Indole-alanine derivatives

FIELD: chemistry.

SUBSTANCE: invention relates to new indole-alanine derivatives of formula I: , where: R1 is phenyl, naphthyl, where phenyl is substituted with one or two halogen atoms, C1-6 alkyls, C1-6 alkoxy or phenyl C1-6 alkyls; and R2 is H, C1-6 alkyl; in free form, in hydrate form or in form of a pharmaceutically acceptable salt. Formula I compounds exhibit selective agonist activity towards S1P4 receptor, at least ten times more selective towards one or more of S1P1, S1P2, S1P3 or S1P5 receptors.

EFFECT: possibility of using derivatives in a pharmaceutical composition.

7 cl, 2 tbl, 1 ex

 

The present invention relates to organic compounds, method of their production and containing pharmaceutical compositions.

In one embodiment, the present invention relates to a compound which is an agonist of sphingosine-1-postanova receptor (S1P4), where the compound is selective for the S1P4 receptor in relation to one or more receptors S1P1, S1P2, S1P3 or S1P5. The S1P receptors are described, for example, in WO 03/061567. Preferably, the compound exhibits a selectivity for the S1P4 receptor in relation to all the above S1P receptors. The compound preferably exhibits a selectivity of at least 10-fold, more preferably 20-fold, most preferably 100-fold to the S1P4 receptor in relation to one or more of the above receptors S1P. Selectivity can be measured by determining the ratio EU50connections for the S1P4 receptor to EC50connection to receptors S1P1, S1P2, S1P3 or S1P5. Values EU50can be obtained, for example, in accordance with the analysis of binding with GTPγ35S or analysis of the mobilization of calcium, described next. In another preferred embodiment, the connection also has values EU50for the S1P4 receptor 1 μm or less in the analysis of binding with GTPγ35S or in the analysis of the mobilization of calcium.

In site Cetelem embodiment, the present invention relates to a compound of the formula I:

where R1represents phenyl or naphthyl, where phenyl is substituted by one or two halogen atoms, With1-6alkilani, C1-6alkoxy or panels1-6alkilani; and

R2represents hydrogen or C1-6alkyl;

in free form or in salt form.

Any alkyl group can be linear or branched. C1-6alkyl preferably represents C1-4alkyl. With1-6alkoxy preferably represents C1-4alkoxy.

The halogen can represent F, Cl, Br or I.

R1preferably represents a group of formula Ia:

where one or two radicals of R3, R4and R5represent hydrogen; and

one or two of the radicals R3, R4and R5represent halogen, C1-6alkyl, C1-6alkoxy or panels1-6alkyl;

or R3and R4or R4and R5together with the carbon atoms to which they are attached, together form a benzene ring.

In the formula I and Ia the following values preferably are independently or together in any combination or podnominatsii:

a) one of R4or R5is other than hydrogen, more preferably R5is other than hydrogen and R4

b) R4or R5represents benzyl, ethyl, butoxy, propyl, isopropyl or chlorine, more preferably R5represents one of the groups listed above and R4represents hydrogen;

C) R3represents a hydrogen or chlorine, more preferably hydrogen;

g) R2represents hydrogen or methyl.

Compounds or formula I can also form acid additive salts with inorganic or organic acids, for example hydrochloric, Hydrobromic or maleic acid. The compounds of formula I can also form cationic salts derived from carboxypropyl, in particular salts with alkali or alkaline earth metals, for example salts with sodium, potassium, calcium or magnesium, and salts with ammonium, derived from ammonia or organic amines.

The compounds of formula I contain a chiral center at the carbon atom with the primary amino group. The compound of formula I, therefore, can exist in two enantiomeric forms. It should be understood that the present invention also includes the racemate of formula I and any enantiomeric form.

The compounds of formula I can also be obtained in the form of their hydrates. Hydrates also form part of the invention.

The present invention also relates to a method for obtaining connected the th formula I, which includes removing the protective group from compounds of formula II

where R1and R2are as described above

R6represents a C1-6alkyl or benzyl,

R7represents a protective group for amino group, and

and, if necessary, conversion of the compounds of formula I in its salt.

The method can be carried out using conventional methods. Examples of suitable protective groups for amino groups are, for example, the groups described in the book "Protective Groups in Organic Synthesis", T.W.Greene, J.Wiley & Sons NY, 2nd Edition., Chapter 7, 1991, and listed in the references, for example acyl, for example tert-butyloxycarbonyl, benzyloxycarbonyl, 9-fluorenylmethoxycarbonyl, TRIFLUOROACETYL, trimethylsilylethynyl and the like. Removing the protective groups can be carried out, for example by hydrogenolysis, when R7is benzyloxycarbonyl and R6represents benzyl. The reaction then can be performed in an organic solvent, such as tetrahydrofuran, methylene chloride or dioxane at room temperature with palladium on coal as a catalyst. If R6represents a C1-6alkyl, a method usually carried out in two stages. In the first stage with carboxypropyl the compounds of formula II can be removed protective group me is Kim hydrolysis, for example, using an aqueous solution of NaOH or basic ion-exchange resin in an organic solvent, such as tetrahydrofuran, dioxane, methanol or ethanol, at room temperature. In the second stage with amino remove the protective group, for example by using attributively in methylene chloride. If

R7is benzyloxycarbonyl, can be used hydrogenolysis. The two-stage method is usually used when one or two of the radicals R3-R5represent halogen.

Optional salt formation can be carried out in the usual way.

The racemic mixture of the compounds of formula I can be separated in a known manner, for example using an optically active acid as a decomposing agent. Alternatively, pure enantiomeric form can be obtained by using optically active reagents.

The compounds of formula II used as starting reagents may be obtained, for example by reaction of compounds of formula III:

where R6and R7are as described above, with the compound of formula IV:

where R1and R2are as described above and X represents a leaving group.

The reaction may be carried out in the usual way. In the example, the reaction can be carried out in an organic solvent such as methylene chloride at a temperature of from -15° to 25°. Leaving group X is, for example halogen, especially chlorine or hydroxy.

There is a General agent for binding the acid, for example a tertiary amine, such as pyridine.

Despite the fact that obtaining initial reagents for the above methods not specifically described, they can be obtained analogously to methods known compounds or ways described here.

In the following examples, all temperatures are given in degrees Celsius on the centigrade scale and are set without regard to the amendment. Values [α]D20also given without amendment.

Example 1

3-(4-(2-Ethylphenyl)-2-carboxamidine)-D-alanine

a) 4-(2-Ethylphenyl)indole-2-carboxylic acid

To a mixture of 0.28 g of 4-bromoindole-2-carboxylic acid and 0,069 g tetranitroaniline in 11 ml of toluene and 2 ml of 2M soda solution was added 0,300 g 2-ethylvanillin acid in 3 ml of ethanol. This mixture was boiled under reflux for 16 h, was filtered and the aqueous phase was acidified using 2N HCl and was extracted with ethyl acetate. Concentration of the organic phase resulted in the receipt of the product as a brownish powder, tPL230-233°, pure enough for the next stage.

b) Methyl ester of 3-(4-(2-ethylphenyl)-2-backsliding)-N(2)-Z-D-alanine

To a solution 2,11 g of 4-(2-ethylphenyl)indole-2-carboxylic acid in 32 ml of pyridine was added 1,41 g carbonyldiimidazole. After cessation of gas was added to 2.29 g of methyl N(2)-Z-D-2,3-diaminopropionic and the mixture was stirred at room temperature for 4 days. After evaporation of the solvent the residue was extracted with a mixture of water/ethyl acetate, the organic phase was dried, concentrated and the crude product was chromatographically on silica gel using a mixture of isopropylacetate/toluene 4:1, obtaining the desired compound as a yellow amorphous powder.

C) 3-(4-(2-Ethylphenyl)-2-carboxamidine)-D-alanine

The mixture 2,03 g of methyl ester of 3-(4-(2-ethylphenyl)-2-carboxamidine)-N(2)-Z-D-alanine, 4,1 ml of 2N NaOH and 10 ml of dioxane was stirred at room temperature for 2 hours After treatment in the usual way, the resulting acid was dissolved in 22 ml of methylene chloride and treated of 1.03 ml attributively at 0°C. After stirring for 50 min, the mixture was concentrated to dryness and the residue is transferred into the water. The crude product was precipitated and was collected by filtration, washed with water and recrystallized from a mixture of water/isopropanol at bringing the pH to 6 by adding 0,2N NaOH, resulting in obtaining specified in the title compound as a white powder, tPL258-265°.

The compounds of formula I, where R1and R2are as shown is table 1, can be obtained by one of the above methods, but using the corresponding source reagents.

Table 1
Etc.R1R2tPL(C)
22-benzylphenolN220
3naphthalen-2-ylN226-233
4naphthalen-1-ylN210
52-ethylphenylCH3220
62-butoxyphenylN210-220
72-propylphenylN245
82-isopropylphenylN245-260
92,4-dichlorophenylN235

These compounds, which are selective agonists of the S1P4 receptor (hereinafter described as compounds according to the invention), for example the compounds of formula I, in free form or in the form of pharmaceutically acceptable salts, exhibit valuable pharmacological properties, for example modulating properties regarding recirculation of lymphocytes, for example as shown in tests in vitro and in vivo, and, therefore, suitable for therapy. In particular, the compounds according to the invention are useful as functional agonists of receptors human S1P4 (EDG6), as shown in the following tests.

The test for determining the in vitro pharmacology of the compounds against S1P4

a) an expression Vector encoding the receptors S1P person

The expression vector for gene human S1P4 (HSEDG4; GenBank inventory number AJ000479), coupled with peptide-labeled C-myc at the C-end, obtained as described in Van Brooklyn and others, Blood, 2000, 95 (8), s. The coding DNA for fused protein S1P4-myc were cloned in the expression vector pRc/CMV mammal (Invitrogen), which has a G418 resistance for selection of stable mammalian cells.

The DNA sequence of the inserts S1P4 was determined in both chains. No nucleotide differences that p is evovle to amino acid changes, compared with the GenBank data for HSEDG4 were found. S1P4-myc cDNA was built in the vector pRc/CMV using HindIII/XbaI.

Used the following vectors.

cDNA S1P1 (GenBank™, inventory number M) and S1P3 (GenBank™, inventory number H) person containing myc-sequence instead of the sequence S1P1 and S1P3 person, have been built into the vector pcDNA of 3.1. Vectors sequenced to completion validate the design. S1P2 human (GI: 4090955, TREMBL: 0195136) was cloned by PCR method. Received lung cDNA (marathon cDNA) (BD Biosciences Chontech, Palo Alto, CA 94303, USA). For the PCR reaction used the following oligonucleotides: forward primer CAC CAT GGG CAG CTT GTA CTC GGA GTA CCT GAA CCC CAA CAA GGT CCA G (from 1 to 45. GenBank™ inventory number AF034780) and reverse primer 5'-GAT TCA GAC CAC CGT GTT GCC CTC CAG (1062 to 1039, GenBank™ inventory number AF034780), the initiator of translation (ATG) and stop codon are underlined. PCR was carried out in the presence of 0.2-0.4 µg of cDNA, 1x reaction buffer (10x PfuTurbo DNA polymerase buffer, Stratagene, La Jolla, CA 92037, USA), 0.5 µm primers, 0.25 mm dNTP and 2.5 units of PfuTurbo DNA polymerase (Stratagene), the first stage at 95°C for 2 min, 30 cycles (30 s at 95°C, 30 s at 60°C and 90 s at 72°C) and the last phase of 10 min at 72°C. Amplificatory product with a circumference of about 1100 bp were analyzed by standard electrophoresis on agarose gel. After cloning the PCR product into pcDNA 3.1 V Toro (Invitrogen Corporation) sequenced the insert DNA is C different bacterial colonies. The final sequence was assembled from three independent plasmid compositions, which are sequenced in both directions.

S1P5 human (GI: 30171332 or GenBank™ inventory number AY262689, TREMBL: Q9H228) was cloned by PCR method. cDNA lung and spleen (marathon cDNA) was obtained from BD Biosciences Chlontech (BD Biosciences Chlontech, Palo Alto, CA 94303, USA); genomic DNA was isolated from HeLa cells by standard methods. For the PCR reaction used the following oligonucleotides: forward primer CAC CAT GGA GTC GGG GCT GCT GCG (-4 to 20, GenBank™ inventory number AY262689) and reverse primer 5'-TCA GTC TGC AGC CGG TTC TGA TAC CAG AGT (from 1197 to 1131, AY262689), the initiator of translation (ATG) and stop codon are underlined. PCR was carried out in the presence of 0.2-0.4 µg of cDNA, 1x reaction buffer (10x PfuTurbo DNA polymerase buffer, Stratagene, La Jolla, CA 92037, USA), 0.5 µm primers, 0.25 mm dNTP and 2.5 units of PfuTurbo DNA polymerase (Stratagene), the first stage at 95°C for 2 min, 30 cycles (30 s at 95°C, 30 s at 60°C and 90 s at 72°C) and the last phase of 10 min at 72°C. Amplificatory product with a circumference of about 1100 bp were analyzed by standard electrophoresis on agarose gel. After cloning the PCR product into pcDNA 3.1 V Toro (Invitrogen Corporation) sequenced the insert DNA from different bacterial colonies. The final sequence was assembled from three independent plasmid compositions, which are sequenced in both directions.

b) Development of a stable cell line With The About-K1, expressing S1P4

To develop stable cell lines expressing C-myc-tagged receptor S1P4, 5 μg of plasmid pRc/CMV-myc-S1P4 cut with the restriction endonuclease PvuI, which cleaves the plasmid at one place. Aligned plasmid was then besieged by using sodium acetate to a final concentration of 0.3 M, pH 5.0 and 66% ethanol. After centrifugation and washing the remnants of the DNA was dissolved in 30 μl of water. For transfection Cho-K1 (ATS number: CCL-61) cells were placed in medium MEM α (minimally adequate medium alpha modification) containing 10% FCS (calf serum) for one day before transfection with cellular density of 1×106cells on the cell 100-mm tablet for cell culture (Falcon) and incubated at 37°C in a 5% atmosphere of CO2within 24 hours. On the day of transfection to 270 μl of RPMI medium was added 5 μg aligned plasmid pRC/CMV-myc-S1P4. After adding 60 μl of the reagent for transfection with SuperFect (Qiagen) to the DNA solution and mixing for 10 s, the sample was incubated for 10 min before the formation of the complex. Complex DNA-SuperFect was mixed with an additional 3 ml of RPMI/10% FCS and then transferrable in the cell monolayer. After 3 hours incubation transfection the medium was removed and cells were washed in PBS. Added fresh RPMI medium with 10% FCS and cells were incubated for 72 hours at 37°C and 5% CO2. Selection of stable transformieren the x clones was carried out after addition of 500 μg/ml G418 (Lifetechnologies). After 12-14 days of cell clones obtained when sorting individual cells according to their primary side and the dispersion in individual wells of 96-well plates for cell culture using the device for sorting cells FACStar Plus (BectonDickinson). Individual clones that grew after the procedure, sorting and selection, increased and at the end of the selected one clone on the basis of the level of S1P4 mRNA expression, determined by quantitative analysis of PCR TaqMan.

b) Maintaining the cell culture

Parenteral cells Cho-K1 were maintained in RPMI medium (Lifetechnologies) with 10% FBS and 10 μg/ml gentamicin (Lifetechnologies). S1P4/myc transfected Cho-K1 cells, including the one selected at the end of the clone was stored in alpha-MEM medium with 10% FBS, 10 µg/ml gentamycin and 0.5 mg/ml G418 (Lifetechnologies).

g) determining the levels of transcription S1P4 in stable clones of Cho

Whole RNA from cells was isolated using minnebar RNeasy (Qiagen). After the destruction of cells grown in a monolayer) directly in culture plates (one 35 mm tablet used 350 ál buffer received in accordance with the Protocol of the Qiagen), the lysate pipette was applied on a rotating qiashredder column and centrifuged for 2 min at 21'000 g. Added 350 μl of 70% ethanol mixed flow cell, which is equipped with minicrane RNeasy, and centrifuged for 15 s at 10'000 dproto cell unloaded, added 700 μl of buffer RW1 (Qiagen) to the RNeasy column and centrifuged for 15 s for washing the column. The column was then washed twice by adding 500 ál of buffer RPE (Qiagen) and centrifuged for 15 s at 10,000 g. RNA was suirable add 30-50 ál of water, not containing RNase directly into the column with the RNA substrate and centrifuged for 1 min at 10'000 g.

RNA was back transcribable with a set Qiagen Omniscript (Qiagen). About 2 μg of RNA was mixed with 2 ál of 10 x buffer, 2 ál dNTP Mix, I ál of RNase inhibitor (10 units/ál), 0.5 μg random hexamer, 1 μl Omniscript reverse transcriptase and water, not containing RNase to a final volume of 20 μl, and incubated at 37°C for 60 min and an additional 30 min at 42°C. the Reaction iactiveaware for 5 min at 93°C, cooled in ice and kept at -20°C until use.

To determine the relative levels of transcription of S1P4 mRNA in the selected clones, used the analysis of real-time PCR (polymerase chain reaction). The optimal concentration of primers and samples was determined as described in User bulletin from RE (Perkin/Elmer) Biosystems using human S1P4 containing plasmid as a template. Oligonucleotides human S1P4, and their optimal concentration for the analysis of real-time PCR, were as follows (based on HSEDG4; inventory number GenBank AJ000479):

Primer/ProbeLevelSequenceOpt. conc
Direct primernoAACTGCCTGTGCGCCTTT50 nm
Reverse primernoGAGGATGTAGCGCTTGGAGTAGA900 nm
Sample5'-F, 3'TAMRAACCGCTGCTCCAGCCTTCTG100 nm

The first molecular chain cDNA is then used for quantitative PCR analysis on the device ABI7700 TaqMan (PE Biosystems). As an internal control for the amount of RNA present in each sample, used 18S ribosomal RNA reaction multiple transmission S1P4 PCR ribosomal RNA PCR in the same tube, using the control reagents TaqMan ribosomal RNA (PE Biosystems, P/N4308310, VIC-labeled probe). Although similar to the efficiency of the two independent amplification for S1P4 and ribosomal RNA is not formally defined, semi-quantitative determination of the levels of transcription S1P4 the different cell clones is sufficient, to select cell clones for further characterization and functional analysis.

d) Obtaining membranes

Membrane proteins were obtained from Cho-K1 wild-type and Cho cell clones expressing human S1P4. To obtain 10-30 mg of membrane proteins cells were grown in one big cultural tablet (500 cm2for cell clone up to 80 and 90% confluence. Culture medium was removed and cells were collected on ice from the tablet by means of scraping in 20 ml of cold 10 mm HEPES (pH 7.5) with 0.1% bovine serum albumin, containing no fatty acid (BSA), and a mixture of protease inhibitors (one tablet per 50 ml, Roche Diagnostics, Rotkreuz). The cells were centrifuged at 750 g for 10 min at 4°C and re-suspended in 10 ml cold membrane buffer (20 mm HEPES, pH of 7.4; 100 mm NaCl; 10 mm MgCl2; 1 mm EDTA; 0.1% of BSA and a mixture of protease inhibitors). The cell suspension is homogenized in ice using a homogenizer transmitter station at 25000 rpm with three intervals of 20 seconds each. Homogenizate was centrifuged at 26'900 g for 30 min at 4°C and the residue membrane protein re-suspended by shaking in 2 ml of cold membrane buffer. The concentration of protein was determined by analysis of the Bio Rad Protein and human IgG as a standard. The volume of the suspension membrane proteins brought up to a final concentration of 2 to 3 mg protein/ml Solution of the ATEM again homogenized (transmitter station) in ice at 25000 rpm for 20 s before the division into aliquots in Eppendorf tubes with a volume of 0.8-1 ml

e) Measuring the activity of cells expressing hS1P4:

E1) Analysis of binding with GTPγ35S

The choice of the tested clones in the analysis with GTPγS was based on the analysis of real-time PCR. Cho clones expressing a large number of human S1P4, used in these experiments. Membrane proteins were obtained as described above. Used by the core Protocol analysis on linking with GTPγ35S described in a recent publication (article Brinkmann and others, J.Biol. Chem, 2002, 277, 21453) with modifications described below. To characterize the binding of GTPγ35S with membrane proteins from cells SNO expressing S1P, used covered WGA granules PVT (SPA-granule, Amersham Biosciences). Due to the fact that β-rays GTPγ35S have significant penetration in aqueous solution, the plates were centrifuged to minimize nonspecific effects caused by unrelated GTPγ35S. Analysis was carried out in 96-well tablets Optiplates (Packard, No. 6005190) in a final volume of 225 μl/well. After a short homogenization, membrane proteins suspended in various concentrations (25 to 150 μg/ml) in 50 mm HEPES, 100 mm NaCl, 10 mm MgCl2, 20 μg/ml saponin (Riedel-de-Haen: N° 16109), 0,1% BSA, containing no fats (Sigma, N° A0281) pH of 7.4. Membrane proteins were mixed with 1 mg/well SPA granules, 10 μm GDP, various concentrations of agonists and incubated for 10-15 min at RT. The reaction of binding the Oia with GTPγ 35S were initiated by addition of 200 PM GTPγ35S (Amersham, N° SJ1308, >1000Ci/mmol). Tablets Optiplates were closed and incubated at RT for 110-120 minutes with constant shaking. The tablets are then centrifuged for 10 minutes at 2000 rpm and were processed using equipment TopCount (Packard). The calculated values of the EU50carried out using nonlinear regression analysis, available in the software Origin 7 RS2 (Origin Lab Corporation, One Roundhouse Plaza, Northampton, MA 01060, USA).

e2) analysis of the mobilization of calcium

Cells SNO were placed in black tablets Costar (96 or 384-well, 50'000 cells or 12,500 cells, respectively) in α-MEM with FCS and konturirovany for 20-24 h at 37°C in incubator CO2. After removal of the culture medium of cells incubated in medium HBSS containing 2 μm Fluo4AM (Molecular Probes, No F-1241; 1 mg/ml substrate in DMSO), 5 mm probenecid for 1 h at 37°C, washed with HBSS buffer, 2.5 mm of probenecid and covered the same environment (75 μl in 96-well plates, 50 μl for 384-well). The tablets carried in the FLIPR. After measuring the baseline within 40 with added agonist in HBSS and measured fluorescence at intervals of 2 to over 3 to 5 minutes In some cases, the cells were pre-treated for 5 h with 50 ng/ml pertussis toxin (Sigma, No. R). 2-Aminoethoxyethanol (2-ARV, Calbiochem, Juro Supply, Bleicherstr. 11, Lucerne, Switzerland, No. 100065), block the PR of calcium release from endoplasmic reticulum (article Ascher-Landsberg and others, Biochem. Biophys. Res. Commun., 1999, 264, 979) at a concentration of 50 μm and/or 150 μm was added directly to the cell medium for 20-40 min before measurement. The calculated values of the EU50carried out using nonlinear regression analysis, available in the software Origin 7 RS2 (Origin LabCorporation) from Novartis.

Determination of in vitro specificity and selectivity of agonists S1P4.

Compounds specified herein, were tested for specificity, for example on the activity they have in the parent cell lines, to conversion to cDNA S1P4, and the selectivity in respect of the cell lines Cho, transformed S1P1, S1P2, S1P3 and S1P5. Production of stable cell lines for the other S1P receptors was carried out as described for S1P4, using published sequence of the human cDNA as described above. Preferably selected compounds with a hundred-fold selectivity and specificity. For example, S1P4 specific and selective compounds can have values EC50(obvious EU50), measured with S1P4 that 10 times, preferably 100 times lower than the values measured with cells Cho wild-type or with cells expressing any of the other four receptors S1P. For example, if the value of EC50200 nm measured for S1P4, values EU50in cells SNO or in cells SNO expressing S1P 1, 2, 3, 5, etc is doctitle is ≥20 microns. The compound of example 1 has a value of EC50for S1P4 in this analysis 432 nm.

Values EU50(in μm) for compounds of example 2 in cells SNO or in cells SNO expressing different receptors, S1P, are shown in table 2 below.

Table 2
SNOS1P1S1P2S1P3S1P4S1P5
Analysis of the mobilization of calcium>6>6>6>60,012,4
Analysis of the binding of GTPγS>10>10>10>100,25>10

Compounds according to the invention are therefore useful for the treatment and/or prevention of diseases or disorders mediated by interactions between lymphocytes; for example, in transplantation, such as acute or chronic rejection of ALLO - or xenografts cells, t is Anya or bodies, or delayed graft function, the reaction of the host against the graft, autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematosus, Hashimoto's thyroiditis, multiple sclerosis, bulbospinal palsy, diabetes type I or type II and related diseases, vasculitis, pernicious anemia syndrome Segren, uoit, psoriasis, ophthalmopathy of Graves, circular areata and others, allergic diseases, e.g. allergic asthma, atopic dermatitis, allergic rhinitis/conjunctivitis, allergic contact dermatitis, inflammatory diseases optionally with underlying aberrant reactions, e.g. inflammatory bowel disease, Crohn's disease or ulcerative colitis, infectious-allergic asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, irritant contact dermatitis, and other eczematous dermatitises, seborrhoeic dermatitis, cutaneous manifestations of immunologically-mediated disorders, inflammatory eye disease, keratoconjunctivitis, myocarditis or hepatitis, injury during ischemia/reperfusion, such as a heart attack myocardi, stroke, intestinal ischemia, renal failure or hemorrhagic shock, traumatic shock, other cancer, for example T-cell lymphoma or T-cleto is Naya leukemia, infectious diseases, e.g. toxic shock (e.g. caused by superantigens), septic shock, respiratory distressful syndrome in adults or viral infections, e.g. AIDS, viral hepatitis or chronic bacterial infection. Examples of transplants of the cells, tissues or whole organs include, for example, pancreatic islets, stem cells, bone marrow, tissue, cornea, skin, neural tissue, heart, lung, combined heart-lung, kidney, liver, intestine, pancreas, trachea or the esophagus.

For the above applications, the required dosage will of course depend on the method of administration, the specific treatable condition and the desired effect. Generally, satisfactory results are obtained with the systematic introduction of a daily dosage of from about 0.03 to 2.5 mg/kg of body weight. Shows daily dosage for the larger mammal, e.g. humans, is in the range from about 0.5 mg to about 100 mg, usually introduced, for example, single doses up to four times per day, or in the form of slow release. Suitable unit dosage forms for oral administration comprise from about 1 to 50 mg of active ingredient.

Compounds according to the invention can be administered by any conventional method, in particular enterline, for example, orally, such as the form of tablets or capsules, or parenterally, for example in the form of injection solutions or suspensions, topically, e.g. in the form of lotions, gels, ointments or creams, or in the form of a nasal or suppozitornoj introduction. Pharmaceutical compositions comprising the compound according to the invention in free form or in the form of pharmaceutically acceptable salts together with at least one pharmaceutically acceptable carrier or diluent can be obtained in the usual way of mixing with a pharmaceutically acceptable carrier or diluent.

Compounds according to the invention can be administered in free form or in the form of a pharmaceutically acceptable salt, for example, as shown above. Such salts can be obtained in the usual way and show the same activity as the available connections.

In accordance with the foregoing the present invention also applies to:

1,1) method of prevention or treatment of disorders or diseases mediated by lymphocytes, such as that described above, the subject in need of such treatment, which includes the introduction of a specified subject an effective amount of the compounds according to the invention, for example, the compounds of formula I or its pharmaceutically acceptable salt;

1,2) the method of preventing or treating acute or chronic transplant rejection or mediated by T-cells vocal is positive or autoimmune diseases for example above, the subject in need of such treatment, which includes the introduction of a specified subject an effective amount of the compounds according to the invention, for example the compounds of formula I, or its pharmaceutically acceptable salt;

2) the compound according to the invention, for example compound of formula I, in free form or in the form of a pharmaceutically acceptable salt, for use as a drug, for example, any of the methods described above in 1.1 or 1.2;

3) the pharmaceutical composition, e.g. for use in any of the ways of 1.1 or 1.2, including a connection according to the invention, for example compound of formula I, in free form or in the form of a pharmaceutically acceptable salt together with a pharmaceutically acceptable diluent or carrier.

Compounds according to the invention, for example compound of formula I may be administered as the sole active ingredient or in combination, for example as an adjuvant with other drugs such as immunosuppressive or immunomodulating agents or other anti-inflammatory agents, e.g. for the treatment or prevention of acute or chronic rejection of ALLO - or xenograft or inflammatory or autoimmune diseases, or chemotherapeutic agents, such as antiproliferative the agent of malignant cells. For example, the compounds according to the invention can be used in combination with a calcineurin inhibitor, e.g. cyclosporin a or FK 506; a mTOR inhibitor, e.g. rapamycin, 40-O-(2-hydroxyethyl)-rapamycin, CCI779 or AVT; ascomycin having immunosuppressive properties, e.g. ABT-281, ASM981, etc.; corticosteroids; cyclophosphamide; azathioprene; methotrexate; Leflunomide; mizoribine; mycophenolic acid; mycophenolate mofetil; 15-desoxypeganine or immunosuppressive homologues, analogues or derivatives; immunosuppressive monoclonal antibodies, e.g., monoclonal antibodies to receptors of leukocytes, for example, MHC, CD2, CD3, CD4, CD7, CD8, CD25, CD28, CD40, CD45, CD58, CD80, CD86 or their ligands; other immunomodulatory compounds, e.g. a recombinant binding molecule having at least a portion of the extracellular domain of CTLA4 or a mutant, for example at least extracellular portion of CTLA4 or a mutant associated with a non-CTLA4 protein sequence, e.g. CTLA4Ig (for example, known as ATSC 68629) or a mutant, e.g. LEA29Y; inhibitors of adhesion molecules, such as antagonists of LFA-1 antagonists, ICAM-1 or -3, antagonists, VCAM-4 antagonists of VLA-4; or chemotherapeutic agents, such as paclitaxel, gemcitabine, cisplatin, doxorubicin or florouracil.

In cases where the compounds according to the invention, for example compound of formula I is administered in combination with another immunosuppressant and/or immunomodulator, anti-inflammatory or chemotherapeutic agent, dosage jointly entered immunosuppressant, immunomodulator, anti-inflammatory or chemotherapeutic compounds will of course depend on the type of jointly used drugs, for example, whether it is a steroid or a calcineurin inhibitor, on the specificity of the applied drugs on the state of the disease, and so forth. In accordance with the foregoing, the present invention relates to another variant implementation:

4) the method as described above comprising co-administration, e.g., together or sequentially, a therapeutically effective non-toxic amount of the compound according to the invention, for example the compounds of formula I, and at least a second drug substance, e.g. immunosuppressant, immunomodulator, anti-inflammatory or chemotherapeutic drug, e.g. as described above;

5) pharmaceutical combination, for example, the set including a) a first agent which is a compound according to the invention, for example compound of formula I, as described herein, in free form or in the Orme pharmaceutically acceptable salt, and b) at least one joint agent, such as immunosuppressant, immunomodulator, anti-inflammatory or chemotherapeutic drug. The kit may include instructions for its use.

Used herein, the terms "co-administration" or "combined introduction" and the like mean the introduction of selected therapeutic agents to the individual patient, and include treatment regimens in which the agents are introduced optional one way of introduction or at the same time.

The term "pharmaceutical combination", as used here, refers to the product, which leads to the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients. The term "fixed combination" means that the active ingredients, e.g. a compound according to the invention and the concomitant agent, both introduced to a patient simultaneously in the form of a single integer or in one dose. The term "non-fixed combination" means that the active ingredients, e.g. a compound according to the invention and the concomitant agent, both introduced to a patient as separate units together, simultaneously or sequentially in unbounded time intervals, where this introduction relates to therapeutically effective levels of the two joint is in the body of the patient. The latter also applies to multiple therapy, for example for the introduction of 3 or more active ingredients.

1. The compound of the formula I

where R1represents phenyl or naphthyl, where phenyl is substituted by one or two halogen atoms, With1-6alkilani, C1-6alkoxy or panels1-6alkilani; and
R2represents hydrogen or C1-6alkyl;
in free form, in the form of a hydrate or in the form of pharmaceutically acceptable salts.

2. The compound according to claim 1, which is selected from
3-(4-(2-ethylphenyl)-2-carboxamidine)alanine,
3-(4-(2-benzoylphenyl)-2-carboxamidine)alanine,
3-(4-(naphthalen-2-yl)-2-carboxamidine)alanine,
3-(4-(naphthalen-1-yl)-2-carboxamidine)alanine,
3-(4-(2-butoxyphenyl)-2-carboxamidine)alanine,
3-(4-(2-propylphenyl)-2-carboxamidine)alanine,
3-(4-(2-isopropylphenyl)-2-carboxamidine)alanine and
3-(4-(2,4-dichlorophenyl)-2-carboxamidine)alanine,
or its pharmaceutically acceptable salt.

3. The compound according to claim 2, which is 3-(4-(2-ethylphenyl)-2-carboxamidine)-D-alanine, in free form or in the form of pharmaceutically acceptable salts.

4. The compound according to any one of claims 1 to 3 in free form or in the form of pharmaceutically acceptable salts exhibiting selective agonistic activity towards the S1P4 receptor.

Harmaceuticals composition, showing selective agonistic activity towards the S1P4 receptor, comprising a compound as defined in any one of claims 1 to 3 in free form or in the form of a pharmaceutically acceptable salt together with a pharmaceutically acceptable diluent or carrier.

6. The use of compounds according to any one of claims 1 to 3 in free form or in the form of pharmaceutically acceptable salts, or pharmaceutical composition according to claim 5 for the manufacture of a medicine for treatment or prevention of diseases or disorders mediated by lymphocytes, acute or chronic transplant rejection mediated T-cell inflammatory or autoimmune diseases, diabetes, allergic diseases, myocarditis, hepatitis, injury, ischemia/reperfusion, renal failure, hemorrhagic shock, traumatic shock, cancer or infectious diseases, and the compound or its pharmaceutically acceptable salt is used in amounts effective for the manifestation of selective agonistic activity towards S1P4 receptor.

7. A method of obtaining a compound according to claim 1, which comprises removing the protective group from compounds of formula II

where R1and R2are as defined in claim 1;
R6represents a C1-6alkyl or benzyl;
R7pre is is a protective group for amino group,
and optional conversion of the compounds of formula I in free form in the form of a pharmaceutically acceptable salt or Vice versa.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: invention relates to new a compound of formula I or formula II, or to its pharmaceutically acceptable salts, I II, where X is S; R1 is H or C1-C6alkyl; R2 is NR5R6; R3 is aryl, substituted with a halogen; R4 is H; R5 is H; R6 is H; R7 is CH2NR8R9 where R8 is H, C1-C10alkyl, C3-C8cycloalkyl, aryl, aryl(C1-C6alkyl), aryl(C2-C6alkenyl), heterocycle(C1-C6alkyl), heterocycle(C2-C6alkenyl), hydroxyl(C1-C6alkyl), hydroxyl(C2-C6alkyl), C1-C6alkoxycarbonyl, aryl(C1-C6alkoxy)carbonyl, carbamoyl(C1-C6alkyl); where the above mentioned aryl is an aromatic ring and is not substituted or substituted with one to three substituting groups, each of which, independently from the others, is chosen from: methylenedioxy, hydroxy, C1-C6-alkoxy, halogen, C1-C6alkyl, trifluoromethyl, trifluoromethoxy, NO2, NH2, NH(C1-C6alkyl), N(C1-C6alkyl)2, NH-acyl, N(C1-C6alkyl)-acyl, hydroxy(C1-C6alkyl), dihydroxy(C1-C6alkyl), CN, C(=O)O(C1-C6alkyl), phenyl, phenyl(C1-C6alkyl), phenyl(C1-C6alkenyl), phenoxy and phenyl(C1-C6alkoxy), R9 is H, C1-C10alkyl, heterocycle(C1-C6alkyl) or heterocycle(C2-C6alkenyl); where the above mentioned heterocycle represents a 5-member saturated monocyclic ring system, consisting of carbon atoms, as well as heteroatoms, chosen from a group comprising N, O, and S, which can be unsubstituted or have one to three substituting groups, independently chosen from a list which includes NO2, aryl(C1-C6alkyl), arylsulphonyl; or R8 and R9 together with nitrogen, to which they are bonded, form a heterocycle, which represents a 5 - 7-member saturated monocyclic ring system, consisting of carbon atoms, as well as one to three heteroatoms, chosen from a group comprising N, O and S, which can be unsubstituted or have one to three substituting groups, independently chosen from a list which includes C1-C6alkoxy, hydroxy, C1-C6alkyl, C2-C6-alkenyl, C(=O)O(C1-C6alkyl), C(=O)NH2, C(=O)NH(C1-C6alkyl), C(=O)N(C1-C6-alkyl)2, hydroxy(C1-C6alkyl), dihydroxy(C2-C6alkyl), aryl, aryl(C1-C6alkyl), aryl(C2-C6alkenyl), aryl(C1-C6alkoxy) and pyrimidin-2-yl; and m equals 0. The invention also relates to a pharmaceutical composition, as well as to use of formula I or formula II compounds.

EFFECT: obtaining new biologically active compounds, with inhibitory properties towards casein kinase 1ε.

32 cl, 3 tbl

FIELD: chemistry.

SUBSTANCE: invention refers to the selective method for preparation of "АХЭ" inhibitor - perindopril with usage as initial reagent of the sterospecific amino acid N-/1-(S)-ethoxycarbonylbutyl/-(S)-alanine which is activated by tetramethyl-uronium salts in the presence of tertiary organic base and following interreaction with (2S,3aS,7aS)-octahydroindolo-2-carbonic acid or its ester. After completing of the reaction the protective group is removed by the hydrogenation, interphase hydrogenation or extraction.

EFFECT: obtaining of perindopril with usage of tetramethyl-uronium salts as reagents of coupling reaction.

5 cl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to novel malononitryl derivatives of formula (I), which can be applied to fight pest insects. In formula (I) R1 represents hydrogen atom; R2 represents hydrogen atom; R represents hydrogen atom; R4 represents C1-C5-alkyl group substituted with at least one halogen atom, C2-C5-alkenyl group; R5 represents hydrogen atom, halogen atom, C1-C5-alkyl group; at least one of X1, X2 and X3 values represents CR6, the other represent nitrogen atoms; R represents hydrogen atom, halogen atom, cyanogroup, nitrogroup, formyl group, C1-C5-alkyl group optionally substituted with at least one halogen atom, C1-C5-alkyltiogroup, substituted with at least one halogen atom, C2-C6-alkylcarbonyl group substituted with at east one halogen atom, C2-C5-alkoxycarbonyl group or group (CH2)mQ, where m = 0, and Q stands for phenyl; and in case when one of R5 and R6 is bonded with two atoms in adjacent positions or two R6 are bonded with two atoms in adjacent positions, they can be bonded to each other in end positions with formation of C2-C6-alkandiyl group, or C4-C6-alkenediyl group. Invention also relates to composition and method used to fight pest-insects.

EFFECT: obtaining novel malononitryl derivatives of formula (I), which can be applied to fight pest-insects.

11 cl, 90 ex

FIELD: chemistry.

SUBSTANCE: invention relates to new compounds with general formula (I) , where R1 and R2 are independently chosen from hydrogen, halogen, nitro, alkyl, alkylaryl and XYR5; X and Y are independently chosen from O and (CR6R7)n; R3 represents hydrogen, alkyl or M; M represents an ion, chosen from aluminium, calcium, lithium, magnesium, potassium, sodium, zinc or their mixture; Z represents CR4; R4 is chosen from hydrogen, halogen, alkyl, alkylaryl and XYR5; R5 is chosen from aryl, substituted aryl, heteroaryl and substituted heteroaryl; R6 and R7 are independently chosen from hydrogen and alkyl; n is an integer from 1 to 6; at least one of R1 and R2 represents XYR5, and at least one of X and Y represents (CR6R7)n. The invention also pertains to the method of increasing concentration of D-serine and/or reducing concentration of toxic products of D-serine oxidation under the effect of DAAO in mammals, involving introduction into a subject of a therapeutically effective amount of a formula I compound, to the method of treating schizophrenia, treating or preventing loss of memory and/or cognitive ability, to the method of improving learning ability, method of treating neuropathic pain, as well as to a pharmaceutical composition, with DAAO inhibitory activity, based on these compounds.

EFFECT: obtained are new compounds and a pharmaceutical composition based on these compounds.

27 cl, 4 tbl, 72 ex

FIELD: chemistry, pharmacology.

SUBSTANCE: present invention relates to compounds with formula I, active towards receptors, activated by peroxisome proliferators (PPAR), and can be used in medicine, formula I, where U, W, X and Y represent CH, V represents CR8; R1 represents-C(O)OR or a carboxylic acid isoster, where R is a hydrogen atom, substituted alkyl, aryl or heteroaryl; R2 represents -S(O)2R21; R6 and R7 represent a hydrogen atom, substituted alkyl or cycloalkyl; R8 represents a hydrogen atom, halogen, -OR9, substituted inferior alkyl, cycloalkyl, heterocycloalkyl, phenyl, benzyl, heteroaryl or heteroaralkyl; R9 represents a substituted alkyl or cycloalkyl; R21 represents a substituted heteroaryl or phenyl; n equals 1.

EFFECT: obtaining new biologically active compounds and pharmaceutically active compositions based on these compounds.

46 cl, 134 ex, 4 tbl

FIELD: chemistry, pharmacology.

SUBSTANCE: present invention relates to new use of compounds of 2-arylacetic acid and amides with formula (I) and their pharmaceutically used salts, where A comprises an atom X and is phenyl or a 5-6 member heteroaromatic ring, optionally containing a heteroatom, chosen from N; corresponding positions on ring A are marked by numbers 1 and 2; atom X is chosen from N (nitrogen) and C (carbon); R represents a substituting group on ring A, chosen from: a group in 3 (meta) positions, chosen from a group comprising straight or branched C1-C5-alkyl, C2-C5-acyl; a group in 4 (para) positions, chosen from a group, comprising C1-C5-alkyl, C1-C5-alkanesulphonylamino, substituted with halogens; Hy represents a small hydrophobic group with steric inhibition constant ν between 0.5 and 0.9 (where ν is Charton steric constant for substitutes), comprising methyl, ethyl, chlorine, bromine, group Y chosen from O (oxygen) and NH; when Y represents O (oxygen), R' represents H (hydrogen); when Y represents NH, R' is chosen from groups: -H, - residue with formula SO2Rd, where Rd represents C1-C6-alkyl. The invention can be used in making medicinal agents, which are inhibitors of induced IL-8 PMN chemotaxis (CXCR1) or induced GRO-α PMN chemotaxis (CXCR2).

EFFECT: new use of compounds of 2-arylacetic acid and amides and their pharmaceutically used salts.

14 cl, 2 tbl, 44 ex, 4 dwg

FIELD: chemistry.

SUBSTANCE: present invention pertains to new compounds with general formula (I), in which X1 is phenyl, 9-member bicyclic heteroaryl, containing S or O as heteroatoms, or 5-member heteroaryl, containing S or O as heteroatoms, each of which is optionally substituted with one or more substitutes, chosen from halogen or C1-6alkyl, which is optionally substituted with one or more halogens. X2 is phenyl, which is optionally substituted with one or more substitutes, chosen from halogen, or 5-member heteroaryl, containing S or O as heteroatoms. Ar is phenylene, which is optionally substituted with one or more substitutes, chosen from halogen, or C1-6alkyl, phenyl, C1-6alkoxy, each of which is optionally substituted with one or more halogens. Y1 is O or S, and Y2 represents O, Z represents -(CH2)n-, where n equals 1, 2 or 3. R1 is hydrogen or C1-6alkoxy and R2 is hydrogen, C1-6alkyl. The invention also relates to pharmaceutical salts of these compounds or any of their tautomeric forms, stereoisomers, stereoisomer mixtures, including racemic mixtures.

EFFECT: invention also pertains to use of these compounds as pharmaceutical compositions, with effect on receptors, activated by the peroxisome proliferator PPARδ subtype, and to pharmaceutical compositions, containing these compounds (I).

36 cl, 41 ex

FIELD: medicine; pharmacology.

SUBSTANCE: invention claims ethers of substituted 1H-indol-3-carboxylic acid of the general formula 1 or their pharmaceutically acceptable salts. Compounds can be applied as active substance for pharmaceutical compositions and for application of these compositions in production of medicine for virus disease prevention and treatment, especially for diseases caused by infection hepatitis viruses (HCV, HBV) and influenza A viruses. In the general formula 1 R1 is aminogroup substitute selected out of hydrogen, optionally substituted inferior alkyl, optionally substituted C3-6cycloalkyl, optionally substituted aryl selected out of phenyl, naphthyl or 5-6 member heteroaryl containing 1-2 heteroatoms selected out of nitrogen, oxygen and sulfur, and possibly condensed with benzene ring of optionally substituted heterocyclyl, which can be optionally substituted 5-6-member heterocyclyl with 1-2 heteroatoms in heterocyclic ring selected out of nitrogen and oxygen; R2 is alkyl substitute selected out of hydrogen, optionally substituted hydroxyl group, optionally substituted mercapto group, optionally substituted arylsulfinyl group; optionally substituted amino group, optionally substituted 5-6-member heterocyclyl containing 1-2 heteroatoms selected out of nitrogen, oxygen and sulfur; R3 is hydrogen or optionally substituted inferior alkyl; R14 and R24 are independently substitutes of cyclic system, selected out of hydrogen or halogen atom, cyano group, trifluoromethyl, optionally substituted phenyl or optionally substituted heterocyclyl which is an optionally substituted 5-6-member heterocyclyl with 1-2 heteroatoms in heterocyclic ring, selected out of nitrogen, oxygen or sulfur, possibly condensed with benzene ring.

EFFECT: improved efficiency of compositions.

15 cl, 3 tbl, 1 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: present invention concerns application of new biologically active substances of the general formula of 1 either their racemates, or their optical isomers, or their pharmaceutically comprehensible salts and-or hydrates, and also to a pharmaceutical composition and its use at manufacturing of the medicinal preparations applied to treatment and-or preventive maintenance of diseases, caused by flu viruses. In compounds of the general formula 1, R1 are represented by the substituent to the amino group chosen from unessentially replaced C1-C6alkyl, unessentially replaced aryl or unessentially replaced 5-6 term azaheterocycl, R14 and R24 independently from each other represent the substituent to an amino group chosen from hydrogen, unessentially replaced C1-C6alkyl, unessentially replaced C3-C8cycloalkyl, or R14 and R24, together with atom of nitrogen to which they are bound, form through R14 and R24 unessentially replaced 5-6-term azaheterocycl with 1-3 heteroatoms in a ring and which can be monocyclic or condensed with a benzene ring, or aminoethanamidine; R2 is a substituent chosen from hydrogen, of unessentially replaced mercapto group, unessentially replaced amino group, unessentially replaced hydroxyl represents alkyn; R3 represents the lowest alkyl; R5 the substituent to the cyclic system chosen from hydrogen, atom of halogen, cyano group, unessentially replaced aryl or unessentially replaced 5-6-term heterocycl represents, the containing 1-2 heteroatoms chosen from nitrogen, oxygen or sulphur and which can be monocyclic or condensed with a benzene ring.

EFFECT: invention provides increase of efficiency of a composition and a method of treatment.

11 cl, 1 dwg, 2 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to novel crystalline form of N-(3-cyano-4-methyl-1H-indole-7-yl)-3-cyanobenzolsulfonamide, which has diffraction peak at diffraction angle (2θ±0.2°) 11.4° and 19.1° at powder roentgenography, crystalline form of hydrate of N-(3-cyano-4-methyl-1H-indole-7-yl)-3-cyanobenzolsulfonamide, which has diffraction peak at diffraction angle (2θ±0.2°)8.5° and 25.8° at powder roentgenography, which have excellent light resistance. Methods of their obtaining are described.

EFFECT: obtaining novel crystalline form.

22 cl, 15 tbl, 9 dwg, 9 ex

FIELD: chemistry.

SUBSTANCE: invention relates to new indolylmaleimide derivatives with formula I , where: Ra is H; C1-C4alkyl; one of Rb, Rc, Rd and Re is C1-C4alkyl, and the others are H; or Rb, Re, Rd and Re are all H; and R is a radical with formula (a), (b) and (c), presented in the claim.

EFFECT: compounds inhibit protein kinase C (PKC), which allows for their use in making a medicinal agent for treating or preventing diseases or disorders mediated by T lymphocytes and/or PKC, particularly during transplantation.

8 cl, 11 tbl, 47 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely to experimental ophthalmology, and can be applied for suppression of positive regulation of short form of c-Maf transcription factor in processed with steroids or transforming growth factor β2 (TGF β2) cells of trabecular net. For this purpose introduced is antagonist c-Maf, also possessing inhibiting activity with respect to cyclin-dependent kinase cdk2, for instance purvalanol A.

EFFECT: invention explains mechanism and possible new approach to treatment of primary open-angle and steroid glaucoma.

4 cl, 1 tbl, 7 ex, 3 dwg

FIELD: chemistry.

SUBSTANCE: invention relates to new a compound of formula I or formula II, or to its pharmaceutically acceptable salts, I II, where X is S; R1 is H or C1-C6alkyl; R2 is NR5R6; R3 is aryl, substituted with a halogen; R4 is H; R5 is H; R6 is H; R7 is CH2NR8R9 where R8 is H, C1-C10alkyl, C3-C8cycloalkyl, aryl, aryl(C1-C6alkyl), aryl(C2-C6alkenyl), heterocycle(C1-C6alkyl), heterocycle(C2-C6alkenyl), hydroxyl(C1-C6alkyl), hydroxyl(C2-C6alkyl), C1-C6alkoxycarbonyl, aryl(C1-C6alkoxy)carbonyl, carbamoyl(C1-C6alkyl); where the above mentioned aryl is an aromatic ring and is not substituted or substituted with one to three substituting groups, each of which, independently from the others, is chosen from: methylenedioxy, hydroxy, C1-C6-alkoxy, halogen, C1-C6alkyl, trifluoromethyl, trifluoromethoxy, NO2, NH2, NH(C1-C6alkyl), N(C1-C6alkyl)2, NH-acyl, N(C1-C6alkyl)-acyl, hydroxy(C1-C6alkyl), dihydroxy(C1-C6alkyl), CN, C(=O)O(C1-C6alkyl), phenyl, phenyl(C1-C6alkyl), phenyl(C1-C6alkenyl), phenoxy and phenyl(C1-C6alkoxy), R9 is H, C1-C10alkyl, heterocycle(C1-C6alkyl) or heterocycle(C2-C6alkenyl); where the above mentioned heterocycle represents a 5-member saturated monocyclic ring system, consisting of carbon atoms, as well as heteroatoms, chosen from a group comprising N, O, and S, which can be unsubstituted or have one to three substituting groups, independently chosen from a list which includes NO2, aryl(C1-C6alkyl), arylsulphonyl; or R8 and R9 together with nitrogen, to which they are bonded, form a heterocycle, which represents a 5 - 7-member saturated monocyclic ring system, consisting of carbon atoms, as well as one to three heteroatoms, chosen from a group comprising N, O and S, which can be unsubstituted or have one to three substituting groups, independently chosen from a list which includes C1-C6alkoxy, hydroxy, C1-C6alkyl, C2-C6-alkenyl, C(=O)O(C1-C6alkyl), C(=O)NH2, C(=O)NH(C1-C6alkyl), C(=O)N(C1-C6-alkyl)2, hydroxy(C1-C6alkyl), dihydroxy(C2-C6alkyl), aryl, aryl(C1-C6alkyl), aryl(C2-C6alkenyl), aryl(C1-C6alkoxy) and pyrimidin-2-yl; and m equals 0. The invention also relates to a pharmaceutical composition, as well as to use of formula I or formula II compounds.

EFFECT: obtaining new biologically active compounds, with inhibitory properties towards casein kinase 1ε.

32 cl, 3 tbl

FIELD: chemistry.

SUBSTANCE: invention relates to formula (I) compounds and to their use in treating diseases related to lipid storage disorders, such as atherosclerosis and diabetes. In R1 represents hydrogen, alkyl, halogen, formyl, hydroxyalkyl or trifluoromethyl, R2 represents hydrogen, alkyl or halogen, R3 represents hydrogen or alkyl, R4 represents hydrogen, alkyl, hydroxy or alkoxy, R5 and R6 are chosen from hydrogen, alkyl, phenylalkyl, hydroxyalkyl, alkoxycarbonyl and phenyl, A represents aryl or heterocyclyl, m equals 0-3, n equals 0-1, p equals 0-3, sum of m, n and p equals 1-4, the bond between carbon atoms Ca and Cb is a single or double carbon-carbon bond.

EFFECT: obtaining new biologically active compounds.

27 cl, 147 ex

FIELD: medicine.

SUBSTANCE: invention covers new compounds of formula (I) where: one of groups R6, R7 and R8 meets formula (II) and groups X, Y1-Y4, R1-R14 and n possess the values specified in the patent claim, and also their pharmaceutically acceptable salts. Compounds I show activating effect with respect to PPARδ and/or PPARαreceptors.

EFFECT: applicability of compounds for treatment and prevention of the diseases modulated by PPARδ and PPARα agonists.

22 cl, 8 dwg, 1 tbl, 21 ex

FIELD: chemistry.

SUBSTANCE: invention relates to novel statin derivatives of formula: or its pharmaceutically acceptable salt or stereoisomer, where: X represents -O-, R represents statin residue of formula:

, Y represents a) straight or branched C1-C20alkylene, mainly C1-C10, optionally substituted with one or more OH;

b)

,

where n equals from 0 to 20, and n1 from 1 to 20; on condition that when Y represents b), group -ONO2 is bonded with -(CH2)n1;

g)

,

where X2 represents -O, n3 from 1 to 6, mainly from 1 to 4, R2 represents H or CH3.

EFFECT: obtaining compounds which possess anti-inflammatory, antithrombotic and antithrombocytic activity, which allows to use them for production of medication for reduction of cholesterol and triglycerides levels and/or for increasing HDL-C level.

14 cl, 6 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: invention concerns a tablet containing fluvastatin with sodium carboxymethylcellulose of calcium in the form of raising agent. The fluvastatin tablet is characterised by time of disintegration from 10 to 30 minutes and good bioavailability equivalent to bioavailability of serially produced capsules, containing fluvastatin. Manufacturing of tablets does peroral application of fluvastatin economically more favourable and more convenient for patients.

EFFECT: rising of profitability and convenience of peroral fluvastatin application to patients.

12 cl, 7 dwg, 6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates medicine and pharmaceutics area and concerns a pharmaceutical composition possessing antidiabetic, hypolipidemic, hypoglycemic and cholesterol lowering action, containing a chemical combination of the general formula (1) in quality of an active substance, a way of its reception and also ways of treatment and prevention of diabetes, hypolipidemy, hypoglycemia and hypocholesteremia. The composition possesses hypotoxicity and good acceptability.

EFFECT: development of a composition which possesses hypotoxicity and good acceptability.

13 cl, 9 dwg, 6 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention relates medicine and pharmaceutics area and concerns a pharmaceutical composition possessing antidiabetic, hypolipidemic, hypoglycemic and cholesterol lowering action, containing a chemical combination of the general formula (1) in quality of an active substance, a way of its reception and also ways of treatment and prevention of diabetes, hypolipidemy, hypoglycemia and hypocholesteremia. The composition possesses hypotoxicity and good acceptability.

EFFECT: development of a composition which possesses hypotoxicity and good acceptability.

13 cl, 9 dwg, 6 tbl, 6 ex

FIELD: chemistry, medicine.

SUBSTANCE: invention refers to the triheterocylic compounds of formula (Ia) and their pharmaceutically acceptable salts used as growth inhibitors of the cancer or tumor cells, to the preparation method and pharmaceutical compositions thereof, to the treatment method used aforesaid compounds as well as to the intermediates of formula (II) the to the method of its preparation. In general formulas (Ia) and

, Q1 is -N(R1)-; Q2 is -C(R3)-; Q3 is -C(R5)-; Q4 is -C(R9)-; R1 is -Ym(Ra), where -Ra is -H, -OH, -C(O)R14, -O-C(O)R14, -C(O)N(R14)2, -C(O)OR14, -OS(O)2ONa-; R2 is -H; R3, R4 and R5 independently are -Ym(Rb), where Rb is -H, halogen, -C1-C8 alkyl, -O-(C1-C8 alkyl) or -OR14, -at condition that if value m of radical Ym(Rb) is equal 0, then R5 is not H; R6 is -H; R7 is -Ym-(RC), where -RC is -O-(C1-C8 alkyl) or -NH(phenyl), R8 is -Ym(Rd), where - Rd is -H, -OH, R9, R10, R11, R12 and R13 independently are -Ym(Re), where Re is -H, halogen, 5-6-membered heterocycle containing 2 heteroatoms selected from N or O, -OR14, or -O-C(O)OR14; every R14 independently is -H, -C1-C8 alkyl, -phenyl, 5-6-membered heterocycle containing one heteroatom being S; every Y independently is -C1-C8 alkylene-; every m independently is equal 0 or 1.

EFFECT: claimed compounds can find application for treatment of different cancer species.

41 cl, 4 tbl, 4 dwg, 8 ex

FIELD: medicine, pharmacology, pharmacy, medicinal biochemistry.

SUBSTANCE: invention proposes a pharmaceutical composition that comprises, in particular, N-(1-octyl-5-carboxymethyl-dimethylindolin-7-yl)-2,2-dimethylpropaneamid or its pharmacologically acceptable salts as inhibitor of enzyme ACAT and inhibitor of HMG-CoA-reductase that represents pravastatin, lovastatin, simvaststin, fluvastatin, rivastatin, atorvastatin, rosuvastatin or pitavastatin used as active component of the composition. The combination of active substances shows the expressed synergistic effect. Invention provides enhancing activity of the composition in clinical applying.

EFFECT: valuable medicinal properties of composition.

71 cl, 2 tbl, 3 ex

Up!