Completed virus-like particles

FIELD: medicine.

SUBSTANCE: invention relates to virology, immunology and medicine. The composition contains antigen bound or fused with virus-like particle (VLP), completed with immunostimulating nucleic acid containing at least one unmathylated CpG-sequence and ligand of toll-like receptor (TLR). There are also disclosed vaccine composition and method for potentiating immune response in an animal.

EFFECT: invention can be used for inducing strong antibody and T-cell response and, particularly it is effective in treatment of allergy, tumours and virus chronic diseases, and also other chronic diseases.

25 cl, 12 dwg, 1 tbl, 11 ex

 

The text descriptions are given in facsimile form.

1. Composition for enhancing an immune response in an animal, comprising:
(a) a virus-like particle;
(b) immunostimulirutuyu nucleic acid,
where specified immunostimulirutuyu nucleic acid is demetilirovanny CpG-containing oligonucleotide and where specified immunostimulirutuyu nucleic acid (b) packaged in a virus-like particle (a);
(c) at least one antigen associated or mixed with the indicated virus-like particle (a), and
(d) at least one ligand of toll-like receptor (TLR), where the indicated TLR ligand is selected from a TLR4 ligand, the ligand of TLR7 or TLR8 ligand.

2. The composition according to claim 1, in which the indicated TLR ligand (d) is mixed with the VLP specified.

3. The composition according to claim 1, in which the indicated ligand (d) is a ligand of TLR4 and where preferably the indicated ligand (d) is chosen from the group including:
(a) LPS and its derivatives;
(b) monostability and its derivatives;
(c) a synthetic analogue LPS;
(d) gp96 and its derivatives;
(e) heat shock proteins and
(f) defensin.

4. The composition according to claim 1, in which the indicated ligand (d) PR is dstanley a TLR4 ligand, and where the indicated ligand (d) represents the LPS and its derivatives.

5. The composition according to claim 1, in which the specified CpG-motif specified demetilirovannogo CpG-containing oligonucleotide is part of palindrome sequence and where preferably specified palindrome sequence represents the sequence is GACGATCGTC (SEQ ID NO:39).

6. The composition according to claim 5, in which the specified demetilirovanny CpG-containing oligonucleotide contains or, alternatively, consists essentially of or alternatively consists of the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO:54).

7. The composition according to claim 5, in which palindrome sequence is flanked at its 5'-terminal stretch of at least and maximum 9 guanosine residues, and such palindrome sequence is flanked at its 3'-terminal stretch of at least 6 and maximum 9 guanosine residues, preferably where specified demetilirovanny CpG-containing oligonucleotide has a nucleotide sequence selected from the group including
(a) GGGGACGATCGTCGGGGGG (SEQ ID NO:40);
(b) GGGGGGACGATCGTCGGGGGG (SEQ ID NO:41);
(c) GGGGGGACGATCGTCGGGGGG (SEQ ID NO:42);
(d) GGGGGGGACGATCGTCGGGGGG (SEQ ID NO:43);
(e) GGGGGGGACGATCGTCGGGGGGG (SEQ ID NO:44);
(f) GGGGGGGGGACGATCGTCGGGGGGGG (SEQ ID NO:45);
(g) GGGGGGGGGGACGATCGTCGGGGGGGGG (SEQ ID NO:46);
(h) GGGGGGCGACGACGATCGTCGTCGGGGGGG (SEQ ID NO:47).

8. The composition according to claim 1, where the specified demetilirovanny CpG-containing oligonucleotide is not stabilized due to fosforo iatneh modifications phosphodieterase skeleton.

9. The composition according to claim 1, in which the indicated ligand (d) is a ligand of TLR 7 and 8.

10. The composition according to claim 9, where the specified ligand, TLR 7 and TLR 8 is imidazoquinolines.

11. The composition according to claim 1, in which the virus-like particle contains at least one first site of attachment, and the specific antigen (s) also contains at least one second site of attachment selected from the group including:
(a) the site of attachment of the antigen or antigenic determinant, not existing in nature;
(b) the site of attachment of the antigen or antigenic determinants present in nature, and the specified second site of attachment capable of Association with a first site of attachment.

12. The composition according to claim 11, further containing amino acid linker, and the specified amino acid linker contains or, alternatively, consists of the specified second site of attachment.

13. The composition according to claim 1, in which the virus-like particle contains or, alternatively, consists essentially of recombinant proteins of RNA bacteriophages, or fragments of these proteins, preferably specified RNA bacteriophage is selected from the group including
(a) bacteriophage Qβ;
(b) bacteriophage R17;
(c) bacteriophage fr;
(d) bacteriophage GA;
(e) bacteriophage SP;
(f) bacteriophage MS2;
(g) bacteriophage M11;
(h) bacteria the g MH;
(i) bacteriophage NL95;
(j) bacteriophage f2;
(k) bacteriophage RR and
(1) the bacteriophage AR.

14. The composition according to item 13, in which the virus-like particle contains recombinant proteins of RNA bacteriophages, or fragments of these proteins, and the RNA-bacteriophage is a bacteriophage Qβ or bacteriophage AR.

15. The composition according to claim 1, where the specified virus-like particle comprises the protein SEQ ID NO:1.

16. The composition according to claim 1, in which the specified antigen (s) selected from the group including:
(a) polypeptides;
(b) lipoproteins and
(c) glycoproteins.

17. The composition according to claim 1, in which the specified antigen (s) derived from a natural source selected from the group including
(a) the extract of pollen;
(b) extract dust;
(c) extract dust mites;
(d) the extract of mushrooms;
(e) extract of the epidermis of mammals;
(f) extract of feathers;
(g) extract insects;
(h) extract food;
(i) extract hair;
(j) the extract of saliva and
(k) extract serum.

18. The composition according to claim 1, in which the specified antigen (s) derived from a source selected from the group including
(a) viruses;
(b) bacteria;
(c) parasitic protozoa;
(d) prions;
(e) tumor;
(f) autoantigens;
(g) ones molecule haptens;
(h) allergens and
(i) hormones.

19. The composition according to claim 1, in which the specified antigen (s) is the Oh tumor antigen, preferably selected from the group including
(a) Neg;
(b) GD2;
(c)EGF-R;
(d) CEA;
(e) CD52;
(f) protein gp100 melanoma;
(g) protein melan-A/MART-1 human melanoma;
(h) the tyrosinase;
(i) protein NA17-A nt;
(a) protein MAGE-3;
(k) protein p53;
(l) protein of HPV16 E7;
(m) an analogue of any of the antigens (a)-(l) and
(n) a fragment of any of the tumor antigens (a)-(m).

20. The composition according to claim 1, in which the specified antigen (C) is an allergen derived from a source selected from the group including:
(a) the extract of pollen;
(b) extract dust;
(c) extract dust mites;
(d) the extract of mushrooms;
(e) extract of the epidermis of mammals;
(f) extract of feathers;
(g) extract insects;
(h) extract food;
(i) extract hair;
(j) the extract of saliva and
(k) extract serum.

21. The composition according to claim 1, in which the specified antigen (C) is an allergen derived from a source selected from the group including
(a) trees;
(b) grass;
(c) house dust;
(d) household dust mites;
(e) Aspergillus;
(f) the hair of animals;
(g) the feathers of animals;
(h) the venom of bees;
(i) animal products and
(j) vegetable products.

22. The composition according to claim 1, in which the specified antigen (s) selected from the group including
(a) phospholipase a2poison bee;
(b) Amb a1 (antigen pollen ragweed);
(c) Bet v1 (antigen birch pollen);
(d) 5 Dol m V (antigen OS is spotted);
(e) Der p 1 (antigen home dust mites);
(f) Der f 2 (antigen home dust mites);
(g) Der 2 (antigen home dust mites);
(h) Lep, d (dust mite antigen);
(i) Alt a 1 allergen fungi);
(j) Asp f 1 allergen fungi);
(K) Asp f 16 (allergen mushrooms) and
(l) allergens peanuts.

23. The composition according to claim 1, in which the specified antigen (s) represents the epitope of cytotoxic T-cell epitope of Th cells, or a combination of at least two of these epitopes, and at least two epitope linked directly together or through a linker sequence.

24. Method of enhancing an immune response in an animal, comprising an introduction to the animal a composition according to any one of claims 1 to 23.

25. Vaccine composition for enhancing immune response in animals, containing immunologically effective amount of the composition according to any one of claims 1 to 23 together with immunologically acceptable diluent, carrier or excipient.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention refers to medical products and concerns an ellagic acid composition for immune system enhancement, differing that additionally is contains chitosan beta-1.3/1.6-glucans or oligosaccharides.

EFFECT: offered composition possesses enhanced immunostimulating effect.

3 ex

FIELD: medicine.

SUBSTANCE: invention refers to pharmacology and can be used in veterinary science and medicine for chemotherapy. There is disclosed immunostimulating and antioxidant lithium composition containing lithium ascorbate and lithium aspartate in percentage ratio 50:50.

EFFECT: expansion of the list of low-toxicity immunomodulators applicable for manufacture of drugs.

1 dwg, 2 tbl

FIELD: medicine.

SUBSTANCE: invention concerns medicine, particularly therapy, and can be applied in chronic disease treatment. Method involves causative agent extraction or determination of antibodies to causative agents or extraction of genetic components from blood, body fluid or smear. Treatment is performed by vaccine drugs specific to one or several identified causative agents, additionally immunomodulators are administered.

EFFECT: activated repair processes, arrested development of disease state of organs and systems due to elimination of identified pathogen from organism and to immune correction.

3 cl, 8 ex

FIELD: medicine.

SUBSTANCE: invention concerns medicine, particularly granulocytopoiesis stimulants, radioprotectors and immune stimulants. Under cytostatics effect Cyclophilin A amplifies granulocyte precursor removal from marrowbone and stimulates granulocytopoiesis.

EFFECT: in case of sublethal radiation, cyclophilin A stimulates migration of marrowbone stem elements and participates in recovery of blood cells and immune system, and shows redioprotection properties.

4 dwg, 2 tbl

FIELD: medicine.

SUBSTANCE: medicinal agent contains alpha and/or beta and/or gamma human recombinant interferon, tocopherol acetate or other tocopherol derivatives, ascorbic acid and/or its salts, pantothenic acid or calcium pantothenate, or dexapanthenol, riboflavin or levocarnitine, and orotic acid and/or ornithine or its derivative - citrulline malate, or Glutoxim, antibacterial, antimycotic agents, additives: emulsifiers, stabilisers, preservatives, antioxidants and base. The formulation is suppositories in certain component ratio.

EFFECT: efficiency for severe infectious diseases and mixed infections.

9 cl, 18 ex

FIELD: medicine.

SUBSTANCE: invention concerns medicine, be more specific to oncology, and concerns the substances stimulating maturing of dendritic cells (DC). Application of fucoidan from Fucus evanescens or polysaccharide composition from Fucus evanescens consisting of fucoidan in amount of 60-80% and poly-mannuronic acid in amount of 20-40%, as an agent possessing ability to induce maturing of dendritic cells is offered. The declared fucoidan preparations have a standardised composition and, hence, possess direct biological effect. They keep the properties for long time (3 years).

EFFECT: increase of DC functional activity under the influence of the declared substances.

8 dwg

FIELD: medicine, veterinary science.

SUBSTANCE: invention concerns veterinary science, in particular, to ways of reception of immunomodulatory and antiseptic compounds for prevention and treatment of infectious diseases of animals. The way of reception of a complex immunotropic antiseptic preparation for prevention and treatment of infectious diseases of animals includes mixing of an amber acid, novocaine, Dorogov's antiseptic-stimulator of the second fraction and formalin in water at a following parity of components, wt %: amber acid 1; DAS №2 4; novocaine 0.25; formalin 0.4; the distilled water - the rest, and sterilisation using autoclave treatment which is performed in a 1 atm regimen. Within 20 minutes. The received compound possesses antiseptic, immunomodulatory and trophicostimulating activity at a parenteral way of introduction.

EFFECT: rising of efficiency of the received preparation at treatment and prevention of infectious diseases of animals.

2 tbl

FIELD: medicine.

SUBSTANCE: invention concerns medicine, namely to creation of immunogene compositions and vaccines for prevention or treatment of the infections caused by Gram-negative bacteria. The immunogene compositions containing a transferrin-binding fiber and Hsf, and a way of their reception are offered. It is shown, that the combination of these two antigens synergically influences on production of antibodies with high activity in the analysis of bactericidal Serum. The composition can be used in vaccines against Gram-negative bacteria, including Neisseria meningitides, Neisseria gonorrhoeae.

EFFECT: creation of immunogene compositions and vaccines for prevention or treatment of the infections caused by Gram-negative bacteria.

56 cl, 10 ex, 1 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention concerns area of medical products, in particular to application of complex bonds of iron (III) with carbohydrates or their derivatives for reception of a medical product for improvement of immune protection and-or activity of a brain at patients without an anaemia caused by deficiency of iron or deficiency of iron in which complex bond of iron (III) is iron (III)-polymaltose complex bond or complex bond of iron (III) with a product of oxidation one or several maltodextrins.

EFFECT: development of preparations for improvement of immune protection and-or activity of a brain at patients without an anaemia caused by deficiency of iron or deficiency of iron.

7 cl, 1 tbl, 1 ex

FIELD: medicine; pharmacology.

SUBSTANCE: substance of technical decision seeks to produce immunopotentiating composition based on nanotechnology products, specifically fullerenes and superdispersed diamond powders (nanodiamonds) produced by detonation synthesis. Composition contains modified fullerene of general formula C60-X, where C60 is fullerene nucleus, X is formylporphyrin, as well as superdispersed diamond powder in ratio as follows, wt %: porphyrin modified fullerene C60 - 50; superdispersed diamond powder - 50.

EFFECT: synergetic effect of immunopotentiating components activity with simultaneous considerable reduction in price concerning prototype composition.

2 tbl, 1 dwg

FIELD: medicine.

SUBSTANCE: invention claims synthetic DNS molecule encoding L1 HPV58 protein, where codons are optimised for high expression level in yeast cell. Also invention claims expression vector, yeast host cell, HPV58 virus-like particle and method of its obtainment, and pharmaceutical composition including such VLP.

EFFECT: invention can be applied in medicine for efficient immune prevention of papillomavirus infection by neutralising antibodies and cell-mediated immunity, and for treatment of developed HPV infections.

10 cl, 10 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: invention concerns area of medicine and concerns therapeutic and preventive vaccines against hepatitis B and HIV. The essence of the invention: the offered composition includes a superficial antigen of hepatitis B (HBsAg) as the main component, received as a recombinant product of Pichia pastoris and the vaccine antigen representing polypeptide CR3, containing epitopic determinants of a human immunodeficiency virus. The offered composition can be applied at HIV treatment and during too time as a preventive vaccine against the virus of hepatitis B.

EFFECT: working out of a composition which can be applied at treatment HIV and during too time as a preventive vaccine against the virus of hepatitis B.

3 cl, 5 dwg, 7 ex

FIELD: medicine.

SUBSTANCE: invention concerns virology and medicine area. The synthetic DNA-molecule coding protein L1 HPV45 is presented. Thus DNA-molecule was Codonum-optimised for high-level protein expression in a yeast cell. The given synthetic molecules can be used for reception of virus-like particles (VLP) HPV45 and for reception of vaccines and the pharmaceutical compositions containing VLP-particles HPV45.

EFFECT: effective immunologic prophylaxis of infections with papilloma virus due to neutralised antibodies and cellular immunity.

9 cl, 6 dwg, 8 ex

FIELD: pharmacology.

SUBSTANCE: invention relates to the field of medicine immediately dealing with preparation of pharmaceutical compounds. Proposed is a compound that contains a solution composed of a synthetic peptide, its final concentration being no less than 70 mg/ml, mixed with polyethyleneglycol. The synthetic peptide is represented by a HIV [cell] FI. The polyethyleneglycol final concentration is no less than 10% and no more than 75% of the compound total mass. Additionally proposed is a reference dose compound that contains a synthetic peptide (HIV [cell] FI) water solution with the synthetic peptide final concentration no less than 70 mg/ml mixed with polyethyleneglycol, the latter's final concentration being no less than 10% and no more than 75% of the compound total mass The proposed composition compound provides for maintenance of improved solubility and stability levels during lengthier periods of time.

EFFECT: proposed is a method of HIV-infection therapy consisting in the HIV-infected patient receiving injection of the pharmaceutical compound in accordance with the invention concept.

16 cl, 4 ex, 7 tbl, 1 ex

FIELD: biology, genetic engineering.

SUBSTANCE: invention concerns molecular biology and genetic engineering. Invention claims synthetic DNA molecule encoding HPV31 L1 protein, virus-like HPV31 particles, vaccine and pharmaceutical composition including virus-like HPV31 particles.

EFFECT: papilloma virus therapy.

17 cl, 6 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: claimed is polynucleous succession, coding polypeptide of human papilloma virus, representing epitope of antigen E1 from HPV 6b, epitope from HPV 6b E2 and epitope HPV 11 E2. Also claimed are expression vector and pharmacological composition.

EFFECT: invention can be used in treatment and prevention of human papillomaviral infections.

18 cl, 18 dwg, 7 ex

FIELD: veterinary science.

SUBSTANCE: method includes infecting the transplantable cell culture, cultivating the infected culture, settling the cells and cell detritus by centrifugation, preparing the cell lysate and freezing-defrosting. Herewith cell lysate is twice exposed to 12 mcm ultrasound within 1 minute every 1 min. After-centrifugation residual debris are refilled with distilled water, exposed to the same ultrasound. Supernatant fluids containing antigen are combined. Then antigen is double-activated with β-propiolactone in ratio 1:1000 at first at 37° constantly stirring, then β-propiolactone is introduced again in the same ratio, with exposition 18 hours and at temperature +4°C.

EFFECT: produced inactivated blutang antigen has high specificity and activity (tbl) and can be used for serodiagnosis in CFT, diffusion precipitation and EIA reactions.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention relates to fields of molecular biology, virology, immunology and medicine. Composition contains modified virus-like particle (VLP), immuno-stimulating substances, in particular, DNA-oligonucleotides, containing non-methylated C and G (CpG), and separate peptides, obtained from MelanA. Said CpG-VLP are considerably more immunogenic than their analogues, which do not contain CpG, and induce enforced B- and T-cell responses. Immune response against analogues of peptide MelanA, conjugated with VLP, is enforced in the same way as immune response against VLP itself. In addition, T-cell responses against peptide MelanA analogues are mainly directed to type Th1. Antigens, associated with VLP, loaded with CpG, can be ideal vaccines against allergy, tumors and other autologic molecules and chronic viral diseases.

EFFECT: invention can be used in medicine.

52 cl, 6 dwg, 4 tbl, 27 ex

FIELD: medicine.

SUBSTANCE: claimed invention relates to field of molecular biology, virology and medicine. Claimed is application of adenovirus for manufacturing medication for tumor treatment. Said virus is replication-deficient in cells which do not contain YB-1 in nucleus and encodes oncogenic protein E1A, which transactivates at least one viral gene from group including E1B55kDa, E4orf6, E4orf6 and E3ADP.

EFFECT: invention can be used for treating tumors demonstrating resistance to many cytostatic medications.

19 cl, 19 dwg, 13 ex

FIELD: medicine; biotechnologies.

SUBSTANCE: substance of invention involved reconstructed virus membrane with lipid bilayer containing fused virus protein and amphiphilic adjuvant represented with lipopeptide. Further invention refers to production procedures of reconstructed virus membranes manifesting fused membrane activity, that are lipid bilayer membranes preferably containing natural virus lipids, fused virus protein, optionally, one or more additional antigens and amphiphilic adjuvants. Besides invention refers to pharmaceutical compositions containing these reconstructed virus membranes.

EFFECT: intensified immune response.

13 cl, 6 ex, 1 tbl, 10 dwg

FIELD: biotechnology, veterinary science.

SUBSTANCE: invention relates to therapeutic vector used in therapy of infectious diseases in cats that comprises at least one foreign nucleic acid each of that (a) encodes protein taken among the group consisting of feline protein CD28 represented in SEQ ID NO:8 or its immunogenic moiety; feline protein CD80 represented in SEQ ID NO:2 or 3, or its immunogenic moiety; feline protein CD86 represented in SEQ ID NO:6 or its immunogenic moiety, or feline protein CTLA-4 represented in SEQ ID NO:10 or its immunogenic moiety; and (b) nucleic acid that is able to be expressed in insertion of vector in the corresponding host. Indicated therapeutic vector is used in effective dose as component of vaccine against infectious diseases in cats for their immunization and in methods for enhancement or inhibition of immune response in cats and reducing or eradication of tumor in cats. Invention provides stimulating the activation and proliferation of T cells and to enhance effectiveness of control of infectious diseases in cats.

EFFECT: valuable biological properties of recombinant virus.

41 cl, 13 dwg

Up!