Recombinant plasmid dna pbmc-rt(a)-hum for expressing protein of reverse transcriptase of human immunodeficiency virus

FIELD: biology.

SUBSTANCE: present invention relates to biotechnology, particularly to genetic engineering and can be used in the biomedical industry. Proposed is a recombinant plasmid pBMC-RT(A)-hum, meant for expressing reverse transcriptase of the human immunodeficiency virus, and is distinguished by that, it contains an artificial gene (RT(A)-hum) synthesised by an enzyme, which is characterised by a sequence of nucleotides, optimally adapted to expression in cells of mammals.

EFFECT: use of the recombinant plasmid provides for significant increase (6-8 times) in output of the target protein compared with the primary standard.

4 dwg, 1 tbl, 3 ex

 

The invention relates to the field of biotechnology, in particular to methods of producing vaccines using techniques of genetic engineering and immunology, and can be used in medicine and related fields to enhance protein expression, in particular protein RT a fragment of the Pol protein of human immunodeficiency virus type 1 HIV-1 subtype a or its fragments and synthetic analogs in eukaryotic cells.

One of the global challenges facing biotechnology is to increase the output of the substances produced by cells of prokaryotes and eukaryotes. To solve these problems, as a rule, cells exposed to various external factors: the temperature rises above 42°C, decreasing the amount of nutrients, such as phosphates or nitrogen, to a level below that required for the survival of microorganisms, toxic effects - for example, the use of dyes, acids or exudates plants, the metabolic destruction of cells as a result of changes in the level of ions impinging on the ability of microorganisms to osmoregulation, or in the level of contents introduction vitamins or cofactors, which can cause the cessation of metabolism (EN 2179980, 2002).

However, as the impact of the above factors on the yield of specific producers feature is characterized by its high possess narrow specificity for each case it is necessary to conduct extensive research.

The most difficult questions stimulate the expression is solved in the case of receiving a vaccine against human immunodeficiency virus (HIV), for the manufacture of which you must learn to achieve the expression of viral proteins in eukaryotic cells without the introduction of the virus, which would develop in the body with the necessary immune response. The problem is related to the characteristics of the gene sequences of the human immunodeficiency virus, in particular, with the use of viral genes codons that are not typical for intensively expressed genes mammals, in particular humans, as well as a large variability of viral populations expressed in genetic divergence.

One approach to solving this problem is the use of the genomes of retroviruses, adenoviruses, papillomaviruses and papovaviruses as promoters for the expression of protective antigens of pathogenic viruses in mammalian cells.

The most detailed studies were carried out with the use of vaccinia virus (WWII). In particular, we have constructed recombinant BOB, separately expressing individual proteins of HIV-1: gp160, gp120, Tat, and reverse transcriptase (Moss Century, and Flexner C. // Ann. Rev. Immunol, 1987, v.5, p.305; Moss Century // Seminars in Virology, 1992, v.3, p.277; Falkner F.G. et al. // Karpova et al., 1988, v.164, p.450; Flexner C, et al. // Karpova et al., 1988, v.166, p.339; Takahashi, H., et al. // Proc. Natl. Acad. Sci. USA, 1988, v.85, p.3105; Walker, B.D., et al. // Science, 1988, v.240, p.64; Willey R.L., et al. // J. Virol, 1988, v.62, p.139). The obtained recombinant BOB were used for immunization of laboratory animals and identify proteins of HIV-1, can cause the induction of neutralizing virus antibodies. However, using recombinant BOB failed to induce full protective immune response against HIV infection. Apparently, this is due to the low immunogenicity of individual viral proteins (EN 2194075, 2002).

To solve the problem of generating an immune response to proteins of HIV was created protein TBI, which includes several cell epitopes of HIV-1. However, when using it you cannot get the full range of target products. In addition, the level of expression of the resulting protein is not high enough (EN 2237089, 2005).

The closest in technical essence and the achieved effect of the claimed invention is the stimulation of the expression of the RT protein by introduction into the cell of higher eukaryotic expression plasmid DNA pBMC-RT(A)m-l, containing the modified gene RT human immunodeficiency virus type 1 subtype And presented on figa (2238977, 2004). The disadvantage of this invention was not a high yield of the target product and it differs in several amino acid there from protein sequence RT, prevalent in a population of HIV-1 circulating in Russia.

The technical problem solved by the authors was to create a stimulator of protein synthesis RT, which increases its output and immunogenicity.

The technical result was obtained when using as a stimulator of expression of plasmid DNA containing the modified fragment of the pol gene (gene RT) of human immunodeficiency virus type 1 subtype a, called RT(A)m-1, the sequence of which is represented in fig.1b.

The basis of the invention was based on the idea that the genes of the virus are the so-called inhibiting plots (INS), in which a lot of adenine and thymine and rare guanine and cytosine. The content in the composition of the mRNA of these plots leads to premature decay of mRNA in the cell nucleus. For transport of viral mRNA from the nucleus to the cytoplasm, the virus uses its viral protein Rev. While not Rev was synthesized and has not penetrated into the nucleus, the viral mRNA will be in the kernel and there be subjected to degradation. Appeared in the nucleus Rev binds to a specific sequence RRE (Rev Responsible Element) in virus mRNA, mRNA migrates to the cytoplasm, where it is then synthesized viral proteins, including Pol. As a result of the authors of the studies it was found that upon the elimination of the gene RT inhibitory sites Odets is 10-15 times to increase the yield of protein RT. The analysis of sequences of the RT gene of HIV-infected people reveal differences in the amino acid sequence of the protein. Some amino acids located in the famous immunologically important regions are found with varying frequency in the analyzed population. Introduction of nucleotide substitutions in the sequence of the RT gene resulting in the most statistically expressed protein sequence RT increases its possibilities as immunogen. In addition, the introduction of known amino acid substitutions in the region corresponding to the active centre RT, leads to inactivation of the enzyme and the possibility of reducing the likelihood of side effects when used.

According to the present invention a new stimulator was obtained by the following method.

Performed analysis of the codons in the composition of the fragment of pol gene that encodes a protein RT HIV-1 subtype A. All codons with a high content of adenine and thymine were replaced by synonymous codons with a reduced content of adenine and thymine and correspondingly higher content of guanine and cytosine nucleotides in the gene composition preferably included codons characteristic of intensively expressed human genes. In addition, the sequence of a gene included a Kozak sequence, initiating and two terminating translation codons. The codons that code is highlighted several amino acids in some immunologically important sites of protein RT, were replaced with codons of amino acids, prevalent in the population of HIV-1 on the territory of Russia and CIS countries. Besides, we have made the nucleotide substitutions in codons several amino acids localized in the region of the active center of the enzyme RT, for the inactivation of the enzymatic activity. In the automated chemical synthesis was obtained artificial gene RT(A)-hum, encoding an artificial protein RT(A)-hum, which was inserted into the vector rvms obtaining expression plasmids pBMC-RT(A)-hum.

The invention is illustrated by drawings, on which:

on figa the nucleotide sequence of the gene RT(A)-hum in comparison with the nucleotide sequence of the gene RT(A)m-1 (prototype); 1b - gene RT(A)-hum;

figure 2 is the nucleotide sequence of the gene RT(A)-hum in comparison with the nucleotide sequence of the natural gene RT(A);

figure 3 is the amino acid sequence of the protein RT(A)-hum in comparison with the amino acid sequence of the protein RT(A).

Nucleotides and amino acids, the same presents for genes marked in the compared sequence by a dot (.), missing in the sequence - the tilde (~), distinguished - see the corresponding letter. Gene RT(A)-hum length 1335 nucleotides differs from prototype RT(A)m-1 257 nucleotides and 358 nucleotides different from the natural gene RT(A). B. the POC RT(A)-hum length of 443 amino acids different from the natural protein RT(A) and 15 amino acids.

Industrial applicability of the claimed stimulator of protein synthesis and synthetic protein is illustrated by the following examples.

Example 1. Plasmid DNA isolation, ensuring the expression of the artificial protein RT(A)-hum using artificial gene RT(A)-hum.

Artificial gene RT(A)-hum, the sequence of which is presented in figure 1, obtained by chemical synthesis of overlapping fragments with subsequent annealing and legirovaniem. The assembled gene was inserted in a known manner in the plasmid vector rvms obtaining expression plasmids pBMC-RT(A)-hum. The obtained plasmid pBMC-RT(A)-hum transformed cells of Escherichia coli and its further developments.

Example 2. Investigation of the synthesis of synthetic protein RT(A)-hum in eukaryotic cells.

Culture human cell line 293 transformed DNA recombinant plasmids pBMC-RT(A)-hum. As a control, parallel cultures of 293 cells transformed an equal amount of DNA plasmids pBMC-RT(A)m-1. Transformed cell cultures were incubated in culture medium for 48 hours at a temperature of +37°C, and the content of CO2in the air, equal to 5%, literally and analyzed proteins in the cell lysates by electrophoresis in SDS page followed by Western blot turns with the serum of a patient infected with HIV-1 subtype A. the intensity of the color bands, sootvetstvujushij squirrel RT, analyzed using computerized video system. It is established that in the culture of cells transformed by plasmid DNA pBMC-RT(A)-hum, the protein level RT(A) not less than 6-8 times higher than protein synthesis RT(A) in cells transformed with control plasmid pBMC-RT(A)m-1.

Example 3. The use of plasmid DNA pBMC-RT(A)-hum for immunization.

Laboratory mice BALB/c mice were injected intramuscularly three times at 10 micrograms of plasmid DNA pBMC-RT(A)-hum, the control group of mice were administered the same dose of pBMC-RT(A)m-1. After 6 weeks in the blood serum of the animals was determined the titers of antibodies to the protein of the RT in a known manner. The results are shown in table 1.

Table 1
The titers of antibodies in the blood sera of mice immunized with plasmid DNA pBMC-RT(A)-hum and pBMC-RT(A)m-1
Antibody titers with the introduction of DNA plasmids pBMC-RT(A)-hum1:1024
Antibody titers with the introduction of DNA plasmids pBMC-RT(A)m-11:512

The obtained results show that using the proposed stimulator allows 6-8 times to increase the output of synthetic protein RT compared to the prototype.

Recombinant plasmid DNA pBMC-RT(A)-hum for the expression of protein reverse transcriptases immunodeficiency syndrome (RT), represented by the vector RPMs containing the DNA fragment that encodes called RT, and characterized in that said fragment is a synthetic genome, which has a nucleotide sequence represented by fig.1b.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: invention concerns biotechnology, particularly obtaining cytokine proteins, and can be applied in cell technology. Polypeptide binding Zalpha11 ligand receptor is obtained. Nucleotide sequence coding new polypeptide is introduced into host cell as part of expression vector, and polypeptide is produced.

EFFECT: possibility of efficient adjustment of proliferation and/or development of hemopoietic cells in vitro and in vivo.

14 cl, 1 dwg, 55 ex

FIELD: chemistry, biotechnology.

SUBSTANCE: invention relates to field of biotechnology and concerns obtaining factor VII protein by method of recombinant DNA. Recombinant plasmid DNA was constructed for expression of blood clotting factor VII in mammalian cells, which is product of ligating of fragment of cDNA of human factor VII gene, flanked by sites of restrictases Xhol and BamHI recognising, with large XhoI/BglII fragment of vector pEFZeo, including genes of resistance to ampicillin and zeocin. As result of BHK cell transformation with new recombinant plasmid, cell line BHK/F7 was obtained, which produces recombinant protein of factor VII with output of up to 40 mkg/ml.

EFFECT: obtaining cell line producing recombinant protein of factor VII.

2 cl, 4 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: invention concerns genetic engineering, biotechnology, immunology and medicine and can be applied in obtaining antitumoral vaccine and melanoma treatment. Vaccine compositions are based on heat shock proteins and antigen peptides for treatment of tumor disease, the said compositions containing hybrid protein consisting of heat shock HSP70 family protein and one of specific melanoma MAGE peptides (A1, A2, A3) or gp 100, as well as suitable pharmaceutical carrier. The invention also claims a method for obtaining the said hybrid proteins by gene expression in synthetic recombinant vectors in producer strains of E coli BL21 (DE3) cells.

EFFECT: improved immunising power.

3 cl, 4 ex, 1 tbl, 2 dwg

FIELD: biotechnology, genetic engineering.

SUBSTANCE: invention describes recombinant plasmid DNAs constructed in vitro that comprise artificial genes for light and heavy chains of full-scale human antibody prepared by genetic engineering methods. These genes are created on basis of variable fragments of light and heavy chains of recombinant antibody 1F4 and constant human genes IgG1, cytomegalovirus promoter and polyadenylation site BGH. Plasmids provide biosynthesis of recombinant full-scale human antibodies of class IgG1 in mammalian cells. These antibodies interact specifically with smallpox vaccine virus. The affinity constant for prepared recombinant antibodies is 3.54 x 109 ± 0.38 x 109 M-1. Plasmids are used by combined transfection of human cells HEK 293T. Prepared full-scale recombinant antibody against protein of size 27 kDa of smallpox virus vaccine can be used as a base for creature of pharmaceutical preparations used for diagnosis of some post-vaccine complications caused by smallpox virus vaccine. Also, preparations will comprise decreased therapeutic doses of immunoglobulins that will provide minimal undesirable immune response in patients after administration of the preparation.

EFFECT: valuable medicinal properties of plasmid DNA.

4 cl, 7 dwg, 6 ex

FIELD: biotechnology, medicine, immunology.

SUBSTANCE: invention relates to recombinant vaccine against HIV-1 that represents a combination of immunogens as micelle-like particles comprising recombinant plasmid DNA pcDNA-TCI covered by conjugate spermidine-polyglucine with recombinant protein TBI comprising conservative T- and B-cellular virus-neutralizing epitopes in the stabilizing system. In immunization using this created vaccine production of specific antibodies possessing the virus-neutralizing activity is induced as well specific cytotoxic immune response also.

EFFECT: valuable medicinal properties of vaccine.

1 tbl, 5 dwg, 5 ex

FIELD: medicine, immunology.

SUBSTANCE: the present innovation deals with specific prophylaxis of smallpox and viral hepatitis B. The kit contains two tablets each contains stabilizing additives, a filler and lyophilized alive viral material worked out based upon recombinant VOV strain at typical VOV properties expressing proteins preS2-S and HBs virus of hepatitis B virus, the first immunizing dosage corresponds to minimal quantity of viral material being sufficient to obtain weak immune response in the body in case of insignificant at insignificant reactogenicity, and immunizing dosage of the second - maximal quantity of viral material that causes pronounced and prolong immune response in the body at no negative side action. The technique of applying the kit of bivaccine tablets, first, one should use the 1st tablet at minimal dosage of bivaccine, as for the 2nd tablet - with maximal dosage of bivaccine it should be taken till the moment of developing humoral answer (in 7-14 d) after injecting the 1st tablet at minimal immunizing dosage of bivaccine. The innovation enables to create stable immunity.

EFFECT: higher efficiency.

4 cl, 5 ex, 6 tbl

FIELD: gene engineering.

SUBSTANCE: invention relates to method for modification target endogenic gene or chromosomal locus in eucaryotic cells. Claimed method includes production of large cloned genomic fragment having more than 20000 n.p. and designing based on the same large targeting vector (LTVEC) by using bacterial homological recombination. Further LTVEC is introduced into eucaryotic cells to modify endogenic gene or chromosomal locus. Finally assay is carried out to determine of allele modification in such cells. Also disclosed is application said cells for generation of organisms carrying such genetic modification.

EFFECT: method for modification with large DNA sequences.

26 cl, 6 dwg, 2 tbl, 5 ex

FIELD: molecular biology, biochemistry, medicine, oncology.

SUBSTANCE: invention relates to DNA sequences found in analysis of mDNA from squamous carcinoma cellular lines of different origin wherein these DNA sequences represent transcripts from rearranged genes SCCA1 and SCCA2. Result of rearrangement is formation of fused gene consisting of exon 2-7 of gene SCCA1 and exon 8 of gene SCCA2, or exons 2-7 of gene SCCA2 and exon 8 of gene SCCA1. Prepared expressing vectors comprising above said combinations of exons of two genes provide synthesis of corresponding fused protein in host-cell. Proposed sequences of nucleic acids and genetic constructions based on thereof represent novel agents for diagnosis squamous carcinomas.

EFFECT: valuable biological and medicinal properties of transcripts.

8 cl, 9 dwg, 1 tbl, 5 ex

FIELD: biotechnology, in particular isolated DNA molecule providing plant disease resistance and method for providing of disease resistance to plants.

SUBSTANCE: DNA molecular containing N1M1 is isolated. Recombinant vector including active in plant promoter functionally bonded with said DNA is constructed and plant is transformed by this vector.

EFFECT: decreased technological charges and increased land productivity.

9 cl, 37 dwg, 18 tbl, 10 ex

FIELD: gene engineering.

SUBSTANCE: vector of present invention includes expression cassette containing transgene located under promoter control and central polypurine tract (cPPT) located upstream from cassette. Said vector provides delivery of desired transgenes into target cells and high level expression thereof in such cells. Also disclosed are host cell transduced with lentiviral vector, methods for transduction and uses thereof.

EFFECT: new agent for gene therapy.

26 dwg, 2 tbl, 4 ex

FIELD: gene engineering.

SUBSTANCE: vector of present invention includes expression cassette containing transgene located under promoter control and central polypurine tract (cPPT) located upstream from cassette. Said vector provides delivery of desired transgenes into target cells and high level expression thereof in such cells. Also disclosed are host cell transduced with lentiviral vector, methods for transduction and uses thereof.

EFFECT: new agent for gene therapy.

26 dwg, 2 tbl, 4 ex

FIELD: biology.

SUBSTANCE: present invention relates to biotechnology, particularly to genetic engineering and can be used in the biomedical industry. Proposed is a recombinant plasmid pBMC-RT(A)-hum, meant for expressing reverse transcriptase of the human immunodeficiency virus, and is distinguished by that, it contains an artificial gene (RT(A)-hum) synthesised by an enzyme, which is characterised by a sequence of nucleotides, optimally adapted to expression in cells of mammals.

EFFECT: use of the recombinant plasmid provides for significant increase (6-8 times) in output of the target protein compared with the primary standard.

4 dwg, 1 tbl, 3 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology and a set of synthetic oligonucleotide primers and method for use thereof. Proposed set comprises two pairs of primers having following structure - FIV F: 5′-AAGAGTCCCAAATATGCCATAGG-3′ and FIV R: 5′-TCCATCCAAATTGCTACTGTTC-3′; FeLV F: 5′-GAATAAACCTCTTGCTGTTTGC-3′ and FeLV R: 5′-AATCAGATCGAATGACAGAGACAC-3′. Presented primers do not contain palindromic repetitions of nucleotides, do not form expressed secondary structure and do not have extended G-C portions, and temperature of annealing is 55 °C for both pairs of oligonucleotides. Described method involves preparation of reaction mixture by mixing buffer of 10-fold for PCR - 2.5 mcl, a dNTP (25 mM) - 0.4 mcl, primers FIV F, FIV R, FeLV F and FeLV R (15 pmol/mcl) in 1 mcl, Taq polymerase (5 units/mcl) - 0.2 mcl MgCl2 (50 mM) - 1.5 mcl bidistilled water - 11.4 mcl and test DNA 5 mcl, amplification is carried out in following mode: total denaturation 95 °C - 3 minutes, cycle denaturation (95°C - 20 or 60 s) - annealing (55 °C - 20 or 60 s) - elongation (72 °C - 40 or 60 s), cycle of denaturation-annealing-elongation is repeated 35 times, final elongation 72 °C - 5 minutes, storing 4 °C - 10 minutes, and detection of obtained results is carried out by 1.5 % agarose gel. Presence or absence of amplified fragments of nucleotide sequences length 397 base pairs for FIV (feline immunodeficiency virus) and 221 base pairs for FeLV (feline leukemia virus) indicates presence or absence of viruses in organism cat.

EFFECT: invention can be used in scientific research for detecting a genetic material of immunodeficiency viruses - FIV and leukemia FeLV cats by multiplex polymerase chain reaction (PCR) in animal blood.

2 cl, 3 dwg, 3 tbl

FIELD: biochemistry.

SUBSTANCE: invention relates to biochemistry. Described is kit for DNA detection of bovine immunodeficiency provirus (BIV (bovine immunodeficiency virus)), containing pair of specific primers and DNA-probe, by PCR in real time. Primers and probe have following nucleotide composition (5′-3′-): pf - TAGGGTAGTGGGATCTCAGAAATC, pr - ACATCCGTAACATCTCCTACCATC, z - GAGGATGGTAGGAGATGTTACGGAT. Source of fluorescence at 5′ end of the probe used is dye ROX and fluorescence quenching fluorescence on 3′ end of BHQ2. Also described is diagnostic technique for BIV by PCR in real time using kit according to claim. 1. Reaction mixture is prepared by mixing buffer 10-fold for PCR - 2.5 mql, dNTP (25 mM) is 0.2 mql, pf and pr primers (10 pmol/mql) by 1 mql, probe z (10 pmol/mql) is 0.5 mql, Taq polymerase (5 units/mql) is 0.2 mql, MgCl2 (50 mM) is 2 mql, bidistilled water is 7.6 mql, and amplification is carried out as follows: denaturation 95°C is 5 minutes, cycling: denaturation (95°C - 20 s) - annealing (55°C - 20 s) - elongation (72 C - 20 s), wherein cycle of denaturation-annealing-elongation is repeated 10 times, cycling 2 with detection: denaturation (95°C - 20 s)-annealing (55°C - 20 s)-elongation (72°C - 20 s), wherein cycle denaturation-annealing-elongation is repeated 25 or 30 times. Fluorescence is measured over a Orange channel at temperature of 55°C. Intersection of fluorescence curve line threshold, set at level of 30% of maximum level of fluorescence in last cycle amplification testifies to provirus BIV presence in sample, at that, the less value of “Ct” indicator, the higher amount of provirus BIV in analysed sample, while absence of intersection of fluorescence curve line threshold testifies to absence of provirus BIV in sample.

EFFECT: invention can be used in scientific research for detecting genetic material BIV in animal blood lymphocytes by PCR in real time.

2 cl, 6 dwg, 3 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: recombinant chimerical polypeptide-immunogen is proposed, including conservative T- and B-cell epitopes of HIV-1 and consecutive peptide fragments of p24, gp41, gp120 proteins, recognizable by wide-neutralizing 10e8, 2F5, VRC01 antibodies.

EFFECT: improved HIV-specific immune response due to the inclusion of unique linear conformational epitopes imitators, recognizable by wide-neutralizing antibodies into the polypeptide-immunogen nTBI.

6 dwg, 5 ex

FIELD: biotechnology, in particular isolated DNA molecule providing plant disease resistance and method for providing of disease resistance to plants.

SUBSTANCE: DNA molecular containing N1M1 is isolated. Recombinant vector including active in plant promoter functionally bonded with said DNA is constructed and plant is transformed by this vector.

EFFECT: decreased technological charges and increased land productivity.

9 cl, 37 dwg, 18 tbl, 10 ex

FIELD: molecular biology, biochemistry, medicine, oncology.

SUBSTANCE: invention relates to DNA sequences found in analysis of mDNA from squamous carcinoma cellular lines of different origin wherein these DNA sequences represent transcripts from rearranged genes SCCA1 and SCCA2. Result of rearrangement is formation of fused gene consisting of exon 2-7 of gene SCCA1 and exon 8 of gene SCCA2, or exons 2-7 of gene SCCA2 and exon 8 of gene SCCA1. Prepared expressing vectors comprising above said combinations of exons of two genes provide synthesis of corresponding fused protein in host-cell. Proposed sequences of nucleic acids and genetic constructions based on thereof represent novel agents for diagnosis squamous carcinomas.

EFFECT: valuable biological and medicinal properties of transcripts.

8 cl, 9 dwg, 1 tbl, 5 ex

FIELD: gene engineering.

SUBSTANCE: invention relates to method for modification target endogenic gene or chromosomal locus in eucaryotic cells. Claimed method includes production of large cloned genomic fragment having more than 20000 n.p. and designing based on the same large targeting vector (LTVEC) by using bacterial homological recombination. Further LTVEC is introduced into eucaryotic cells to modify endogenic gene or chromosomal locus. Finally assay is carried out to determine of allele modification in such cells. Also disclosed is application said cells for generation of organisms carrying such genetic modification.

EFFECT: method for modification with large DNA sequences.

26 cl, 6 dwg, 2 tbl, 5 ex

FIELD: medicine, immunology.

SUBSTANCE: the present innovation deals with specific prophylaxis of smallpox and viral hepatitis B. The kit contains two tablets each contains stabilizing additives, a filler and lyophilized alive viral material worked out based upon recombinant VOV strain at typical VOV properties expressing proteins preS2-S and HBs virus of hepatitis B virus, the first immunizing dosage corresponds to minimal quantity of viral material being sufficient to obtain weak immune response in the body in case of insignificant at insignificant reactogenicity, and immunizing dosage of the second - maximal quantity of viral material that causes pronounced and prolong immune response in the body at no negative side action. The technique of applying the kit of bivaccine tablets, first, one should use the 1st tablet at minimal dosage of bivaccine, as for the 2nd tablet - with maximal dosage of bivaccine it should be taken till the moment of developing humoral answer (in 7-14 d) after injecting the 1st tablet at minimal immunizing dosage of bivaccine. The innovation enables to create stable immunity.

EFFECT: higher efficiency.

4 cl, 5 ex, 6 tbl

FIELD: biotechnology, medicine, immunology.

SUBSTANCE: invention relates to recombinant vaccine against HIV-1 that represents a combination of immunogens as micelle-like particles comprising recombinant plasmid DNA pcDNA-TCI covered by conjugate spermidine-polyglucine with recombinant protein TBI comprising conservative T- and B-cellular virus-neutralizing epitopes in the stabilizing system. In immunization using this created vaccine production of specific antibodies possessing the virus-neutralizing activity is induced as well specific cytotoxic immune response also.

EFFECT: valuable medicinal properties of vaccine.

1 tbl, 5 dwg, 5 ex

Up!