Method of obtaining transgenic monocotyledon plants

FIELD: genetic engineering.

SUBSTANCE: invention can be used in monocotyledon plants selection for creation of novel sorts and hybrids by means of genetic engineering, in works insertional mutagenesis, separating and cloning of plant genes. In order to obtain transgenic monocotyledon plants in period of their active blooming flowers lacking own fertile pollen are selected. As object of genetic transformation, blooming female gametophyte is used, which is processed with suspension of strain Agrobacterium tumefaciens with activated vir-genes, pistil filaments being processed directly. After that said flowers are pollinated with pollen of fertile plants. For processing cells with strain Agrobacterium pistil filament sections, located near flower ovary, are used.

EFFECT: said operations allow to create transgenic monocotyledon plants preserving high frequency of their obtaining under conditions, that correspond to natural temperatures of blooming, and to simplify technology of obtaining transgenic plants.

4 cl, 1 dwg, 1 tbl

 

The invention relates to agriculture and biotechnology and can be used in the selection of monocotyledonous plants in the creation of new varieties and hybrids using genetic engineering, in insertional mutagenesis, isolation and cloning of plant genes.

A method of obtaining transgenic maize plants based on Agrobacterium-mediated transformation of immature embryos of maize in vitro (Zhao Z.-Y., Cai T., Tagliani L. et al. Agrobacterium-mediuted sorghum transformation // Plant Mol. Biol., 2000, v.44, pp.789-798), according to which immature embryos of corn placed for 5 min in a suspension of Agrobacterium-mediated cell density of 0.5-1.0×109cells/ml) in the medium for inoculation containing mineral salts and MS vitamins, hydrolyzed casein (1.0 g/l), 2,4-D (1.5 mg/l), glucose (36 g/l), sucrose (68.5 g/l), acetosyringone (100 μm), after which they transferred to 3 days on Wednesday to cocultivation different from the source is increased to 2.0 mg/l concentration of 2,4-D reduced to 20 and 10 g/l, respectively, the concentrations of sucrose and glucose, the addition of L-Proline (0.7 g/l), ascorbic acid (10 mg/l), MES 0.5 g/l) and agar (8 g/l). Then the embryos are transferred on a 4 day on Wednesday without acetosyringone, but with the addition of antibiotic carbenicillin (100 mg/l) to inhibit the growth of Agrobacterium. Then for the induction of embryogenic callus embryos are transferred to an environment different from the pre is adusei the absence of glucose and a reduced concentration of 2,4-D (1.5 mg/l) and the addition of a selective agent phosphinotricin (5 mg/l), the resistance gene to which (bar) was present in T-DNA used agrobacterial strain, and cultured for 2 weeks. Carry survivors (sustainable) callus on a medium of the same composition with a high level of phosphinotricin (10 mg/l) and transplanted every 2 weeks. For the development of embryoids callus transplanted to an environment that is different from the previous addition of kinetin (0.5 mg/l), and then on Wednesday for pobegoobrazuyuschaya different from the previous absence of 2,4-D increased to 60 g/l concentration of sucrose, replacement of kinetin on zeatin (0.5 mg/l), the addition of indolyl-3-acetic acid (IAA) (1 mg/l), abscisic acid (ABA) (0.1 µM) and thidiazuron (0.1 mg/l). The shoots are transferred to medium for rooting - 1/2 Murashige-Skoog (MS) (nitrile-3-acetic acid (NAA) (0.5 mg/l), indole-3-benzoic acid (IB) (0.5 mg/l), sucrose (20 g/l), agar (7 g/l), and then on Wednesday of the same composition, but without NAA and IB. The resulting plants using molecular genetics methods analyze the presence in their genome insertion of a fragment of foreign DNA (T-DNA Agrobacterium). This method allows you to achieve frequency of stable transformation to 10.1% (based on the number of inoculated embryos.

The disadvantage of this method is the high complexity and duration of the process of obtaining transgenic plants. In addition, the use of the system of culture i vitro, firstly, can lead to somaclonal variations among plants transformed secondly, limits the application of this method, since not all samples of corn (seleccionando lines and hybrids) give good growing embryogenic callus with a high regenerative ability, or their explants producing embryogenic callus, necrotizing result cocultivation with agrobacterial cells.

A method of obtaining a transgenic monocotyledonous plants using genetic markers used in genetic engineering in higher plants for selection of transgenic plants, which serves as nptll gene, which encodes the enzyme neomycin-phosphotransferase causing resistance to kanamycin. For selection of transgenic plants carrying the gene nptII, from seeds collected from plants transformed remove the embryos and grow them in culture medium with kanamycin (Danilova S.A. Optimization of Agrobacterium-mediated transformation method of corn. Abstract. Diss. Kida. Biol. Sciences. M, 2001), While seedlings carrying and expressing the gene nptII, have a green phenotype, whereas seedlings, do not carry this gene, become albino and die.

This way you can take away from some species of dicotyledonous and monocotyledonous plants kanamycin-resistant t is informant with the gene nptII, it has, however, two significant drawbacks: high complexity, limiting the volume of the analyzed material, the duration of contact of embryos with kanamycin in the process of their cultivation on kanamycin-containing medium, resulting in disrupted development even kanamycin-resistant transformants.

Closest to the proposed method is a method of obtaining a transgenic sorghum plants (Patent RF №2229793, IPC: AN 1/00, C12N 15/82, C12N 15/00), including cells transformation of sorghum using Agrobacterium tumefaciens and the selection of transgenic plants. To obtain transgenic plants using flowering panicles of sorghum, deprived of their own fertile pollen that pollinate with pollen fertile plants of sorghum and, then, put the cell suspension of strain Agrobacterium tumefaciens with activated vir genes, and activation of vir genes use acetosyringone, and application of a suspension of Agrobacterium tumefaciens cells is carried out at a temperature which is optimal for the process of transformation, while the transgenic plants are selected among seedlings, grown from seeds, ensuing in these panicles.

The disadvantage of this method is the requirement to implement the transformation at the temperature optimum for the process of transformation, which is in contradiction with the natural temperature optimum maturation of pollen, the village is olcu considered the optimum temperature for activation of the vir genes is the temperature below 25°C (Fullner K.J, Nester E.W. Temperature affects the T-DNA transfer machinery of Agrobacterium tumefaciens // J.Bacteriol. 1996. V.178. P.1498-1504), and the optimal temperature for pollen maturation temperature is above 25°C. in Order to avoid this contradiction, the plants have to work at night, to grow them in special containers (or dig plants from the earth and place into containers) and transfer them for incubation at low temperatures in special areas. After incubation at low temperatures due to backward movement of plants to full maturity in optimal conditions of light and temperature, which greatly complicates the technology of production of transgenic plants leads to the loss of plants, deterioration of aging and, ultimately, decrease the efficiency of producing transgenic plants.

The objective of the invention is to provide a more rapid and simple method of obtaining a transgenic monocotyledonous plants, while maintaining the high frequency of their receipt in the conditions corresponding to the natural temperature of monocotyledonous flowering plants.

The technical result is the possibility of highly efficient DNA transfer from Agrobacterium in the real natural plant at temperatures of monocotyledonous flowering is of astini (above 25°C), with the simplification of obtaining transgenic plants (processing, incubation, maturation).

This object is achieved in that in the method of obtaining a transgenic monocotyledonous plants, including selection as an object of genetic transformation flowers monocotyledonous plants, deprived of their own fertile pollen, the pollination pollen fertile plants, processing flowers suspension of Agrobacterium tumefaciens cells with activated vir genes, according to the proposed solution as an object of genetic transformation using a blooming female gametophyte monocotyledonous plants, which is first treated with a suspension of cells of a strain of Agrobacterium tumefaciens with activated vir genes, and then pollinated with pollen fertile plants.

In addition, the pollination of flowering female gametophyte pollen fertile plants carry out within hours after they are processed by a cell suspension of strain of Agrobacterium tumefaciens, and the processing of the cell suspension of strain Agrobacterium tumefaciens carried out directly pistillate threads blooming female gametophyte, while the flowers are selected in the period of their active flowering. For suspension cells of Agrobacterium tumefaciens strain used parts pistillate threads blooming female gametophyte, located near the ovary. To obtain transgenic plants is okorusu for processing a suspension of cells of Agrobacterium tumefaciens strain used parts pistillate threads blooming female gametophyte, located at the exit of the threads from the cob.

The invention is illustrated in the drawing (picture), which presents evidence of insertion of T-DNA into the genome of the plant in the form of DNA fragments of a certain length, the resulting polymerase chain reaction (PCR) and visualized by electrophoresis in agarose gel, in particular, the drawing shows a PCR analysis of DNA from maize seedlings transformed in planta, where the numbers 1-8 marked lanes: 1, DNA from nerastrirovannye plants (negative control); 2 - molecular weight marker (Fermentas, Latvia), the size of the fragments, starting from the top: 3000, 2000, 1500, 1200, 1031, 900, 800, 700, 600, 500 P.N.; 3-8 - test sprouts, grains are germinated without delay on kanamycin.

The proposed method is as follows. Female flowers (in the monoecious or dioecious, diclinous plants isolated parchment insulators before flowering. To handle flowers use a cell suspension of Agrobacterium tumefaciens with a cellular density of 1×107cells/ml, which adds acetosyringone. Female flowers plants after treatment agrobacterial suspension pollinated with pollen of the same or another line of the same plant species and over again isolated. With treated plants, collect seeds, germinate them and selected on medium containing kanamycin seedlings carrying the marker is a gene. In seedlings, resistant to kanamycin, take a piece of fabric and using the method of PCR (polymerase chain reaction) to verify the presence of the portable DNA sequence of a gene, using untreated and surface-sterilized plants. Selected seedlings carrying the DNA fragment of the marker gene ("PCR+seedlings), which are transgenic plants.

The inventive method was implemented on the maize plant of the line at-3 and sorghum seed. As pollen donors were the plants of the same line. Transgenes was performed using Agrobacterium tumefaciens, was used strain GV3101 with plasmid pTd33, which included selective marker gene nptII, obuslavlivanie resistance to kanamycin. Cell suspension data agrobacterial strains were grown on a rocking chair on a nutrient medium CIB (Fullner K.J., Stephenens C.M., Nester E.W. An essential virulence protein of Agrobacterium tumefaciens, VirB4, requires an intact mononucleotide binding domain to function in transfer of T-DNA. // Mol. Gen. Genet. 1994. V.245. P.704-715) to a density of 1x107cells/ml at room temperature. Upon reaching the required density in the suspension was added acetosyringone (200 µM) and either directly used in the experiment transgenes, or placed in a refrigerator (t°=4-7°C) for use in the next 2-3 days.

Before flowering ears insulated parchment insulators. As the object g is kinetic transformation used blossoming female gametophyte monocotyledonous plants, pistillate thread which is located at the output of the threads from the cob, cut and first treated with a suspension of cells of a strain of Agrobacterium tumefaciens with activated vir genes, and then within hours pollinate collected in the package pollen fertile plants by nadrachivanie from a package or fingers to the surface of the cut beam pollen tubes. The temperature in the processing plants varied depending on the year in the range from 20 to 28°C. For the detection of transgenic plants the seeds collected from the cobs treated with agrobacterial suspension and untreated (control) corn plants baseline, were sterilized with 5%solution of bleach (15 min), intensively washed in tap water, soaked in distilled water (24 hours), re-sterilized in the kelp-Boxing 5%solution of bleach and without rinsing was spread on agar medium containing kanamycin (200 mg/l), and after the appearance of the roots after 2-5 days transferred to soil in pots with soil, where were germinated in 2-3 weeks.

Confirm the transgenic nature of the obtained green seedlings was performed using PCR method (see drawing). Thus from the leaves of the selected plants were isolated DNA according to the conventional techniques (Maniatis T., Frisch., Sambrook J. Molecular cloning. Laboratory manual. M.: Mir, 1984). The reaction Provo is or with oligonucleotide primers, specific to the fragment of the nptII gene size 250 BP: ACAGACAATCGGCTGCTCTGATG and GGCAGGAGCAAGGTGAGATGACA. The reaction products were separated by agarose gel electrophoresis, as a marker of molecular weight used DNA of phage λ. As a positive control was used plasmid pTd33.

The result of the DNA analysis showed that the number of samples total DNA of the plant contain a sequence of approximately 500 BP, characteristic gene nptII. In the calculation of the number of germinated caryopses frequency derived from these adults transformed plants was 1.3-6.8% (see table 1). Moreover, it was observed that the frequency of transformation is not dependent on high ambient temperature (>25°C).

Table 1.
The frequency of insertion of T-DNA into the genome of corn after treatment pistillate corn yarns A. tumefaciens according to the proposed method
OptionsTemperature during processing plants
25-28°C20-22°C
Sample seeds1200600
The number of green p is Oreshkov on kanamycin 5337
The number of seedlings was analyzed by PCR5337
The number of PCR-positive cells (% of the total number of seedlings)25 (47%)9 (24.3%)
The number of transformants (% of the total number of seeds)6.8%1.5%

Thus, the above data show that the inventive method allows a high frequency to obtain transgenic plants with real natural temperatures of monocotyledonous flowering plants of more than 25°C, with greatly reduced complexity and simplified technology for producing transgenic plants (processing, incubation, maturation).

The proposed method allows: 1) to obtain transgenic plants with real natural temperatures of monocotyledonous flowering plants in simplifying and increasing the speed of processing technology, incubation, growing plants while maintaining a high frequency of transformation, 2) to obtain transgenic plants, bypassing the system of culture in vitro, which speeds up and simplifies the obtaining of transgenic maize plants, 3) to avoid znackovanie somaclonal variation; 4) avoid hibernate of transformants resulting from the development of multicellular meristem containing both transformed and untransformed cells; 5) be used to transform virtually all well-known varieties and maize line, because there are no restrictions on genotypes that are capable of forming well-growing embryogenic callus.

1. A method of obtaining a transgenic monocotyledonous plants, including selection as an object of genetic transformation flowers monocotyledonous plants, deprived of their own fertile pollen, the pollination pollen fertile plants, processing flowers suspension of Agrobacterium tumefaciens cells with activated vir genes, characterized in that the object of genetic transformation using a blooming female gametophyte monocotyledonous plants, which is first treated with a suspension of cells of a strain of Agrobacterium tumefaciens with activated vir genes, and then pollinated with pollen fertile plants.

2. The method according to claim 1, characterized in that the pollination of flowering female gametophyte pollen fertile plants carry out within hours after they are processed by a cell suspension of strain Agrobacterium tumefacien.

3. The method according to claim 1, characterized in that the processing of a cell suspension of strain Agrobacterium tumefaciens carried out directly pistillate threads blooming wives who who gametophyte, while flowers are selected in the period of their active flowering.

4. The method according to claim 3, characterized in that the processing suspension cells of Agrobacterium tumefaciens strain used parts pistillate threads blooming female gametophyte, located near the ovary.



 

Same patents:

FIELD: medicine, microbiology.

SUBSTANCE: invention concerns biotechnology. It is described bispecific antibody which binds also the factor of blood coagulation IX or the activated factor of blood coagulation IX, and the factor of blood coagulation X, and functionally replaces the factor of blood coagulation VIII or the activated factor of blood coagulation VIII which strengthens enzymatic reaction. The pharmaceutical composition containing the described antibody is revealed. The present invention can be used as an alternative agent for functional replacement of cofactor which strengthens enzymatic reaction.

EFFECT: creation of bispecific antibody which can replace functional proteins, strengthens enzymatic reaction.

14 cl, 18 dwg, 37 ex

FIELD: biotechnology, organic chemistry, biochemistry.

SUBSTANCE: invention represents a novel method of preparing optically active 4-(indole-3-ylmethyl)-4-hydroxy-2-oxoglutaric acid (IHOG) used in preparing monatine, and a method for synthesis of optically active monatine. Also, invention relates to a novel aldolase used in these methods. 4-(Indole-3-ylmethyl)-4-hydroxy-2-oxoglutaric acid of high optical purity representing effective intermediate compound for synthesis of optically active monatine can be synthesized from indolpyruvic acid and pyruvic acid (or oxalacetic acid). Invention provides preparing 4-(indole-3-ylmethyl)-4-hydroxy-2-oxoglutaric acid and monatine with high degree of effectiveness.

EFFECT: improved preparing method.

18 cl, 12 dwg, 12 tbl, 25 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to new aldolase which catalyzes reaction of producing substituted alpha-ketoacid from oxalacetic or racemic pyrotartaric acid and indole-3-racemic pyrotartaric acid.

EFFECT: method for production of substituted alpha-ketoacids with increased effectiveness.

FIELD: gene engineering, in particular yeast strain modified by introducing of foreign genetic material.

SUBSTANCE: claimed strain is obtained by transforming of starting culture Pichia pastoris X-33 with two albumin structural genes with signals of yeast alpha-factor secretion, transcribed under control of 5'AOX1 promoter and transcription termination region of hepatitis G virus. Strain of present invention is useful in production of albumin-containing drugs.

EFFECT: strain for production of human recombinant albumin of increased yield.

3 ex

FIELD: biotechnology, in particular plant gene engineering.

SUBSTANCE: recombinant plasmid DNA pBi101-IL18 is constructed having length of 15000 n.p. and containing DNA fragment of pBi101-IL18 vector plasmide having length of 13900 n.p.; -NdeI-BamHI/BgIII DNA fragment being cDNA site of human IL-18 gene; -Nol-NdeI fragment of pET15b plasmide; encoding N-terminal polypeptide from six hystidine amino acids and site of thrombin enzyme hydrolysis, -5'URT region from genome of tobacco etch virus; double 35S CaMV promoter from genome of cauliflower mosaic virus; -3'URT region from genome of cauliflower mosaic virus. Method of present invention makes it possible to transfer nucleotide sequence of human IL-18 in plant genomic DNA.

EFFECT: method for production of mature human IL-18 having biological activity.

2 dwg, 1 tbl, 3 ex

FIELD: agriculture, in particular determination of plant material genotype and sunflower breeding.

SUBSTANCE: claimed method includes isolation of DNA from each sprout in seed group of sunflower plant followed by amplification thereof using PCR. Amplification is carried out on HA 432, HA 514, HA 1442, and ORS 5 microsatellite locuses by using primers corresponding to flanking regions of such locuses. Amplification products are separated by electrophoresis in colored, e.g. agarose gel. Visual comparison of electrephoresis spectra, e.g., in ultraviolet beam makes in possible to evaluate inbred line uniformity and hybridism level in tested sample based on number of single-type spectra.

EFFECT: method of increased accuracy.

5 cl, 3 dwg, 2 ex

FIELD: biotechnology.

SUBSTANCE: method for production of purine nucleosides and purine nucleotides, in particular 5'-inosinic acid is disclosed. Claimed method includes using of bacterium belonging to genus Esherichia or genus Bacillus. Production of purine nucleosides and purine nucleotides by said bacterium is increased due to increased activity of YdhL pritein. Also disclosed is amino acid sequence of YdhL pritein from Bacillus amyloliquefaciens and gene encoding thereof.

EFFECT: method for industry scale production of nucleosides and nucleotides.

25 cl, 2 dwg, 6 tbl, 9 ex

FIELD: biotechnology, microbiology.

SUBSTANCE: invention relates to a method for producing methanol. Method involves culturing recombinant microorganism E. coli at temperature 20-30°C. Prepared culture and cells isolated from this culture, or treated product of these cells are remained in contact with methane for producing methanol. Indicated recombinant microorganism ahs ability to convert methane to alcohol as result of transformation of DNA encoding enzyme methane oxygenase of soluble type. Invention provides expression of all components of methane oxygenase that allows realization of method for producing methanol under milder conditions.

EFFECT: improved producing method.

3 cl, 1 dwg, 1 tbl

FIELD: biotechnology.

SUBSTANCE: DNA is constructed encoding protein, advancing fungus resistance to certain group of compounds. Alternatively DNA is constructed having defect in function and encoding protein, which advances lowering of GPI-anchored protein amount in fungus cell wall. Encoded protein is useful in production of antibody thereto which may by applied as active ingredient of antifungal agent.

EFFECT: new method for production of antifungal agent.

11 cl, 8 dwg, 1 tbl, 2 ex

FIELD: gene engineering, in particular production of transgenic potato with Colorado beetle resistance and biological and food safety.

SUBSTANCE: recombinant polynucleotide sequence of general formula X-A, wherein X is part of nucleotide sequence of introduced genetic construct representing in SEQ ID N 1; A is nucleotide sequence of flanking site of genomic DNA of genus Nevskiy potato, representing in SEQ ID N 2 is constructed; plant cell producing of cryIIIa protein and containing recombinant polynucleotide sequence, as well as potato transgenic plant and vegetative generation thereof with Colorado beetle resistance are obtained. Polynucleotide sequence is used in identification of plant cell producing of cryIIIa protein, plant and vegetative generation.

EFFECT: new potato genus with Colorado beetle resistance.

6 cl, 6 dwg, 7 tbl, 7 ex

FIELD: genetic engineering.

SUBSTANCE: invention can be used in corn selection in creating new sorts and hybrids by means of genetic engendering, in works on insertional mutagenesis, separating and cloning of corn genes. Generative organs of corn are processed with suspension of cells of strain Agrobacterium tumefaciens with activated vir-genes. As generative organs, blooming female gametophyte is used. Before processing said suspension is mixed with substances inert with respect to strain cells and characterised by osmotic potential exceeding osmotic potential of suspension for obtaining isotonic solution. As such substances sucrose and/or glycerin are used. After procession with suspension generative organs are pollinated with pollen of fertile plants. In gametophyte pistil filaments are used, which are cut at height of 1-2 cm from corncob before processing with suspension. Processing is carried out by means of pipette into the depth of cut part of pistil filaments. Pollination is performed with pollen preliminary collected into packet, which is applied onto cut of pistil filaments with fingers or shaken onto it.

EFFECT: method allows to reduce term of obtaining transgenic corn plant and increase yield of final product, preserving high obtaining frequency.

5 cl, 1 dwg

FIELD: agriculture.

SUBSTANCE: tissues of the mildewed plants are collected to obtain mildew agent. Then seeds of mildew-sensitive sunflower grade are artificially infected with the mildew agent. The infected preservator of the infection is kept under low temperature and is used as a source of primary infection. The collected tissues of the mildewed plants are placed in a damp chamber for 15-18 hours, taken out to make water suspension of the mildew agent by water washing away of white deposits from the collected tissues into a vessel, the deposits contain mildew fungi mycelium and oospores. The obtained suspension is concentrated up to 90000-100000 zoosporangiums per 1 ml of water. Seeds of mildew-sensitive sunflower grade are placed in the suspension, held for 24 hours under the temperature of 16-18°C, dried under the room temperature up to air-dry state and put into sterile flasks with a plug for storage, further they are used as a primary mildew infection source, i.e. for inoculum production.

EFFECT: possibility to preserve sunflower mildew agent for 2 years and use it as primary mildew infection source at any time of the year.

11 cl, 1 tbl, 1 ex

FIELD: medicine, biotechnologies.

SUBSTANCE: invention can be used for obtaining of the factor VII of blood coagulation. Derivatives of a polypeptide of the factor VII with amino-acid replacements Q250C, R396C and P406C are obtained or with Cysteinum attached to the S-end of native sequence of the factor VII. Obtain derivatives with use of transgene technologies in eucariotic cells-owners of mammals.

EFFECT: invention allows obtaining derivatives of the factor VII with the kept activity of the coagulative factor VII and with increased ability conjugate with PEG, in comparison with the natural form of a polypeptide.

20 cl, 2 dwg, 8 ex

FIELD: agriculture.

SUBSTANCE: development of a reliable means for the identification of the corresponding transformation event in the plant genome. As a result of agrobacterial transformation of the Lugovskoy potato with a genetic maker containing the gene cryIIIa, and the analysis of the resulting transgenic plants demonstrating resistance to the Colorado beetle, the transgenic line (transformation event) 1210 amk has been selected. In the genomic DNA of the plants belonging to this line a fragment has been identified and sequenced, related to the genetic maker insertion area and being a recombinant sequence, one part of which relates to the genetic maker inserted, and the other part relates to the flanking area of the Lugovskoy potato genomic DNA. It is proposed to use the identified recombinant sequence as an identifier of this unique transformation event.

EFFECT: obtaining transgenic potato that is resistant to Colorado beetle and complies with requirements of biological and food safety on basis of high yield Russian variety.

5 cl, 5 dwg, 7 tbl, 7 ex

FIELD: agriculture.

SUBSTANCE: embryogenetic pine tissue is cultivated in or on the medium containing maltose and glucose, for cultivation of pine cotyledonous blastemals. Both maltose and glucose are available in the medium at concentration less than 3%. The maltose concentration in medium is 2.5 times higher than concentration of glucose. In one of the versions of this method the pine tissue is first kept in the medium for support of animated existence, and the mentioned concentrations of maltose and glucose are used further for cultivation in the medium for development from embryogenetic tissue of cotyledonous blastemals of a pine.

EFFECT: productivity increase of cotyledonous blastemals of a pine.

26 cl, 2 dwg, 2 tbl, 2 ex

FIELD: agriculture.

SUBSTANCE: invention concerns agriculture. Carrot precocity evaluation is realised by growing seeds at naturally short daylight (7-10 hours) in winter greenhouse (December-February). The time between sowing and beginning of stooling is registered. Forms with early stooling would be late-maturing in the long daylight field environment (15-17 hour daylight, May-August), while forms with late stooling would be early-maturing. This method provides faster evaluation of carrots precocity than other methods.

EFFECT: enables faster evaluation of carrot precocity.

1 tbl, 1 ex

FIELD: agriculture.

SUBSTANCE: invention agricultural biotechnologies. Healthy potato plants are cultivated in vitro by micrografting into nutrient medium containing macro- and microelements according to Murashige&Skoog formula, Fe-chelate, agar, vitamins according to White subscription, and sucrose. The regenerated plants obtained are replanted out. Additionally 3 mg/l of glycine, 1000-2000 mg/l of activated carbon and 1-2 mg/l of ascorbic acid are introduced into the nutrient medium. Original plants undergo micrografting at the apical, middle and basal parts. Apical and middle parts are vegetated in nutrient medium with sucrose content of 20 g/l at the temperature of 23-25°C in daytime and 17-18°C at night. Further regenerated potato plants are bedded. Basal part is vegetated in nutrient medium with sucrose content of 80 g/l in darkness at the temperature of 8-10°C, with further growing of potato microtubers in vitro.

EFFECT: allows improving survival rate and accelerate explants growth, increasing reproduction rate of regenerated plants and quantity of in vitro microtubers, as well as improving survival rate for regenerated plants after replanting them out.

6 tbl

FIELD: processes.

SUBSTANCE: way contains preparation of explants, their sterilisation, placing of explants for callus formation and biomass growth in sterile test glasses with inoculated nutrient medium of Murasige-Skuga with addition of growth stimulants, thermostatting at 26±1°C. Sterilisation of explants carries out in distilled water by affecting of ultrasonic oscillations with intensity of 1...2 W / sq. sm. on working frequency 22...44 kHz during 3...6 minutes. At stages of callus formation and growth of biomass the test glasses with explants entrained on water medium and carry out through it affecting by ultrasonic oscillations with intensity not less than 10...15 W / sq. sm. on frequency 22...44 kHz. Affecting is spent from a bottom of test glasses with periodicity not less often than 1 time a day during not less than 6 minutes at each stage. The biomass gain makes 87.40 - 176.53%.

EFFECT: sterilisation efficiency and ability not infected explants to form callus increases.

5 tbl

FIELD: biology, cellular engineering.

SUBSTANCE: method involves addition of lanthanum chloride to barley cell protoplasts to its final concentration 5-10 mM, and after aggregation protoplasts are incubated at 42°C for 30 min. Amount of fused protoplasts is carried out using light microscope. Protoplast fusion frequency is estimated to be 30-50%. Invention can be used for preparing large amount of barley cell fused protoplasts.

EFFECT: improved method for fusion of protoplasts.

FIELD: agriculture, in particular, plant multiplication and sanitation processes.

SUBSTANCE: method involves selecting plants-regenerants; planting in substrate; moving into individual chamber and keeping under cultivated conditions; opening; adding into substrate green earth and extrasol preparation having concentration of 1.0-10.0 ml/l, and potash lignohumate in an amount 0.01-0.2%; using solution containing emistim preparation diluted to 10-8-10-12 extent as foliar feeding means for plants.

EFFECT: reduced infection of substrate, increased yield and improved quality of plants.

5 tbl

FIELD: agriculture.

SUBSTANCE: invention may be used for selecting immune and highly resistant to cocco mycosis sweet cherry and cherry varieties and root stocks for the above crops. During active leaves growing, they are subject to diagnostic analysing by producing UHF extract of phenol compounds. The produced extract is diluted with the distilled water at a ratio 1:4-1:5 and a sample is supplied to amperometric analyser. The type resistance to infection is judged based on the availability of detector signal at 0.4 V potential on glassy-carbon electrode.

EFFECT: reduced time for infection-resistant types selection and essential improvement of results reliability.

2 dwg, 4 ex

Up!