbent assay and immunohistochemical assay with isoforms of alpha 2-fertility microglobulin of endometrial or special origin. Monoclonal antibodies do not have cross reaction with placental α 1-microglobulin, trophoblastic β1-globulin, human chorionic gonadotropin, α-fetoprotein, bovine serum albumin, and C-reactive protein. Monoclonal antibodies detect alpha 2-fertility microglobulin/glycodelin in cells and tissue of female and male reproductive organs.

EFFECT: use of monoclonal antibody A-5D1 as an immunodiagnostic system allows for quantitative analysis of isoforms of alpha 2-fertility microglobulin/glycodelin in body fluids with high sensitivity (1 ng/ml) and specificity.

3 ex

FIELD: medicine; pharmacology.

SUBSTANCE: allocated human monoclonal antibodies which specifically bind a receptor of the epidermal growth factor (EGFR), and also corresponding compositions on the basis of antibodies and a biospecific molecule are described. Human antibodies can be received with use of the transgenic mouse capable to formation of set of isotypes of human monoclonal antibodies by recombination V-D-J and switching of isotypes. The pharmaceutical compositions containing human antibodies for treatment or prevention of diseases, mediated by expression EGFR, the transgenic animals distinct from a human, the specified expressing antibodies, hybridomes and transfectomes which produce human antibodies are also presented. Ways of therapy and diagnostics of the diseases mediated by expression EGFR, with use of human antibodies or their antigen-binding of fragments, and also methods of growth suppression of the cells expressing EGFR, and an induction of cytolysis of the specified cells are described.

EFFECT: invention allows obtaining therapeutic and diagnostic preparations of antibodies with improved properties.

53 cl, 22 dwg, 4 tbl, 11 ex

FIELD: biotechnologies.

SUBSTANCE: obtaining monoclonal antibodies immunoreactive with the nucleocapsid protein of the hepatitis virus C-4G5, and the development of a method of diagnostics based on the double layer version of immunoenzymometric assay for the detection of the nucleocapsid (core protein) of the hepatitis C virus using a combination of linear and conformational core protein epitope monoclonal antibodies 27, 1F9, and 4G5: MCA 1F9: linear epitope with amino-acid residues (AAR) 81-85, MCA 27, and 4G5: conformational epitopes at site 1-150 of the core protein AAR. The combination of monoclonal antibodies 27, 1F9, and 4G5, immunoreactive with the hepatitis C virus nucleocapsid protein may be used both for the capture (capture antibodies) and for the detection (detection antibodies) of the core protein. The double layer variant of the immunoenzymometric assay developed for the detection of the nucleocapsid of the hepatitis C virus using a combination of monoclonal antibodies including MCA 4G5 has high sensitivity and allows to detect core proteins in blood of both asymptomatic HCV-infected donors and patients suffering from acute and chronic hepatitis C. The advantages of the immunoenzymometric assay of the core protein may be useful for determining the viral load during IF therapy.

EFFECT: allows to diagnose hepatitis C with high probability at early stages of disease and is efficient for detection of HCV of at least three genotypes most actual for Russia.

3 cl, 3 tbl, 4 ex

FIELD: medicine, peptides, biochemistry, pharmacy.

SUBSTANCE: invention relates to modification of glycosylation of proteins for preparing polypeptides with improved therapeutic indices including antibodies with enhanced antibody-dependent cellular cytotoxicity. For preparing indicated polypeptides cell-host is used that is modified with nucleic acid encoding enzyme β-1,4-N-acetylglucosaminyltransferase III (GnTIII). Prepared polypeptide represents, in particular, IgG or its fragment. Invention discloses a method for preparing polypeptide and antibodies or its fragment and a fusion protein prepared by indicated method. Invention describes a pharmaceutical composition used for increasing Fc-mediated cellular cytotoxicity and comprising antibody and carrier, and its using in cancer treatment, and a method for treatment of disease associated with elevated amount or production of B cells using indicated antibody, in particular, against CD20, and representing antibody IDEC-C2B8 in the preferable variant. Invention provides preparing polypeptide and antibody possessing the enhanced Fc-mediated cellular cytotoxicity that decrease the content of B cells in a patient body.

EFFECT: improved preparing method, valuable medicinal properties of polypeptide and antibodies.

38 cl, 21 dwg, 4 ex

FIELD: biotechnology, immunology.

SUBSTANCE: invention describes a monoclonal anti-IFNα antibody that binds with the following subtypes of IFNα: IFNα1, IFNα2, IFNα4, IFNα5, IFNα8, IFNα10 and IFNα21 and comprises three CDR-sites of heavy chain. Amino acid is given in the invention description. Invention discloses heavy chain of anti-IFNα antibody or its fragment that comprise indicated CDR-sites also. Invention describes anti-IFNα antibody that comprises at least one light chain and one heavy chain. Invention discloses variants of nucleic acids encoding indicated antibodies and variants of vectors used for expression of nucleic acids, and variants of transformed host-cells. Among expression vectors invention describes also vectors deposited at № 2881 and № 2882 carrying heavy and light chain of antibody, respectively. Invention describes a method for preparing antibody from indicated cells. Invention discloses the murine hybridoma cell line deposited in ATCC at number № РТА-2917, and antibody produced by indicated cell line. Also, invention describes variants of the antibody-base pharmaceutical composition and a method used for diagnosis of autoimmune disease. Also, invention discloses using antibodies in treatment of disease or state associated with enhanced level of IFNα in a patient. Using the invention provides inhibiting biological activity of at least seven human IFNα subtypes simultaneously, namely: IFNα1, IFNα2, IFNα4, IFNα5, IFNα8, IFNα10 and IFNα12 that can be used in diagnosis and therapy of different human diseases mediated by IFNα, such as insulin-dependent diabetes mellitus or erythematosus lupus.

EFFECT: valuable biological and medicinal properties of antibodies.

53 cl, 4 tbl, 10 dwg, 2 ex

FIELD: biotechnology, immunology, molecular biology, pharmacy.

SUBSTANCE: invention describes variants of MCP-1-binding molecules. One of MCP-1-binding molecule comprises at least one variable region of immunoglobulin (VH) heavy chain comprising of hypervariable sites CDR1, CDR2 and CDR3 while other molecules comprises both light and heavy chains. Invention proposes DNA constructs encoding indicated MCP-1-binding molecules and expressing vector carrying at least one of these DNA constructs. Invention describes a method for preparing MCP-1-binding molecule. Invention discloses a method for treatment of disease or disorder mediated by MCP-1 or eotaxine-1 based on antibody raised to MCP-1 that binds eotaxine-1 by cross mode. Invention describes a pharmaceutical composition based on antibody raised to MCP-1 that binds eotaxine-1 by cross mode and used in treatment of disease or disorder mediated by MCP-1 or eotaxine-1 in a patient. MCP-1-binding molecules inhibit binding MCP-1 with its receptor. The full immobilized antibody is highly specific as far as it binds human recombinant MCP-1 with value KD = (43 ± 2.9) x 1012 and can be used in medicine.

EFFECT: valuable medicinal properties of antibodies, improved method of treatment.

13 cl, 5 dwg, 4 tbl, 2 ex

FIELD: immunology, medicine.

SUBSTANCE: claimed recombinant antibody (Ab) has at least constant regions in heavy and light chains representing human Ab regions. Said At inhibits bonding of integrine recognizing RGD and SVVYGLR sequences to integrine or fragment thereof. Also disclosed are nucleotide sequences (NS) encoding heavy and light chains of recombinant Ab as well as expression vectors containing respective NS. Described are host cell for Ab production, transformed with two vectors for expression of Ab heavy and light chains and method for abovementioned host cell application to produce recombinant Ab. Ab of present invention is useful in diagnosis and treatment of autoimmune diseases, rheumatism and rheumatoid arthritis.

EFFECT: therapeutic methods of increased efficiency.

45 cl, 14 tbl, 28 ex

FIELD: chemistry.

SUBSTANCE: proposed is a chimeric or humanised monoclonal antibody against hepatocyte growth factor, produced from L2G7 antibody. Invented is a mouse antibody L2G7, produced by hybridoma ATCC PTA-5162, and the said hydbridoma. Described is a cell line, producing a chimeric or humanised monoclonal antibody against hepatocyte growth factor. Proposed is a pharmaceutical composition and a method of treating tumours based on the said antibody.

EFFECT: use of the invention provides for a neutralising antibody against hepatocyte growth factor, which can be used in treating human cancer.

7 cl, 12 dwg, 1 tbl, 3 ex

Up!