Anti-nogo antibodies ("11c7") and their application in pharmaceutics

FIELD: biology; biotechnology.

SUBSTANCE: invention concerns biotechnology. It claims linking molecule represented by monoclonal antibody or its fragment capable of binding human NogoA polypeptide, human NogoA 623-640. Polynucleotide encoding the claimed molecule is presented. Expression vector including indicated polynucleotide is described. Host cell including indicated polynucleotide or vector is described. Pharmaceutical composition for treatment of diseases related to nerve reconstruction and containing indicated molecule is described.

EFFECT: obtainment of antibodies capable of binding NogoA 623-640.

9 cl, 1 dwg, 3 tbl, 7 ex

 

The present invention relates to connecting NogoA molecules, such as monoclonal antibodies or their Fab fragments.

The regeneration of damaged nerve cells in the Central nervous system (CNS) adult individual is limited by an overwhelming effect on the myelin surrounding axons (or neurites) and forming scar tissue. Over the last few years were discovered phenomena that are important for understanding the molecular mechanisms underlying the inability of the CNS to spontaneous healing after injury. The presence of myelin inhibitory growth molecules is a major impediment to axonal regeneration, in particular immediately after injury. To date, known and described as powerful inhibitors of axon growth, as NogoA, myelin-associated glycoprotein (MAG) and myelin-oligodendrocyte glycoprotein (Omgp). In addition, the myelin present and other inhibiting regeneration components, such as chondroitinsulfate proteoglycans. Protein NogoA belongs to the family of reticulana and has at least two biologically active and different pharmacological respect of the domain, which are called Amino-Nogo and Nogo-66. The receptor site for the first of them is still unknown, a Nogo-66 inhibits the growth of neurons in vitro and in vivo, with the participation of neuronal receptor NgR. In addition Nog-66 receptor NgR also be contacted inhibiting the growth of neurites or axons), MAG and Omgp, and this binding is of high affinity.

Currently studying new approaches to the problem of recovery of the nervous tissue, including enzymatic cleavage of scar tissue by chondroitinase ABC, the formation of a cellular bridge due to transplantation of meningeal cells of olfactory glia cells and stem cells, the use of protein growth factors to stimulate the growth of nerve cells; blocking the action of inhibitors of axon growth by modulation of mediators of intercellular communication, such as Rho-related membrane guanosin-triphosphatase (GTP-ASE), which is a key element in the inhibition of axon growth; application of cyclic adenosine-monophosphate (camp-Aza), which can overcome associated with myelin suppression of regeneration in vitro and to induce regeneration in vivo; the use of peptide inhibitors of receptor NgR (NEP 1-40) for the induction of growth and functional recovery of the neurons in rats after spinal cord injury.

In addition to the approaches described above draws attention to the possibility of neutralizing molecules of the Central and peripheral nervous system, inhibiting the growth of axons, monoclonal antibodies, including neutralizing the vast steps NogoA. Thus, it was shown that monoclonal is antibodies IN-1 or Fab-fragments-IN-1 induce axonal growth in vitro and stimulate the formation of new shoots (the process is called "sprouting") and regeneration in vivo (Schwab and others, Physiol. Rev., t, 1996, s-370). The results of testing different domains of the molecule NogoA on the ability to inhibit neurite outgrowth was described several domains, possessing inhibitory activity (Chen et al Nature, t, 2000, s-439; GrandPre and others, Nature, t, 2000, s-444; Prinjha, and others, Nature, t, 2000, p.383-384; see also the detailed analysis in Example 1).

Natural immunoglobulins, or antibodies, as a rule, are Y-shaped multi-dimensional molecules with antigennegative site at the end of each upper "shoulder". The rest of the structure, in particular the trunk Y, performs the inherent immunoglobulin effector functions. The antibody molecule consists of two heavy and two light chains. Both heavy and light chains have variable domain and a constant part. Antigennegative site consists of a variable domain of the heavy chain associated with the variable domain of the light chain. The variable domains of the heavy and light chains have the same General structure. More specifically, antigennegative properties antibodies essentially determined by the three specific regions of the variable domain of the heavy and light chains, which are called hypervariable sites or areas, determining the complementarity of antibodies to the antigen (CDR). These three hypervariable area alternate with four frame sections (FR), serial is a major which have a relatively conservative in nature; direct participation in the linking frame sections do not accept. CDRs form loops and are held at a short distance from each other of the frame sections, which are largely attended a conformation β-layer. Essentially, the heavy chain CDR with CDR associated light chain and are antigennegative website molecule antibodies. What portion of the antibody is a framework (FR)and which defines the complementary antibodies to the antigen (CDR), usually revealed by comparing the amino acid sequences of multiple antibodies, obtained from the same species. General rules identify areas CDR and FR are well known specialist in this field, and can be found on the Internet, for example, on the website (http://www.bioinf.org.uk/abs/).

Unexpectedly it was discovered that the new mouse monoclonal antibodies (hereinafter referred to as "11C7") to a fragment of the polypeptide NogoA rat (SEQ ID NO:1), related to the type IgG1, have better properties than the previously obtained antibodies to NogoA, especially in relation to the affinity of binding with NogoA various species, including humans, and in relation to higher activity, aimed at neutralizing ability NogoA to suppress neurite outgrowth at a given concentration of the antibodies. Moreover, it is possible to construct other binding NogoA the Molek is s, having the same hypervariable sites, as the above-mentioned antibodies.

Thus, the present invention presents molecules that bind specific areas or epitopes NogoA (referred to in this "binding molecules according to the invention" or simply "binding molecules"). Binding molecules according to the invention preferably bind NogoA_623-640 people (ontological fragment to which the obtained antibodies S; = SEQ ID NO: 6), NiG-D20 person (orthological the smallest fragment NogoA retaining the ability to inhibit neurite outgrowth, SEQ ID NO: 24), human NogoA (SEQ ID NO: 5) or NiG man (who is the most powerful on the degree of suppression of neurite growth in the fragment NogoA, starting with amino acid at position 186 and ending with amino acid at position 1004 sequence of the human NogoA, SEQ ID NO: 5) with the dissociation constant (Kd)<1000 nm, more preferably with a Kd < 100 nm, and most preferably with a Kd < 10 nm. The binding reaction can be demonstrated using standard methods (qualitative methods), including, for example, a method of enzyme immunosorbent assay (ELISA)described in Example 6, and the method of determining the affinity of complementary interactions using the biosensor described in Example 7. In addition, binding to the human NogoA and, what is more important is, its effectiveness can be demonstrated in the test of neurite growth, for example, as described below.

Thus, in another preferred embodiment of the present invention the binding molecule (in a concentration of 1 mg/ml, or more preferably, in a concentration of 0.1 mg/ml, but most preferably in a concentration of 0.01 mg/ml culture medium) increased the number of neurites in granular cells of the cerebellum of the rat, growing on the substrate representing a protein extract of the spinal cord of the rat, at least 20%, preferably 50%and most preferably 100%, compared with the number of neurites in granular cells of the cerebellum of the rat, which are processed by the control antibody, which is not associated with human NogoA, NiG human NiG-D20 person or polypeptide NogoA_623-640 (i.e. have a dissociation constant >1000 nm).

In another preferred embodiment, binding molecules according to the invention have at least one antigennegative website, which includes sequentially hypervariable region CDR1-X, CDR2-X and CDR3-11C7, where CDR1-S has the amino acid sequence of SEQ ID NO:8, CDR2-S has the amino acid sequence of SEQ ID NO:9 and a CDR3-S has the amino acid sequence of SEQ ID NO:10; and their direct equivalents.

Another object of the invention proposed svyazyvayus the molecules according to the invention, having at least one antigennegative a website that contains or

a) sequentially hypervariable region CDR1-X, CDR2-X and CDR3-S where CDR1-S has the amino acid sequence of SEQ ID NO:8, CDR2-S has the amino acid sequence of SEQ ID NO:9 and a CDR3-S has the amino acid sequence of SEQ ID NO:10, or

b) sequence hypervariable region CDR1'-S, CDR2'-S and CDR3'-11C7, where CDR1'-S has the amino acid sequence of SEQ ID NO:11, a CDR2'-S has the amino acid sequence of SEQ ID NO:12, and CDR3'-S has the amino acid sequence of SEQ ID NO:13, or

in their direct equivalents.

Another object of the present invention are binding molecules according to the invention, containing at least

a) a first domain comprising sequentially hypervariable region CDR1-X, CDR2-X and CDR3-S where CDR1-S has the amino acid sequence of SEQ ID NO:8, CDR2-S has the amino acid sequence of SEQ ID NO:9 and a CDR3-11C7 has the amino acid sequence of SEQ ID NO:10, and

b) a second domain comprising sequentially hypervariable region CDR1'-S, CDR2'-S and CDR3'-S where CDR1'-S has the amino acid sequence of SEQ ID NO:11, a CDR2'-S has the amino acid sequence of SEQ ID NO:12 and CDR3'-S has the amino acid sequence of SEQ ID NO:13, or

in their direct equivalents.

Also what about the, the present invention also provides a binding molecule according to the invention, containing at least one antigennegative website, including

a) or the variable part of the heavy chain C (SEQ ID NO:2); or

b) the variable part of the light chain C (SEQ ID NO:3), or their direct equivalents.

When antigennegative the site includes both the domain and the first and second - they can reside on the same polypeptide molecule or, more preferably, at different, while the first domain is part of the heavy chain of the immunoglobulin or its fragment, and the second domain is a part of the light chain of the immunoglobulin or its fragment.

Examples of binding molecules according to the invention include antibodies produced by b-cells or cells hybridoma, hybrid or humanized antibodies, or any fragments thereof such as F(ab')2; and Fab fragments and single-chain antibodies or antibodies with a single domain.

Single-chain antibodies are composed of variable domains of heavy and light chains covalently linked by linker peptide, usually consisting of 10 to 30 amino acids, preferably from 15 to 25 amino acids. So this structure does not include a constant part of the heavy and light chain, and antigenicity of peptide spacer small size is lower than the antigenicity of the whole con is Tannoy part. Under "hybrid antibody" refers to an antibody in which the constant region of the heavy chain or the constant region of light chain, or the constant region of both chains are of human origin, while the variable domains of the heavy chain and light chain are in origin is not human, such as mouse. By "humanized antibody" refers to an antibody in which hypervariable region (CDR) are in its origin is not human, such as mouse, while all or substantially all of the remaining parts of the immunoglobulin, i.e. constant region and a highly conserved part of the variable domains, for example the frame region are of human origin. Humanitariannet antibody, however, can save a few amino acids of murine sequence in parts of the frame areas adjacent to the hypervariable regions.

Hypervariable region may be associated with any kind of frame section, preferably mouse or human origin. Suitable for this purpose, the frame region described by Kabat and others in the book, Sequences of proteins of immunological interest (U.S. Department of health and human services U.S. public health Service, national institutes of health). The constant part of a human heavy chain binding is of Alakul preferably refers to the type IgG4, including subtypes, the constant part of a human light chain preferably is of type κ or λbut more preferably of type κ.

Monoclonal antibody to human protein can be obtained, for example, in mice, but the direct consequence of this method of obtaining is that xenogenic antibody when injected into the human organism will cause adverse immune reaction, which is carried out mainly with the participation of the constant part of xenogeneic immunoglobulin. Such antibodies can be entered in a long time, which naturally limits their application. It is therefore particularly preferable to use single-chain antibodies, antibody single-domain hybrid antibodies or humanized antibodies that with low probability will cause significant allogeneic response when administered to humans.

In light of the above, more preferred binding molecules according to the invention are selected from hybrid antibodies, which contain at least

a) one heavy chain immunoglobulin or its fragment with (1) a variable domain comprising sequentially hypervariable region CDR1-X, CDR2-X and CDR3-X, and (2) the constant part of the heavy chain of the immunoglobulin or its fragment, which CDR1-S has the amino acid on sledovatelnot SEQ ID NO:8, CDR2-S has the amino acid sequence of SEQ ID NO:9 and a CDR3-S has the amino acid sequence of SEQ ID NO:10, and

b) one light chain immunoglobulin or its fragment with (1) a variable domain comprising sequentially hypervariable region CDR1'-S, CDR2'-S and CDR3'-S, and (2) the constant part of a human light chain or fragment, where CDR1'-S has the amino acid sequence of SEQ ID NO:11, a CDR2'-S has the amino acid sequence of SEQ ID NO:12 and CDR3'-11C7 has the amino acid sequence of SEQ ID NO:13, or

their direct equivalents.

Alternatively, the binding molecules according to the invention can be a single-chain binding molecule which has antigennegative site containing

a) a first domain comprising sequentially hypervariable region CDR1-11C7, CDR2-11C7 and CDR3-11C7, where CDR1-11C7 has the amino acid sequence of SEQ ID NO:8, CDR2-11C7 has the amino acid sequence of SEQ ID NO:9 and a CDR3-11C7 has the amino acid sequence of SEQ ID NO:10, and

b) a second domain comprising sequentially hypervariable region CDR1'-11C7, CDR2'-11C7 and CDR3'-11C7, where CDR1'-11C7 has the amino acid sequence of SEQ ID NO:11, a CDR2'-11C7 has the amino acid sequence of SEQ ID NO:12 and CDR3'-11C7 has the amino acid sequence of SEQ ID NO:13, and

C) linker peptide that binds or N-conc is m first domain and a second domain, or With the end of the first domain and the N-end of the second domain; or

their direct equivalents.

It is well known that small changes in amino acid sequence, such as deletions, additions or substitutions of one or several amino acids, can lead to the formation of allelic forms of the original protein, which have essentially the same properties. Thus, the term "their direct equivalents" means, or any binding molecule according to the invention with a single domain (molecule X),

(1) in which each of the hypervariable regions CDR1, CDR2 and CDR3 binding molecule is at least 50 or 80% homologous, preferably at least 90% homologous, but most preferably at least 95, 96, 97, 98, 99% homologous equivalent hypervariable regions CDR1-11C7 (SEQ ID NO:8), CDR2-11C7 (SEQ ID NO:9) CDR3-11C7 (SEQ ID NO:10), whereas CDR1 equivalent CDR1-11C7, CDR2 equivalent CDR2-11C7 and CDR3 equivalent CDR3-11C7; and

(2) which is able to contact the human NogoA, NiG human NiG-D20 person or NogoA_623-640 person, preferably with a dissociation constant (Kd)<1000 nm, more preferably with a Kd < 100 nm, but is most preferably with a Kd<10 nm, or

any binding molecule according to the invention, having at least two domains in each binding site (molecule X'),

(1) in which each of the hypervariable region is th CDR1, CDR2, CDR3, CDR1', CDR2' and CDR3' binding molecules, at least 50 or 80% homologous, preferably at least 90% homologous, but most preferably at least 95, 96, 97, 98, 99% homologous equivalent hypervariable regions CDR1-X (SEQ ID NO:8), CDR2-11C7 (SEQ ID NO:9), CDR3-11C7 (SEQ ID NO:10), CDR1'-11C7 (SEQ ID NO:11), CDR2'-11C7 (SEQ ID NO:12) and CDR3'-11C7 (SEQ ID NO:13), whereas CDR1 equivalent CDR1-11C7, CDR2 equivalent CDR2-11C7, CDR3 equivalent CDR3-11C7, CDR1' equivalent CDR1'-11C7, CDR2' equivalent CDR2'-11C7, CDR3' equivalent CDR3'-11C7; and

(2) which is able to contact the human NogoA, NiG human NiG-D20 person or NogoA_623-640 person, preferably with a dissociation constant (Kd)<1000 nm, more preferably with a Kd < 100 nm, but is most preferably with a Kd < 10 nm.

In other embodiments, implementation of the present invention in, for example, offers a linking molecule that is able to contact the human NogoA, human NiG, human NiG-D20 or human NogoA_623-640 with a dissociation constant < 1000 nm and has at least one antigennegative website, which includes, or

- consistently hypervariable region CDR1, CDR2 and CDR3, each of which is homologous to at least 50%and preferably at 80, 90, 95, 96, 97, 98, 99% the corresponding equivalent hypervariable region CDR1-11C7 (SEQ ID NO:8), CDR2-11C7 (SEQ ID NO:9) and CDR3-11C7 (SEQ ID NO:10); or

- sequence is correctly hypervariable region CDR1', CDR2' and CDR3', each of which is homologous to at least 50%and preferably at 80, 90, 95, 96, 97, 98, 99% the corresponding equivalent hypervariable region CDR1'-11C7 (SEQ ID NO:11), CDR2'-11C7 (SEQ ID NO:12) and CDR3'-11C7 (SEQ ID NO:13).

In addition, the binding molecule is able to contact the human NogoA, human NiG, human NiG-D20 or human NogoA_623-640 with a dissociation constant < 1000 nm and contains

first antigennegative site that contains one hypervariable region CDR1, CDR2 and CDR3, each of which is homologous to at least 50%and preferably at 80, 90, 95, 96, 97, 98, 99% the corresponding equivalent hypervariable region CDR1-11C7 (SEQ ID NO:8), CDR2-11C7 (SEQ ID NO:9) and CDR3-11C7 (SEQ ID NO:10); and

second antigennegative site that contains one hypervariable region CDR1', CDR2' and CDR3', each of which is homologous to at least 50%and preferably at 80, 90, 95, 96, 97, 98, 99% the corresponding equivalent hypervariable region CDR1'-11C7 (SEQ ID NO:11), CDR2'-11C7 (SEQ ID NO:12) and CDR3'-11C7 (SEQ ID NO:13).

The dissociation constant can be easily checked by various methods, including, for example, the method of determining the affinity of binding using a biosensor described in Example 7. In addition, binding effect and functioning of the binding molecules can be demonstrated in a biological sample, for example, as is isano below.

The constant part of the heavy chain of human immunoglobulin may be of type γ1, γ2, γ3, γ4, α1, α2, δ or ε, preferably of type γbut more preferably of type γ4, and the constant part of the light chain of human immunoglobulin may be of type κ or λ (which includes the subtypes λ1 that λ2 and λ3), but preferably of the type κ. Amino acid sequences of all these constant parts are presented in the work of Kabat and others (see above).

Conjugates binding molecules according to the invention, for example, enzymes, or toxins or radioisotopes also beyond the boundaries of the entity and is included in the scope of claims of the invention.

The term "polypeptide", if there is no other way of doing it, refers to any peptide or protein representing amino acids connected to each other by peptide bonds having the amino acid sequence starting at N-end and ending at the C-end. Preferably the polypeptide of the present invention is a monoclonal antibody, more preferably a hybrid (with variable domains of murine origin) or humanitariannet (CDR mouse origin) monoclonal antibody. Humanitariannet monoclonal antibody is optional mutations introduced in the sequence of frame the area of the (FR) acceptor antibody.

In the context of the present description, the term "functional derivative polypeptide" refers to a molecule, possessing qualitatively the same with the polypeptide according to the present invention, biological activity, i.e. the ability to communicate with the human NogoA, human NiG, human NiG-D20 or human NogoA_623-640. Functional derivatives include fragments and peptide analogs of the polypeptide in accordance with the present invention. Fragments include areas included in the sequence of the polypeptide in accordance with the present invention, for example, a certain sequence. The term "derivative" is used to refer to amino acid sequence variants and covalent modifications of the polypeptide in accordance with the present invention, for example, a defined sequence. Functional derivatives of the polypeptide in accordance with the present invention, for example, a defined sequence, for example hypervariable region of the light and heavy chains, homologous amino acid sequence of the polypeptide of the present invention, for example, a defined sequence at least about 65%, more preferably at least about 75%, even more preferably at least about 85%, but most preferably, m is Nisha least about 95, 96, 97, 98, 99%, and essentially retain the ability to bind to the human NogoA, human NiG, human NiG-D20 or human NogoA_623-640.

The term "covalent modification" refers to modifications of the polypeptide in accordance with the present invention, such as sequence or its fragment with organic protein or non-protein-modifying reagent, for fusion with heterologous polypeptide sequences and post-translational modifications. Covalently modified polypeptides, for example, a given sequence retains the ability to bind to the human NogoA, human NiG, human NiG-D20 or human NogoA_623-640 through the formation of cross-links. Covalent modifications are traditionally introduced by implementing the response of certain amino acid residues with an organic modifying agent, which is able to react with the selected lateral or terminal residues, or through mechanisms of post-translational modifications that function in selected recombinant cell hosts. Certain post-translational modifications are the result of exposure to recombinant host cells for expressing the polypeptides. Glutaminase and asparaginase remains frequent is subjected to posttranslational dezaminirovanie in appropriate glutaminase and aspartate residues. Alternatively, these residues desabilitada in slightly acidic conditions. Other post-translational modifications include hydroxylation of Proline or lysine, phosphorylation of hydroxyl groups of the residues was serila, tyrosine or threonine, methylation α-amino group of the side chains of lysine, arginine and histidine (see, e.g., Creighton, Proteins: Structure and Molecular Properties, W.H.Freeman & Co., San Francisco, 1983, s-86). Covalent modifications include, for example, fused hybrid (or chimeric) proteins, a component of which is a polypeptide in accordance with the present invention, for example, a given sequence or variants of this amino acid sequence, such as immunoadhesins, and N-terminal joining heterologous signal sequences.

"Homology" in the context of the present description with reference to the native polypeptide and its functional derivative is defined as the percentage of amino acid residues in the analyzed sequence that are identical with the residues of a corresponding native polypeptide, after aligning the sequences and, if necessary, fill gaps to achieve the maximum percent homology, and any conservative substitutions are not considered as part of the identity of the sequence. Either N - or C-terminal extensions, newstake will not be construed as elements, reducing identity or homology. Comparison methods designed for this computer programs well known to the specialists working in this field.

The term "amino acid(s)" refers to all natural L-α-amino acids, for example, including D-amino acids. To denote amino acids using well-known one - and three-letter designation.

The term "variant amino acid sequences" refers to molecules with some differences in their amino acid sequences compared to the polypeptide in accordance with the present invention, for example with a given sequence, which still have the ability to contact human NogoA or NiG man, but more preferably NogoA_623-640. Options for replacement are those cases in which the polypeptide in accordance with the present invention, for example in sequence at least one amino acid residue is deleted, and replaced in the same position inserted another amino acid. Such replacement may be single when in a molecule were replaced by only one amino acid, or multiple, when in the same molecule are substituted two or more amino acids. Insertional variants are variants in which the polypeptide in accordance with the crust is Asim invention, for example, in sequence produced by inserting one or more amino acids at a position adjacent to the amino acid located in position. Directly adjacent to the amino acid means joining functional α-carboxyl or α-amino group of amino acids. Deletion variants are variants in which the polypeptide in accordance with the present invention, for example, from a given sequence, removed one or more amino acids. Usually in deletion variants produced by deleting one or more amino acids in a specific region of the molecule.

The binding molecule according to the invention can be produced using recombinant DNA technology. Because of this, shall be constructed of one or more DNA molecules encoding the binding molecule, then they must be linked with appropriate regulatory sequences and transferred for expression in suitable for these purposes, the host organism.

In the most General terms respectively are available:

(1) a DNA molecule encoding a binding molecule according to the invention, having a single domain, single-stranded binding molecule according to the invention, a heavy or light chain binding molecules according to the invention or their fragments, and

p> (2) application of DNA molecules according to the invention for obtaining a binding molecule according to the invention recombination methods.

Current state of Affairs in this area is that in the presence of the information presented by a qualified specialist can synthesize DNA molecules according to the invention, i.e. the amino acid sequence of hypervariable sites and DNA sequences of their coding. Method design variable domains of the gene are described, for example, in EP 239400 and can be briefly summarized as follows: clone the gene encoding the variable domain of the monoclonal antibody of any specificity. Define segments of DNA encoding a frame part and a hypervariable region, and the DNA segments encoding the hypervariable region is removed so that the merged segments of DNA coding frame region, with the formation of convenient restriction sites in the joints. These restriction sites can be formed in certain provisions of the standard means of mutagenesis of the DNA molecule. Synthesize sets of double-stranded CDR having the sequence CDR1-11C7, CDR2-11C7, CDR3-11C7, CDR1'-11C7, CDR2'-S and CDR3'-11C7. Receive fragments with sticky ends, through which they can be legirovanyh to frame region according to the standard Protocol of obtaining Panora the dimensional DNA molecules encodes a variable domain of immunoglobulin.

In addition, to obtain a recombinant DNA that encodes a monoclonal antibody according to the invention, having access to the mRNA MCAT-secreting pituitary hybridoma is not required. For example, PCT application WO 90/07861 contains full instructions, sufficient to obtain monoclonal antibodies using recombinant DNA technology if there is only written information about the nucleotide sequence of a gene.

The method involves the synthesis of a set of oligonucleotides, amplification by polymerase chain reaction (PCR) and splicing with the desired DNA sequence.

The expression vectors with comfortable promoter or the genes encoding the heavy and light chain constant parts of immunoglobulins, public. Thus, it is only necessary to obtain a DNA molecule according to the invention, and it can be easily transferred into the appropriate expression vector.

DNA molecules encoding single-chain antibodies, can also be obtained by standard methods, for example as described in WO 88/1649.

In the private embodiment of the present invention the means of recombinant technology used to obtain some of the binding molecules according to the invention include constructing the first and second recombinant DNA, as described below:

First what I recombinant DNA encodes a heavy chain or a fragment and contains:

(a) a first part which encodes a variable domain comprising alternating frame and hypervariable region, and the hypervariable region are sequentially DNA-CDR1-S (SEQ ID NO:15), DNA-DR2-S (SEQ ID NO:16) and DNA DR3-S (SEQ ID NO:17); this first part starts with a codon encoding the first amino acid of the variable domain, and ends with a codon encoding the last amino acid of the variable domain, and

(b) a second part encoding a heavy chain constant part or fragment, which starts with a codon encoding the first amino acid of the constant part of the heavy chain, and ends with a codon encoding the last amino acid of the constant part or fragment, followed by Nesmelova (non-coding) codon.

The second portion preferably encodes a constant part of the heavy chain of human immunoglobulin, more preferably the constant part of the γ4 chain of human immunoglobulin. The second part may be a fragment of genomic DNA (including introns) or cDNA fragment (without introns).

The second recombinant DNA encodes a light chain or fragment and contains:

(a) a first part which encodes a variable domain containing alternating frame and hypervariable region, and the hypervariable region are posledovatel is but DNA-CDR1'-11C7(SEQ ID NO:17), DNA-CDR2'-11C7(SEQ ID NO:18) and DNA DR3'-S (SEQ ID NO:19); this first part starts with a codon encoding the first amino acid of the variable domain, and ends with a codon encoding the last amino acid of the variable domain, and

(b) a second part encoding a light chain constant part or fragment, which starts with a codon encoding the first amino acid of the constant part of the light chain and ends with a codon encoding the last amino acid of the constant part or fragment, followed by non-coding codon.

The second portion preferably encodes a constant part of the light chain of human immunoglobulin, more preferably the constant part of the chain of human immunoglobulin.

The first or second recombinant DNA preferably have the third part, which is to the first part and encodes part of the leader peptide; this third part starts with a codon encoding the first amino acid leader peptide, and ends with a codon encoding the last amino acid leader peptide. This peptide required for secretion of the circuits of the host organism in which they are expressed, after which the peptide is removed by the host organism. Preferably the third part of the first recombinant DNA encodes the leader peptide, amino acid sequence which is essentially Ident is CNA amino acid sequence of the leader peptide of the heavy chain, as shown in SEQ ID NO:21 from amino acid at position 19 and ending with amino acid at position - 1). Also preferably, the third part of the second recombinant DNA encodes the leader peptide, amino acid sequence of which is shown in SEQ ID NO:23 (light chain, starting with amino acid at position 18 and ending with amino acid at position - 1).

Each of the recombinant DNA molecule is placed under the control of suitable regulatory sequences, particularly under the convenient control of the promoter. Can be used any promoter, provided that it is adapted to the host organism, which will be transferred recombinant DNA for expression. However, if the expression in the cell of a mammal, particularly preferable to use a promoter immunoglobulin gene.

The desired antibody can be obtained in cell culture or in transgenic animal. Suitable for these purposes, the transgenic animal can be obtained using standard methods, which include microinjection into oocytes first and second recombinant DNA, placed under the control suitable for this purpose regulatory sequences, transferring the thus obtained oocytes suitable pseudoriemannian females and selection of progeny expressing the desired antibody.

<> If you receive or antibody-based test circuits in cell culture, recombinant DNA must first be inserted into a single expression vector, or two different, but compatible expression vector, the latter option is preferred.

Accordingly, the invention also features an expression vector capable of replication in a prokaryotic or eukaryotic cells and carrying at least one of the recombinant DNA described above.

Each expression vector containing the recombinant DNA is then transferred into suitable for this purpose, the host organism. When recombinant DNA separately inserted into two expression vector, they can be transferred separately, i.e. each cell contains a vector of the same type, or in conjunction, the latter option is preferred. The host organism may be a bacterial cell, yeast cell or cell line of a mammal, the latter option is preferred. More preferably, if mammalian cells are of lymphoid origin, such as myeloma cells, hybridoma or normal human b-cells, if they are not expressed heavy or light chain of endogenous antibodies.

Also preferably, the cell of the host organism contained a large number of copygator. If the host organism is used, the cell of the mammal, this goal can be achieved by increasing the copy number of standard means. Methods of amplification typically include selection on the basis of increased resistance to the drug substance, if the resistance is encoded by the expression vector.

Another object of the present invention is a method for mnogosetochnykh binding molecules according to the invention, which comprises (1) culturing an organism which is transformed first and second recombinant DNA according to the invention and (2) isolation from the culture of active binding molecules according to the invention.

Alternatively, the heavy and light chains can be selected separately and restored in the active binding molecule as a result of refolding in vitro. Recovery methods well known to the specialists working in this field. Examples of methods, in particular, are given in EP 120674 or in EP 125023. Therefore, the method can also include the

(1) cultivation of the first body, which is subjected to transformation of the first recombinant DNA according to the invention, and the selection of the desired heavy chain or fragment from the culture and

(2) the cultivation of the second body, which is subjected to a second transformation of recombinant DNA according to the invention, and the selection of the desired light chain or afragment of culture and

(3) the restoration of in vitro active binding molecules according to the invention of the heavy chain or fragment obtained in (1), and light chain or fragment obtained in (2).

Similarly also proposes a method of obtaining single-stranded binding molecule or binding molecule with one domain according to the invention, including

(1) cultivation of the body, which is subjected to transformation of recombinant DNA that encodes a single-stranded respectively binding molecule or binding molecule with one domain according to the invention, and

(2) the allocation of the specified molecule from the culture.

Binding molecules according to the invention have a very good neuro-restorative effect, as shown, for example, on the model of neurite growth of granular cells.

1. Assessment of neurite growth in granular cells of the cerebellum (in vitro)

Neurite outgrowth of dissociated granular cells of the cerebellum estimate, as described in the work Niederost, etc., J. Neurosci., t, 1999, s-8989. A brief description of the method: decapitating at 5-7-th day after birth in rats delete the cerebellum and the resulting material is treated with trypsin. To reduce the content of fibroblast cells pre-seeded on Petri dishes. Then to each well (the surface of the hole 1 cm2) 4-hole culture tablet Greiner (Huber & AG, Rheinach, Basel, the Seam is Rebecca) seeded at 75,000 cells and cultured in Neurobasal medium with B27 instead of serum (Invitrogen). The surface of the cups cover poly-L-lysine (Sigma). In each well contribute 0.5-8 µg of protein material extracted 3-[(cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS) from a homogenate of whole spinal cord of adult rats using the method Spillmann, etc., J. Biol. Chem., t, 1998, s-19293; Cup incubated over night at 4°and washed. Then, the binding molecules according to the invention preincubated 30 min on the test substrate, and is removed before adding cells. Granular cells of the cerebellum is added and incubated for 24 hours To stop the experiment in the culture Cup slowly add 2 ml of 4% formaldehyde in buffer. Then culture stained by immunofluorescence dye for detection of neuron-specific protein 43 associated with the growth of neurons (GAP), and Hoechst dye, coloring the cell nucleus (stained nucleus granular cells, to see whether all cells have the neurites, which, in turn, are rendered anti-GAP-43). At a certain distance from the top, bottom and side edges of each well make some photos (the choice of frames is random), using fluorescent Axiophot microscope with a 40x lens Zeiss. On randomized photos with numbered codes consider all neurites in the field of view. Answer (neurite outgrowth of granular cells) hung the t dose in the range of from about 0.1 to 10 μg total protein per well (specific activity of the drug varies in the interval).

You can see an increase in the growth of neurites granular cells of the cerebellum, located in nopermission environment created by the extract of the spinal cord, prepared as described above, due to the inactivated cells with a binding molecule according to the invention. An example of a typical profile of the neutralizing effect of murine antibody 11C7-IgG1 on the model of neurite growth in granular cells following:

Study 1
Rat myelin (1 µg per well)
The number of neurites in the field of viewPercentage
without antibodies80,5100%
+IgG mouse86,5108%
S 250 µg/ml160199%
Study 2
Rat myelin (8 μg per well)
(drug 2)The number of neurites in the field of viewPercentage
without antibodies20100%
+IgG mousethe 17.386.5%
S 250 µg/ml31155%
S 75 µg/ml26130%
S 7,5 mg/ml26130%

The neutralizing activity of the molecules according to the invention can also be determined by measuring the regenerative sprouting and growth of neurites on the model spinal cord injury in vivo:

2. Model spinal cord injury (in vivo)

Adult rats breed Lewis was applied microsurgical injured by bilateral dissection of the dorsal part of the spinal cord at the level of the 8th thoracic vertebra. Laminectomy, anesthesia and surgery described by Schnell and Schwab in Eur. J. Neurosci., volume 5, 1993, s-1171. The control and the binding molecules according to the invention was used in two different ways: either by implantation of 106fresh hybridoma cells on one side of the cortex (grafted animals), or, alternatively, by implantation of ventricular cannula connected to an implanted subcutaneously 2-ml Alzet pump (Alza Corporation, Palo Alto) ("pumping" animals). Animals inoculated with the hybridoma cells to suppress immune responses in rats within 7-10 days was administered cyclosporine A; 14 days after spinal cord injury, rats were killed by intracardiac the introduction of a 4% solution of formalin in the buffer. Pumping animals: binding molecules of the invention (for example, at a concentration of 3.3 mg/ml for mouse S) was filled with 2 ml pumps, which gave the drug in the lateral ventricle at a rate of 0.5 μl/h for 2 weeks. Was nasosinusal at the time of spinal cord injury, after 2 weeks, rats were killed.

Neuroanatomy monitoring: monitoring of motor and sensory kortiko-spinal tract (CRP) was performed, inhazinue anterograde Biotin-dextran-amine label (BDA) into the bark on the side opposite the location of the pump or implantable cells. BDA was transported to the spinal cord for 10-14 days and was visualized using diaminobenzidine (DAB) as substrate, as described in the work Brosamle and others, J. Neurosci., t.20, 2000, s-8068.

Evaluation of anatomic results: have used two valuation method is semi-quantitative and quantitative. Semi-quantitative assessment of the intensity of sprouting and regeneration: the complete series of sagittal sections of animals encoded numbers and randomly mixed, were evaluated for the presence and density of regenerating processes located Rostral towards the injury site, using the following definitions: regenerating shoots are fibers emerging from CRP cut; it's a long, uneven processes, much less branched than normal collaterals gray matter, they grow in the direction of the hearth damage, as well as ventral or lateral around him. Regenerating shoots are often end-cone growth, which can be small and lukamizeroni or large and branched. P is otnesti growth is measured on a scale from 0 to 3 for each animal. - Remote regeneration: fiber, which can be traced through the hearth damage to the caudal spinal cord, considered remote regenerating fibers. The maximum distance from fire damage can be measured, but often there are some intact fibers from a small ventral cord CRP; their branches are mixed with branches regenerating neurites, which complicates the recognition of those and others.

Counting fibers (quantitative method): line, located at a distance of 0.5 mm rostralnie end cut CRP, is superimposed on the alternating slices of gray matter, and counted all intersections with fibers CRP (normal collaterals or bone). Similar lines are superimposed Caudalie the injury site at a distance of +0.5, and +2 and +5 mm from the center of the damage. Intersecting fibers are counted, and the amount is added 3 levels to get the number of fibers CRP in the caudal part of the spinal cord. These caudal fibers are classified by the number of fibers at a distance of-0.5 mm rostralnie the end of the CSD to obtain the ratio.

2 weeks after spinal cord injury, destroying about 40% of the segment T8 spinal cord, mainly in the dorsal part, including both major CRP, visualization CRP control animals reveals cf the working day the degree of reactive growth. This phenomenon corresponds to the spontaneous growth in response to damage, well known in literature. The injured rats that receive a binding molecule according to the invention or which are implanted pumps that deliver a binding molecule according to the invention may be reinforced sprouting and regeneration of neurites in the hearth damage.

Thus, the invention also features:

(1) the use of binding molecules according to the invention for the recovery of the nervous system of a mammal, in particular human nervous system,

(2) method of recovery of the nervous system of a mammal, in particular human nervous system, which includes the introduction of an effective amount of a binding molecule according to the invention to a patient in need of such treatment, or

(3) a pharmaceutical composition for the recovery of the nervous system of a mammal, in particular human nervous system, which contains binding molecules according to the invention and a pharmaceutically acceptable carrier or diluent.

More specifically, the binding molecules according to the invention is useful for the regeneration and improvement of sprouting of neurites after damage to the nerve fibers. Thus, molecules according to the invention can find wide application, in particular for the treatment of humans. For example, binding molecules according to the invention is Olesky for the treatment of various diseases of the peripheral nervous system (PNS) and Central nervous system (CNS), ie, more specifically, neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, the disease is diffuse Taurus levy and other types of dementia, the consequences of traumatic brain or spinal injury, stroke or demyelinating diseases. To demyelinization diseases include, without limitation, multiple sclerosis, monophasic demyelination, encephalomyelitis, multifocal leucoencephalopathy, panencephalitis, disease Marchiafava, and also differing sets, Pontigny myelinolysis, adrenoleukodystrophy, disease, Pelizaeus-Merzbacher, spongy degeneration, Alexander disease, Canavan disease, metachromatic leukodystrophy and Krabbe disease. In one example, the introduction of binding molecules according to the invention can be used for the treatment of demyelinating diseases associated with protein NogoA. In another example, cells expressing the binding molecules according to the invention can be transplanted into the injury site of the spinal cord to stimulate sprouting of neurites into the injury site. The transplanted cells will contribute to the recovery of spinal cord function after damage or injury. Such cells can include cells of the olfactory shell glia, stem cells of different origin or fetal transpl ntati nerve fibers or fabrics.

Furthermore, the binding molecules according to the invention are useful for the treatment of degenerative eye diseases that can be directly or indirectly related to the degeneration of the cells of the retina or the cornea of the eye, including ischemic retinopathy, ischemic neuropathy anterior part of the optic nerve, and all forms of inflammation of the optic nerve associated with age-related macular degeneration, diabetic neuropathy, fighting cystic macular edema, pigmentary pigmentosa, disease of Stargardt, hereditary macular degeneration syndrome (best), Leber's congenital amaurosis and other hereditary degenerative retinal disorders, pathological myopia, retrolateral fibroplasia syndrome (Terry) and hereditary pathology of the optic nerve's, long-term effects of transplantation of the cornea or corrective refractive surgery on the cornea, herpetic keratitis.

In addition, it was shown that NogoA plays a role in the pathogenesis of mental illness, in particular schizophrenia and depression. Therefore, the binding molecules according to the invention are useful for the treatment of mental illness, in particular schizophrenia and depression.

Binding molecules according to the invention can be produced in the form of monotherapy, or as part of combination products, or for consistent application of the combination with other agents. For example, after a stroke or spinal cord injury, binding molecules according to the invention can be introduced in combination with anti-inflammatory agents, including, without limitation, corticosteroids, as a means of blocking further neuronal damage and suppress the regeneration of neurites; for the treatment of neurodegenerative diseases, binding molecules according to the invention can be combined with neurotropic factors, such as NGF, BDNF, or other medicines for the treatment of neurodegenerative diseases, such as Exelon™ or levodopa. In the context of the present description on the joint use of the two agents, say in the case when these two agents are administered simultaneously or independently from each other, but so that they have exerted their action at the same time.

For the treatment of mental illness, in particular schizophrenia and depression, the binding molecules according to the invention can be manufactured in the form of monotherapy or in a combined drug, in particular, with other agents selected from the group comprising (a) antiepileptic drug selected from the group including barbiturates and their analogues, benzodiazepines, carboxamides, hydantoins, suktinimida, valproate acid and other derivatives of fatty acids and others V. the epileptic drugs (b) conventional antipsychotic drugs, (b) atypical antipsychotics and antidepressants.

The term "barbiturates and their derivatives" in the context of the present description refers, without limitation, phenobarbital and primidone. "Benzodiazepines" in the context of the present description include, without limitation, clonazepam, diazepam and lorazepam. The term "carboxamide" in the context of the present description refers, without limitation, to carbamazepine, oxcarbazepine and 10-hydroxy-10,11-dihydrocarbamazepine. The term "hydantoins" in the context of the present description refers, without limitation, to phenytoin. The term "suktinimida" in the context of the present description refers, without limitation, to tosucceed and mesuximide. The term "valproic acid and other derivatives of fatty acids" in the context of the present description refers, without limitation, sodium salt of valproic acid, hydrochloric acid to tiagabine the monohydrate and vigabatrin. The term "other antiepileptic drugs" in the context of the present description refers, without limitation, to levetiracetam, lamotrigine, gabapentin and felbamate.

The term "conventional antipsychotic drugs" in the context of the present description refers, without limitation is listed, to haloperidol and fluphenazine.

The term "atypical antipsychotics" in the context of the present description refers, without limitation, to clozaril, risperidone, olanzapine, quetiapine, ziprasidone and aripiprazole.

The term "antidepressants" in the context of the present description refers, without limitation, selective inhibitors of serotonin reuptake (SSRI) or selecting the reuptake inhibitors of serotonin and norepinephrine (SNRI). Suitable for this purpose an SSRI can be selected from the group including fluoxetine, uvoxamine, sertraline, paroxetine, citalopram and ESCITALOPRAM.

The structure of the active ingredients identified by code numbers, the generic names or trade names can be found in the current edition of the standard compendium "the Index of production of firm Merck" ("The Merck Index") or in databases, e.g. Patents International (e.g. IMS World Publications). The relevant contents of these databases included in the present description by reference. Qualified in this field specialist easily identify the active ingredients and on the basis of these links with high probability will produce and test indications and properties of a medicinal product on the standard models, both in vitro and in vivo.

For the above indications acceptable dose to which ecno, will vary depending on, for example, molecules used according to the invention, the method of administration and the nature and severity of the disease to be treated. Binding molecules according to the invention is easily injected using a pump or by injection in the form of medicines in the affected areas, for example, they can be used by intracranial injections directly into the CNS or intrathecally into the spinal column in the affected area.

The pharmaceutical compositions according to the invention can be prepared in the traditional way. For example, the composition in accordance with the invention containing molecules according to the invention, it is preferable to prepare in dried form. Just before the introduction of the drug dissolved in suitable for this purpose aqueous carrier, such as sterile water for injection or sterile physiological solution in the buffer.

In order to simplify the procedure for preparation of the respective compositions, binding molecules according to the invention and an optional second drug, amplifying the effect of the binding molecules according to the invention, can be Packed separately in the same container, they include instructions for mixing or simultaneous administration. Above are medications that can be used as long the high of the second medication.

Synergistic effect of combination of binding molecules according to the invention and growth factors such as NGF, can be demonstrated in vivo in models of spinal cord injury described above.

Brief description of figures

Figure 1. Comparison of sequences: comparison of sequences NiG different species, showing the sequence of the immunogenic peptide for monoclonal antibodies S.

The invention will be easier to understand in its entirety with reference to the following examples. However, they should not be interpreted as limiting the nature and scope of the claims of the invention.

In the following examples, the temperature is always measured in degrees Celsius (°).

Monoclonal antibody, which is the object of attention in the examples are binding molecule in accordance with the present invention, containing the variable part of the light chain (SEQ ID NO:3) and the variable part of the heavy chain (SEQ ID NO:2).

The description uses the following abbreviations:

ELISAenzyme immunosorbent analysis
FACSfluorescence-activated cell sorting
FITCthe fluorescein isothiocyanate
FBSfetal bovine serum
CMV promoter human
IgGimmunoglobulin isotype G
MCATmonoclonal antibody
PBSbuffered phosphate saline
PCRpolymerase chain reaction

Example 1

NiG-D20 (SEQ ID NO:24) is one of the fragments NogoA, are able to suppress the growth of neurites

Methods:

a) Deletion library Nogo-A in rats: deletion variants was obtained by treatment with nuclease ExonucleaseIII/Mung Bean Upset DNA Nogo-A rat internal restriction sites, followed by PCR with primers specific for Nogo-A in rats (method described in WO 00/31235): Nogo-A rat (AA 1-1163; DNA, as will be shown below with respect to the amino acid sequence of Nogo-A rat (SEQ ID NO:26), for example, AA 1-1163 means that the cDNA encodes a polypeptide that begin with amino acids 1 and ending with amino acid 1163 sequence NogoA polypeptide rats), Nogo-B rats (AA 1-172+976-1163), Nogo-C rats (N-terminal fragment 11 AA+AA 976-1163 Nogo-C rats), Nogo-66 rat (AA 1019-1083), GST-Nogo-66 rat (AA 1026-1091), NiR-G rats (AA 1-979), NiR rats (1-172), NiR-D1 rats (AA 1-31), NiR-D2 rats (AA 59-172), NiR-D3 rat (AA 1-31+59-172), EST-Nogo1 rats (AA 762-1163), NiG rats (AA 174-979), NiG-Dl rats (AA 174-909), WG-D2 rats (AA 174-865), NiG-D3 rat (AA 172-723), NiG-D4 rats (AA 172-646), NiG-D5 rats (who and 293-647), NiG-D6 rats (AA 763-975), NiG-D7 rats (AA 174-235+294-979), NiG-D8 rats (AA 218-653), NiG-D9 rats (AA 172-259+646-974), NiG-D10 rats (AA 293-979). NiG-D11 rats (AA 209-268), NiG-D12 rats (AA 198-233), NiG-D13 rats (AA 174-216), NiG-D14 rats (AA 174-260), NiG-D15 rats (AA 174-190+493-979), NiG-D16 rats (AA 174-190+621-979), NiG-D17 rats (AA 174-190+259-979), NiG-D18 rats (AA 174-190+263-979), NiG-D19 rats (AA 763-865), NiG-D20 rats (AA 544-725), NiG-D21 rats (AA 812-918), NiG-D22 rats (AA 866-975), NiG-D23 rats (AA 914-975), NiG-D24 rats (AA 544-685), NiG-D25 rats (AA 614-725), NiG-D26 rats (AA 544-613), NiG-D27 rats (AA 581-648), NiG-rat D28 (AA 614-685), NiG-D29 rats (AA 648-725), NiG-D30 rats (AA 682-725), NiG-D31 rats (AA 544-580), NiG-D32 rats (AA 581-613), NiG-D33 rats (AA 614-648), NiG-D34 rats (AA 648-685), NiG-D35 rats (AA 260-556), NiG-D36 rats (AA 260-415). NiR-G and NiR-a derived from Nogo-A-pET28 as a result of decomposition by enzymes. NiG obtained from NiR-G in the decomposition of restrictase and treatment with MungBean nuclease. NiG-D1, -D3, -D4, -D5, -D7, -D8, -D9-D10 obtained from the NiG-pET28 as a result of decomposition by enzymes. NiG-D15, -D16, -D17, -D18 obtained from the NiG-pET28 as the result of cleavage by exonuclease III. NiR-b, NiR-D1, -D2, -D3 obtained in PCR with NiR-a-pET28 as a matrix. NiG-D2, -D6, -D11, -D12, -D13, -D14, -D19, -D20, -D21, -D22, -D23, -D24, -D25-D26, -D27, -D28, -D29, -D30, -D31, -D32, -D33, -D34, -D35. -D36 obtained in PCR with NiG-pET28 as a matrix. All recombinants subcloned in plasmid RET. In all the above-mentioned recombinant molecule is a plasmid RET. Plasmid pGEX-6P used for GST-Nogo66 and plasmid RET for periplasm the political expression NiG rats. GST-Nogo-66 person (AA 1055-1120 Nogo-A person) cloned by PCR on DNA NogoA human (SEQ ID NO:4) as the matrix. Deletion variants are then cloned in plasmid vectors RET (Novagen), pGEX-6P (Amersham Pharmacia Biotech) and RET (Novagen). GST-Nogo-66 person corresponds protein GST-nogo described GrandPré and others (see above). Synthetic peptide 4 rats EELVQKYSNSALGHVNSTIKELRRL (SEQ ID NO:27) corresponds to peptide 4 (it has been shown that peptide 4 people is an inhibitory fragment of the domain of Nogo-66 (GrandPré et al., 2000)). Ontological peptide rat has a single mismatch C>S (see the sequence of peptide 4 in the work GrandPré and others 2000, see above). Synthetic peptide PSSPPPSSPPPSSPPPS with a high content of Pro/Ser (SEQ ID NO:28)and peptide 4 rats received and cleared S.A.Primm by HPLC. NogoA_623-640 human (SEQ ID NO:6) was synthesized and purified in Research Genetics Inc.

b) Creation of genetic constructs expressing Nogo-A person (pRK7-hNogo-A): screening of a cDNA library created using phage vector λ gt10 (Clontech), was performed on a dual filter set using standard procedures. Fragments of Nogo-A man amplified in PCR from cDNA of the human brain (Clontech) using standard Protocol and then was subcloned into the plasmid pBluescript was digested and allocated, or immediately used as probes for screening. Fragment XoI/Smal (400 tpd) was used as the 5'-probe, 3'-probe amplified with primers CA-NA-2F: 5'-AAG CAC CAT TGA ATT CTG CAG TTC C-3' (SEQ ID NO:29) and CA-NA-3R: 5'-AAC TGC AGT ACT GAG CTC CTC CAT CTG C-3' (SEQ ID NO:30). Selected positive clones were subclinically and confirmed the sequence. To get the full-size cDNA Nogo-A person held an Assembly of overlapping clones unique cleavage site of the restriction enzyme EcoRI in the sequence of Nogo-A man and then was subcloned into the Bluescript vector to obtain the coding sequence, named Pbsnogoa. To obtain pRK7-hNogo-A full-size cDNA was incorporated into the expression vector eukaryotic cells pRK-7 by directional cloning.

C) Creating plasmid expression vector NiG (hNiG) person (RETA-hNiG) for production in bacterial cells: encoding hNiG DNA fragment was subcloned into the BamHI/XhoI plasmid rate (Novagen) after PCR amplification of the corresponding coding region Pbsnogoa in reading frame with N-terminal His - and T7-tag for expression in bacterial cells using the primer set - direct 5'-GTC GCG GAT CCA TGG AGA CCC TTT TTG CTC TTC-3' (SEQ ID NO:31) and reverse 5'-GTT CTC GAG TTA TGA AGT TTT ACT CAG-3' (SEQ ID NO:32). The final plasmid was named pET28a-hNiG. Then hNiG expressed in E.coli BL21 pRP by induction of 1 mm isopropyl-beta-D-thiogalactopyranoside (IPGT).

d) expressing plasmids NiG-Acton (mNiG-ehop) mouse: region encoding the exon 3 of the mouse follower of the spine, amplified using primers direct 5'-GTG CGG ATC CAT GGA TTT GAA GGA GCA GC-3' (SEQ ID NO: 33) and reverse 5'-GTT TCT CGA GTG AAG TTT TAT TCA GCT C-3' (SEQ ID NO:34) and was subcloned into RETA sites BamHI/XhoI. The final plasmid was named pET28a-mNiG-exon3.

Cloning NiG monkeys: Poly(A)RNA was isolated from frozen tissues of monkeys ' brains and synthesized cDNA using oligo)dT primer. Two overlapping fragment covering the 5'- and 3'-region cDNA, amplified in PCR using specific sequences of the primers and the enzyme that checks the correct reading. Primers designed on the known cDNA sequence NiG man. For amplification of the 5'-fragment the primers used were 5'-TCCACCCCGGCCGCGCCCAA-3' (SEQ ID NO:35) and 5'-AATGATGGGCAAAGCTGTGCTG-3' (SEQ ID NO:36), for the 3'fragment 5'-GGTACAAAGATTGCTTATGAAACA-3' (SEQ ID NO:37) and 5'-AGCAGGGCCAAGGCAATGTAGG-3' (SEQ ID NO:38). Then the two fragments were subclinically and conducted analysis of the sequences of at least four independent clones obtained from each fragment. Full-size cDNA amplified in PCR of overlapping sequences using the above primers, the product was cloned and re-sequenced.

d) Obtaining recombinant proteins NogoNiG and deletion library Nogo-A, as defined above: deletion library Nogo-A expressed in Escherichia coli. Proteins were extracted by repeated about the processing ultrasound in a special buffer (20 mm Tris, 50 mm NaH2PO4, 100 mm NaCl, pH 8.0) with 0.75 mg/ml lysozyme, by solubilization with In-Per™ (Pierce) or 8 M urea. NiG, expressed with a leader sequence of pelB, was isolated from periplasmatic space according to the Protocol recommended by Novagen to cleanse periplasmatic proteins. Supernatant clones carrying recombinant DNA molecules, based on the vector RET, was purified using affinity chromatography on the Co2+-Talon™ Metal Affinity Resin (Clontech) in a static mode. Lysates, solubilization 8 M urea or Per™, transferred in adenocarinoma conditions by replacing the buffer with a buffer for ultrasonic treatment during the chromatographic procedure, which was conducted in static mode. Proteins were suirable 250 mm imidazole in buffer for ultrasonic processing on a gravity column (BioRad). Proteins NiG was further purified by gel-filtration on a Superdex 200 HiLoad 16/60. Supernatant clones carrying recombinant DNA molecules, based on the vector pGEX-6P, was purified using a column Packed with G-sepharose, in a static mode, in accordance with the instructions of the manufacturer (Amersham Pharmacia). Cleavage of GST-Nogo-66 was carried out, incubare the solubilized GST-Nogo-66 with PreScission protease, followed by purification by HPLC. Gel-electroelution recombinant Nogo protein, purified by the method of affin the th chromatography using immobilized metal ions (IMAC), conducted by the method of preparative electrophoresis in polyacrylamide gel with dodecyl-sodium sulfate and elution using the device for electroelution BioRad Electro-Eluter in a buffer containing 50 mm Tris, pH 7.4, 100 mm NaCl, and 0.2% (wt./about.) CHAPS, for 1 h at 250 mA; upon completion of 30 with changed polarity of the electrodes. The concentration of the chromatographically purified proteins was determined using dye Pierce Coomassie and BSA as a standard protein. The concentration of proteins after elution from the gel was determined by the intensity of the bands in the gels, stained with silver (see Merril and others, A rapid sensitive silver stain for polypeptides in polyacrylamide gels. Analyt.Biochem., t, 1981, s-207), with BSA as the standard.

e) Obtaining fragments of recombinant NogoA in cells SNO: NiR-G - fragment 3119 TPN, the resulting partial cleavage by the restriction enzyme HincII cDNA Nogo-A rat, cloned in the expression vector pSecTag2 (Invitrogen, Groningen, the Netherlands). Transfection of pNiR-G cells SNO led to intracellular, cytoplasmic expression of NiR-G. Stable cell line of Cho, secreting NiR-G, were selected using Zeocin concentration of 250 μg/ml (Invitrogen). Recombinant NiR-G was isolated from cell lysates on a column with Ni2+-NTA (Qiagen AG, Basel, Switzerland). NiG-D20 and Nogo-66 rat cloned in the vector pAPtag5 by PCR. Transfection of pNiG-D20-AP cells SNO led to secretion NiG-520-ARV culture supernatant. Stable cell lines pNiG-D20-AP and pNogo-66-AP were selected using Zeocin concentration of 250 μg/ml (Invitrogen). Both cell lines adapted to the conditions of cultivation in medium without serum (Gibco) and cultured in chambers for cell lines (Integra). Before using supernatant concentrated 10 times the concentration of the hybrid protein was determined as described in the work of Flanagan and others, The kit ligand: a cell surface molecule altered in steel mutant fibroblasts. Cell, t. 1990, p.185-194).

W) Tests "spreading" T fibroblasts and cells SNO: test "spreading" on the fibroblasts T set, as described previously (Spillmann and others, Identification and characterization of a bovine neurite growth inhibitor (bNI-220). J. Biol. Chem., t, 1998, s-19293). The test flow cell SNO conducted essentially in the same manner as in fibroblasts T. Brief description of the procedure: cells SNO diluted 1:2. After 24 h, they were treated with trypsin in PBS with EDTA for 30 s and about 8000 cells SNO were seeded into tablets, coated with a layer NiG or Nogo-66 in number 5, 1, 0.5 and 0.2 μg per well. 30-45 min the cells were fixed with a solution containing 4% (wt./about.) of paraformaldehyde and 5% (wt./about.) sucrose, and further analyzed as described Spillmann and others (see above). In each well were counted approximately 100 cells, using for this purpose the light microscope. Criteria for the "spreading" of the cells have the following characteristics: (a) attaching to the Cup And (b) stretched and RA is the expansion of cells, pointing to the formation of lamellipodia; under light microscope, the cells appear darker and larger than prestaties, rounded cells; neraschetliva cells are cells that are not attached to the Cup OR (b) have attached to the Cup, but have a small size, rounded shape, with no visible protruding lamellipodia. The correlation between spreading and practicalities cells characterizes the degree of nopermissions substrate.

C) Test of neurite growth in PC12: assessment of neurite growth in PC12 were performed as described previously (Rubin and others, Inhibition of PC-12 cell attachment and neurite outgrowth by detergent solubilized CNS myelin proteins. Europ.J. Neurosci., Vol.7, 1995, S. 2524-2529). The PC12 cells (a clone of PC12 cells able to grow regardless of the presence of laminin received from Moses Chao (new York, USA), was primiraly within 2 days of 50-100 ng/ml NGF (Harlan Bioproducts, stantinople, USA) in culture medium DMEM containing 5% fetal calf serum, 10% horse serum, 100 u/ml penicillin, and 0.5 mg/ml streptomycin (Pen-Strep, available on the company Gibco-BRL). PC 12 cells were removed mechanically, trypsinization for 5 min 0.05% trypsin solution (Sigma) in HBSS (Gibco) and seeded at a concentration of 3000-5000 cells/cm2in culture medium containing 100 ng/ml NGF. The test was stopped after 24 h by the addition of a solution containing 4% (wt./about.) of paraformaldehyde and 5% (wt./about.) sucrose in PBS at the N. 8. For PC12 cells culture the tablets were prepared in the same manner as for cells T.

and Test strips on the cells in the retinal ganglion: the test was performed as described in the work Vielmetter (see Vielmetter and other In vitro assay to test differential substrate affinities of growing axons and migratory cells. Exp.Brain Res., t, 1990, s-287) with some modifications (see Schmalfeldt and others, Brain derived versican V2 is a potent inhibitor of axonal growth. J. Cell Sci., t, 2000, s-816). The explants were investigated after fixing solution containing 4% (wt./about.) of paraformaldehyde and 0.1% (vol./about.) glutaraldehyde in PBS for 10 min at RT. For immune staining of fixed explants were blocked at RT for 1 h with RNO-blocking solution containing 0.5% (wt./about.) BSA, and 0.3% (wt./about.) TopBlock (Juro Supply) and 0.1% (wt./about.) NaN3in PBS, and treated with 10 min of 0.05% (vol./about.) TX-100 in RNO-blocking solution for violations of the membrane permeability, frozen 1 min at -20°and incubated with the first antibodies (AS Bianca for NiR, AS Laura for Nogo-A, NiR-G, NiG, NiG-D3 and NiG-D20, Novagen, MCAT anti-T7 for Nogo-C and the control of protein β-Gal). After PBS washing the explants were added conjugates of antibodies with FITC and TRITC (FITC: fluorescein-isothiocyanate, TRITC: tetramethyl rhodamine isothiocyanate) (Jackson ImmunoResearch Laboratories) (1:150). The samples were covered with cover glasses in 50% (vol./about.) the glycerol containing 25 mm NaHCO3, 40 mm NaCl and 1% (wt./about.) p-phenylenediamine (Sigma).

The results:

a) Two areas in-terminal part of Nogo-A inhibit the spreading ZTZ fibroblasts: to identify the region of Nogo-A, responsible for the suppression of spreading T fibroblasts, was created a library of 50 deletion variants of Nogo. Recombinant proteins expressed in bacterial cells (see method 1A). For Nogo-A concentration repressing spreading 50% of fibroblasts T (EC50), was approximately 400-500 ng/0.1 ml in cm2surface (incubation cards with Nogo-A during the nights (˜4 pmol/cm2). Processing of Nogo-A or its fragments 8 M urea resulted in a significant decrease in inhibitory activity, indicating the important role of the conformation of the molecule for the activity of the protein. Analysis of the fragments of Nogo test spreading of fibroblasts revealed that at least two sites of the protein Nogo-A are involved in the suppression of the newly spreading of fibroblasts, namely NiR-D2 (aa 59-172) and NiG-D20 (aa 544-725). All fragments obtained from the field NiG possessing inhibitory activity (e.g., NiG-D4 and NiG-D8), partially overlap with NiG-D20. Negligible inhibitory activity at high concentrations of protein were observed in NiG-D19 within the region NiG-D6. Nogo-C, Nogo-66 peptide 4 rats (according to GrandPré and others 2000, peptide 4 is inhibiting plot Nogo-66) does not inhibit the spreading of fibroblasts. These data show that inhibition of spreading ZTZ fibroblasts typical two specific areas of Nogo-A, located at the N-end (NiR-D2) and limit the Nogo-A-specific region (NiG-D20) protein. The effect is not associated with non-specific physical-chemical properties (acidity fragments, structural effects due to residues of Proline and serine). The C-terminal domain RTN is not involved in suppressing the spreading of fibroblasts.

b) Region NiG-D20 Nogo-A inhibits neurite outgrowth: to determine, do fragments of Nogo-A, which nopermission for spreading cells inhibitory effect on neurite outgrowth in different experiments with nerve cells tested a series of fragments of Nogo-A, synthesized bacterial cells, as well as a hybrid protein Nogo-AP synthesized in eukaryotic cells. Test strips (method 1) neurite avoided coated with laminin/Nogo-A strips and grew up on the strips, covered only by laminin, whereas the strips, coated with laminin/beta-galactosidase, there was no growth. Full-size protein Nogo-A showed high inhibitory activity against the growth of neurites of cells in the retinal ganglion, and the N-terminal part (NiR) had a minor effect. The activity of Nogo-C is not different from the activity of the control protein (beta-galactosidase). Nogo-A-specific region NiG-D20 contained the main area responsible for the suppression of neurite growth of cells in the retinal ganglion; growth cones stopped when confronted with stripes, covered NiG-D20. Nopermission effectsevista concentration. At lower concentrations of Nogo-A number of intersecting fibers increased. There has been no obvious differences between the neurites of cells in the nasal and temporal retinal ganglia in relation to their sensitivity to the field of Nogo-A. Laminin-independent, NGF-sensitive clone of PC12 cells was primiraly 50 ng/ml NGF for 24 h and then were seeded into tablets, coated with a layer of fragments of Nogo synthesized in bacterial cells, in a concentration of 0.1-3 mg/cm2. Neurite outgrowth was assessed the next day. Nogo-A-specific region (NiG) and its fragment NiG-820 significantly inhibited neurite outgrowth of PC-12. In contrast, N-terminal fragment NiR had only a minor activity is detectable only at high concentrations of protein. Nogo-C and Nogo-66 had no activity.

Example 2

The presence of the site (sites) bind NiR-G and NiG-D20 on fibroblasts T and cell membranes of the cerebral cortex of the rat

Methods

a) the Introduction of a radioactive label and experiments on binding: purified by the method of affinity chromatography using immobilized metal ions NiG-D20 was madirovalo the firm ANAWA Trading SA (Wangen, Switzerland) (2030 Ci/mmol) using lactoperoxidase and purified using the inverse-phase HPLC. The membranes of the cells of the cerebral cortex rats were treated as described previously (Olpe and others, CGP 35348: a centrally active blocker of GABAB receptors. Eur. . Pharmacol., t, 1990, p.27-38). Binding was carried out for 1 h at RT according to the method, essentially as described earlier (Kaupmann et al., Expression cloning of GABA (B) receptors uncovers similarity to metabotropic glutamate receptors. Nature, t, 1997, s-246), using a 2.5-ml tubes, preincubated for 2 h with 1% (wt./about.) BSA to reduce nonspecific binding. The homogenates membranes in HEPES buffer at pH 7.4 (125 mm NaCl, 5 mm KCl, 0.6 mm MgCl2, 1.8 mm CaCl2, 20 mm HEPES, 6 mm dextrose)containing inhibitors of proteolytic enzymes (Rôche Diagnostics, Mannheim, Germany), incubated with 1.3 nm iodirovannoi NiG-D20 in the presence of increasing concentrations of unlabeled NiG-D20 or without it.

b) Flow cytometry: flow cytometry and sorting of cells was performed on a high-speed device Cytomation MoFlo (Fort Collins, stallord, USA). Flow cytometer equipped with a laser nozzle (argon-ion/UV laser Enterprise II), tuned to 488 nm at a power of 130 mW. The FITC fluorescence was measured after optical filters on 530/40 nm. For the analysis of fibroblasts ZTZ filmed using a buffer for the dissociation of the cells of the firm Gibco. Preobrazovaniya complexes used to detect binding of NiR-G T fibroblasts were prepared as follows: NiR-G and ICC-ATA (E) were incubated in a molar ratio of 1:1 for 30 min at 4°C. Then was added FITC-conjugated F(ab)2fragments of goat IgG to mouse IgG, incubi is ovali another 30 min at 4° C. the Resulting molar ratio of the trimeric complexes was 1:1:0,5. The complex was added to 1×106T fibroblasts in the final volume of 0.1 ml, incubated 2 h at 4°C, washed and analyzed by flow cytometry.

Results

The presence of the site (sites) bind Nogo-A-specific active fragments fibroblasts ZTZ and cell membranes of the cerebral cortex of the rat: Because the field N1R-D2 and NiG-D20 protein Nogo-A inhibit the spreading of the cells and neurite outgrowth, despite the absence of Nogo-66 and independently NgR, you can accept without proof the existence of separate from them Nogo-A-specific receptor. Experiments on binding was performed with multibeam NiR-G-labeled myc and purified by the method of affinity chromatography using immobilized metal ions, and living fibroblasts ZTZ, analyzed by flow cytometry. Complexes NiR-G antibodies effectively contacted with cells ZTZ, as evidenced by the increased fluorescence over 90% of the cells ZTZ. In contrast, after incubation with the first anti-myc, MCAT mouse (E)associated with FITC-conjugated F(ab)2-fragments of antibodies goat to mouse IgG or only with the second AT the cells ZTZ did not give a signal. To determine the binding NiG-D20 with the cell membranes of the cerebral cortex of the rat used [125I]-NiG-D20 test binding radioligand. Evidence for the presence of specific binding sites NiG-D20 in the membranes of brain cells of the rat were obtained when the concentration of [125I]-NiG-D20 equal to 1.3 nm, as dependence was found competition for binding between radioligand and unlabeled NiG-D20 concentration. These results show that aminoterminal fragments of Nogo-A may contact with the surface of the cells ZTZ and membranes of the cells of the cortex of the rat brain, suggesting that membrane-bound specific binding sites Nogo-A, i.e. a specific receptor (receptors).

Example 3

Creating mouse 11C7-IgG1

Of mice SN and C57BI6/J were immunized by subcutaneous injection of synthetic peptide SYDSIKLEPENPPPYEEA (=NogoA_623-640 rats; SEQ ID NO:1), corresponding to a specific epitope NiG-D20. This highly conserved epitope Nogo-A-specific region NiG-D20 human, macaque, cynomolgus and mouse, which begins with amino acid at position 623 and ends with the amino acid at position 640 amino acid sequence of human NogoA (SEQ ID NO:5) (see also the comparison of sequences in the drawing). Monoclonal AT 11C7 received from mice immunized with the hybrid protein of rat NogoA_623-640-KLH (KLH - a carrier protein). Screening of monoclonal antibodies was performed by ELISA with mouse NogoA_623-640-KLH, free peptide NogoA_623-640 rats and g is Britney molecule, representing inert peptide-KLH. Further screening of MCAT tested using ELISA method with NiR-G or b-galactosidase, both protein expressibility as his-proteins; purification procedure was performed metalroofing chromatography. Then MCAT tested for the ability to recognize Nogo-A in the Western-blotting of oligodendrocytes and lysates of brain tissue in rats. Antibodies tested for the detection of protein using the methods of immunocytochemistry on cells Cho or COS, transfected Nogo-A rat, and with endogenous Nogo-A rat oligodendrocytes (permeabilization cells). They were also tested for binding to the surface of living oligodendrocytes of the rat. Interspecies cross-reactivity was tested on recombinant molecules NiG rat, mouse, human and bull using ELISA and endogenous Nogo-A rat, mouse, human and bull Western-blotting tissue and cell extracts.

Western blot analysis: Electrophoresis in polyacrylamide gel with dodecyl-sulfate sodium (SDS-PAGE) and Western blot analysis was performed as described previously (Huber and others, Patterns of Nogo mRNA and protein expression in the developing and adult rat and after CNS lesions. J. Neurosci., t, 2002, C-3567), blocking was performed using 3% (wt./about.) Top Block (Juro Supply, glucerna, Switzerland). Antibodies were diluted as follows: purified monoclonal antibodies S or supernatant g is predomi diluted in the ratio of 1:150. Secondary antibodies were conjugated with horseradish peroxidase (HRP) anti-mouse antibody (Pierce; 1:5000, 1:50000).

Hybridization with antibodies S was performed over night at 4°C. For visualization used reagents for detection ECL available on the company Amersham Pharmacia.

Results

Monoclonal antibodies IS identified appropriate 190-kDa Nogo-A band in the Western blot analysis of cell homogenate cultures of oligodendrocytes. In Western blot analysis of monoclonal antibodies IS found NiG human cell lysate NiG, cynomolgus and NiG-D20 rats. MCAT S belong to the IgGI isotype (IsoStrip Kit, Roche).

Example 4

Characterization of murine monoclonal antibodies S

Immunocytokine: oligodendrocytes of the optic nerve was isolated, as described by Schwab and Caroni, (Schwab, Caroni, Neuron, 1988). Culture grown on coated with poly-L-lysine coating the glass in 3-5 days, twice washed with PBS, fixed with a solution of 4% (wt./about.) of paraformaldehyde (PFA), 5% (wt./about.) sucrose in PBS for 15 min at room temperature (RT) and blocked for nonspecific binding with 10% (vol./about.) fetal calf serum. Next, cells were incubated with mouse S (1:100). As secondary antibodies used TRITC-conjugated antimurine antibodies goat (Jackson ImmunoResearch Laboratories). For staining of cell surface two days to the cultural cells of the optic nerve of rats were incubated with monoclonal antibodies in the environment for 25 min at RT. Conjugates of the second antibody with alkaline phosphatase (Milan Analytica, Lausanne) was used at a dilution of 1:7500 in 0.1 M maleic acid with 1% (wt./about.) blocking reagent (1 h). Culture was twice washed with buffer containing maleic acid, and once with buffer with alkaline phosphatase (0.1 M Tris-HCl pH to 9.5, 0.1 M NaCl, 5 mm MgCl2). Staining was shown for 3 h at room temperature in the presence 0,175 mg/ml 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Sigma) and 0,338 mg/ml of nitrotetrazolium blue (NBT, Sigma) in buffer with alkaline phosphatase.

Epitope NogoA_623-640 Nogo-A on the cell surface of cultured oligodendrocytes: in living cultures of oligodendrocytes, incubated with the mouse MCAT S, stained bodies of oligodendrocytes and their radial processes. In the presence of a control mouse IgG or antibodies to the intracellular cyclic nucleotide-phosphodiesterase (CNPase) living cells were not stained. Preincubate mouse S with the appropriate immunogenic peptide (=NogoA_623-640 rats SEQ ID NO:1) reduced the intensity of this color to the background level (competitive quantitative analysis). The cell surface was stained all major and minor processes and the cell body. Thus, Nogo-A-specific part of the molecule recognized by murine T MCAT exposed in the extracellular space plasma membrane of oligodendrocytes.

Getting ochistka mouse, MCAT S: for continuous cultivation of hybridoma, secreting MCAT S, used a 10-liter glass bioreactor. The bioreactor is equipped with the impeller in the Central tube for soft stirring, rotating filter delay cells and a collapsed silicone tube for aeration of the culture without the formation of bubbles. Cell hybridoma cultivated in our serum-free medium on the basis of RPMI. Wednesday was inoculable cells in a dose of 3.7×105/ml After 28 h began continuous current environment through the bioreactor at a rate of 0.5 volume of the fermenter per day (5 liters/day). After another 24 h speed environment through the fermenter was increased to the final level, which constituted 1 fermenter/day (10 liters/day). After 1 week culture reached stationary state with a density of 11×105cells/ml and the process continued for another 1 week. The titer of the mouse MCAT S was determined daily using HPLC. The bioreactor was collected 150 liters of the culture supernatant, which was subjected to sterile filtration to remove cells and cell remnants. 150 liters of the culture supernatant was concentrated to about 6 liters, using tangential flow device Pellikon (Millipore; separation of up to 10 kDa). The concentrated supernatant was purified in three steps through 220-ml column Packed with Sepharose C1-4B conjugated with protein A (Pharmacia; height is alongi 11 cm). Brief description of the procedure: the culture supernatant after adjusting the pH to 8.1 was applied on the column at a speed of 4 ml/min, then the column was washed to baseline values 100 mm Na2HPO4(pH 8.1) at a rate of 8 ml/min of bound peroxidase material was finally suirable at a rate of 8 ml/min, eluting with a solution containing 50 mm NaH2PO4, pH 3.0, 140 mm NaCl, the eluate was immediately neutralized (pH 7.0) with 5 N NaOH and sterilized by filtration. The absorption was measured at 280 nm. Fractions of purified material was further concentrated by ultrafiltration and/or were dialyzed against PBS. All buffer solutions used for cleaning, filtered by tangential flow apparatus ULTRASETTE™separating fractions (mol. weighing more than 10-kDa (Filtron Technology Corporation)to remove possible impurities of endotoxin. With the same purpose, chromatographic media, conjugated with protein A, intensively washed with 20% ethanol, and all tubes/pumps treated before using 0.1 M NaOH. The protein concentration was measured spectrophotometrically at 280 to them, taking as a standard absorption at a protein concentration of 1 mg/ml value of 1.35. The purity was controlled by SDS-PAGE electrophoresis in reducing conditions, using 4-20% gradient gels (Novex. The content of endotoxin measured in the classical LAL test (Limulus Amoebocyte Lysate) according the instructions of the manufacturer (Endotell AG, Allschwil, Switzerland).

Getting Fab-fragments: part of the mouse MCAT S intensively were dialyzed against 100 mm Na-acetate buffer (pH 5.5)containing 2 mm EDTA, and lead concentrations up to 6 mg/ml. Fabfragments obtained by cleavage with papain (in a weight ratio of 1:200) in the presence of 0.25 mm cysteine. The reaction was continued for 16 h at 37°With, then it was stopped by the addition of a specific inhibitor of papain E (N-[N-(L-3-TRANS-carboxen-2-carbonyl)-L-leucyl]agmatine in a large excess (10 μm). Split antibodies were driven through a column Packed with Sepharose Fast Flow, conjugated with protein A, removal of intact material and Fc-fragments. The fraction Fabintensively were dialyzed against PBS and concentrated to about 3 mg/ml Papain and E available on the company Roche Molecular Biochemicals).

HPLC, mass spectrometry and N-terminal sequencing of regions VLand VH:

(a) Restoring and alkylation: peeled, dried antibodies S was dissolved in 40 μl of buffer solution containing 8 M urea and 0.4 M NH4HCO3(pH 8.3). Then added 60 µg DTT (Calbiochem), pre-dissolved in 10 μl of the same buffer, in which the dissolved protein. The restoration was carried out at 50°C for 30 min in argon atmosphere (100-fold molar excess of DTT on the content of thiols). After the reduction is the service, the material was cooled to room temperature. Added 304 µg iodoacetamide (Sigma Ultra, I-1149), dissolved in the same buffer, and protein. Carboxamidotryptamine was carried out at room temperature for 15 min in the dark. To stop the reaction was added 1 μl of β-mercaptoethanol.

(b) Selection of heavy and light chains: Carboxamidotryptamine heavy and light chains of the antibodies identified using inverse-phase high-performance liquid chromatography (RP-HPLC) in the system Hewlett Packard 1090M HPLC System with pump DR5 and UV detector diode beam. Chromatography was performed on a column (PerSeptive Biosystems Poros size 2,1×100 mm, filled R1/H, at a rate of 0.5 ml/min, using the following solutions: (A) 0.1%solution triperoxonane acid (TFU) in water and (B) acetonitrile/water in a ratio of 9:1 0,09% TFU; the gradient of solution B from 25 to 70% for 8 min at 80°C; detection at 218/280 nm.

(b) LC-ESI-MS: Mass spectrometry was performed using a quadrupole time-of-flight hybrid tandem mass spectrometer Q-Tof (Micromass, Manchester, UK), equipped with electrostatic ionization source Micromass Z-type (ESI). A typical range of mass numbers were m/z 500-2000. Data were recorded and processed using MassLynx software package. The calibration of the scale, 500-2500 m/z was performed using differently charged ion peaks of myoglobin in the heart of the horse (mol. weight 16951,5).

(The) HPLC-MS heavy and light chains: the Department restored and carboxamidotryptamine heavy and light chains was performed using a system NR HPLC (Hewlett Packard, Palo Alto, stilborne, USA) on a column of size 1 mm×150 mm LC Packings, filled Perseptive Biosystems POROS R1/h Column was kept at 60°C. the column was applied sample volume of 10 µl using automatic device for sample introduction, CTC PAL (CTC, Zwingen, Switzerland) with valve model Valco C6UW HPLC (Valco, Houston, Texas, USA) and injection loop 10 ál. The process HPLC was controlled by the software MassLynx (Micromass, Manchester, UK). Measurement of the UV spectrum was carried out at 214 nm. Eluent A - water containing 0.05% TFU. Eluent B is a mixture of water/acetonitrile in the ratio of 1:9, containing 0,045% TFU. The gradient of eluent B from 20% to 90% was held for 20 min at 80°C. In a typical case, the chromatography was performed at 60 ál/min All the material from the LC system without dilution was done in a spectrophotometric cuvette, then in the ESI source. System management HPLC and signal processing with UV detector was carried out using MassLynx (Micromass, Manchester, UK). We have received the following five signals:

Signal And+127 (Lys)N-chain with CAMCys*
Table 1
Measurements:The interpretation of the signal
A=50959,0 YesN-chain with carboxamidates-cysteine (CAMCys)*
In=51119,5 YesThe signal A+162 Da (=hexose)**
C=51086,0 Yes
D=51251,0 YesThe signal+162 Da (=hexose)**
E=24464,8 YesL-chain with CAMCys
* The presence of N-chains of two types: N-chain with C-terminal Lys and without it. The ratio between the circuits of the two types is approximately 50:50%.
** Both types of H chains have corresponding glycosylated form (+162)

(e) N-terminal sequencing of regions VLand VH: Analysis of amino acid sequences was conducted on data collected after HPLC peaks chains H+L. Amino acid sequence was determined using the system for N-terminal protein sequencing Hewlett Packard G1000A N-terminal Protein Sequencing System. The system automatically carries out the reaction of Edman on protein samples collected on the miniature bi-absorbing columns. To improve the chemical efficiency of the method, minimize phase shifts and thus expanding the analysis of a sequence of up to about 50 residues used method of chemical optimization (double pair of 3.0). Analysis of PTH-amino acids was performed on-line in the system Hewlett Packard HP 1090 HPLC System, equipped with a ternary pump system and a narrow column PTH size (2.1mm×25 cm.

Results

Analysis of the mass confirmed the selection of homogeneous preparations of heavy and light separating 11C7-IgG1. H-chain was a single glycosylated chain, existing in two forms with a difference in one C-terminal lysine residue. General analysis of the masses of the heavy and light chains showed that for both circuits there is a single mass. HPLC mouse C-IgG1 showed the presence of one peak. In the purification by HPLC, followed by reduction and alkylation were obtained pure heavy and light chains. Spent N-terminal sequencing of the heavy and light chain. Were identified from 45 to 55 amino acids of N-terminal sequences of L - and H-chains by the method of chemical degradation.

Example 5

Gene cloning heavy and light chain of the mouse MCAT S

Total RNA was obtained from 10 cells hybridoma (clone C) using TriPure reagent (Roche diagnostics, Germany, cat. # 1667157) and guided by the instructions of the manufacturer. For cDNA synthesis mRNA was isolated from a preparation of total RNA using Oligotex Resin (Qiagen, Germany, cat. # 70022).

The cDNA library was created by reverse transcription in the following conditions: the reaction mixture consisted of 2 μl of mRNA, 2 ál of 10x buffer for reverse transcription, 2 μl of primer (dT)20(10 μm), and 0.5 μl of RNasin (Promega, 40 u/ml), 2 μl of dNTP (no 5 mm each), 1 μl Omniscript reverse transcriptase™ (Qiagen, cat. # 205110), and 10.5 μl ddH2O; reaction Prov the Dili 1 h at 37° C. When conducting PCR amplification of cDNA encoding VHand VLused DNA polymerase ProofStart™ DNA-enzyme that checks the correctness of the reading.

PCR light and heavy chains: the reaction mixture consisted of 2 μl of cDNA, 5 ál of 10x reaction buffer, 3 μl of dNTP (5 mm each), 2 μl 5'-primer (10 μm) (see Table 2), 2 μl of 3'-primer (10 μm) (see Table 2), 1 ál of ProofStart (Qiagen, cat.# 202203), 36 μl ddH2O. PCR Conditions: 95°C/5 min, (95°C/40 s, 53°C/1 min, 72°C/1 min)×35, 72°C/10 min PCR Products ligated directly with plasmid pCRbluntTOPO (Invitrogen). Produced transfection TOP 10 cells (Invitrogen) were obtained ligation mixture and selected a few clones. The sequence of nucleotides in the cDNA of the variable part of the heavy chain of MCAT S (V-H, SEQ ID NO:43) and light chain MCAT S (V-L, SEQ ID NO:44) was determined on the ABI sequencing machine. The amino acid sequence of V-H and V-L shown in SEQ ID NO:2 (V-H) and SEQ ID NO:3 (V-L). All primers used for PCR amplification of cDNA VHand VLsynthesized in the company MWG Biotech (Germany).

Table 2
PrimerSequenceSEQ ID NO:
5'-VLleaderAATATGAGTCCTGCCCAGTTCCTGTTTC39
3'-κTTAGGAATTCCTAACACTCTCCCCTGTTGAAG 40
3'-VHleaderAATATGGATTTTGGGCTGATTTTTTTTATTG41
3'-CH hingeATT GGGCAACGTTGCAGGTGACG42

Example 6

Enzyme-linked immunosorbent assay binding S and Fab domains Nogo-A

In each well of 96-well PS tablet Greiner (#655161) was introduced into 100 μl of PBS containing fragments of the protein Nogo (0.4 to 2 mg/ml), tablets were closed and incubated for 4 h at room temperature. Then the tablets were pressed, each well was brought to 200 μl of blocking buffer (PBS+2% BSA), covered and incubated 1 h at RT or over night at 4°S, then 4 times washed with water and PBS. Different concentrations of mouse, MCAT S or S Fab fragments in PBS+2% BSA was introduced into the wells (100 μl well) and incubated for 2 h at RT or over night at 4°C. Repeated all washing steps and was added to the wells of the antibody goat to mouse IgG conjugated with horseradish peroxidase (HRP) at a dilution of 1:5000 (ICN #55550) in PBS/0.1% BSA/0.1% of Nonidet 40 (100 μl well); the plates were incubated 2 h at RT or over night at 4°With, then repeating the washing procedure. Peroxidase reaction was started by adding to the wells, 100 μl of a solution of 3,3'-5,5'-tetramethylbenzidine (TMB) (product BM Blue POD Substrate firm Roche #1484281), the plates were incubated in the dark at RT for 15 minutes To stop reaction with the HRP substrate was added to each well p is 50 ál of 1M H 2SO4and was determined by optical density using a device for determining the optical density in microtiter plates (Packard Spectra Count)set to 450 nm.

Mouse S MCAT contacted NiG man, NiG rats, NiG mouse, NIG-D20 rats and peptide 472 at very low concentrations from 0.02 to 2.5 nm. Linking NiG man, NiG rats, NiG mouse at very low concentrations confirmed a very high affinity (KD of 0.1 to 0.44 nm, as determined by measuring the affinity of using biosensor) and consistent with the fact that the peptide 472, with the exception of 2-3 amino acids, identical to the equivalent regions of the sequences of human, rat and mouse. The binding specificity was indicated by the fact that in the same range of concentrations mouse S MCAT not contacted NiG-D6 rats and fragments of Nogo-66. Monovalent Fab fragments were associated with NiG man and NiG-D20 rats at concentrations from 0.025 to 25 nm, but in the same range of concentrations did not correlate with the NiG-D6 rats and fragments of Nogo-66. For NiG person KD value measured using the biosensor was 7,14 nm.

Example 7

Measurement of the affinity of the mouse 11C7-IgG1 domains Nogo-A and their Fab fragments using biosensor

The affinity of murine S MCAT and Fab fragments S was measured using the technology of surface plasmon resonance (SPR) using the receiving optical biosensor BIAcore 2000 (Biacore, Gopala, Sweden) in accordance with the instructions of the manufacturer.

Recombinant NIG human, mouse and rat was covalently attached to three separate flow kootam touch chip SM. Brief description of the procedure: the matrix of carboxymethylamino dextran activated by injection of 35 μl of a solution containing 0.025 M NHS and 0.1 M dichloroethane. For immobilization on the sensor chip recombinant NIG mouse, human and rat were diluted in 0.01 M citrate buffer at pH 3.5 to 4.5, and were injected with a speed of 5 μl/min to achieve a level of binding is sufficient to measure the affinity of. Inactivation of the remaining NHS-ester group was carried out by injection of 35 μl of 1 M ethanolamine hydrochloride (pH 8.5). The surface of sensor chip was regenerated by injection of 5 μl of 0.1 m HCl. To measure the affinity of the antibodies were injected with different concentrations of from 0.50 to 100 nm, with a speed of 200 μl/min After each injection the surface of sensor chip was regenerated by injection of 10 µl HCl without loss of surface binding activity. Kinetic constants ka, kd and affinity constants KA and KD were estimated using the program BIAevaluations 3.0 provided by the manufacturer.

Determination of affinity using BIAcore Kinetic parameters and constants affinity binding of mouse, MCAT S and monovalent Fab fragments, p the first of MCAT S, with recombinant NogoA was measured in real time using SPR technology (Biacore). For this analysis, recombinant NIG human, rat and mouse were connected with three disjoint surfaces of sensor chip and were injected with antibodies at different concentrations. Kinetic parameters of binding was calculated by sensorama by non-linear curve approximation. Of affinity constant in the steady state for 11C7-IgG1 mouse was KD=0.1 nm, KD=0.4 nm and KD=0,19 nm for NIG human, rat and mouse, respectively (table 3). For Fab fragments derived from S, constant affinity to NIG man was KD=7,14 nm. Lower the affinity of Fab fragments is a consequence of the reduction of both kinetic constants - constants of Association and dissociation constants (ka, kd). Lower the affinity of Fab-fragments compared to whole antibody, probably connected with the avidity effect, which is absent in Monomeric Fab.

Table 3
Ska (1/Mc)kd (1/c)KA (M-1)KD (M)
NIG man4,48×1054,6×10-59,73×1091,03×10-10
NIG rat8.76×1053,89&x000D7; 10-42,25×109of 4.44×10-10
NIG mouse5,52×1051,06×10-45,2×1091,92×10-10
S FabKa (1/Mc)KD (1/C)KA (M-1)KD(M)
NIG man7,29×1045,28×10-41,4×1087,14×10-9

1. Linking molecule that is a monoclonal antibody or fragment is capable of contact with a human NogoA polypeptide, a human NogoA 623-640 (SEQ ID NO:6), which includes at least one antigennegative site, and this antigennegative website contains

in sequence hypervariable region CDR1-11C7 (SEQ ID NO:8), CDR2-S (SEQ ID NO:9) and CDR3-11C7 (SEQ ID NO:10), and in sequence hypervariable region CDR1'-11C7 (SEQ ID NO:11), CDR2'-11C7 (SEQ ID NO:12) and CDR3'-11C7 (SEQ ID NO:13); or

their direct equivalents, where hypervariable region have posledovatel the face, identical, at least 95%.

2. The binding molecule according to claim 1, further comprising a constant part of the heavy chain of the immunoglobulin or its fragment and a constant part of the light chain of the immunoglobulin or its fragment.

3. The binding molecule according to claim 2, in which the constant part of the heavy chain of the immunoglobulin or its fragment is of type γ4 and the constant part of the light chain of the immunoglobulin or its fragment is of type K.

4. Polynucleotide encoding a binding molecule according to any one of claims 1 to 3.

5. The expression vector including polynucleotide according to claim 4.

6. A host cell comprising polynucleotide according to claim 4 or the expression vector according to claim 5, and this cell is capable of producing the polypeptide according to any one of claims 1 to 3.

7. The use of a binding molecule according to any one of claims 1 to 3 as a drug for the treatment of diseases associated with the restoration of the nerve.

8. The use of a binding molecule according to any one of claims 1 to 3 to obtain medicines for recovery of the nerve.

9. Pharmaceutical composition for treatment of diseases associated with the restoration of the nerve containing the binding molecule according to any one of claims 1 to 3 and at least one pharmaceutically acceptable carrier or diluent.



 

Same patents:

FIELD: medicine; bioengineering.

SUBSTANCE: are offered variants of antibodies, specifically recognizing two regions of peptide β-A4, characterised by amino-acid residual list. The first region of recognised peptide contains amino-acid sequence AEFRHDSGY or fragment thereof, while the second region contains amino-acid sequence VHHQKLVFFAEDVG or fragment thereof. Described are nucleic acid molecules coding molecules of antibodies, offered in invention, vectors and hosts containing specified nucleic acid molecules. Discovered are methods of antibodies production and optimisation, pharmaceutical compositions based on specified antibodies and method of production thereof, as well as antibodies-based set and various applications of antibodies. Invention application provides high-avidity antibodies of peptide β-A4 that can be applied for diagnostics of various peptide β-A4 mediated diseases.

EFFECT: efficient application of compositions.

29 cl, 15 dwg, 10 tbl, 16 ex

FIELD: biochemistry.

SUBSTANCE: invention refers to antibodies that link with CTGF. Antibodies, in particular, are directed to the areas of CTFG participating in different types of biological activity related to fibrosis. The invention also refers to the method of antibodies application in pharmaceutical compositions for the treatment of CTGF-related diseases including localised and systemic fibrotic diseases such as diseases of lungs, liver, heart, skin and kidneys, for neutralisation of biological activity of CTGF and method of treatment and prophylaxis of CTGF-related diseases. The invention covers polynucleotide sequence and its variants coding the specified antibody as well as the host cell and cell line № PTA-6006 (ATCC) producing the specified antibody.

EFFECT: use of the invention provides new specific means - antibodies which effectively neutralise certain types of CTGF activity in pathology and provide specificity and pharmacokinetic profile suitable for a therapeutic agent.

82 cl, 33 dwg, 4 tbl, 12 ex

FIELD: bioengineering.

SUBSTANCE: versions of the molecule binding CD45RO and CD45RB, and the anti-CD45RO and anti-CD45RB antibody are invented. In one of versions, the said molecule contains at least one antigen-binding site and includes the subsequently located hypervariable sites CDR1, CDR2 and CDR3. The molecule represents the humanised or monoclonal antibody. CDR1 has the amino acid sequence NYIIH, CDR2 has the amino acid sequence YFNPYNHGTKYNEKFKG and CDR3 has the amino acid sequence SGPYAWFDT. The molecule can additionally contain the subsequently located hypervariable sites CDR1', CDR2' and CDR3'. CDR1' has the amino acid sequence RASQNIGTSIQ, CDR2' has the amino acid sequence SSSESIS and CDR3' has the amino acid sequence QQSNTWPFT. In another version, the molecule contains both heavy and light chains where the amino acid sequences contain the corresponding CDR. The versions of the corresponding coding polynucleotide are disclosed; expression vector and based on it expression system. The host cell is disclosed basing on the expression system. The application of the molecule in treatment of autoimmune diseases, graft rejection, psoriasis, intestine inflammatory disease and allergy is described. The pharmaceutical composition for the said application is disclosed.

EFFECT: enables immunosuppressant induction; inhibiting T-cell response and primary lymphocyte response in mixed lymphocyte culture (MLC); prolongs survival period in mice with severe combined immunodeficiency SCID.

20 cl, 5 dwg, 2 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: described humanised and chimeric CD20 antibodies are designed for treatment of CD20-positive malignant and autoimmune diseases. Antibody is effective with respect to depletion of B-cells of mammals in vivo, contains in variable region of H-chain of CDR3- sequence from antibody to human CD20 and practically all remains of consensus frame region (FR) of human H-chain of subgroup 111. According to invention antibody is used in composition or product, binding CD20. Besides, antibody is used for apoptosis induction, treatment of CB20-positive cancer, autoimmune disease, and rheumatic arthritis. Invention contains nucleic acid (NA) coding antibody, expression vector containing specified NA, and host cell producing recombinant antibody, as well as method of specified antibody production. According to invention antibodies are characterised by minimum antigenicity or no antigenicity at all, that enables to use them for continuous treatment overcoming limits of existing therapeutic compositions application.

EFFECT: enables to use for continuous treatment.

83 cl, 32 dwg, 12 tbl, 16 ex

FIELD: medicine, molecular biology, antibodies.

SUBSTANCE: invention relates to an antibody raised against CCR5 and comprising: (i) two light chains wherein each light chain comprises product of plasmid expression and designated as pVK:HuPRO140-VK (ATCC - PTA-4097), and (ii) two heavy chains wherein each heavy chain comprises product of plasmid expression and designated as pVg4:HuPRO140 HG2-VH (ATCC - PTA-4098), or plasmid designated as pVg4:HuPRO140 (mut B+D+I)-VH (ATCC - PTA-4099), or fragment of such antibody binding with CCR5 on a human cell surface. Invention relates to nucleic acid encoding light and heavy chains of antibody, expression vector, cell-host transformed with at least one vector, and a method for preparing antibody. Antibody is used as an active component in composition used for inhibition of infection of cells CD4 + HIV-1, and to a pharmaceutical composition used in treatment of a patient with HIV-1 infection. Also, invention relates to antibody conjugate against CCR5 and its using. Use of antibodies provides enhancing effectiveness of prophylaxis and treatment of HIV-1 infection.

EFFECT: valuable medicinal properties of antibody.

31 cl, 23 dwg, 3 ex

FIELD: biotechnology, immunology.

SUBSTANCE: disclosed are variants of chimerical anti-IL-6 antibodies based on mice CLB-8 antibody. Each antibody contains constant region from one or more human antibodies. Described are variants of nuclear acids encoding anti-IL-6 antibody, vectors and host cells. Developed is method for production of anti-IL-6 antibody by using nuclear acid or vector. Described are variants of composition for application in method for modulation of malignant disease or immune disorder mediated with IL-6. Developed is method for treatment or modulation of malignant disease or immune disorder mediated with IL-6.

EFFECT: variant of chimerical anti-IL-6 antibody with high affinity of mice anti-IL-6 antibody and reduced immonogenicity.

26 cl, 16 dwg, 1 tbl, 8 ex

FIELD: biotechnology, proteins, immunology.

SUBSTANCE: invention proposes fragment of antibody MR1-1 that retains capacity for recognition and binding EGFRvIII and nucleic acid encoding its. Polypeptide is prepared from the known antibody MR1 by mutation of CDR3 VH- and VL-chains. Also, invention describes using a polypeptide for preparing immunotoxin possessing the cytotoxicity property to cells carrying antigen of epidermal growth factor EGFRvIII receptors. Also, invention disclosed immunotoxin based on this polypeptide. Also, invention proposes a method for preparing polypeptide comprising amino acid substitution of at least one amino acid in hypervariable region CDR with amino acid encoded by a codon comprising nucleotide belonging to a hot point motif. The hot point motif is chosen from AGY or RGYW wherein R represents A or G; Y represents C or T, and W represents A or T. Prepared polypeptide is characterized by value Kd for EGFRvIII 7 nM or less. Also, invention describes a method for cell killing that expresses antigen EGFRvIII using a polypeptide. Using this invention provides preparing antibodies showing enhanced cytotoxicity and improved binding EGFRvIII as compared with the parent antibody MR1 that can be used for target-directed delivery of immunotoxins in treatment of malignant neoplasms.

EFFECT: valuable medicinal properties of polypeptide.

34 cl, 7 tbl, 6 dwg, 8 ex

FIELD: biotechnology, genetic engineering.

SUBSTANCE: invention describes recombinant plasmid DNAs constructed in vitro that comprise artificial genes for light and heavy chains of full-scale human antibody prepared by genetic engineering methods. These genes are created on basis of variable fragments of light and heavy chains of recombinant antibody 1F4 and constant human genes IgG1, cytomegalovirus promoter and polyadenylation site BGH. Plasmids provide biosynthesis of recombinant full-scale human antibodies of class IgG1 in mammalian cells. These antibodies interact specifically with smallpox vaccine virus. The affinity constant for prepared recombinant antibodies is 3.54 x 109 ± 0.38 x 109 M-1. Plasmids are used by combined transfection of human cells HEK 293T. Prepared full-scale recombinant antibody against protein of size 27 kDa of smallpox virus vaccine can be used as a base for creature of pharmaceutical preparations used for diagnosis of some post-vaccine complications caused by smallpox virus vaccine. Also, preparations will comprise decreased therapeutic doses of immunoglobulins that will provide minimal undesirable immune response in patients after administration of the preparation.

EFFECT: valuable medicinal properties of plasmid DNA.

4 cl, 7 dwg, 6 ex

FIELD: biotechnology, immunology.

SUBSTANCE: invention describes a monoclonal anti-IFNα antibody that binds with the following subtypes of IFNα: IFNα1, IFNα2, IFNα4, IFNα5, IFNα8, IFNα10 and IFNα21 and comprises three CDR-sites of heavy chain. Amino acid is given in the invention description. Invention discloses heavy chain of anti-IFNα antibody or its fragment that comprise indicated CDR-sites also. Invention describes anti-IFNα antibody that comprises at least one light chain and one heavy chain. Invention discloses variants of nucleic acids encoding indicated antibodies and variants of vectors used for expression of nucleic acids, and variants of transformed host-cells. Among expression vectors invention describes also vectors deposited at № 2881 and № 2882 carrying heavy and light chain of antibody, respectively. Invention describes a method for preparing antibody from indicated cells. Invention discloses the murine hybridoma cell line deposited in ATCC at number № РТА-2917, and antibody produced by indicated cell line. Also, invention describes variants of the antibody-base pharmaceutical composition and a method used for diagnosis of autoimmune disease. Also, invention discloses using antibodies in treatment of disease or state associated with enhanced level of IFNα in a patient. Using the invention provides inhibiting biological activity of at least seven human IFNα subtypes simultaneously, namely: IFNα1, IFNα2, IFNα4, IFNα5, IFNα8, IFNα10 and IFNα12 that can be used in diagnosis and therapy of different human diseases mediated by IFNα, such as insulin-dependent diabetes mellitus or erythematosus lupus.

EFFECT: valuable biological and medicinal properties of antibodies.

53 cl, 4 tbl, 10 dwg, 2 ex

FIELD: biotechnology, immunology, molecular biology, pharmacy.

SUBSTANCE: invention describes variants of MCP-1-binding molecules. One of MCP-1-binding molecule comprises at least one variable region of immunoglobulin (VH) heavy chain comprising of hypervariable sites CDR1, CDR2 and CDR3 while other molecules comprises both light and heavy chains. Invention proposes DNA constructs encoding indicated MCP-1-binding molecules and expressing vector carrying at least one of these DNA constructs. Invention describes a method for preparing MCP-1-binding molecule. Invention discloses a method for treatment of disease or disorder mediated by MCP-1 or eotaxine-1 based on antibody raised to MCP-1 that binds eotaxine-1 by cross mode. Invention describes a pharmaceutical composition based on antibody raised to MCP-1 that binds eotaxine-1 by cross mode and used in treatment of disease or disorder mediated by MCP-1 or eotaxine-1 in a patient. MCP-1-binding molecules inhibit binding MCP-1 with its receptor. The full immobilized antibody is highly specific as far as it binds human recombinant MCP-1 with value KD = (43 ± 2.9) x 1012 and can be used in medicine.

EFFECT: valuable medicinal properties of antibodies, improved method of treatment.

13 cl, 5 dwg, 4 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention concerns medicine, particularly immunotherapy. Invention claims bispecific antibody and its application in tumour treatment. New antibody can link to EGF receptor and includes two antigene-binding sites linking to different epitopes of indicated receptor, thus ensuring higher receptor engagement by antibodies at the same dosage. It allows for higher antibody density on receptor and significant inhibition of tumour growth and/or enhancement of solid tumour or metastasis apoptosis.

EFFECT: higher receptor engagement by antibodies at the same dosage.

16 cl, 2 ex

FIELD: medicine; biotechnologies.

SUBSTANCE: anticoagulative antibody is more affinity fixed to FVIIa/TF complex, than to free TF. Discovered is pharmaceutical composition for thrombosis prevention and treatment, containing the described antibody. Offered is method of thrombosis prevention, consisting in introduction of therapeutically effective amount of the described antibody. Furthermore, offered is method of decrease and treatment of deep venous thrombosis (DVT), disseminated intravascular clotting (DIC), acute coronary artery thrombosis or cancer with coagulopathy signs in the patient, consisting that therapeutically effective amount of the described antibody is introduced to the patient. Discovered is method of inflammatory response regulation in the patient, consisting that therapeutically effective amount of the described antibody is introduced to the patient. Polynucleotide sequence encoding the described antibody is presented.

EFFECT: higher efficiency.

24 cl, 10 dwg, 9 ex

FIELD: chemistry, biochemistry.

SUBSTANCE: claimed invention relates to field of biotechnology and immunology. Claimed is monoclonal antibody specific to human oculospanin, possessing cytotoxic activity with respect to human cancer cells. In one of versions antibody is obtained from mouse hybridome O3B8-2C9-4F3, FERM BP-08627. Described is set for cancer detection based on, at least, said antibody and second, specific to it, antibody. Described is pharmaceutical composition for treatment of cancer, whis cells express oculospanin, and application of antibody for manufacturing medication for treatment of cancer, whose cells express oculospanin. Use of invention ensures highly-specific antibodies to human oculospanin, which can find application for diagnostics of tumors, expressing human oculospanin.

EFFECT: ensuring highly-specific antibodies to human oculospanin, which can find application for diagnostics of tumors, expressing human oculospanin.

17 cl, 5 dwg, 10 ex

FIELD: medicine; bioengineering.

SUBSTANCE: are offered variants of antibodies, specifically recognizing two regions of peptide β-A4, characterised by amino-acid residual list. The first region of recognised peptide contains amino-acid sequence AEFRHDSGY or fragment thereof, while the second region contains amino-acid sequence VHHQKLVFFAEDVG or fragment thereof. Described are nucleic acid molecules coding molecules of antibodies, offered in invention, vectors and hosts containing specified nucleic acid molecules. Discovered are methods of antibodies production and optimisation, pharmaceutical compositions based on specified antibodies and method of production thereof, as well as antibodies-based set and various applications of antibodies. Invention application provides high-avidity antibodies of peptide β-A4 that can be applied for diagnostics of various peptide β-A4 mediated diseases.

EFFECT: efficient application of compositions.

29 cl, 15 dwg, 10 tbl, 16 ex

FIELD: medicine.

SUBSTANCE: invention claims a method of T-cell epitop chartering for a given albumen or its fragment by using peripheral blood mononuclear cells (PBMC). The invention also concerns T-cell epitop identification in therapeutic albumens. In addition, the invention concerns a combined approach to application of epitop chartering according to identification of MHC class II ligands detected by the claimed chartering method, and construction of similar sequence with less amount of such ligands.

EFFECT: screening methods for albumen molecule determinants and epitops identification.

17 cl, 3 dwg, 3 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to the field of genetic engineering, namely, to obtaining new proteins, stimulators of MAP-kinases and can be used in medicine. New G-protein-connected receptor polypeptide, which is capable of stimulating MAP-kinases is obtained. By means of expressing vector, which contains sequence of DNA coding new polypeptide, animal host-cell is transformed, cultivated in conditions suitable for expression and thus polypeptide is obtained. Medication is obtained on the basis of new polypeptide or nucleic acid that codes it. The invention allows treating tumor diseases, hypoxia, disorders of cardiovascular, nervous and immune systems.

EFFECT: possibility to treat tumor diseases, hypoxia, disorders of cardiovascular, nervous and immune systems.

14 cl, 66 dwg, 15 ex

FIELD: chemistry.

SUBSTANCE: polynucleotide is obtained, coding chromo- or fluorescen mutant wild type DsRed (SEQ ID N0:2), where chromo- or fluorescent mutant contains a substitute in the amino acid position 42 SEQ ID N0:2, and optionally one or more substitutes in the amino acid positions, chosen from a group, consisting of 4, 2, 5, 6, 21, 41, 44, 117, 217, 145. Using the polynucleotide in the vector, the host cells which express chromo- or fluorescent mutant DsRed are transformed. The invention allows for obtaining chromo- or fluorescent polypeptide DsRed, which matures faster than wild type DsRed.

EFFECT: increased effectiveness.

26 cl, 10 dwg, 2 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: described humanised and chimeric CD20 antibodies are designed for treatment of CD20-positive malignant and autoimmune diseases. Antibody is effective with respect to depletion of B-cells of mammals in vivo, contains in variable region of H-chain of CDR3- sequence from antibody to human CD20 and practically all remains of consensus frame region (FR) of human H-chain of subgroup 111. According to invention antibody is used in composition or product, binding CD20. Besides, antibody is used for apoptosis induction, treatment of CB20-positive cancer, autoimmune disease, and rheumatic arthritis. Invention contains nucleic acid (NA) coding antibody, expression vector containing specified NA, and host cell producing recombinant antibody, as well as method of specified antibody production. According to invention antibodies are characterised by minimum antigenicity or no antigenicity at all, that enables to use them for continuous treatment overcoming limits of existing therapeutic compositions application.

EFFECT: enables to use for continuous treatment.

83 cl, 32 dwg, 12 tbl, 16 ex

FIELD: medicine, oncology, endocrinology, pharmacy.

SUBSTANCE: invention relates to an agent used in prophylaxis or treatment of patients suffering from anorexia and containing antibody raised against protein relates to the human parathyroid hormone (PTHrP) as an active component. Agent can comprise antibody raised against human PTHrP wherein antibody can represent human, humanized or chimeric one and shows the low antigenicity. Using the proposed agent provides improving a patient state suffering from malignant tumor.

EFFECT: valuable medicinal properties of agent.

6 cl, 6 tbl, 10 ex

FIELD: medicine.

SUBSTANCE: the present innovation refers to isolated human antibodies against peptides being the derivatives of apolipoprotein B. It is necessary to apply isolated human antibody or antibody fragment indicated to, at least, one oxidized fragment of apolipoprotein B, in manufacturing pharmaceutical composition for either therapeutic or prophylactic treatment of atherosclerosis due to immunization. The advantage of the present innovation lies in the fact that passive immunization has been occurred with pre-developed antibodies indicated to the same peptides. Moreover, as the applied antibodies are being completely human ones, the risk of unfavorable immunological reaction during the process of their introducing to a patient is decreased.

EFFECT: higher efficiency.

72 cl, 18 dwg, 5 ex, 3 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention concerns medicine, particularly immunotherapy. Anthracycline-antibody conjugate linked by linker containing twice substituted cyclohexane ring is claimed. Antibody included in conjugate is linked to CD74 antigene highly expressed in B cell lymphomas, melanomas and other tumours. Conjugate is internalised by target cells and expressed again on cell surface. Invention also claims method of obtaining indicated conjugate by anthracycline medium conjugation with linker and further with thiene-restored monoclonal antibody. Conjugate can be administered to patients when immunotherapy is required.

EFFECT: efficient method of obtaining anthracycline medicine obtainment.

11 cl, 8 ex, 5 dwg

Up!