Quinolone analogues

FIELD: chemistry.

SUBSTANCE: present invention pertains to new compounds with formula (1): and to their pharmaceutical salts, where B, X, A or V are not present, if Z1, Z2, Z3 or Z4 respectively represent N, and independently H, halogen atom, azido, R2, CH2R2, SR2, OR2 or NR1R2, when Z1, Z2, Z3 or Z4 represent C. In each NR1R2, R1 and R2 together with N there can be formation of an optionally substituted piperidine, pyrrolidine, piperazine or morpholine ring. Z1 represents N and Z2, Z3 and Z4 represent C, or Z1 and Z3 represent N and Z2 and Z4 represent C. W together with N and Z form an optionally substituted thiazole, imidazole or pyrimidine ring, which is condensed with an optionally substituted ring, chosen from a group consisting of: or . U represents NR1R2, NR1-(CR12)n-NR3R4, where in NR3R4, R3 and R4 together with N there can be formation of an optionally substituted piperidine, pyrrolidine, piperazine or morpholine ring. R1 and R3 independently represent H or C1-6alkyl. Each R2 represents H or C1-10alkyl, each optionally substituted with a halogen atom, or C3-6cycloalkyl, aryl, heteroaryl or pyridine, pyrrolidine, piperazine or morpholine ring, where each ring is optionally substituted; or R2 is optionally substituted with piperidine, pyrrolidine, pyridine, piperazine, pyrazine, morpholine or benzimidazole. R2 represents H or C1-10alkyl. Each R5 represents a substitute in any position in ring W, and is H, OR2, amino, alkoxy, amido, halogen atom or cyano; or R5 represents C1-6alkyl, -CONHR1-, each optionally substituted with a halogen atom; or two adjacent R5 are linked with formation of a 5-6-member ring, an optionally substituted heterocyclic ring, chosen piperidine, pyrrolidine, piperazine or morpholine ring. n equals 1-6, and each optionally substituted part can be substituted with one or more halogens, OR2, NR1R2 , carbamate, C1-10alkyl, each optionally substituted with a halogen atom, C=O, cyano, nitro, COR2, NR2COR2, sulphonyl amides, NR2SOOR2; SR2, SOR2, COOR2, CONR22, OCOR2, OCOOR2 or OCONR22. The invention also relates to pharmaceutical compositions, to the method of suppressing proliferation of cells and/or weakening cell proliferative breakdown, to the method of reducing microbe titre and/or weakening microbe infection, to the method of inducing death of cells and/or inducing apoptosis, to compounds, chosen from a group, to pharmaceutical compositions, as well as to the method of producing compounds with formula (1).

EFFECT: obtaining new biologically active compounds, which can suppress proliferation of cells and/or induce apoptosis.

41 cl, 113 ex, 12 tbl

 

This application claims the priority of provisional patent application U.S. No. 11/149007, filed June 9, 2005, and provisional application No. 60/611030, filed September 17, 2004; 60/688986, filed June 9, 2005; 60/638603, filed December 22, 2004 and 60/688796, filed June 9, 2005, each of which is incorporated in this description by reference in its entirety.

The invention relates to quinolone analogues and their applications. The invention also relates to a method of receiving quinolone analogues.

Based on the available information it can be assumed that quadruplexes patterns may exist in vivo in certain regions of the genome, including the telomeric ends of chromosomes and regulatory region of oncogenes (Han et al., Trends Pharm. Sci. (2000) 21: 136-142). QUADRUPLEX structures can form enriched in purines chain nucleic acids. In duplex nucleic acids, some enriched with purines chain can participate in the creation of a slow equilibrium between conventional duplex helical structure and promoted areas not related to In-form. Data hyped and not In form can be attributed to "Paralimni structures". Some forms are associated with sensitivity to cleavage by S1 nuclease, which can be attributed to the "members with hypersensitivity to the nuclease" or "NHE". QUADRUPLEX is one type of PA is anemoi patterns, and some NHE can take QUADRUPLEX structure.

The present invention relates to quinolone analogs that can inhibit cell proliferation and/or induce apoptosis of the cells. The present invention also relates to a method of receiving quinolone analogs and methods of use thereof.

In one aspect the present invention relates to compounds of General formula:

and their pharmaceutically acceptable salts, esters and prodrugs;

where B, X, or V is absent if Z2, Z3or Z4respectively represent N and is independently H, halogen atom, azido, R2CH2R2, SR2, OR2or NR1R2if Z2, Z3or Z4represents independently; or

A and V, and X or y may form a carbocyclic ring, heterocyclic ring, aryl or heteroaryl, each of which may be optionally substituted and/or condensed with a cyclic ring;

Z represents O, S, NR1CH2or C=O;

Z1, Z2, Z3or Z4represent O or N, provided that two N are not adjacent;

W together with N and Z forms an optionally substituted 5 - or 6-membered ring which is condensed with an optionally substituted saturated or unsaturated ring; the specified saturated and the unsaturated ring may contain a heteroatom and a is a monocyclic or condensed with one or more carbocyclic or heterocyclic rings;

U is R2, OR2, NR1R2, NR1-(CR12)n-NR3R4orN=CR1R2where N=CR1R2group R1and R2together with a may form a ring;

provided that U is N, and when U is HE, OR2or NH2then, at least one of the Z1-Z4is N;

each NR1R2group R1and R2together with N may form an optionally substituted ring;

in NR3R4R3and R4together with N may form an optionally substituted ring;

R1and R3independently represent N or C1-6alkyl;

each R2represents N or C1-10alkyl or C2-10alkenyl, each optionally substituted by a halogen atom, by one or more nonadjacent heteroatoms, carbocyclic ring, heterocyclic ring, aryl or heteroaryl, where each ring optionally substituted; or R2optionally substituted carbocyclic ring, heterocyclic ring, aryl or heteroaryl;

R4represents H, C1-10alkyl or C2-10alkenyl, optionally containing one or more non-adjacent heteroatoms selected from the atoms N, O and S, and optionally substituted carbocyclic or hetero is ilicheskom ring; or R3and R4together with N may form an optionally substituted ring;

each R5represents a substituent in any position in the ring W; and is H, OR2, amino, alkoxy, amido, halogen atom, cyano or an inorganic Deputy; or R5is1-6alkyl, C2-6alkenyl,2-6quinil, -CONHR1each optionally substituted by a halogen atom, a carbonyl or one or more non-adjacent heteroatoms; or two adjacent R5associated with the formation of 5-6-membered optionally substituted carbocyclic or heterocyclic ring which may be condensed with an additional, optionally substituted carbocyclic or heterocyclic ring; and

n is 1-6.

In the above formula (1) may be absent when Z1is N, or is N, or a halogen atom when Z1is C.

In the above formula (1) W together with N and Z form an optionally substituted 5-6-membered ring which is condensed with an optionally substituted aryl or heteroaryl selected from the group consisting of:

where each Q, Q1, Q2and Q3independently represents CH or N;

Y is independently researched the Simo is About, CH, C=O or NR1;

n and R5have the meanings given above.

In other embodiments, the implementation of W together with N and Z form a group having a formula selected from the group consisting of:

where Z represents O, S, CR1, NR1or C=O;

each Z5is CR6, NR1or C=O, provided that Z and Z5if related, both are not NR1;

each R1represents H, C1-6alkyl, COR2or S(O)pR2where p is 1-2;

R6represents H or Deputy, known in this field, including, but not limited to, hydroxyl, alkyl, alkoxy, halogen atom, amino or amido; and

the ring S or the ring T can be saturated or unsaturated.

In some embodiments, the implementation of W together with N and Z form a 5-6-membered ring which is condensed with phenyl. In other embodiments, the implementation of W together with N and Z form a 5-6-membered ring which is optionally condensed with another ring, when U is NR1R2provided that U is not NH2. In some embodiments, the implementation of W together with N and Z form a 5-6-membered ring which is not condensed with another ring, when U is NR1R2(for example, NH2).

In another embodiment, connection to the present is the invention have the General formula (2A) or (2B):

where a, b, V, X, U, Z, Z1, Z2, Z3, Z4and n have the meanings defined above;

Z5represents O, NR1, CR6or C=O;

R6represents H, C1-6alkyl, hydroxyl, alkoxy, halogen atom, amino or amido; and

Z and Z5may optionally form a double bond.

In the above formulas (1), (2A) and (2B) U can imagine NR1R2where R1is N, and R2is1-10the alkyl, optionally substituted by a heteroatom, With3-6cycloalkyl, aryl or 5-14 membered heterocyclic ring containing one or more atoms of N, O and S. for Example, R2may present With1-10alkyl, substituted optionally substituted morpholine, thiomorpholine, imidazole, aminotetrazoles, pyrrolidine, piperazine, pyridine or piperidine. In other examples, R1and R2together with N form an optionally substituted piperidine, pyrrolidine, piperazine, morpholine, thiomorpholine, imidazole or aminoethanol.

In other embodiments, the implementation of U is NR1-(CR12)n-NR3R4; n is 1-4; and R3and R4in NR3R4together form an optionally substituted piperidine, pyrrolidine, piperazine, morpholine, thiomorpholine, imidazole or aminoethanol. In some of the examples which U represents NH-(CH 2)n-NR3R4; where R3and R4together with N form an optionally substituted pyrrolidine, which can be associated with (CH2)nin any position in the pyrolidine ring. In one embodiment, R3and R4together with N form a N-methylseleninic pyrrolidin. In other embodiments, the implementation of U is 2-(1-methylpyrrolidine-2-yl)ethylamino or (2-pyrrolidin-1-yl)ethanamine.

In the above formulas (1), (2A) and (2B) Z can represent S or NR1. In some embodiments, the implementation of at least one of V, X, or a represents a halogen atom, and Z1, Z2and Z3present C. In other embodiments, the implementation of each X and a is not H when Z2and Z3present C. In the above formulas (1), (2A) and (2B) V may represent H. In specific embodiments, the implementation of the U HE is not.

In one embodiment, each of the Z1, Z2, Z3and Z4is S. In another embodiment, three of the Z1, Z2, Z3and Z4present With, and the other is N. for Example, Z1, Z2and Z3are C and Z4is N. Alternatively, Z1, Z2and Z4are, and Z3is N. In other examples Z1, Z3and Z4are C and Z2is N. In another p the imarah Z 2, Z3and Z4are C and Z1is N.

In another embodiment, two of the Z1, Z2, Z3and Z4present With, and the other two are non-adjacent nitrogen atoms. For example, Z1and Z3can be S, and Z2and Z4represent N. Alternatively, Z1and Z3can be N, and Z2and Z4can imagine C. In other examples Z1and Z4are N, and Z2and Z3were C. specific examples of W together with N and Z form a 5-6-membered ring which is condensed with phenyl.

In some embodiments, the implementation of each of B, X, and V is N, and Z1-Z4are From. there are many ways of implementing at least one of V, X, and V is N, and the corresponding adjacent atom Z1-Z4is S. for Example, two of B, X, a and V can be N. In one example, V and M may both represent H. In other examples, any three of a, X, a and V represent N, and the corresponding adjacent atom Z1-Z4is C.

In some embodiments, the implementation of one of V, X, and V is a halogen atom (e.g. fluorine), and the corresponding adjacent atom Z1-Z4is S. In other embodiments, the implementation of two of X, and V is a halogen atom or SR2where R2is0-10alkyl or C2-1 alkenyl, optionally substituted by heteroatoms, carbocyclic ring, heterocyclic ring, aryl or heteroaryl; and the corresponding adjacent atom Z2-Z4is C. for Example, each X and may represent a halogen atom. In other examples, each X and, if present, may be SR2where R2is0-10alkyl, substituted phenyl or pyrazino. In some examples, V, and X can be akinyemi, fluorinated alkilani, such as CF3CH2CF3, perfluorinated alkilani etc.; cyano, nitro, inorganic salts, sulfonylamides or carbonyl derivatives, such as COR2.

In each of the above formulas U and X, V and A, if present, can be independently represent NR1R2where R1is N, and R2is1-10the alkyl, optionally substituted by a heteroatom, With3-6cycloalkyl, aryl or 5-14 membered heterocyclic ring containing one or more N, O or S. If the connection according to the invention is present in more than one group NR1R2for example, when both a and U represent NR1R2in connection with any of the above formulas, each R1and each R2choose independently. In one example, R2is1-10alkyl, substituted optional what about the substituted 5-14-membered heterocyclic ring. For example, R2may present With1-10alkyl, substituted morpholine, thiomorpholine, imidazole, aminotetrazoles, pyrrolidine, piperazine, pyridine or piperidine. Alternative, R1and R2together with N may form an optionally substituted heterocyclic ring containing one or more atoms of N, O, or S. for Example, R1and R2together with N may form a piperidine, pyrrolidine, piperazine, morpholine, thiomorpholine, imidazole or iminodiethanol.

Illustrative examples of the optionally substituted heterocyclic rings include, but are not limited to, tetrahydrofuran, 1,3-dioxolane, 2,3-dihydrofuran, tetrahydropyran, benzofuran, isobenzofuran, 1,3-dihydroisobenzofuran, isoxazol, 4,5-dihydroisoxazole, piperidine, pyrrolidine, pyrrolidin-2-it, pyrrole, pyridine, pyrimidine, octahedral[3,4-b]pyridine, piperazine, pyrazin, morpholine, thiomorpholine, imidazole, iminodiethanol, imidazolidin-2,4-dione, benzimidazole, 1,3-dehydrobenzperidol-2-it, indole, thiazole, benzothiazole, thiadiazole, thiophene, tetrahydrothiophene 1,1-dioxide, diazepin, triazole, diazabicyclo[2.2.1]heptane, 2,5-diazabicyclo[2.2.1]heptane and 2,3,4,4A,9,9a-hexahydro-1H-carbolin.

In one embodiment, the present invention relates to compounds of the General formula (1), (2A) or (2B)where:

each of A, V and, if available is t, independently represents H or a halogen atom (e.g. chlorine atom or fluorine);

X is -(R5R1R2where R5is C or N, and where each R5R1R2group R1and R2together may form optionally substituted aryl or heteroaryl ring;

Z represents NH or N-alkyl (for example, N-CH3);

W together with N and Z form an optionally substituted 5 - or 6-membered ring which is condensed with an optionally substituted aryl or heteroaryl ring; and

U represents-R5R6-(CH2)n-CHR2-NR3R4where R6is N or C1-10the alkyl, and where in the group-CHR2-NR3R4each R3and R4together with a may form an optionally substituted heterocyclic or heteroaryl ring, or where the group-CHR2-NR3R4each R3and R4together with N may form an optionally substituted carbocyclic, heterocyclic, aryl or heteroaryl ring.

In yet another embodiment, the present invention relates to compounds of the General formula (1), (2A) or (2B)where:

And, if present, is H or halogen atom (e.g. chlorine atom or fluorine);

X, if present, is -(R5R1R2where R 5represents C or N, and where each R5R1R2group R1and R2together may form optionally substituted aryl or heteroaryl ring;

Z represents NH or N-alkyl (for example, N-CH3);

W together with N and Z form an optionally substituted 5 - or 6-membered ring which is condensed with an optionally substituted aryl or heteroaryl ring; and

U represents-R5R6-(CH2)n-CHR2-NR3R4where R6is H or alkyl, and where in the group-CHR2-NR3R4each R3and R4together with a may form an optionally substituted heterocyclic or heteroaryl ring, or where the group-CHR2-NR3R4each R3and R4together with N may form an optionally substituted carbocyclic, heterocyclic, aryl or heteroaryl ring.

In each of the above formulas, each optionally substituted group may be substituted by one or more halogen atoms, OR2, NR1R2, carbamate,1-10the alkyl, C2-10alkenyl, each optionally substituted by a halogen atom,=O, aryl or one or more heteroatoms; inorganic substituents, aryl, carbocyclic or heterocyclic ring. Others who zamestitel include, but not limited to, quinil, cycloalkyl, fluorinated alkali, such as CF3, OCH2CF3; perfluorinated alkali etc.; oxidized fluorinated alkali, such as OCF3or OCH2CF3etc.; cyano, nitro, COR2, NR2COR2the sulfonylamides; NR2SOOR2; SR2, SOR2, COOR2, CONR22, OCOR2, OCOOR22, OCONR2, NRCOOR2, NRCONR22, NRC(NR)(NR22), NR(CO)NR22and SOONR22where each R2matter as defined for formula 1.

The present invention also relates to pharmaceutical compositions containing a compound of any of the foregoing formulae, and pharmaceutically acceptable excipient. In one example, the composition contains a compound of any of the above formulas, polyethylene glycol and propylene glycol in buffer solution.

In addition, the present invention relates to a method of suppressing cell proliferation and/or inducing cell death, comprising contacting the system with an effective amount of a compound of the formula or its pharmaceutical composition and optionally in combination with a chemotherapeutic agent, thereby inhibiting cell proliferation and/or inducyruya cell death, such as AP is ptosis or apoptotic cell death, in the specified system. The system may be a cell or tissue. In one embodiment, the system includes a cell of the pancreas, such as a cell from the subject or cultured cell (e.g., in vitro and ex vivo). In specific embodiments, the implementation of the system includes a cell malignant tumors of the pancreas. In one embodiment, the system is a cell line, such as RS, ST, NT, MIA Paca-2, HPAC, Hs700T, Panc 10.05, Panc 02.13, PL45, SW 190, Hs766T, CFPAC-1 and PANC-1.

The present invention also relates to a method of weakening of cell proliferative disorders, comprising the administration to a subject in need, an effective amount of a compound of the formula or its pharmaceutical composition and optionally in combination with a chemotherapeutic agent, thereby weakening the specified cell proliferative disorder. For example, cell proliferation can be reduced and/or may be induced cell death, such as apoptosis or apoptotic cell death. The cell proliferative disorder may be a tumor or a malignant tumor in a human or animal. In a specific embodiment, a malignant tumor is a malignant disease of the pancreas, including endocrine and e is docrine tumors. Illustrative examples endocrinic tumors include, but are not limited to, adenocarcinoma, carcinoma of the exocrine part, glandular squamous cell carcinoma, giant cell tumor, vnutrimatocny papillary mucinous neoplasms, mucinous cystadenocarcinoma, pancreatoblastoma, serous cystadenoma, solid and pseudopapillary tumors. Endocrine tumor may represent a tumor of the islets of Langerhans.

The above methods of suppressing cell proliferation and/or inducing cell death can be used in practice in combination with the procedure and/or chemotherapeutic agent. Examples of procedures that can be used in combination with the methods of the present invention, include, but are not limited to, radiation therapy or surgery. In some embodiments, the communication of the present invention is administered in combination with gemcitabine, and used for suppression of cell proliferation, induction of cell death and/or attenuation of cell proliferative disorders.

In addition, the present invention relates to a method of reducing the titles of microbes, comprising contacting the system with an effective amount of a compound of the formula or its pharmaceutical composition and not necessarily to what Binali with antimicrobial agent, thereby reducing the titles of microbes. The system may be a cell or tissue. The present invention also relates to a method of weakening of cell proliferative disorders, comprising the administration to a subject in need, an effective amount of a compound of the formula or its pharmaceutical composition and optionally in combination with antimicrobial agent, thereby weakening the specified microbial infection. The subject may be a human or an animal. The titles of microbes can be titers of viruses, bacteria or fungi.

The present invention also relates to methods of determining the selectivity of the interaction between the compound of any of the above formulas and nucleic acids are capable of forming QUADRUPLEX structure, comprising: a) contacting the compound in the absence of competitive molecules with three or more nucleic acids capable of forming quadruplexes patterns, where each nucleic acid is not telomeric nucleic acid; (b) the definition of direct interaction between the compound and three or more nucleic acids; and C) determining the selectivity of interaction as a result of comparison of data for the interaction. In one example, three or more nucleic what the slot include the nucleotide sequence, located on the 5'-end nucleotide sequence of the oncogene. Oncogene may be a MYC, HIF, VEGF, ABL, TGF, PDGFα, MYB, SPARC, HER, VAV, RET, H-RAS, EGF, SRC, and BCL-1, BCL-2, DHFR or HMGA. When determining the selectivity of the interaction of the connection can be subject to individual contact with each of the three or more nucleic acids in a variety of containers. In addition, the selectivity of the interaction can be determined by comparing the values of the IC50.

Compounds of the present invention can interact or not to interact with regions of DNA that can form QUADRUPLEX. In some embodiments, the communication according to the present invention may contact and/or to stabilize the "propeller" QUADRUPLEX. Examples of "propeller" quadruplexes include, but are not limited to, H-RAS, RET, BCL-1, DHFR, TGF-β, HIF-1α, VEGF, c-Myc or PDGFα. In another embodiment, the connection may contact and/or stabilize "pancake" QUADRUPLEX. For example, the connection may contact and/or stabilize BCL-2.

The present invention also relates to methods of inducing cell death, such as apoptotic cell death (apoptosis), which includes the introduction in the system or subject in need, an effective amount of a compound of any of the above four is str or its pharmaceutical composition and optionally in combination with a chemotherapeutic agent. The present invention also relates to methods for treating or attenuating the disturbance-mediated overexpression of an oncogene, such as overexpression of C-ICC, including the introduction of a system or subject in need, an effective amount of a compound of the formula or its pharmaceutical composition, and optionally in combination with a chemotherapeutic agent. The subject may be a human or an animal, and the system may be a cell or tissue.

In another aspect, the present invention relates to methods of preparing compounds of the formula (3):

or formula (4),

comprising contacting a complex ether, other1R2and Lewis acid, where the specified ether has the formula (5)

or the formula (6)

where a, b, V, X, R1, R2, R5Z, Z1, Z2, Z3, Z4and n have the meanings given above for formula (1);

W together with N and Z form an optionally substituted 5 - or 6-membered ring which is condensed with an optionally substituted aryl or heteroaryl where specified aryl or heteroaryl may be monocyclic or condensed with one or more rings and where indicated which ring optionally contains a heteroatom;

W1represents optionally substituted aryl or heteroaryl, which may be monocyclic or condensed with one or more rings, and optionally contain a heteroatom;

Z5represents C or N, provided that Z5is, if Z represents O, S or NR1and the additional condition that Z and Z6are not N, if Z5is N; and

Z6, Z7and Z8independently represent C or N, provided that two N are non-contiguous.

Current methods of producing compounds of the formula (3)include amide combination of ester with an amine in the presence of a Lewis acid such as aluminum chloride. Suitable Lewis acid may be selected by holding the control reactions and the determination of the amount of the formed reaction product, as described below. For these methods do not require hydrolysis of the ester to carboxylic acid before amide combination. Thus, these methods are more simple. As shown in example 29, the present methods also provide a higher yield and purity compared with the methods of the prior art, which requires hydrolysis of the ester to the acid (example 30).

In another embodiment, the Lewis acid has the formula m lnwhere L is at the m halogen or an organic radical, n is 3-5, and M is an atom of an element of group III atom of an element of group IV, As, Sb, V and Fe.

In the above methods, the stage of contacting can be performed at room temperature. Alternatively, ether, amine and the Lewis acid can be subjected to interaction at a lower or higher temperature compared with room temperature, which can be determined by a specialist in this field.

In one example, the stage of contacting includes the interaction between ether and amine in an organic solvent to form a solution and the interaction of the solution with a Lewis acid. In one example, the organic solvent is methylene chloride. The reaction can also be performed using other suitable solvents known in this field.

In one embodiment, it is possible to use an excess of amine relative to the ether. For example, the ratio of ester to amine may be 1:2, 1:1.5 or 1:1,25.

In another embodiment, it is possible to use equimolar amounts of Lewis acid to amine. Alternatively, you can use more or fewer Lewis acid relative to the amine.

The above methods further include the selection of compounds any one of the formulae given above. The selected compound can be further purified using any method known in this field. For example, the selected compound can be cleared column chromatography, recrystallization or by both methods.

In the above methods, the purity of the isolated compounds may be in the range of from 90 to 99%. For example, the selected compound may have a purity of from 90 to 95%.

In the above methods, the ester can be subjected to interaction with other1R2,

where R1represents a group (CR32)n;

R2is NR3R4;

R3is N or C1-6by alkyl;

n is 1-6; and

R4represents N or C1-10alkyl or C2-10alkenyl, optionally containing one or more non-adjacent heteroatoms selected from N, O and S, and optionally substituted carbocyclic or heterocyclic ring; and

where NR3R4group R3and R4can form an optionally substituted ring, such as described above.

Figure 1-10 shows the activity of examples of compounds of the present invention on the model of transplant malignant tumors of the colon HCT-116.

Definition

As used herein, the term "alkyl" refers to carbon-containing compound and includes compounds containing one or more heteroatoms. The term "alkyl" also includes alkali, someseni is one or more substituents, including, but not limited to, OR1, amino, amido, halogen atom, =O, aryl, heterocyclic group or inorganic substituents.

As used herein, the term "carbocycle" refers to a cyclic compound containing only carbon atoms in the ring, while the "heterocycle" refers to a cyclic compound containing heteroatom. Carbocyclic and heterocyclic structure include compounds having a monocyclic, bicyclic or multiple ring system.

As used herein, the term "aryl" refers to a polyunsaturated, typically aromatic hydrocarbon Deputy, while the terms "heteroaryl" or "heteroaromatic" refers to an aromatic ring containing a heteroatom. Aryl and heteroaryl structures include compounds having a monocyclic, bicyclic or multiple ring system.

As used herein, the term "heteroatom" refers to any atom that is not carbon or hydrogen, such as nitrogen atom, oxygen or sulfur.

Illustrative examples include, but are not limited to, 1,3-dioxolane, 2,3-dihydrofuran, Piran, tetrahydropyran, benzofuran, isobenzofuran, 1,3-dihydroisobenzofuran, isoxazol, 4,5-dihydroisoxazole, piperidine, Pyrrhus is lidin, pyrrolidin-2-it, pyrrole, pyridine, pyrimidine, octahedral[3,4-b]pyridine, piperazine, pyrazin, morpholine, thiomorpholine, imidazole, imidazolidine-2,4-dione, 1,3-dehydrobenzperidol-2-it, indole, thiazole, benzothiazole, thiadiazole, thiophene, tetrahydrothiophene 1,1-dioxide, diazepin, triazole, guanidine, diazabicyclo[2.2.1]heptane, 2,5-diazabicyclo[2.2.1]heptane, 2,3,4,4A,9,9a-hexahydro-1H-carbolin, oxiran, oxetan, tetrahydropyran, dioxane, lactones, aziridine, azetidine, piperidine, lactams, and they may also include heteroaryl. Other illustrative examples include, but are not limited to, furan, pyrrole, pyridine, pyrimidine, imidazole, benzimidazole and triazole.

As used herein, the term "inorganic Deputy" refers to substituents that do not contain carbon or contain carbon associated with elements other than hydrogen (e.g., elemental carbon, carbon monoxide, carbon dioxide and carbonate). Examples of inorganic substituents include, but are not limited to, nitro, halogen atom, sulfonyl, sulfinyl, phosphates, etc.

The terms "treat", "treatment" and "therapeutic effect"as used herein, refer to suppress or stop the proliferation of cells (e.g., slow or stop tumor growth) or decrease in the number of proliferating malignant cells (the example the removal of part or all of a tumor). These terms also apply to lower titers of microorganisms in the system (i.e. in the cell, tissue or subject)that is infected with a microorganism, reducing the speed of propagation of microorganisms, reduction of the number of symptoms or manifestation of a symptom associated with a microbial infection and/or release detectable quantities of germs from the system. Examples of the microorganism include, but are not limited to, a virus, bacterium or fungus.

As used herein, the term "chemotherapeutic agent" refers to therapeutic tool that can be used to cure or ameliorate cell proliferative disorders, such as tumors or malignant disease. Examples of chemotherapeutic agents include, but are not limited to, anti-tumors, an alkylating agent, an alkaloid of plant origin, antimicrobial agent, a sulfonamide, an antiviral agent, means on the basis of platinum antitumor agents known in this field. Specific examples of chemotherapeutic agents include, but are not limited to, cisplatin, carboplatin, busulfan, methotrexate, daunorubicin, doxorubicin, cyclophosphamide, mephalan, vincristine, vinblastine, chlorambucil, paclitaxel, gemcitabine, and others, know the design and engineering in this area (See, for example, Goodman&Gilman's, The Pharmacological Basis of Therapeutics (9thEd) (Goodman et al., eds.) (McGraw-Hill) (1996) and 1999 Physician''s Desk Reference (1998)).

As used herein, the term "apoptosis" refers to the characteristic of cell self-destruction or suicide program. In response to "triggers" stimulus cells are subjected to a cascade of events, including shrinkage of cells, the formation of vesicles from the cell membrane and condensation and fragmentation of chromatin. These events lead to the transformation of cells into "clusters" of related membrane particles (apoptotic bodies), which are then absorbed by macrophages.

The present invention relates to quinolone derivative of the General formula (1), (2A) and (2B) and their pharmaceutically acceptable salts, esters and prodrugs. The present invention also relates to methods of using compounds described in this description, for example, for screening and treatment. Compounds of the present invention can interact or not to interact with regions of DNA that can form QUADRUPLEX.

Compounds of the present invention, having the formula (1), (2A) and (2B)below:

where a, b, V, X, Z, Z1, Z2, Z3, Z4X2and n have the meanings given above.

Synthetic methods for obtaining the of soedinenii of the present invention represented by the reaction scheme 1 and in the examples. You can also use other options of synthetic methods known to experts in this field, to obtain the compounds of the present invention. For example, you can use various protective groups in obtaining intermediates illustrated in the side chain 1 (see, in particular, example 31).

The scheme of reactions 1

Compounds of the present invention can be chiral. As used herein, the term, chiral compound is a compound that differs from its mirroring, and has enantiomer. In addition, the connection may be a racemate or a dedicated enantiomer or stereoisomer. Methods of synthesis of chiral compounds and methods for the separation of racemic mixtures of enantiomers is well known to specialists in this field. See, for example, March, Advanced Organic Chemistry", John Wiley and Sons, Inc., New York, (1985), included in this description by reference.

Compounds of the present invention was tested using screening tests, such as described in this description. Figure 1-10 presents data on the activity of exemplary compounds of the present invention in xenograft models slok the quality of tumors of the colon HCT-116. Some compounds showed no activity at this dose.

Illustrative examples of the compounds having the above formula are presented in table 1 (a-C) and in the examples. The present invention also includes other compounds of any of formulas (1), (2A) and (2B), containing substituents U, A, X, V and V, independently selected from the substituents shown in table 1 (a-C) and in the examples. For example, Deputy isopropyl in the last two compounds in table 1A can be replaced acetyl Deputy or N-CH3in the condensed ring may be substituted NH-group. In addition, the fluorine atom can be replaced by N. Thus, the present invention is not limited to the specific combination of the substituents described in the various embodiments, the implementation presented below.

Table 1A

Table 1B

Compounds described herein, can interact with the fields of nucleic acids that can form QUADRUPLEX. Because the field of DNA that can form quadruplexes, are regulators of biological processes, such as transcription of the oncogene, the modulators of the biological activity of quadruplexes can be used as medicines for the treatment of malignant diseases. Molecules that vzaimode setout regions of DNA, which is able to form QUADRUPLEX, can exhibit a therapeutic effect on certain cell proliferative disorders, and loved ones conditions. In particular, abnormally high expression of the oncogene can lead to the development of cell proliferative disorders, and, as a rule, quadruplexes patterns lead to a decrease in the expression of the oncogene. Examples of oncogenes include, but are not limited to, MYC, HIF, VEGF, ABL, TGF, PDGFA, MYB, SPARC, HUMTEL, HER, VAV, RET, H-RAS, EGF, SRC, BCL1, BCL2, DHFR, HMGA and other oncogenes known to specialists in this field. In addition, the compounds described herein, can induce cell death (e.g. apoptosis) and not interact with regions of DNA that can form QUADRUPLEX.

Molecules that are associated with regions of DNA that can form QUADRUPLEX capable to demonstrate biological activity through various mechanisms that include, for example, stabilization of natural quadruplexes patterns, inhibiting the conversion of natural QUADRUPLEX in duplex DNA by blocking cleavage of the chain and stabilization of natural quadruplexes structure having a nucleotide substitution resulting in destabilization of quadruplets, and other specific interaction sequences. Thus, compounds that are associated with what blastema DNA which can form QUADRUPLEX described in this description, you can enter into cells, tissues or organisms in order to reduce transcription of the oncogene and thereby the treatment of cellular proliferative disorders.

Determining whether the biological activity of natural DNA, which can form QUADRUPLEX, is modulated in a cell, tissue or organism, it is possible to carry out the monitoring of the biological activity of quadruplets. Forming QUADRUPLEX biological activity of DNA can be traced in cells, tissues or organisms, for example, when determining the reduction or amplification of gene transcription in response to interaction forming QUADRUPLEX DNA molecule. Transcription can be used to detect the direct determination of the RNA transcripts, or the identification of polypeptides translated the transcripts, and these methods are well known to specialists in this field.

Molecules that interact with forming QUADRUPLEX DNA or forming QUADRUPLEX nucleic acids, can be used for treatment of many cellular proliferative disorders. Cell proliferative disorders include, for example, malignant tumors of the colon and malignant diseases of the hematopoietic system (e.g., diseases involving hyperplastic/neoplastic the Kie cells of hematopoietic origin, such as originating from myeloid, lymphoid or erythroid cells or their precursor cells). In poorly differentiated acute leukemias can develop, for example, urethroplasty leukemia and acute megakaryoblastic leukemia. Additional myeloid disorders include, but are not limited to, acute promyeloid leukemia (APML), acute myeloid leukemia (AML) acute and chronic myeloid leukemia (CML) (Vaickus, Crit. Rev. in Oncol./Hemotol. 11: 267-297 (1991). Lymphoid malignant diseases include, but are not limited to, acute lymphoblastic leukemia (ALL), which includes b-cell ALL and T-cell ALL, chronic lymphocytic leukemia (CLL), prelimiinary leukemia (PLL), leukemia retikulez (HLL) and macroglobulinemia waldenstrom (WM). Additional forms of malignant lymphomas include, but are not limited to, non-Hodgkins lymphoma and its variants, T-cell, peripheral lymphoma, T-cell leukemia/lymphoma adult (ATL)T-cell cutaneous lymphoma (CTCL), both granular lymphocytic leukemia (LGF), Hodgkin's disease and reed disease-Sternberg. Cell proliferative disorders also include malignant tumors of the colon, breast, lung, pancreas, lymph nodes, colon, prostate, brain, head and neck, skin, liver, kidney and heart. Compounds that interact with regions of DNA that are capable to form QUADRUPLEX, can also be used for targeted impact on the processes and conditions associated with malignant tumors, such as enhanced angiogenesis, suppression of angiogenesis in the subject.

The present invention relates to a method of suppressing cell proliferation or treatment or attenuation of cell proliferative disorders, comprising contacting the system with natural DNA, can form QUADRUPLEX area, connection with any of the above formulas. The system can represent a group of cells or one or more fabrics. In one embodiment, the system is subject in need of treatment of cell proliferative disorders (e.g., a mammal such as a mouse, rat, monkey or human). The present invention also relates to a method of treatment of malignant tumors of the colon by introducing the compound that interacts with forming QUADRUPLEX region of c-MYC, to a subject in need of it, thereby inhibiting the proliferation of malignant tumor cells of the colon. In addition, the present invention relates to a method of suppressing angiogenesis and optional treatment of malignant tumors, is provided with angiogenesis, involving the introduction of a compound that interacts with forming QUADRUPLEX region vascular endothelial growth factor (VEGF), to a subject in need, thereby inhibiting angiogenesis, and optional treatment of malignant tumor-related angiogenesis.

Compounds that interact with forming QUADRUPLEX regions of DNA can also be used to suppress microbial infection, such as viral infection. Retroviruses represent potential targets for drugs with purposeful action on the G-QUADRUPLEX. G-quadruplexes patterns are as functional elements, at least two secondary structures formed of viral RNA or DNA in HIV linker dimer structure (DLS) and the Central DNA fragment (CDF). Additionally, DNA aptamers which can be inter - or intramolecular quadruplexes patterns that can inhibit viral replication. In one example, DNA aptamers are able to suppress viral replication purposeful action on the shell of the glycoprotein (presumably). In another example, the DNA aptamers inhibit the replication of viruses purposeful action, respectively, on the integrase of HIV, on the basis of what can be assumed about the participation of natural quadruple the red structures in interaction with the enzyme integrase.

Dimer linker structures that are common to all retroviruses, are used to bind two copies of the viral genome by non-covalent interactions between the two 5'-ends of two sequences of viral RNA. Genomic dimer stably associated with gag-protein in the Mature virus particle. In the case of HIV, this non-covalent binding is provided by the sequence of 98 base pairs containing multiple residues, at least two consecutive guanine (for example, in the 3'-end formation of RNA dimers in vitro). In the observed dependence of the cation (potassium ions) for the formation and stability of the dimer in vitro in addition to the lack of ability of an antisense sequence to the effective dimerization was determined that the most probable structure for bonding is an intermolecular G-QUADRUPLEX.

Before integration into the host genome back transcribed viral DNA forms preintegration complex (PIC), at least two major viral proteins, integrase and reverse transcriptase, which is then transferred to the nucleus. The Central DNA fragment (CDF) refers to single-stranded tail +chain of 99 grounds near the centre of viral duplex DNA, which is known that it plays a role in ensuring that Sadra. It was shown that oligonucleotide mimetics form intermolecular G-quadruplexes patterns in cell-free systems.

Thus, compounds which react to form QUADRUPLEX region, can be used to stabilize the dimer linker structure and, thus, to prevent the separation of the two RNA chains. Also when linking with quadruplexes structure formed by CDF, can disrupt recognition and/or binding protein for transport of the PIC into the nucleus. In any case may have a significant advantage compared to other antiviral drugs. Modern highly active antiviral therapeutic schemes (HAART) based on the use of combinations of drugs, their action aimed at HIV protease and HIV integrase. The need for the schemes with the use of many drugs is to minimize the risk of development of resistance, which usually develops quickly when drugs are used separately. The reason for this rapid development of resistance is the variability of the enzyme reverse transcriptase, which is subject to mutation with a frequency of approximately one in every 10,000 base pairs. The advantage of directional effects on viral quadruplexes patterns compared with the protein-Mish is, gives is the development of resistance is slower or is impossible. Point mutation of QUADRUPLEX target may compromise the integrity quadruplexes patterns and lead to non-functional copies of the virus. One drug on the basis of this mechanism of action can replace the scheme with the use of many drugs used currently, with the attendant advantages consisting in a lower cost of treatment and the elimination of negative consequences of the interaction of the drug with the drug.

The present invention relates to a method for reducing the titre of microbes in the system, including communication systems with natural forming QUADRUPLEX region DNA connection with any of the above formulas. The system may present one or more cells or tissues. Examples of titles microbes include, but are not limited to, the titers of viruses, bacteria or fungi. In a particular variant embodiment of the system is the subject in need of treatment of a viral infection (e.g., a mammal such as a mouse, rat, monkey or human). Examples of viral infections include infections caused by hepatitis a virus (such as hepatitis), human immunodeficiency virus (HIV), rhinoviruses, shingles VIR is som (VZV), simple herpes virus (e.g., HSV-1 or HSV-2), cytomegalovirus (CMV), vaccinia virus, influenza virus, viral encephalitis, Hantavirus, arboviruses, West Nile virus, human papilloma virus (HPV), the virus of Epstein-Barr and respiratory intitially virus. The present invention also relates to a method of treating HIV infection by introducing the compound of any of formulae above to a subject in need, thereby inhibiting HIV infection.

Identification of compounds that can contact forming QUADRUPLEX regions of DNA.

Compounds described herein, can contact forming QUADRUPLEX regions of the DNA, where the biological activity of this area, often expressed in the form of a "signal", reproduced in the system containing compound, different from the signal produced in the system not containing the compound. Despite the fact that the background signals can be defined each time the evaluation of new molecules in the test, the background detection signal is not required every time, when I analyze a new molecule.

Examples of forming QUADRUPLEX nucleotide sequences presented in table 2.

Table 2

In addition to determining whether the test molecule or t is streema nucleic acid induce different signal, it is possible to quantify the affinity of interaction between nucleic acid and connection. It is possible to conduct a comparative analysis thresholds IC50, Kd and Ki, the set IC50or Kd for each interaction and thereby to identify a test molecule as interacting with QUADRUPLEX molecules or test nucleic acid as forming QUADRUPLEX nucleic acid. For example, often use a threshold IC50or Kd of 10 μm or less, 1 μm or less and 100 nm or below. In one example, you can use the threshold value of 10 nm or less, 1 nm or below 100 RMB or below and 10 RMB or below, to identify interacting with QUADRUPLEX molecules and forming QUADRUPLEX nucleic acids.

To identify compounds that have affinity for forming QUADRUPLEX regions of DNA, there are many tests. In some of these tests biological activity is binding quadruplexes nucleic acid with the compound, and the binding is determined in the form of a signal. In other tests, the biological activity is a blocking function polymerase QUADRUPLEX, and the degree of blocking is determined in the form of a signal. In some tests of biological activity is transcripts what I and the levels of transcription can be measured quantitatively in the form of a signal. In another test the biological activity is cell death, and in this case, quantify the number of cells affected by the death. In other tests determine the intensity of proliferation of malignant cells. Examples of tests are tests of binding fluorescence analysis of changes in the mobility in the gel (see, e.g., Jin&Pike, Mol. Endocrinol. (1996) 10: 196-205), tests of the blocking polymerase, reporter tests transcription, the tests for determining the proliferation of malignant cells and tests evaluation of apoptosis (see, e.g., Amersham Biosciences (Piscataway, New Jersey), and variants of embodiment of such tests are described below. To determine how interacting with QUADRUPLEX molecules have activity of topoisomerases, you can use tests based on the determination of the activity of topoisomerase (see, for example, TopoGEN, Inc. (Columbus, Ohio)).

Test determination of change of electrophoretic mobility in the gel (EMSA)

Test EMSA is suitable for determining whether the nucleic acid forms QUADRUPLEX and how the nucleotide sequence is destabilizing QUADRUPLEX. EMSA were carried out as described previously (Jin&Pike, Mol. Endocrinol. 10: 196-205 (1996)), with minor modifications. In General, synthetic adnotation the e oligonucleotides mark in the 5'-end of the T-kinase in the presence of [ 32P]ATP (1000 MCI/mol, Amersham Life Science) and purified on a column of Sephadex. Then32P-labeled oligonucleotides (≈30000 pulses/min) incubated with or without test compounds in varying concentrations in 20 μl of buffer containing 10 mm Tris pH 7.5, 100 mm KCl, 5 mm dithiothreitol, 0.1 mm EDTA, 5 mm MgCl2, 10% glycerol, 0.05% of Nonedit P-40 and 0.1 mg/ml poly(dI-dC) (Pharmacia). After incubation for 20 min at room temperature the reaction mixture to bind applied to 5% polyacrylamide gel in 0.25 in× borate-EDTA buffer (0,25× TBE, 1× TBE is 89 mm Tris-borate, pH 8.0, 1 mm EDTA). The gel is dried and quantify each strip using postvisualization.

Test protection from DMS methylation

Chemical tests "Footprinting are suitable for determining quadruplexes patterns. QUADRUPLEX structure evaluate when determining which nucleotides in the nucleic acid are secured or unsecured from chemical modification, as available or not available, for modifying reagent. Test DMS methylation is an example of a chemical test "Footprinting". In this test, allocate bandwidth and subjected to EMSA DMS-induced splitting of the bands. Each interest strip cut out from the gel to determine the changes in electrophoretic mobility and pogruzhaet 100 mm KCl solution (300 μl) for 6 h at 4° C. the Solution is filtered (microcentrifuge) and 30000 pulses/min (the reaction mixture) of DNA solution diluted an additional 100 mm KCl in 0.1× THOSE to a total volume of 70 μl (reaction mixture). After adding 1 μl of DNA salmon sperm (0.1 ág/ál) of the reaction mixture was incubated with 1 μl of a solution of DMS (DMS:ethanol; 4:1, vol/about.) over a period of time. Each reaction mixture was quenched with 18 μl of stop buffer (a mixture of b-mercaptoethanol:water:NaOAc (3M); 1:6:7;./about./vol.). After precipitation with ethanol (twice) and cleavage by piperidine reaction mixture is separated in a preparative gel (16%) and visualize postvisualization.

Test blocking polymerase

The test block includes a nucleic acid matrix, which may include forming QUADRUPLEX sequence, primer nucleic acids that hybridizes with the 5'-end of nucleic acid-matrix, forming QUADRUPLEX sequence. Primer lengthen using polymerase (such as Taq polymerase), which extends from the primer along the nucleic acid matrix. In this test QUADRUPLEX structure can block or stop the progress of the enzyme, leading to the formation of shorter transcriptional fragments. The test block can be done at various temperatures, including 45°s and 60°and under various con is intratech ions.

An example of a stop-test Taq polymerase described by Han et al., in Nucl. Acids Res. (1999) 27: 537-542, this method represents a modification of the method used Weitzmann et al., J. Biol. Chem. (1996) 271: 20958-20964. Briefly, the reaction mixture DNA template (50 nm), Tris·HCl (50 mm), MgCl2(10 mm), DTT (0.5 mm), EDTA (0.1 mm), BSA (60 ng) and labeled at the 5'-end quadruplexes nucleic acid (≈18 nm) is heated to 90°C for 5 min and cooled to room temperature for 30 min. the reaction mixture contribute Taq polymerase (1 μl) and the reaction mixture was kept at constant temperature for 30 minutes After adding 10 μl of stop buffer (formamide (20 ml), 1M NaOH (200 µl), 0.5 m EDTA (400 μl) and 10 mg of bromophenol blue) of the reaction mixture are separated in a preparative gel (12%) and visualize postvisualization. Spend adenine-sequencing (indicated in the upper part of the gel) using cyclic system sequencing double-stranded DNA production Life Technologies. The General sequence of matrix circuits is a TCCAACTATGTATAC-insert-TTAGCGACACGCAATTGCTATTAGTGAGTCGTATTA, where "insert" refers to nucleic acid sequences forming QUADRUPLEX sequence (see, for example, table 2). Bands on the gel, indicating a lower mobility, indicate the formation of QUADRUPLEX.

Test blocking polymerase with high throughput act is a functioning

Developed test blocking polymerase with high throughput. The test includes the interaction matrix nucleic acid, usually DNA primer, which is also often represents the DNA; the interaction of complex primer/matrix connection described in this description also applies to "test connection"); contacting the complex primer/matrix polymerase and separation of the reaction products. Test often includes a step of denaturation mixture of complex primer/matrix and then renaturation complex, which is usually carried out before making the test molecule in the system. Usually spend a lot of tests using different concentrations of the tested compounds so that, for example, you could set the value of the IC50. Often the reaction products include accrued primers of different lengths. In those cases, when the test compound does not significantly interact with QUADRUPLEX structure in the matrix, the primer is usually extended at the end of the matrix.

In those cases, when the test compound significantly interacts with quadruplexes structure in the matrix, the primer is usually increased only in quadruplexes structure in the matrix and not the next. Normally, therefore, the reaction mixture comprises at least two reaction product, when tested the the group interacts with quadruplexes structure in the matrix, one with a fully extended primer and one is not fully extended primer, and these two reaction product separated. Products can be divided using any suitable method of separation, such as mass spectrometry and in one embodiment is capillary electrophoresis.

Typically the reaction products identified by detecting the detectable label associated with the primer. Detected label may be ecovalence linked to the 5'-end of the primer (e.g., Biotin molecule covalently linked to the 5'-end of the primer, which ecovalence associated with the molecule avidin associated with a detectable label). Detektiruya label can be associated with the primer at any stage of the test, sometimes before making primer in the system, after extension of the primer or after separation of the products. Usually detektiruya label covalently associated with the primer using methods based on the nature of the chemical groups in a detectable label.

There are many methods for covalent binding of detectable labels to nucleic acids, such as chemical combination allylamine-derivatizing nucleotide derived from Succinimidyl ether detectable label and then getting the primer using a labeled nucleotide (see, e.g., Nature Biotech. (2000) 18: 345-348 and on the website http://info.med.yae.edu/genetics/ward/tavi/n_coupling.html). In some cases, include a spacer (usually length 5-16 carbon atoms) between the detectable label and the nucleotide. You can use any suitable detektiruya label, including but not limited to, a radioactive isotope (for example,125I131I35S32P,14C and3N); light-scattering label (for example, spherical gold or silver; Genicon Sciences Corporation, San Diego, CA, and U.S. patent No. 6214560); enzyme or protein tag (e.g., GFP or peroxidase) or in some cases use a different chromogenic label, or paint. Often used fluorescent label (e.g., aminotetralin (AMS); diethylaminocoumarin (DEAC); cascade blue (CB); fluoresceinisothiocyanate (FITC), Oregon green (OG); Alexa 488 (A488); rhodamine green (RGr); chelate lanthanide (for example, Europe), carboxyrhodamine 6G (R6G); tetramethylrhodamine (TAMRA); Texas red (TxR); SS3; SS3,5; So; Co,5; and carboxynaphthalene (CNF), digoxigenin (DIG) and 2,4-dinitrophenyl (DNP)). Other fluorophores and the corresponding values of the wavelengths of excitation and emission are described Anantha et al., Biochemistry (1998) 37: 2709-2714 and Qu & Chaires, Methods Enzymol., (2000) 321: 353-369).

In one embodiment, the oligonucleotide primer covalently linked to a fluorescent label, in contact with the matrix DNA. The resulting complex is contacted with the test molecule and then with polymerase, methods for the Noah to extend the primer. Then the reaction products are separated and detected by capillary electrophoresis. Used primer with a longer sequence for the practical application of this variant of implementation compared to the implementation in which the primer includes a covalently linked fluorophore or when separation is not using capillary electrophoresis. Deoxynucleotide add at any stage of the test before the separation, usually when the primer is in contact with the DNA matrix. As a rule, the complex DNA-matrix/primer is subjected to denaturation (for example, when the temperature of the system) and then renaturation (for example, when cooling the system) to make the test connections).

Test binding QUADRUPLEX

Typically, 5'-labeled with a fluorescent label (FAM) primer (P45, 15 nm) was mixed with the DNA-matrix (15 nm) in Tris-HCl buffer (15 mm Tris, pH 7.5)containing 10 mm MgCl2, 0.1 mm EDTA and 0.1 mm of a mixture of deoxynucleotides (dNTP). In one example, the synthesized primer FAM-P45 (5'-6FAM-AGTCTGACTGACTGTACGTAGCTAATACGACTCACTATAGCAATT-3') (SEQ ID NO 17) and DNA-matrix-ICC (5'-TCCAACTATGTATACTGGGGAGGGTGGGGAGGGTGGGGAAGGTTAGCGACACGCAATTGCTATAGTGAGTCGTATTAGCTACGTACAGTCAGTCAGACT-3') (SEQ ID NO 18) and were HPLC purified by chromatograph production Applied Biosystems. The mixture was denaturiruet at 95°C for 5 min and after cooling to room temperature, incubated at 37°C for 15 minutes

After ohla the Denia to room temperature was made 1 mm KCl and the test compound (various concentrations) and the mixture incubated for 15 min at room temperature. The elongation of the primer was performed by adding 10 mm KCl and DNA Taq polymerase (2.5 u/reaction, Promega) and incubation at 70°C for 30 minutes the Reaction was stopped by adding 1 µl of the reaction mixture to 10 μl of formamide Hi-Di and 0.25 ál of standard size LIZ120. Formamide Hi-Di and standard size LIZ120 were obtained from Applied Biosystems. Partially elongated product block QUADRUPLEX had dimensions within 61-62 grounds, and a full-sized elongated product was 99 length basis. The products were separated and analyzed by capillary electrophoresis. Capillary electrophoresis was performed using analyzer ABI PRISM 3100-Avant Genetic Analyzer. The test was performed using compounds described above, and the results are shown in table 1. Values of the concentration in μm, are shown in table 1 represent the concentration at which there is a 50% blocking DNA in the test (i.e. the ratio of the shorter partially extended DNA (blocked DNA) to the full-length DNA is 1:1).

Reporter test transcription

In reporter test definitions transcription test QUADRUPLEX DNA combine with reporter system so that the formation or stabilization quadruplexes patterns can modulate the signal of the reporter. An example of such system is expressing system reporter, in which the polyp is Ted, such as luciferase or green fluorescent protein (GFP), expressed gene, operable associated with potential forming QUADRUPLEX nucleic acid, and can be used to detect the expression of the polypeptide. As used herein, the term "operable linked" refers to a nucleotide sequence that is under the control of sequences containing potential forming QUADRUPLEX nucleic acid. The sequence may be operable connected when it is in the same nucleic acid as QUADRUPLEX DNA, or other nucleic acid. In this case describes the approximate reporter system luciferase.

Promoter test luciferase described by He et al., Science (1998) 281: 1509-1512, often used to study the formation QUADRUPLEX. In particular, the vector used for production test, presented in reference 11 of the document He et al. In this test HeLa cells transposition using based on lipofectamine 2000 system (Invitrogen) according to the manufacturer's Protocol, using a 0.1 μg pRL-TK (reporter plasmid luciferase Renilla) and 0.9 µg forming QUADRUPLEX plasmids. Determine the activity of the Firefly luciferase and Renilla dual test of determination of the luciferase reporter (Promega) in the format of a 96-well agreement tablet is but the Protocol of the manufacturer.

Test circular dichroism

Circular dichroism (CD) is used to determine whether another molecule interacts with quadruplexes nucleic acid. CD is particularly suitable for determining whether PNA or PNA conjugate-peptide hybridized with quadruplexes nucleic acid in vitro. PNA-probes add to QUADRUPLEX DNA (each at 5 mm) in a buffer containing 10 mm potassium phosphate (pH of 7.2) and 10 or 25 mm KCl at 37°and then incubated for 5 min at the same temperature before removing the spectrum. CD spectra shoot at spectropolarimeter Jasco J-715 equipped termoelektricheskii controlled by the holder with a single cell. Usually the intensity of the CD is determined at the wavelength ranging from 220 nm to 320 nm and get comparative spectra for one QUADRUPLEX DNA, one PNA and QUADRUPLEX DNA with PNA to determine the presence or absence of interaction (see, for example, Datta et al., JACS (2001) 123: 9612-9619). Spectra have to get an average of eight scans recorded at a rate of 100 nm/min

Test binding fluorescence

An example of a test binding fluorescenceis a system that includesQUADRUPLEX nucleic acid, the signal molecule and the test molecule. A signal molecule generates a fluorescence signal upon binding with the Quad is olexei nucleic acid (e.g., N-methylresorufin IX (NMM)), and the signal is changed when the test compound competes with the signal molecule for binding with quadruplexes nucleic acid. The signal change in the case when there is a test molecule, compared to when the test compound is absent, is an indication that the test compound interacts with quadruplexes.

50 μl quadruplexes nucleic acid or nucleic acid incapable of forming QUADRUPLEX, bring in a 96-well plate. Also add a test compound in various concentrations. A typical test is carried out in 100 μl of 20 mm HEPES buffer, pH 7.0, 140 mm NaCl and 100 mm KCl. Then add 50 ml of signal molecules NMM to a final concentration of 3 mm. NMM get from Frontier Scientific Inc., Logan, Utah. The fluorescence intensity measured at a wavelength of 420 nm excitation and wavelength of emission of 660 nm using fluorimetry FluroStar 2000 (BMG Labtechnologies, Durham, NC). Usually build a dependency graph as a function of the concentration of the test compound or quadruplexes nucleic acid target and maximum fluorescence signals for NMM in the absence of these molecules.

Test determine cell proliferation

In the test, determine the proliferation of malignant cells, the proliferation rate of the cells is estimated as a function of RA is personal concentrations of the test compounds, added to the cell culture medium. In this test, you can use any type of malignant tumour cells. In one embodiment, cells of a malignant tumor of the colon are cultivated in vitro and tested compounds contribute to the culture medium at various concentrations. A suitable cell line malignant tumors of the colon is colo320, which is a cell line of adenocarcinoma of the colon, deposited at the National Institute of health under inventory number JCRBO225. Options for use of such cells are available on the website http://cellbank.nihs.go.jp/cell/data/jcrb0225.htm.

The formulation of compounds

As used herein, the term "pharmaceutically acceptable salts, esters and amides" include, but are not limited to, carboxylates, additive salts of amino acids, the esters and amides of compounds and their zwitterionic forms, which are known to specialists in this area as suitable for use in humans and animals (see, for example, Gerge S.M. et al., "Pharmaceutical Salts", J. Pharm. Sci. (1977) 66: 1-19, this source is included in this description by reference).

You can prepare any appropriate composition of the compounds described in this description. In cases when connection is sufficiently possess basic or kislotno the mi properties for the formation of non-toxic acidic or basic salts, it may be a suitable introduction compounds in the form of salts. Examples of pharmaceutically acceptable salts are additive salts of organic acids formed with acids which form a physiological acceptable anion, for example tosylate, methanesulfonate, acetate, citrate, malonate, tartrate, succinate, benzoate, ascorbate, α-Ketoglutarate and α-glycyrrhizinate. You can also get suitable inorganic salts include hydrochloride, sulfate, nitrate, bicarbonate and carbonate. Pharmaceutically acceptable salts are obtained using standard methods, well known in this field. For example, pharmaceutically acceptable salts can be obtained by the interaction of a sufficiently basic compound such as an amine with a suitable acid to obtain a physiologically acceptable anion. You can also get a salt of an alkali metal (e.g. sodium, potassium or lithium) or alkaline earth metal (e.g. calcium) and carboxylic acid.

The connection can be formulated as pharmaceutical compositions and enter the host is a mammal in need of such treatment. In one embodiment, the host mammal is man. You can use any suitable route of administration including, but not limited to, oral, parenteral, intravenous, intramuscular,local, or subcutaneous.

In one embodiment, the connection lead systemically (e.g., orally) in combination with a pharmaceutically acceptable excipient, such as an inert diluent or split the food media. You can enable them in hard or soft gelatin capsules, compressed into tablets, or directly included in the food included in the diet of the patient. For oral therapeutic active compound can be combined with one or more excipients and used in the form of tablets, buccal tablets, pastilles, capsules, elixirs, suspensions, syrups, wafers and the like. Such compositions and preparations will contain at least 0.1% of active compound. The percentage of the compositions and preparations may vary and may accordingly be in the range of about 2 to 60% by weight of a given unit dosage form. The number of active compound in such therapeutically suitable compositions is such that will provide effective dose.

Tablets, lozenges, pills, capsules and the like may also contain the following: binders such as tragacanth gum, Arabia gum, corn starch or gelatin; excipients such as dicalcium phosphate; disintegrants, such as corn starch, potato starch, algae is a new acid and the like; lubricant such as magnesium stearate; and you can also add a sweetener such as sucrose, fructose, lactose or aspartame or a flavoring agent, such as peppermint, Wintergreen oil or flavouring substance with the taste and smell of cherries. In that case, if a single dosage form is a capsule, it may contain in addition to the substances of the above type, a liquid carrier, such as vegetable oil or polyethylene glycol. May contain various other substances as shells or otherwise modifying the physical form of a solid unit dosage forms. For example, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like. A syrup or elixir may contain the active compound, sucrose or fructose as a sweetener, methyl - or propylparaben as preservatives, a dye and flavoring substance, such as flavouring substance with the taste and smell of cherry or orange. Any substance used in the preparation of any unit dosage form is pharmaceutically acceptable and generally non-toxic in the quantities used. In addition, the active compound can be included in the drugs and devices with a slow release.

The active compound can also be administered intravenously or vnutri uchino infusion or injection. Solutions of the active compound or its salts can be prepared in a buffered solution, typically phosphate buffered saline solution, optionally mixed with a nontoxic surfactant substance. It is also possible to prepare dispersions in glycerol, liquid polyethylene glycols, triacetin and their mixtures and in oils. Under normal conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In some cases, the compound prepared in the form containing polymatrix compositions for such an introduction (for example, liposomes or microsome assay). For example, liposomes are described in U.S. patent No. 5703055 (Felgner et al.) and (Gregoriadis, Liposome Technology, vols. I-III (2nded. 1993).

Pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders containing the active ingredient which are adapted for making extempore sterile injection or infusion solutions or dispersions, optionally encapsulated in liposomes. In all cases, the final dosage form should be sterile, fluid and stable under conditions of manufacture and storage. Carrier liquid or solvent may be a solvent or liquid dispersion medium containing, for example, water, ethane is l, polyol (e.g. glycerol, propylene glycol, liquid polyethylene glycol and the like), vegetable oils, nontoxic glyceriae esters and their suitable mixtures. You can save the necessary fluidity, for example, obtaining liposomes, the conservation of particle size in the case of dispersions or by the use of surfactants. The action of microorganisms can be prevented by using various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases it will be preferable to include isotonic agents, for example sugars, buffers or sodium chloride. You can achieve prolonged absorption of injectable compositions, using the compositions AIDS in slowing the absorption such as aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incorporation of active compounds in the required amount in the appropriate solvent with various other ingredients specified above, as required, followed by sterilization by filtration. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of obtaining are vacuum drying and freeze-drying, which produce a powder of the active ingredient plus any the th additional desired ingredient, present in previously sterilized by filtration solutions.

For local use, these compounds can be applied in liquid form. Connection is often administered in the form of compositions or preparations in combination with a dermatologically acceptable carrier, which may be solid or liquid. Famous examples of suitable dermatological compositions used for the application of the compounds to the skin (see, for example, Jacquet et al. (U.S. patent No. 4608392), Geria (U.S. patent No. 4992478), Smith et al. (U.S. patent No. 4559157) and Wortzman (U.S. patent No. 4820508).

The compounds can be formulated with a solid carrier, which contains small particles, such as talc, clay, microcrystalline cellulose, silicon dioxide, aluminum oxide, and the like. Suitable liquid carriers include water, alcohols or glycols, or a mixture of water-alcohol/glycol, which can be dissolved or dispersing these compounds in effective amounts, optional with non-toxic surfactants. You can add adjuvants such as perfumes and additional antimicrobial agent, to optimize the properties for a given application. The liquid compositions can be used from vapor absorbent, used to impregnate bandages or other dressings, or sprayed onto the affected area using Raspletin the second pump-type or aerosol sprayers. Also with liquid carriers can be used thickeners such as synthetic polymers, fatty acids, salts and esters of fatty acids, fatty alcohols, modified cellulose or modified mineral substances, for the preparation of distributable pastes, gels, ointments, Soaps, and the like, for direct application to the skin of the user.

Typically, the concentration of the compound in the liquid composition is in the range from about 0.1 wt.% to about 25 wt.%, in some cases, from about 0.5 wt.% up to about 10 wt.%. Concentration in semi-solid or solid composition such as a gel or powder, is typically from about 0.1 wt.% to about 5 wt.%, in some cases, from about 0.5 wt.% up to about 2.5 wt.%. The composition of the compound can be obtained in the form of a single dosage form, which is prepared by conventional means known in the pharmaceutical industry. Typically, such methods include mixing the compound with a pharmaceutical carrier(s) and/or excipient(s) in liquid form, or finely ground solid form, or both forms, and then shaping the product if necessary.

Table 3 presents examples of compositions for use with the compounds described in this description. For example, the compound can be formulated in concentrations of 10 mg/ml to 20 mg/ml of p is the target with the use of these compositions. In table 3 the designation "D5W" refers to deionized water with 5% dextrose. The content of each component in each composition can be varied without adversely affecting the potency of the compound. In one example, the connection is formulated in a solution containing polyethylene glycol and propylene glycol in a buffer solution such as phosphate buffer.

Table 3
Composition%< / br>
(wt./wt.)
Connection (ml)+solvent (ml)the pH of the solventthe pH of the resulting solution< / br>
(10 ml/ml)
1.Mannitol435 ml+35 ml6,16,1
Sucrose0,5
Deionized water with 5% dextrose95,5
2.Mannitol435 ml+35 ml65,8
50 mm citrate buffer, pH 6.096
3.Mannitol435 ml+35 ml55
50 mm citrate buffer, pH 5.0 96
4.Mannitol435 ml+35 ml66
Deionized water with 5% dextrose96
5.The test compound (20 mg/ml)135 ml+35 ml6,46,1
Deionized water with 5% dextrose99
6.PEG-30075 ml+5 mlN/A5,80
Propylene glycol9
Deionized water with 5% dextrose84
7.PEG-30075 ml+5 mlN/A5,8
Propylene glycol9
50 mm citrate buffer, pH 6.084
8.Mannitol45 ml+5 mlN/Athe 5.7
PEG-30020
50 mm citrate buffer, pH 6.076
9.Mannitol45 ml+5 mlN/A 5,8
Propylene glycol10
50 mm citrate buffer, pH 6.086

The composition of the compounds can be present in any dosage form such as tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. Also the composition can be represented as suspensions in aqueous, non-aqueous or mixed environment. Aqueous suspensions can contain substances which increase the viscosity, including, for example, sodium carboxymethyl cellulose, sorbitol and/or dextran. Suspensions can also contain one or more stabilizers. The number of connections or an active salt or derivative required for use in treatment will vary not only depending on the particular salt selected but also from the way of introduction, the origin of the disease being treated, the age and condition of the patient, and ultimately from the decision of the attending physician or Clinician.

Dosage

A suitable dose of a compound is usually determined at the evaluation of its activity in vitro in a cell or tissue system and/or its activity in vivo on animals. For example, in the area known methods of extrapolation of the effective dose with mice and other animals to humans (see, for example, atent U.S. No. 4938949). Such systems can be used to define LD50(the dose that causes the death of 50% of the population) and ED50(therapeutically effective dose in 50% of the population) connection. The ratio between toxic and therapeutic doses is a therapeutic index and can be expressed as the ratio of the ED50/LD50. Dosage connections are often in the range of concentrations in the blood, in which the ED50little or no toxicity manifests. The dose can vary within this limit depending on the dosage form and the applicable route of administration. For any of the compounds used in the methods described herein, therapeutically effective dose can be initially set in the tests in cell culture. In some cases, the dose is set to limit concentrations in blood plasma, including IC50(i.e. the concentration of test compound, which provides half of the maximum suppression of symptoms) according to tests in vitro, while such information is usually used to more accurately determine useful doses in humans. Concentration in plasma can be determined, for example, high performance liquid chromatography.

Another example of determining the effective dose for the subject is the ability the ü directly to analyze the concentration of "free" and "bound" connections in the serum of the test subject. In the formulation of such analyses can be used mimetics of antibodies and/or "biosensors", obtained by the methods of molecular "printing". The connection is used as a matrix, or "opacityvalue" molecules for the spatial organization of the polymerized monomers prior to their polymerization with catalytic reagents. Then remove the "printed" molecule leaves the polymer matrix, which contains repeated negative reflection of the connection and which is able to selectively reproduce the molecule in the biological conditions of the test (see, for example, Ansell et al., Current Opinion in Biotechnology (1996) 7: 89-94 and Shea, Trends in Polymer Science (1994) 2: 166-173).

Such "imprinted" affine matrices suitable for tests based on the binding of the ligand, in which the immobilized component of a monoclonal antibody replace accordingly "printed" matrix (see, for example, Vlatakis et al., Nature (1993) 361: 645-647). Through the use of isotope labels can easily determine the "free" concentration of compound and used for calculations of the IC50. It is also possible to construct such "imprinted" affine matrices with the inclusion of fluorescent groups, where the property to emit photons determined by the image changes when local and selective binding compounds. These changes can easily analizirovat is in real-time using the appropriate fiber-optic devices, that, in turn, allows you to quickly optimize the dose of a test subject on the basis of his individual values IC50. An example of such a "biosensor" is discussed Kriz et al., Analytical Chemistry (1995) 67: 2142-2144.

Exemplary doses include milligramme or microgramme number of connections per kg weight of the subject or sample, for example, from about 1 μg / kg to about 500 mg / kg, from about 100 μg per kg to about 5 mg / kg or from about 1 μg / kg to about 50 mg per kg Understood that appropriate doses of small molecule depend on the efficiency of small molecule in relation to the expression or activity that are subjected to modulation. When an animal (such as man) impose one or more databases of small molecules to modulate the expression or activity of the polypeptide or nucleic acid described herein, the physician, veterinarian, or researcher may, for example, first assign a relatively low dose, with the consequent increase the dose to obtain an adequate response. Further, it is understood that the specific dose for any particular animal will depend on various factors including the activity of the specific compound, the age, body weight, General health, sex and diet of the subject, time of administration, route of administration, rate of excretion, any kombinats and drugs and the degree of expression or activity, subjected to modulation.

The following examples are offered to illustrate but not to limit the invention.

Example 1

To a solution of magnesium chloride (6,74 g, and 70.8 mmol) and ethylmalonate potassium (of 6.78 g, 39.8 mmol) in dry acetonitrile (100 ml) at 0°With added dropwise 2,4-dichloro-5-perbenzoate (5.0 g, 22,1 mmol), maintaining the temperature of the mixture below 5°C. the Mixture was stirred for 30 min and was added drop wise addition of triethylamine (6,1 ml, 44,25 mmol), again maintaining the temperature of the mixture below 5°and the reaction mixture was stirred throughout the night. The mixture was concentrated in vacuo, diluted with toluene (250 ml) was added 1N. aqueous HCl (100 ml) and the mixture was stirred for 30 minutes, the Layers were separated, the organic layer was washed again with 1H. aqueous HCl (100 ml) and saturated salt solution (200 ml) and dried over sodium sulfate. Then the organic layer was filtered, concentrated in vacuum and purified on silica gel (mixture of ethyl acetate/hexane 1:10) to produce keeeper in the form of oil, which hardened on standing (5,02 g, yield 81%).

To a solution of keeeper (5.0 g, 18 mmol) in diglyme (50 ml) was added 2-chlorobenzotriazol (3,66 g, 21.6 mmol) followed by the addition in portions sodium hydride (1.52 g, to 39.6 mmol, 60% dispersion in oil) for 10 min. the Reaction to shift the b was heated to 160° C for 24 h and allowed to cool to room temperature. The reaction was suppressed with careful addition of water (250 ml), resulting brown precipitate was removed by filtration and washed with water. Then the product was dissolved in methylene chloride (300 ml), washed with saturated salt solution and filtered through celite. The obtained organic layer was dried over sodium sulfate, filtered and concentrated in vacuum. The product was purified on silica gel (7% ethyl acetate in hexane) to give the cyclic compounds (1,76 g, yield 26%) as a solid.

Example 2

To a solution of glorifier (250 mg, 0.66 mmol) in N-methylpyrrolidinone (NMP, 2 ml) was added 2-personication (81 μl, 0.66 mmol) and potassium carbonate (182 mg, of 1.32 mmol) and the mixture was heated to 100°C for 2 hours the Mixture was allowed to cool to room temperature, added water (50 ml) and stirring continued over night. The crude product was separated by filtration and was purified preparative TLC (2% methanol in methylene chloride) to give the crude product as a yellowish-brown crystalline solid (122 mg, yield 38%).

Example 3

To a solution of keeeper (2.0 g, 7.2 mmol) in diglyme (20 ml) was added 2-dichlorobenzothiazole (1,76 g, 8,63 mmol) followed by addition of portions of hidri the sodium (0,63 g, 15.8 mmol, 60% dispersion in oil) for 10 minutes, the Reaction mixture was heated to 160°C for 24 h and allowed to cool to room temperature. The reaction was suppressed with careful addition of water (200 ml), resulting brown precipitate was removed by filtration and washed with water. Then the product was dissolved in methylene chloride (30 ml), washed with saturated salt solution and filtered through celite. The obtained organic layer was dried over sodium sulfate, filtered and concentrated in vacuum. The product was purified on silica gel (5% ethyl acetate in hexane) to obtain the cyclic compound (0.55 g, yield 18,8%) as a solid.

Example 4

To a solution of glorifier (250 mg, 0.61 mmol) in N-methylpyrrolidinone (NMP, 2 ml) was added 2-personication (75 μl, 0.61 mmol) and potassium carbonate (170 mg, 1.2 mmol) and the mixture was heated to 100°C for 2 hours the Mixture was allowed to cool to room temperature and added to water (50 ml) and stirring continued over night. The crude product was separated by filtration and was purified preparative TLC (2% methanol in methylene chloride) to give the pure product in the form of yellowish-brown microcrystalline solid (125 mg, yield 40%).

Example 5

To a solution of keeeper (2.0 g, 7.2 mmol) in diglyme (20 ml) we use the 2-chloro-6-methoxybenzothiazole (1.73 g, 8,63 mmol) followed by the addition in portions sodium hydride (0,63 g, 15.8 mmol, 60% dispersion in oil) for 10 minutes, the Reaction mixture was heated to 160°C for 24 h and allowed to cool to room temperature. The reaction was suppressed with careful addition of water (200 ml), resulting brown precipitate was removed by filtration and washed with water. Then the product was dissolved in methylene chloride (30 ml), washed with saturated salt solution and filtered through celite. The obtained organic layer was dried over sodium sulfate, filtered and concentrated in vacuum. The product was purified on silica gel (5% ethyl acetate in hexane) to give the cyclic compounds (0,23 g, yield of 7.6%) as a solid.

Example 6

To a solution of glorifier (220 mg, 0.54 mmol) in N-methylpyrrolidinone (NMP, 2 ml) was added 2-personication (66 μl, 0.54 mmol) and potassium carbonate (150 mg, 1.1 mmol) and the mixture was heated to 100°C for 2 hours the Mixture was allowed to cool to room temperature, added water (50 ml) and stirring continued over night. The crude product was separated by filtration and was purified preparative TLC (2% methanol in methylene chloride) to give the crude product as a yellowish-brown microcrystalline solid (75 mg, yield 28%).

Example 7

To a suspension of glorifier (0.25 g, 0.67 mmol) in glacial acetic acid (5 ml) was added ammonium formate (0.6 g, 4.0 mmol) and the mixture was degirolami passing argon for 2 minutes and Then was added palladium on coal (10% type Degas, 0.6 g) and the mixture was heated to 60°C for 1 h was Added ammonium formate (0.1 g) and catalyst (0.1 g) and heating was continued overnight. Finally, were added ammonium formate and the catalyst (each 150 mg) and heating was continued for 1.5 hours the Mixture was allowed to cool to room temperature, filtered through celite, the solvent was removed in vacuum and replaced with methylene chloride (100 ml). The organic fractions were washed with water (100 ml) and saturated salt solution (100 ml) and dried over sodium sulfate. The solvent was removed in vacuum to obtain benzothiazole as a yellowish brown solid (153 mg, yield 67%).

Example 8

To a solution of Ftorafur (50 mg, 0.15 mmol) in N-methylpyrrolidinone (NMP, 0.5 ml) was added 2-personication (126 μl, 1.0 mmol) and potassium carbonate (40 mg, 0.3 mmol) and the mixture was heated to 100°C for 2 hours the Mixture was allowed to cool to room temperature, added water (50 ml) and stirring continued over night. The crude product was separated by filtration and was purified preparative TLC (2% methanol in methylene chloride) with the teachings of the crude product in the form of yellowish-brown microcrystalline solid (17 mg, yield 25%).

Example 9

Compound 1 (1.0 EQ, 399 mg, 1.06 mmol) and 1-isopropylpiperazine 2 (5.0 EQ, 0,76 ml, 5,31 mmol) was dissolved in N-methylpyrrolidinone (NMP, 5 ml). The resulting mixture was stirred at 120°C for 3 days. Control LC indicated the formation of two major products 3 and 4 in equal amounts. The solution was poured into water and the precipitate was separated by filtration. Two compounds were separated with flash chromatography on SiO2(gradient Meon 0.5 to 7% in CH2Cl2) to obtain compound 3 (135 mg, yield 27%) and compound 4 (135 mg, yield 26%).

3 connection: Rf=0.40 In (SiO25% of the Meon in CH2Cl2), GHMC (ES): purity 95%, m/z 468 [M+H]+.

Compound 4: Rf=0,26 (SiO25% of the Meon in CH2Cl2), GHMC (ES): purity 95%, m/z 484 [M]+, 486 [M+2]+.

Example 10

This example presents data for two specific compounds:

The binding affinity of with quadruplexes Km=5,5 µm

The average survival time of tumor cells (IC50) (staining Almoravid blue)

Hela2,8 µm
PC32.7 μm
HCT-1161.1 µm

The binding affinity of with quadruplexes Km=4,5 µm

The average survival time of tumor cells (IC50) (staining Almoravid blue)

Hela2.7 μm
PC3of 0.52 μm
HCT-1160,57 mcm

Example 11

In a three-neck flask, equipped with inlet for nitrogen, ethylmalonate potassium (1.5 EQ, 32,8 g, 0,192 mol) and MgCl2(1.5 EQ, an 18.4 g, rate of 0.193 mol) is suspended in acetonitrile (120 ml) under mechanical stirring. The suspension was cooled in an ice bath. Was added dropwise a solution of 2,4,5-triterpenoid (1.0 equiv, 25 g, 0,128 mol) in acetonitrile (60 ml). Was added over 30 min a solution of triethylamine (2.0 EQ, 36 ml, 0,258 mol) in acetonitrile (50 ml), maintaining the temperature of the mixture below 10°With external cooling with a mixture of ice and salt. Formed a very thick suspension was allowed to warm to room temperature. Was added acetonitrile (150 ml) to facilitate stirring of the suspension. The reaction mixture was altered within 2 days and the volatiles removed in vacuum. Was added 10% aqueous HCl solution and EtOAc and the mixture was stirred for 3 hours Substance was extracted with EtOAc (3×). The combined extracts were washed with saturated salt solution and dried over Na2SO4. After evaporation of the solvent in vacuo prophetic the STV recrystallized from a mixture of 10% water/EtOH to obtain compound 1 as a white crystalline substance (17.8 g, yield 56%). IHMS (ES): purity 95%, m/z 269 [M+23]+. A mixture of two tautomers.

Compound 1 (1.0 EQ, with 3.27 g, to 13.29 mmol) was dissolved in anhydrous DMF (30 ml). The solution was cooled on ice, was added To the2CO3(3.0 EQ, 5,51 g, 39,87 mmol) and the solution was stirred for 15 minutes To the resulting white suspension was rapidly added carbon disulfide (1.5 equiv., 1.20 ml, 19,86 mmol) and the mixture was stirred at 0°within 5 minutes Via a syringe was added dropwise methyliodide (3.0 equiv, 2.5 ml, with 40.2 mmol) and the reaction mixture was stirred at 0°C for 2 h After addition of ice-cold water connection was extracted with EtOAc (3×). The combined extracts were washed with water (1×) and saturated salt solution (2×), dried over Na2SO4and volatiles removed in vacuum. Adding hexane and a small amount of EtOAc substance began to crystallize. The crude substance was separated by filtration and recrystallized from hexane to obtain a white crystalline solid (3,27 g, yield 70%). IHMS (ES): purity 95%, m/z 373 [M+23]+, 351 [M+1]+.

Ethyl 3-oxo-3-(2,3,4,5-tetrafluorophenyl)propanoate (1.0 EQ, 5,77 g, 21,84 mmol) was dissolved in a mixture of DMSO (55 ml) and water (12 ml). Was added dropwise a solution of KOH (2.3 EQ, 2,82 g, 50,26 mmol) in water (25 ml), maintaining the temperature of the mixture below 15#x000B0; With the use of ice baths. After stirring for 15 min was rapidly added to the mixture of carbon disulfide (3.2 EQ, 4,2 ml, 69,50 mmol) and iodomethane (3.8 EQ, 5,2 ml, 83,35 mmol) and the resulting mixture was stirred at room temperature overnight. After adding water, the substance was extracted with EtOAc (2×). The combined extracts were washed with water, dried over Na2SO4and the solvent was removed in vacuum. The compound was purified flash chromatography on silica gel (5-15% gradient of EtOAc in hexane) to give a yellow oil (1,69 g, yield 21%). IHMS (ES): purity 95%, m/z 323 [M+1-EtO]+.1H NMR (CDCl3, 500 MHz) δ to 1.15 (t, J=7,0, 3H), 2.40 a (users, 6H), 4,18 (sq, J=7,2, 2H), 7,54-of 7.60 (m, 1H) ppm

Compound 2 (1.0 EQ, 933 mg, 2,84 mmol), 2-aminothiophenol (5.0 EQ, 1.52 g, of 14.2 mmol) and NEt3(4.0 EQ, 1,59 g, 11.0 mmol) were mixed in anhydrous toluene (10 ml). The mixture was stirred while boiling under reflux for several hours. After removal of the solvent in vacuum the substance was purified by sonication in a mixture of EtOAc/hexane to obtain a solid substance (724 mg, yield 53%). IHMS (ES): purity 95%, m/z 485 [M+1]+.

Compound 4 (1.0 equiv, 70 mg, 0.144 mmol) was mixed with DBU (4.0 EQ, 65 μl, 0.43 mmol) in toluene (1.5 ml). The solution was stirred while boiling under reflux for 45 minutes Connect the Addendum was purified flash chromatography on silica gel (1% Meon in CH 2Cl2). IHMS (ES): purity 95%, m/z 465 [M+1]+.

Example 12

Compound 3 (1.0 EQ, 347 mg, 0,942 mmol) and 2-aminothiophenol (1.0 EQ, 0.10 ml, 0,943 mmol) were mixed in toluene (1 ml) and stirred at 130°C for 14 h, After cooling, some solids were removed by filtration. Solution in toluene was applied onto a column of silica gel. Toluene was initially removed, elwira hexane. Then the column was suirable 10-30% gradient of EtOAc in hexane to obtain the intended compound. After evaporation of volatiles, the solid was further purified by recrystallization from a mixture of EtOAc/hexane. Compound 6 was isolated in the form of gray matter (62 mg, yield 18%). IHMS (ES): purity 90%, m/z 378 [M+1]+.

Example 13

Compound 2 (1.0 EQ, 3,15 g 8,99 mmol) and 2-aminothiophenol (1.1 EQ, of 1.06 ml, to 9.91 mmol) were mixed in toluene (150 ml). Within 10 min the solution was passed gaseous nitrogen. The reaction mixture was stirred while boiling under reflux (oil bath T=140° (C) within 30 PM Volatiles were removed in vacuo and added CH2Cl2. Solids were removed by filtration. The substance was purified flash chromatography on silica gel (10-50% gradient of EtOAc in hexane) to give compound 7 as not quite white powder (576 mg, yield 18%). IHMS ES): purity 90%, m/z 360 [M+1]+.

Example 14

Compound 2 (1.0 EQ, 2,52 g, 7.20 mmol) was mixed with N-methylbenzol-1,2-diamine (1.2 EQ, and 0.98 ml) and DIEA (1.2 EQ, 1.5 ml) in toluene (10 ml) and the reaction mixture was stirred at 120°C for 1 day. Compound 8 was separated by filtration after cooling the reaction mixture (679 mg, yield 26%). IHMS (ES): purity 95%, m/z 358 [M+1]+.

Example 15

Compound 7 (1.0 EQ, 392 mg of 1.09 mmol) and racemic tert-butyl 3-(pyrazin-2-yl)pyrrolidin-1-carboxylate (1.6 EQ, 436 mg of 1.74 mmol) suspended in 1 ml of NMP. The mixture was heated by microwave at 150°C for 20 minutes was Added water and the resulting solid substance was separated by filtration. Purification with flash chromatography gave compound 9 (265 mg, yield 50%) as a solid. IHMS (ES): purity 95%, m/z 489 [M+1]+.

Example 16

Compound 6 (1.0 equiv, 66 mg, 0,175 mmol) and racemic tert-butyl 3-(pyrazin-2-yl)pyrrolidin-1-carboxylate (3.8 EQ, 165 mg, 0,661 mmol) were mixed in NMP (0.5 ml). The mixture was stirred at 200°C for 23 hours After adding water, the resulting solid was removed by filtration. Purification with flash chromatography on silica gel (1-4% gradient Meon in CH2Cl2) gave compound 10 as a brown solid (70 mg, yield 7%). IHMS (ES): purity 90%, m/z 507 [M+1]+.

Example 17

Compound 11 was obtained in accordance with the methodology used for the connection 10. The compound was purified flash chromatography on silica gel (1-10% gradient Meon in CH2Cl2with getting a solid (220 mg, 47%). IHMS (ES): purity 95%, m/z 486 [M+1]+.

Example 18

Compound 8 (1.0 EQ, 202 mg of 0.56 mmol) was mixed with 2-(pyrazin-2-yl)echantillon (of 1.05 EQ, 76 μl) and K2CO3(1.2 EQ, 94 mg) in NMP. The mixture was stirred for 3 h at 80°C. After adding water, the solid was filtered and dried to obtain compound 12 (202 mg, yield 85%). IHMS (ES): purity 95%, m/z 477 [M+1]+.

Example 19

Compound 8 (313 mg) was mixed with N-isopropylpiperazine (1.5 EQ, 188 μl) in NMP and the mixture was stirred at 90°within a few hours. The compound was separated by filtration after the addition of water. Purification with flash chromatography on silica gel (mixture Meon/CH2Cl2) gave pure compound 13 (222 mg, yield 54%). IHMS (ES): purity 95%, m/z 465 [M+1]+.

Example 20

Compound 9 (1.0 EQ, 181 mg, 0,370 mmol) and racemic 2-(1-methylpyrrolidine-2-yl)ethanamine (4.0 EQ, of 0.21 ml, 1,449 mmol) were mixed in CH2Cl2(1.5 m is). Added AlCl3(2.9 EQ, 142 mg, 1.06 mmol) and the solution was stirred for 22 hours After removal of CH2Cl2in vacuum, the resulting suspension was treated with a saturated aqueous solution of tartaric acid (about 1 ml) and stirred until complete disappearance of solids (approximately 1 h to complete the hydrolysis). Added water and the pH was brought to 14 the addition of NaOH. The substance was extracted with CH2Cl2(3×) and the combined extracts were washed with water (2×). After drying over Na2SO4volatiles were removed in vacuum. The substance was purified flash chromatography (0,1-1% gradient Meon in CH2Cl2). Solution in CH2Cl2/Meon concentrated in vacuum. Adding EtOAc caused the precipitation of compound 14 as a yellow solid (93 mg, yield 44%). IHMS (ES): purity 95%, m/z 571 [M+1]+.

The following compounds were obtained in a similar way, using the appropriate amines and ethyl esters quinolone.

Example 21

To a solution of ester quinolone (60 mg, 0.13 mmol) and 2-(2-amino-ethyl)-1-methylpyrrolidine (30 μl, 0,19 mmol) in methylene chloride (1.0 ml) was added aluminium chloride (25 mg, 0,19 mmol) and the reaction mixture was stirred for 30 minutes the Solvent prowess and in vacuum and added a saturated solution of L-tartaric acid (1.0 ml), stirring for 45 minutes to dissolve the solids. The aqueous solution was washed with methylene chloride (1.0 ml), was podslushivaet 1H. NaOH solution and was extracted with methylene chloride. The extract obtained was washed with saturated salt solution, dried over sodium sulfate, filtered and the solvent was removed in vacuum. The yellow substance was purified preparative TLC (alumina, 2% methanol in CH2Cl2) to obtain the product as a yellowish solid (30 mg, yield 43%).

Example 22

To a solution of ester chinola (60 mg, 0.13 mmol) and 2-(2-amino-ethyl)-1-methylpyrrolidine (25 μl, 0,17 mmol) in methylene chloride (1.0 ml) was added aluminium chloride (23 mg, 0,17 mmol) and the reaction mixture was stirred for 30 minutes the Solvent was removed in vacuo and added a saturated solution of L-tartaric acid (1.0 ml), stirring for 45 minutes to dissolve the solids. The aqueous solution was washed with methylene chloride (1.0 ml), was podslushivaet 1H. NaOH solution and was extracted with methylene chloride. The extract obtained was washed with saturated salt solution, dried over sodium sulfate, filtered and the solvent was removed in vacuum. The yellow substance was purified preparative TLC (alumina, 2% methanol in CH2Cl2) to obtain the product as a yellowish solid is th substance (30 mg, yield 46%).

Example 23

To a solution of ester quinolone (75 mg, 0.15 mmol) and 2-(2-amino-ethyl)-1-methylpyrrolidine (32 μl, 0.22 mmol) in methylene chloride (1.0 ml) was added aluminium chloride (29 mg, 0.22 mmol) and the reaction mixture was stirred for 30 minutes the Solvent was removed in vacuo and added a saturated solution of L-tartaric acid (1.0 ml), stirring for 45 minutes to dissolve the solids. The aqueous solution was washed with methylene chloride (1.0 ml), was podslushivaet 1H. NaOH solution and was extracted with methylene chloride. The extract obtained was washed with saturated salt solution, dried over sodium sulfate, filtered and the solvent was removed in vacuum. The yellow substance was purified preparative TLC (alumina, 2% methanol in CH2Cl2) to obtain the product as a yellowish solid (30 mg, yield 34%).

Example 24

To a solution of ester quinolone (34 mg, 0.7 mmol) and 2-(2-amino-ethyl)-1-methylpyrrolidine (15 μl, 0.11 mmol) in methylene chloride (1.0 ml) was added aluminium chloride (15 mg, 0.11 mmol) and the reaction mixture was stirred for 30 minutes the Solvent was removed in vacuo and added a saturated solution of L-tartaric acid (1.0 ml), stirring for 45 minutes to dissolve the solids. The aqueous solution was washed of metranil the reed (1.0 ml), was podslushivaet 1H. NaOH solution and was extracted with methylene chloride. The extract obtained was washed with saturated salt solution, dried over sodium sulfate, filtered and the solvent was removed in vacuum. The yellow substance was purified preparative TLC (alumina, 2% methanol in CH2Cl2) to obtain the product as yellow solid (28 mg, yield 73%).

Example 25

To a solution of ester quinolone (146 mg, of 0.65 mmol) and 2-(2-amino-ethyl)-1-methylpyrrolidine (1 mmol) in methylene chloride (1.0 ml) was added aluminium chloride (1 mmol) and the reaction mixture was stirred for 30 minutes the Solvent was removed in vacuo and added a saturated solution of L-tartaric acid (1.0 ml), stirring for 45 minutes to dissolve the solids. The aqueous solution was washed with methylene chloride (1.0 ml), was podslushivaet 1H. NaOH solution and was extracted with methylene chloride. The extract obtained was washed with saturated salt solution, dried over sodium sulfate, filtered and the solvent was removed in vacuum. The yellow substance was purified preparative TLC (alumina, 2% methanol in CH2Cl2) to obtain the product as a yellowish solid (1.7 mg, yield 5%).

Example 26

Compound 3 (1.0 EQ, 126 mg, 0.27 mmol) and amine 5 (2,0 is kV, 68 μl, 0.54 mmol) was dissolved in anhydrous CH2Cl2(1 ml). Added AlCl3(2.0 EQ, 72 mg, 0.54 mmol) and the mixture was stirred at room temperature for 3 hours the Volatiles were removed in vacuum. The resulting suspension was treated with a saturated aqueous solution of tartaric acid (10 ml) and stirred until complete disappearance of solids (approximately 1 h to complete the hydrolysis). The solution was neutralized 1H. NaOH solution (to bring the pH to 14) and the compound was extracted with CH2Cl2(4×). The organic phase is washed with a concentrated aqueous solution of sodium tartrate, potassium, water (2×) and dried over Na2SO4. A solution of CH2Cl2was concentrated. The addition of AcOEt caused crystallization of the proposed connection. After filtration were obtained compound 6 as a yellow microcrystalline solid (76 mg, yield 53%). IHMS (ES): purity 95%, m/z 536 [M+1]+.1H NMR (CDCl3, 500 MHz) δ of 1.12 (d, J=6,6, 6H), 1,80 (users, 4H), 2,62 (users, 4H), and 2.79 (m, 7H), to 3.36 (m, 4H), 3,67 (sq, J=6,0, 2H), 7,45 (t, J=7,2, 1H), 7,53 (TD, J=7,3, J=1,3, 1H), to 7.84 (DD, J=7,8, J=1,2, 1H), 7,89 (d, J=6,9, 1H), 8,16 (d, J=13,1, 1H), 8,23 (d, J= 8,5, 1H), 10,46 (ushort, 1H) ppm

Example 27

The compound was obtained in accordance with the method used in example 26 starting from compound 4 (101 mg, 0.21 mmol) and compound 7, to obtain compound 8 as white is on microcrystalline solid (37 mg, yield 31%). IHMS (ES): purity 95%, m/z 566 [M]+, 568, [M+2]+;1H NMR (CDCl3, 500 MHz) δ of 1.13 (d, J=6,5, 6H), 1.57 in (m, overlapped with water signal, 2H), 1,71 (m, 1H), is 1.81 (m, 1H), 2,04-to 2.18 (m, 4H), of 2.34 (s, 3H), 2,78 (m, 5H), 3,06 (ushort, J=8,6, 1H), 3.27 to (users, 4H), 3,52-3,59 (m, 2H), 7,47 (t, J=of 7.3, 1H), EUR 7.57 (TD, J=8,4, J=1,1, 1H), to 7.84 (d, J=7,8, 1H), 8,19 (s, 1H), 8,27 (d, J=8,4, 1H), to 8.57 (s, 1H), 10,38 (ushort, J=5,6, 1H) ppm

Example 28

In example 28 describes a method for substituted analogue of benzoxazine the interaction of the complex ester with the amine and the chloride of aluminium.

To a solution of 2,3,4,5-tetrafluorobenzoic acid (100 g, 510 mmol) in methylene chloride (0.5 ml) was added oxalicacid (68 g, 540 mmol) and DMF (about 3 drops) and the reaction mixture was stirred at room temperature for removal of the formed gases. The solvent was removed in vacuum, the vessel was placed in a deep vacuum (about 0.5 mm RT. Art.) for 2 h to obtain the acid chloride as a viscous oil (105 g) and used in subsequent reactions without further purification.

To a suspension of ethylmalonate potassium (97 g, 570 mmol) and magnesium chloride (55 g, 570 mmol) in acetonitrile and the suspension was cooled to 0°C. To this suspension was added the crude 2,3,4,5-benzoyl chloride (105 g, 520 mmol) for 5 minutes was Slowly added triethylamine at a rate sufficient to maintain the temperature below 10° C, the mixture was allowed to warm to room temperature and was stirred overnight. The solvent was removed in vacuum, was replaced with toluene (300 ml), was added 1N. aqueous HCl (500 ml) and the mixture was stirred for 1 h the Organic layer was separated, washed with 1N. HCl solution (100 ml) and saturated salt solution (100 ml) and dried over sodium sulfate, filtered through a layer of silica gel (50×100 mm), elwira with ethyl acetate. The solvent was removed in vacuum and the oil obtained was dissolved in a mixture of ethanol/water (9:1) and gave yet to crystallize during the night. The obtained crystals were separated by filtration, washed with a mixture of ethanol/water (8:2) to produce keeeper (43,75 g, 166 mmol) as a white crystalline solid.

In a round bottom flask with a capacity of 250 ml was added terraformation (10.0 g, of 37.9 mmol), triethylorthoformate (8.6 ml, with 56.8 mmol) and acetic anhydride (7,15 ml of 75.8 mmol) and the reaction mixture was heated to 145°C for 2 h, the Reaction mixture was cooled to room temperature and placed in a deep vacuum (about 0.5 mm RT. Art.) for 1 h the resulting oil was dissolved in ethanol (100 ml)was added 2-amino-1-naphthol (of 6.02 g of 37.9 mmol) at room temperature, the solution quickly became transparent, and then the product began to precipitate. The reaction mixture was stirred for 2 h, then filtered and PR is mawali ethanol (100 ml) to give the enamine in the form of a yellow solid (12.5 g, of 28.9 mmol).

To a solution of the enamine (12,13 g 27,95 mmol) in dry DMF (50 ml) was added potassium carbonate (4,24 g, 1.1 mmol) and the mixture was heated to 90°With constant stirring for 2 h the Mixture was allowed to cool to room temperature without stirring and kept at room temperature for 1 h Crystalline solid was separated by filtration, rinsing with water. Recrystallization from THF gave deflorator in the form of a white crystalline solid (9.3 g, 23.6 mmol).

To a solution of littoraria (1.0 g, 2.5 mmol) in NMP (10 ml) was added N-BOC-3-(2-pyrazino)pyrrolidin (870 mg, 3.5 mmol) and the mixture was heated at the boil under reflux for 3 hours the Reaction mixture was allowed to cool to room temperature and the product was separated by filtration. Crystallization from THF gave ester of pyrazine in the form of a yellow solid (910 mg, of 1.74 mmol).

To a solution of ester of pyrazine (250 mg, 0.48 mmol) and 2-(2-amino-ethyl)-1-methylpyrrolidine (80 mg, was 0.63 mmol) in methylene chloride at room temperature was added aluminium chloride (83 mg, 0,63 mmol) and the reaction mixture was stirred for 2 h the Solvent was removed under vacuum, was added a saturated solution of L-tartaric acid (5 ml) and the mixture premesis is whether, within 1 hour Then was added methylene chloride (10 ml) and the mixture was podslushivaet 1H. NaOH solution. The organic layer was separated and washed with saturated solution of Rochelle salt, saturated salt solution and dried over sodium sulfate. The solvent was removed in vacuum and the resulting solid was dissolved in THF, filtered and the solvent was again removed. The crude solid is recrystallized from ethyl acetate to obtain amide as a yellowish solid (225 mg, and 0.37 mmol, purity of 98.5%).

Example 29

As shown in example 29, amide combination of the corresponding ether resulted in a weak response or no, when using zinc chloride as the Lewis acid.

To a solution of ester (100 mg, 0,19 mmol) and 2-(2-amino-ethyl)-1-methylpyrrolidine (80 mg, was 0.63 mmol) in methylene chloride at room temperature was added zinc chloride (86 mg, 0,63 mmol) and the reaction mixture was stirred over night. Data IHMS pointed to the lack of reaction, and the reaction was stopped.

Example 30

In example 30 describes a method for substituted analogue of benzoxazine interaction of the corresponding carboxylic acid with the amine.

Pyrazinamid (2.0 g, 3.8 mmol) was dissolved in ethanol (100 ml) was added concentrated HCl (20 ml)and the mixture is boiled under reflux during the night. The mixture was allowed to cool to room temperature and the solid was separated by filtration under vacuum, washing with ethanol to obtain pertinacity in the form of light yellowish-brown powder (1.6 g, 3.2 mmol).

To a mixture of germinability (1.6 g, 3.2 mmol) and HBTU (2.0 g, 5.3 mmol) in NMP (20 ml) was added N,N-aminobutiramida-N-ethylamine (1.0 ml, 6 mmol) and the mixture was stirred at room temperature in an argon atmosphere for 1 h (the solution became transparent). Was added (S)-2-(2-amino-ethyl)-1-methylpyrrolidine (A. Mizuno, Y. Hamada, T. Shioiri, Synthesis, 1980, 12: 1007) (1.0 ml, 6,9 mmol) and the mixture was stirred for 30 minutes was Added water (200 ml), the obtained solid substance was collected by vacuum filtration, washing with water, and dried to obtain pyrazine in the form of a yellow solid. The yellow solid was purified on silica gel (mixture of 10% Meon/CH2Cl2first elwira impurities followed by elution with a mixture of 5% NH4OH/15% Meon/CH2Cl2. Combined fractions were evaporated to obtain compound as a yellow solid (1.2 g, 2.0 mmol, purity 85%).

Example 31

In example 30 describes how to obtain the BOC-protected pyrolidine reagent as intermediate compounds in obtaining derivatives of benzoxazine and benzothiazole.

A mixture of benzo is lamina (90 g, 841 mmol) and chlorotetracycline (30 g, 246 mmol) was heated at 200°for 2.5 hours mainly trimethylsilyloxy group can be replaced-SiR1R2R3group, where R1, R2and R3independently represent alkyl or substituted alkyl. Benzyl groups may also be replaced with other suitable protective groups.

The mixture was allowed to cool to room temperature and was treated with 1H. a solution of sodium hydroxide (250 ml) and diethyl ether (200 ml) under stirring. The aqueous layer was extracted with ether (3×100 ml) and the combined organic extracts were washed with saturated salt solution, dried over magnesium sulfate and filtered through a porous layer of silica gel (70×50 mm), elwira diethyl ether. The solvent was removed in vacuum and the oil obtained was distilled under vacuum (BP.=70°From about 1 mm RT. Art.) to give the amine as a colourless oil (of 60.8 g), which contained a large number of benzylamine. Then the obtained oil was chromatographically on one Biotage column (90 g silica gel, ANALOGIX), elwira with ethyl acetate. The solvent was removed in vacuum to obtain the pure amine as a colourless oil (43,55 g, 225 mmol). Then, the resulting amine was added to 37% of the formalin (25 ml) and the mixture was stirred at room temperature for 10 min followed by the addition of methanol (25 ml) and CT is onata potassium (20 g). The resulting mixture was stirred overnight, then was extracted with methylene chloride (3×100 ml) and the combined organic extracts were dried over sodium sulfate. The solvent was removed in vacuum and the oil obtained was distilled under vacuum (BP.=80°From about 1 mm RT. Art.) to give the amine as a colorless liquid (39.9 g, 168 mmol).

To a solution of vinylpyrazine (10 g, was 94.3 mmol) in methylene chloride (200 ml) and triperoxonane acid (2 ml) was added dropwise a solution of similarvideo ether amine (24,33 g 102,7 mmol)dissolved in methylene chloride (100 ml)for 4 hours and Then the volume was reduced to 100 ml and was extracted with 1N. HCl solution (3×75 ml). The aqueous layer was podslushivaet NaOH, extracted with methylene chloride (3×100 ml), dried over magnesium sulfate and filtered through a porous layer of silica gel (30×150 mm), elwira with ethyl acetate. The solvent is evaporated to obtain Antilibanus of pyrazinamidase (26,19 g) as a brownish transparent liquid. Usually pyrazinoic the heterocycle can be substituted by other suitable heterocyclic groups.

To a solution of benzylpyrrolidine (7.0 g, of 29.3 mmol) and di-tert-BUTYLCARBAMATE (44,7 g, 205 mmol) in methanol (35 ml) was added 10% Pd/C (type Degas, wet) and the capacity was saturated with hydrogen (50 psig) at which trigiani. Capacity three times blew up to normal pressure. After 5 h the reaction had ended, the mixture was filtered and the solvent evaporated in vacuum. The resulting substance was chromatographically on silica gel (hexane/ethyl acetate 1:1) to give the BOC-protected pyrrolidine in the form of a light yellow oil (2.3 g, 9.2 mmol).

The ratio of enantiomers can be determined by obtaining the TRS (N-cryptomailer-L-propylchloride, Regis #440001) and use GHS (HP 6890N/5973 MSD) on a capillary column (Phenomenex Zebron (ZB-50, 50% phenyl, 50% diethylpropions, 30 M×0.25 mm, film thickness 0.25 µm). Chromatograph conditions were as follows: the volume of 1 ál when you split 50:1. Constant speed=1.0 ml/min Thermostat 100°C for 5 min, increasing the temperature at a speed of 5°C/min to 300°and remain within 8 minutes the Connection goes on 39,08 and 39,31 min, but the separation is very good.

Example 32

In example 32 describes the obtaining chiral amine reagent used in the amide combination.

To a solution of hydroxyethylpyrrolidine (50 g, 434 mmol) in methylene chloride (1 l) was added triphenylphosphine (148 g, 564 mmol) followed by careful addition of tetrabromide carbon (187 g, 564 mmol) at room temperature. The reaction mixture was stirred for 1 h at on the th temperature. Added water and the organic layer was washed with saturated salt solution, dried over sodium sulfate and the solvent was removed in vacuum. The resulting oil was purified by chromatography on silica gel (hexane/ethyl acetate 1:1) to give the bromide as a clear oil (35 g, 197 mmol).

To a solution of bromide (23,0 g, 129 mmol) in a mixture of acetonitrile and water (75:15, 200 ml) was added potassium cyanide (12,6 g, 194 mmol) and 18-crownether-6 (340 mg, 1.3 mmol) and the reaction mixture was stirred over night at room temperature. Then the volume was reduced to 50 ml in vacuo and was twice extracted with methylene chloride (2×200 ml). The obtained extracts were combined and washed with saturated salt solution, dried over sodium sulfate and the solvent was carefully removed under vacuum to obtain cyanide in the form of a clear oil (17 g).

The cyanide solution (17 g, 137 mmol) in methanol (90 ml) was added Raney Nickel (2.0 g, aqueous solution) and the mixture was purged with hydrogen pressure (60 psi) with shaking for 24 hours the Solution was filtered and the solvent was removed in vacuum. Pure amine was isolated by distillation (BP.=50°From about 10 mm RT. Art.) as a clear oil (rate of 7.54 g of 58.9 mmol).

The ratio of enantiomers can be determined by obtaining the RS (N-cryptomailer-L-propylchloride, Regis #440001) and use GHS (HP 6890N/5973 MSD) on a capillary column (Phenomenex Zebron (ZB-50, 50% phenyl, 50% dimitromanolaki, 30 M×0.25 mm, film thickness 0.25 µm). Chromatograph conditions were as follows: the volume of 1 ál when you split 50:1. Constant speed=1.0 ml/min Thermostat 100°C for 5 min, increasing the temperature at a speed of 5°C/min to 300°and remain within 8 minutes the Connection is allocated to 28,51 and 28,68 min, but the separation is very good.

It is clear that the subsequent detailed description and accompanying examples are merely illustrative and are not intended as limiting the scope of the invention. Specialists in this field will become apparent, various changes and modifications of the disclosed embodiments. Such changes and modifications, including without limitation, related to the chemical formula, substituents, derivatives, intermediates compounds, synthesis, compositions and/or methods of use of the invention can be made without departing from its essence and volume. The above U.S. patents and publications incorporated in this description by reference.

Example 33

To a solution of 2,6-dichloronicotinic acid (1.0 EQ, 31,24 g 162,7 mmol) in methylene chloride (500 ml) was added oxalicacid (1.2 EQ, 23.7 g, 187,5 mmol) followed by addition of 3 Capel is DMF and the mixture was stirred over night at room temperature. Then the solvent was removed in vacuum to obtain the crude acid chloride in the form of oil. In a separate flask was dissolved ethylmalonate potassium (1.5 EQ, 41.5 g, 244 mmol) in acetonitrile (500 ml) and the mixture was cooled to 5°C. Then was added magnesium chloride (1.5 EQ, and 23.4 g, 245,8 mmol) over 5 minutes, maintaining the temperature of the mixture below 25°C. and Then the crude acid chloride was dissolved in acetonitrile (50 ml) and added via addition funnel, maintaining the temperature below 5°C for 30 minutes Then as quickly as possible was added triethylamine (2.0 EQ, 42.8 g, 325 mmol), still maintaining the temperature of the mixture below 10°C. After complete addition the reaction mixture was allowed to warm to room temperature overnight with constant stirring. The solvent was removed in vacuo and replaced with ethyl acetate. Added 1N. aqueous HCl (500 ml) and the mixture was stirred for 30 minutes the Organic layer was separated, washed with saturated salt solution, dried over sodium sulfate and the solvent was removed in vacuum to obtain keeeper as an orange oil (35,04 g). The product was purified by recrystallization from a mixture of 10% water/methanol to obtain pure keeeper 1 in the form of a white crystalline solid (31,21 g, 74%). IHMS (ES): purity 95%, eluted in 2 peaks, m/z 216, 262.

Example 34

Ket is ether 1 (1.0 EQ, of 11.45 g, 43,87 mmol) was dissolved in DMF (60 ml) and the mixture was cooled to 0°in an ice bath. Then add methyliodide (3.0 EQ, and 8.2 ml, 132,0 mmol) and the mixture was cooled to -5°C. Then was added carbon disulfide (1.5 EQ, 4.0 g, 65,8 mmol) followed by the addition of potassium carbonate (2.0 EQ, 12,1 g, 88 mmol), keeping the temperature below 5°C. the Mixture was allowed to warm to room temperature with stirring for 2 h, then was extracted with ethyl acetate (5×100 ml) and dried over sodium sulfate. The solvent was removed in vacuum and the oil obtained was purified by chromatography on silica gel (mixture of 10% ethyl acetate/hexane) to produce bestiaire 2 as a yellow oil (yield 70%). IHMS (ES): purity 90%, m/z 388 [M+22]+, 320 [M+1-OEt]+.

Example 35

Ethyl 2,6-dichloro-5-fluoro-3-pyridine-β-ketopropionic (1.0 EQ, 31,79 g, 0,113 mmol) was dissolved in DMF (180 ml). The solution was cooled using a mixture of ice and salt. Added iodomethane (3.0 EQ, 21 ml, 0,887 mmol) and carbon disulfide (1.5 EQ, 10.3 ml, 0,170 mol) and the mixture was stirred until the temperature of the mixture T=-2°C. Very quickly (within 2-3 minutes) was added To a2CO3(2.0 EQ, of 31.4 g, 0,227 mmol), which caused the increase of the temperature of the mixture up to T=12°C. the Mixture was stirred in an ice bath for 5 hours After adding water and saturated salt solution connection extraheavy and EtOAc (3× ). The combined extracts were washed with a saturated solution of salt (2×), dried over Na2SO4and volatiles removed in vacuum. Purification with flash chromatography on silica gel (5-30% EtOAc gradient in hexane) gave compound 3 as a thick yellow oil (22,86 g, yield 52%). Rf=0,14 (10% EtOAc in hexane); IHMS (ES): purity 95%, m/z 384 [M]+, 338 [M-EtOH]+, 340 [M+2-EtOH]+, 342 [M+4-EtOH]+;1H NMR (CDCl3, 500 MHz) δ to 1.16 (t, J=7,4, 3H), 2,43 (s, 6H), 4,18 (sq, J=7,4, 2H), 7,86 (DD, J=0,6, J=7,4, 1H) ppm

Example 36

Compound 3 (1.0 EQ, 18,93 g, 49,18 mmol) was dissolved in toluene (400 ml). The solution was carefully degirolami, barbotine nitrogen for 10 minutes After adding 2-aminothiophenol (0.9 EQ, 4,7 ml, 43,92 mmol) and the mixture was stirred at 130-140°C (oil bath temperature) for 6 h at a constant passing nitrogen into the reaction mixture. Added DIEA (1.0 EQ, 8.6 ml, 49,37 mmol) and the mixture was stirred at 140°With during the night. After cooling, the compound 4 was started to precipitate. The solid was filtered and washed with a small amount of toluene. Substance suspended in the Meon and within a few minutes was treated with ultrasound. After filtration and drying were isolated compound 4 in the form of a yellowish-brown solid (9,19 g, yield 56%). IHMS (ES): purity 95%, m/z 377 [M+1]+, 379 [M+3]+, 331 [M+1-EtH] +, 333 [M+3-EtOH]+;1H NMR (CDCl3, 500 MHz) δ 1,50 (t, J=7,0, 3H), 4,53 (d, J=7,0, 2H), 7,52 (TD, J=0,9, J=7,1, 1H), 7,63 (TD, J=1,4, J=6,0, 1H), to 7.84 (DD, J=1,2, J=7,9, 1H), to 8.62 (d, J=7,4, 1H), 9,49 (d, J=8,6, 1H) ppm

Example 37

The vessel connection 3 (1.0 EQ, 202 mg, 0,526 mmol) and N-methylbenzol-1,2-diamine (1.0 equiv, 60 μl, 0,528 mmol) was stirred at 130°in anhydrous toluene (5 ml) for 16 hours After removal of volatiles in vacuo the crude mixture was purified flash chromatography on silica gel (0.5 to 3% gradient Meon in CH2Cl2). After you add Meon to the resulting oil residue was becoming a pure compound 5. The substance was filtered and dried to obtain compound 5 as a yellow solid (29 mg, yield 15%). Rf=0,26 (5% Meon in CH2Cl2); IHMS (ES): purity 95%, m/z 374 [M+1]+, 376 [M+3]+, 328 [M+1-EtOH]+, 330 [M+3-EtOH]+;1H NMR (CDCl3, 500 MHz) δ to 1.47 (t, J=7,0, 3H), 3,70 (s, 3H), 4,50 (sq, J=7,0, 2H), 7,37 (DD, J=8,1, J=1,0, 1H), 7,44-7,51 (m, 2H), 8,55 (d, J=7,6, 1H), to 8.94 (DD, J=1,1, J=8,1, 1H) ppm

Example 38

The vessel connection 3 (1.0 EQ, 221 mg, 0,575 mmol) and 2-aminophenol (1.1 equiv, 70 mg, 0,641 mmol) was stirred at 130°in anhydrous toluene (5 ml) for 6 hours, After cooling the mixture the resulting brown precipitate was filtered. This substance was dissolved in CH2Cl2and the solution was filtered through a friable layer is of cellite. Recrystallization from toluene gave compound 6 as a beige solid (48 mg, yield 24%). IHMS (ES): purity 95%, m/z 361 [M+1]+, 363 [M+3]+, 315 [M+1-EtOH]+, 317 [M+3-EtOH]+;1H NMR (CDCl3, 500 MHz) showed a purity of about 80%, δ of 1.46 (t, J=7,0, 3H), 4,50 (sq, J=7,3, 2H), of 7.48-rate of 7.54 (m, 2H), 7,65 (DD, J=1,4, J=7,9, 1H), to 8.57 (d, J=7,4, 1H), 8,68 (DD, J=1,4, J=7,9, 1H) ppm

Example 39

The vessel connection 3 (1.0 EQ, 266 mg, 0,692 mmol) and 3-amino-4-(methylamino)benzonitrile (1.0 equiv, 100 mg, 0,689 mmol) was stirred at 130°in anhydrous toluene (5 ml) for 2 days. After evaporation of the solvents the crude product was passed through a column of silica gel (0.5 to 3% gradient Meon in CH2Cl2). Purification preparative TLC on silica gel, the two plates 1 mm thick, 4% Meon in CH2Cl2) gave compound 7 as a yellow solid (32 mg, yield 12%). IHMS (ES): purity 95%, m/z 399 [M+1]+, 401 [M+3]+, 353 [M+1-EtOH]+, 355 [M+3-EtOH]+;1H NMR (CDCl3, 500 MHz) δ to 1.47 (t, J=7,1, 3H), and 3.72 (s, 3H), 4,51 (sq, J=7,3, 2H), 7,42 (d, J=8,4, 1H), 7,79 (DD, J=1,5, J=8,4, 1H), 8,55 (d, J=7,3, 1H), which 9.22 (d, J=1,4, 1H) ppm

Example 40

The vessel connection 3 (1.0 EQ, 228 mg, 0,749 mmol) and 2-amino-4-chlorbenzoyl (1.0 EQ, 120 mg, 0,752 mmol) was stirred at 130°in anhydrous toluene (5 ml) for 2 days. Solid, obrazovavsheesya reaction time, was filtered and dissolved in a mixture of Meon and CH2Cl2(200 ml). The obtained turbid solution was filtered through a loose layer of celite. After evaporation of volatiles compound was purified flash chromatography on silica gel (CH2Cl2then 0.5% of the Meon in CH2Cl2). Compound 8 was isolated as a yellow solid (20 mg, yield 6%). IHMS (ES): purity of >85%, m/z 411 [M]+, 413 [M+2]+, 415 [M+4]+, 365 [M-EtOH]+, 367 [M+2-EtOH]+, 368 [M+4-EtOH]+.

Example 41

The vessel connection 3 (1.0 EQ, 255 mg, 0,664 mmol) and benzene-1,2-diamine (1.0 EQ, 72 mg, 0,666 mmol) was stirred at 130°in anhydrous toluene (5 ml) for 5 hours Volatiles were removed in vacuum and the substance was dissolved in diglyme (2 ml). Added a 60% suspension of NaH in oil (1.0 EQ, 26 mg, 0,63 mmol) and the mixture was stirred at 130°C for 3 hours the precipitate was filtered and washed with water. After trituration with Meon and filtration were isolated compound 9 as a brown solid (91 mg, yield 38%). IHMS (ES): purity 95%, m/z 360 [M+1]+, 362 [M+3]+;1H NMR (CDCl3, 500 MHz) δ the 1.44 (t, J=7,1, 3H), of 4.44 (sq, J=7,1, 2H), 7,40-7,46 (m, 2H), 7,49 (m, 1H), and 8.50 (d, J=7,7, 1H), 8,81 (d, J=6,8, 1H) ppm

Example 42

To a solution of bestiaire 2 (1.0 EQ, 10,14 g, 27.7 mmol) in toluene (300 ml) was added 2-aminothiophenol (1,equ, 3,81 g of 30.5 mmol) and the mixture is boiled under reflux overnight with constant degassing, barbotine nitrogen. Then the mixture was allowed to cool to room temperature and added diisopropylethylamine (1.5 EQ, 7,0 ml, 41,55 mmol) and the mixture was heated to boiling for 3 hours the Mixture was allowed to cool to room temperature, the product was separated by filtration to obtain the cyclic ester 10 as a yellowish brown solid (6.6 g, yield 66%). IHMS (ES): purity 95%, m/z 359 [M+1]+.

Example 43

To a solution of bestiaire 2 (1.0 EQ, 5.0 g, 13,66 mmol) in toluene (150 ml) was added N-methyl-1,2-phenylenediamine (1.2 equiv, 2.0 g, 16.4 mmol) and the mixture is boiled under reflux overnight with constant degassing, barbotine nitrogen. Then the mixture was allowed to cool to room temperature and added diisopropylethylamine (1.5 EQ, 3.5 ml, 20,75 mmol) and the mixture was heated at the boil under reflux for 3 hours the Mixture was allowed to cool to room temperature and was added methanol. The volume was reduced to about 100 ml by evaporation on a rotary evaporator and kept for 2 days. The product was separated by filtration and recrystallized to obtain a cyclic ether 11 in the form of a yellowish-brown solid (2.6 g, yield 53%). IHMS (ES): purity 95%, m/z 356 [M+1]+

Example 44

To a solution of bestiaire 2 (1.0 EQ, 10,14 g, 27.7 mmol) in toluene (300 ml) was added 1,2-phenylenediamine (1.1 EQ, 3.3 grams, of 30.5 mmol) and the mixture is boiled under reflux overnight with constant degassing, barbotine nitrogen. Then the mixture was allowed to cool to room temperature, was added diisopropylethylamine (1.5 EQ, 7,0 ml, 41,55 mmol) and the mixture was heated at the boil under reflux for 3 hours the Mixture was allowed to cool to room temperature and the product was separated by filtration to obtain a cyclic acid 12A in the form of a yellowish-brown solid (3.5 g, and 11.2 mmol, yield 40%). IHMS (ES): purity 95%, m/z 314 [M+1]+. The obtained filtrate was concentrated in vacuo and triturated with diethyl ether (100 ml). The product was separated by filtration to obtain a cyclic ether 12 in the form of a yellowish-brown solid (3.5 g, or 10.3 mmol, yield 37%). IHMS (ES): purity 95%, m/z 342 [M+1]+.

Example 45

Compound 4 (1.0 EQ, of 1.57 g of 4.17 mmol) was suspiciously in acetic acid (15 ml). The suspension was degirolami, barbotine nitrogen for 10 minutes was Added ammonium formate (10 EQ, 2,63 g of 41.6 mmol) and Pd/C (10% wet type Degas, 2.5 g) and the mixture vigorously stirred at 60°C for 3 hours the Mixture was filtered through a loose layer of celite. the Gol several times was treated with a hot mixture of CH 2Cl2, Meon and acetic acid for the complete removal of the intended substance. The combined filtrates evaporated and added CH2Cl2. The organic phase is washed with water (2×), dried over Na2SO4and the solvents were removed in vacuum. The obtained solid was treated with ultrasound in a mixture of EtOAc and hexane, filtered and dried to obtain pure compound 13 in the form of not-quite-white solid (1,11 g, yield 78%). IHMS (ES): purity 95%, m/z 343 [M+1]+.

Example 46

Compound 14 was prepared in accordance with the methodology used for product 13, at a higher temperature (80° (C) and longer reaction time. Several times I added more excess reagents to fully develop. The compound was isolated in the form of not-quite-white solid (41 mg, yield 15%). IHMS (ES): purity 95%, m/z 325 [M+1]+.

Example 47

The vessel connection 6 (1.0 equiv, 13 mg, 0,0360 mmol) and N-isopropylpiperazine (4.0 EQ, 21 μl, 0.147 mmol) was stirred in DMF (0.1 ml) at 90°With over 4.5 hours After addition of water the precipitate was filtered and dried. The product 15 was purified by precipitation with a mixture of AcOEt/hexane to obtain a beige solid (7 mg, yield 43%). IHMS (ES): purity > 90%, m/z 453 [M+1]+.

The following analogs recip is whether a similar way, using the appropriate amines and horsementality.

Example 48

In a vessel of compound 4 (1.0 EQ, 14 mg, 0,0372 mmol) and racemic tert-butyl 3-(pyrazin-2-yl)pyrrolidin-1-carboxylate (4.0 equiv, 50 mg, 0,160 mmol) was stirred in anhydrous NMP (0.2 ml) at 200°C for 1 h After addition of water the precipitate was filtered and dried. This substance was purified preparative TLC on silica gel (plate thickness of 1 mm, and was twice suirable 4% Meon in CH2Cl2). Compound 28 was isolated as a brown solid (9 mg, yield 50%). IHMS (ES): purity 90%, m/z 490 [M+1]+.

Example 49

In the receptacle connector 5 (1.0 EQ, 21 mg, 0,0562 mmol) and racemic tert-butyl 3-(pyrazin-2-yl)pyrrolidin-1-carboxylate (4.0 EQ, 56 mg, 0,225 mmol) was stirred in anhydrous NMP (0.2 ml) at 200°C for 3 hours After adding water the precipitate was filtered and dried. This substance was purified preparative TLC on silica gel (plate thickness of 1 mm, and was twice suirable 5% Meon in CH2Cl2and deposition using a mixture of CH2Cl2/hexane. Compound 29 was isolated as a beige solid (15 mg, yield 55%). IHMS (ES): purity 95%, m/z 487 [M+1]+.

Example 50

In the receptacle connector 5 (1.0 EQ, 21 mg, 0,0562 mmol), 2-(pyrazin-2-yl)ethanthiol (1.1 EQ, 8 ál, 0,0652 mmol) and K2CO3(1.2 EQ, 9 mg, 0,0651 mmol) were mixed in anhydrous DMF (0.2 ml). The mixture was stirred at 90°C for 3 hours After adding water the precipitate was filtered and dried. This substance is triturated with Meon and filtered. Compound 30 was isolated as a yellow solid (19 mg, 71%yield). IHMS (ES): purity 95%, m/z 478 [M+1]+.

The following analogs were obtained in a similar way, using the appropriate horsementality.

Example 51

Compound 13 (1.0 EQ, 266 mg, 0,777 mmol) suspended in anhydrous NMP (3 ml). In several minutes the mixture barbotirovany nitrogen. Was added 2-(pyrazin-2-yl)ethanthiol (5.0 EQ, of 0.48 ml, 3,91 mmol) and K2CO3(10.0 equiv, 1.0 g, of 7.23 mmol) and the reaction mixture is vigorously stirred at 100°C for 1 h To dissolve all substances added to the water. the pH is brought up to 1-2 by addition of 3N aqueous HCl. The obtained orange precipitate was filtered, suspended in a small amount of the Meon and filtered a second time. The crude compound 34 was isolated as an orange-brown solid and used at a later stage without any further purification (188 mg, yield 68). IHMS (ES): purity of 80-90%, m/z 357 [M+1]+.

Example 52

Compound 34 (1.0 EQ, 188 mg, 0,527 mmol) suspended in CH2Cl2(4 ml). Was added triethylamine (2.2 EQ, 0.16 ml, 1,148 mmol) and 2-(methyl bromide)pyridineboronic (1.2 EQ, 160 mg, 0,6325 mmol) and the mixture was stirred at room temperature for 15 minutes After addition of saturated aqueous NaHCO3the substance was extracted with CH2Cl2(3×). The combined extracts were dried over Na2SO4and the solvents were removed in vacuum. The compound was purified preparative HPLC. The resulting solution was concentrated and the pH is brought to 10 by adding aqueous NaOH solution. Compound 35 was filtered, triturated with a mixture of CH2Cl2/hexane and filtered to obtain a pale brown solid (59 mg, yield 25%). IHMS (ES): purity 95%, m/z 448 [M+1]+.

Example 53

In a round bottom flask was mixed compound 4 (1.0 EQ, 1.28 g, 3,397 mmol) and 2-(pyrrolidin-1-yl)ethanamine (2.0 EQ, 0,86 ml, 6,786 mmol) in CH2Cl2(50 ml). Added AlCl3(1.5 EQ, 680 mg, 5,10 mmol) and the mixture vigorously stirred at room temperature for 1 h After removal of CH2Cl2in vacuum, the resulting suspension was treated with a saturated aqueous solution of tartaric acid (about 20 ml) and displaced ivali until the complete disappearance solids (approximately 1 h to complete the hydrolysis). Added water and the pH was brought to 14 the addition of NaOH. The yellow precipitate was filtered and washed with water. The solid was dissolved in a large amount of the mixture of CH2Cl2/Meon and the turbid solution was filtered through a loose layer of celite. Volatiles were removed in vacuo and the solid triturated with hot methanol. Filtration and drying gave compound 36 (1,09 g, yield 72%) as a yellow solid. IHMS (ES): purity 95%, m/z 445 [M+1]+;1H NMR (CDCl3, 400 MHz) δ of 1.84 (m, 4H), to 2.65 (m, 4H), 2,80 (t, J=7,2, 2H), 3,68 (t, J=7,2, 2H), 7,52 (TD, J=1,2, J=7,2 1H), a 7.62 (TD, J=1,2, J=8,4 1H), 7,81 (DD, J=0,8, J=8,0 1H), to 8.62 (d, J=7,2, 1H), 9,49 (d, J=8,8, 1H), ppm

The following compounds were obtained in a similar way, using the appropriate amines and ethyl esters isobenzofuranone. Some compounds alternative was extracted CH2Cl2of the alkaline aqueous solution. Some compounds were purified preparative TLC on aluminium oxide (suirable 1-5% Meon in CH2Cl2), preparative HPLC or by rubbing with mixtures of EtOAc or CH2Cl2/hexane.

Example 54

The connection 64, the protected BOC-group, got in with the accordance with the methodology used for product 36. The crude BOC-amine was treated with undiluted triperoxonane acid (0.5 ml) during 45 minutes After evaporation of the acid was added water and the pH brought up to 14 by addition of 1N. NaOH solution. After extraction CH2Cl2(4×) extracts were washed with water (1×) and dried over Na2SO4. Racemic compound 64 was purified preparative TLC on aluminium oxide (plate 1.5 mm thick, was suirable 3 times 4% Meon in CH2Cl2) to obtain a yellow solid compound (6 mg, yield 37%). IHMS (ES): purity 95%, m/z 509 [M+1]+.

Example 55

Compound 65 was obtained in accordance with the methodology used for product 64. Compound 65 was purified preparative TLC on aluminium oxide (plate 1.5 mm thick, and was twice suirable 4% Meon in CH2Cl2and four times 5% Meon in CH2Cl2) and precipitation with a mixture of CH2Cl2/hexane to obtain yellow solid (2.7 g, yield 12%). IHMS (ES): purity of > 85%, m/z 506 [M+1]+.

Example 56

Compound 63 (300 mg, 0,523 mmol) suspended in undiluted triperoxonane acid (2 ml). The mixture was stirred at about 50°within a few minutes and the volatiles removed in vacuum. Added MeCN (5 ml) and the substance besieged Et2O (200 ml). Obedinenie 66 was purified preparative HPLC and was isolated after evaporation in the form of a double TFA salt (215 mg, yield 59%). IHMS (ES): purity >95%, m/z 474 [M+1]+.

Example 57

Compound 57 (20 mg) suspended in NMP (0.2 ml) and racemic piperidine-3-ylmethanol (0.2 ml). The mixture was heated by microwave at 200°within 15 minutes After purification preparative HPLC solution of compound 67 in a mixture of N2O/MeCN was concentrated in vacuo, the pH was brought to 9 with saturated solution of NaHCO3and the compound was extracted with CH2Cl2(4×). The combined extracts were dried over Na2SO4and the solvents were removed in vacuum. The obtained solid is triturated with a mixture of EtOAc/hexane to obtain racemic compound 67 in the form of a yellowish-brown solid compound (13 mg, yield 54%). IHMS (ES): purity >95%, m/z 506 [M+1]+.

The following compounds were obtained in a similar way, using the appropriate amines and forzamotorsport. In the case of less reactive amines the reaction was conducted at 220°C for 20 minutes

The following compounds were obtained in a similar way, using the appropriate amines and horsementality. The reaction was carried out using microwave heating at 100°t the value of 5 min or 150° C for 3 minutes

Example 58

To a solution of glorifier (1.0 g, of 2.81 mmol) and 1-(2-amino-ethyl)pyrrolidine (0.50 g, 4.4 mmol) in methylene chloride (20 ml) was added aluminium chloride (585 mg, 4.4 mmol) and the reaction mixture was stirred for 4 h at room temperature. Then the reaction was suppressed with saturated solution of Rochelle salt was podslushivaet 1H. NaOH solution and stirred for another hour. The mixture was extracted with methylene chloride, dried over magnesium sulfate and the solvent was removed in vacuum. The crude solid is triturated with ethyl acetate to obtain chloramide in the form of a yellowish-brown solid (0.5 g, 1.1 mmol); IHMS (ES): purity 95%, m/z 437 [M+1]+.

Example 59

To a solution of glorifier (1.0 g, of 2.81 mmol) in N-methylpyrrolidinone (10 ml) was added N-acetylpiperidine (540 mg, 4.2 mmol) and the mixture was heated at 110°C for 4 h was Added water and the crude product was separated by filtration. The obtained solid substance was dissolved in methylene chloride, dried over sodium sulfate and the solvent was removed in vacuum. The obtained solid is triturated with ethyl acetate to obtain aminoether in the form of a yellowish-brown substance (0,70 g of 1.62 mmol); IHMS (ES): who istota 95%, m/z 434 [M+1]+.

Example 60

To a solution of glorifier (1.0 g, of 2.81 mmol) in N-methylpyrrolidinone (10 ml) was added N-acetylpiperidine (540 mg, 4.2 mmol) and the mixture was heated at 110°C for 4 h was Added water and the crude product was separated by filtration. The obtained solid substance was dissolved in methylene chloride, dried over sodium sulfate and the solvent was removed in vacuum. The obtained solid is triturated with ethyl acetate to obtain aminoether in the form of a yellowish-brown substance (0.75 g, 1,67 mmol); IHMS (ES): purity 95%, m/z 451 [M+1]+.

Example 61

The following methodology was used to obtain a library of analogues.

To a solution of aminoether (200 mg, 0.46 mmol) and 1-(2-amino-ethyl)pyrrolidine (80 mg, 1.5 EQ) in methylene chloride (3 ml) was added aluminium chloride (100 mg, 1.5 EQ) and the reaction mixture was stirred for 4 h at room temperature. Then the reaction was suppressed with saturated solution of Rochelle salt was podslushivaet 1H. NaOH solution and stirred for another hour. The mixture was extracted with methylene chloride, dried over magnesium sulfate and the solvent was removed in vacuum. The crude solid was purified by mass-selective IHMS obtaining amide as a white solid (71 mg, 0.14 mmol); IHMS (ES): purity 95%, m/z 502 [M+1 +.

Example 62

The following methodology was used to obtain a library of analogues.

To a solution of aminoether (200 mg, 0.46 mmol) and 1-(2-amino-ethyl)pyrrolidine (80 mg, 1.5 EQ) in methylene chloride (3 ml) was added aluminium chloride (100 mg, 1.5 EQ) and the reaction mixture was stirred for 4 h at room temperature. Then the reaction was suppressed with saturated solution of Rochelle salt was podslushivaet 1H. NaOH solution and stirred for another hour. The mixture was extracted with methylene chloride, dried over magnesium sulfate and the solvent was removed in vacuum. The crude solid was purified by mass-selective IHMS obtaining amide as a white solid (200 mg, 0.38 mmol); IHMS (ES): purity 95%, m/z 519 [M+1]+.

Example 63

The following methodology was used to obtain a library of analogues.

To a solution of chloramine (350 mg, 0.83 mmol) in N-methylpyrrolidinone (2 ml) was added N-acetylpiperidine (160 mg, 1,24 mmol) and the mixture was heated at 110°C for 4 h was Added water and the crude product was separated by filtration. The obtained solid substance was dissolved in methylene chloride, dried over sodium sulfate and the solvent was removed in vacuum. The crude solid is triturated with ethyl acetate to obtain the amide in the form of b is the logo of a solid (200 mg, 0.4 mmol); IHMS (ES): purity 98%, m/z 516 [M+1]+.

Example 64

4-Methoxy-2-(methylthio)pyrimidine-5-carboxylic acid.To a solution of ethyl 4-chloro-2-(methylthio)pyrimidine-5-carboxylate (24,40 g, 104,9 mmol) in Meon (125 ml)was added solid sodium methylate (11,40 g, 211,0 mmol) at room temperature. The reaction mixture was stirred at room temperature for 5 h and then was treated with NaOH (17,70 g, 315,5 mmol) in N2O (100 ml). Then it was stirred at the same temperature for 1 h the Reaction mixture was concentrated to half volume and then acidified with HCl to pH 4 (6N. the solution). The reaction mixture was extracted with EtOAc (5×200 ml) and the organic layer was washed with saturated salt solution (200 ml), dried over Na2SO4and concentrated to give the desired product as a white solid (19,28 g, 92%); MS m/z: 201 [MH+].1H NMR (DMSO-d6) δ: 8,72 (s, 1H), 3,98 (s, 3H), of 2.54 (s, 3H).

Example 65

Ethyl 3-(4-methoxy-2-(methylthio)pyrimidine-5-yl)-3-oxopropanoic.A solution of 4-methoxy-2-(methylthio)pyrimidine-5-carboxylic acid (10.92 g, the 54.6 mmol) and oxalicacid (19,0 ml, 217,8 mmol) in toluene (100 ml) was heated at 100°C for 1 h the Solvent was removed under reduced pressure and the crude acid chloride was used without purification in the next the stage. To a solution of MgCl2(7,80 g, or 81.9 mmol) and malonate of etermine (14,10 g of 82.6 mmol) in THF (100 ml) was added the above acid chloride in THF (100 ml) at 0°C, followed by addition of tea (15.0 ml, 107,6 mmol). The reaction mixture was stirred at 0°C for 30 min and at room temperature for 2 hours was Added EtOAc (200 ml) and N2O (100 ml) and stirred for 30 minutes, the Layers were separated and the organic layer was washed with saturated salt solution (100 ml), dried over Na2SO4and concentrated. The crude substance was purified flash chromatography (mixture of 15% EtOAc/hexane) to give the desired compound as a white solid (7,73 g, 52%). MS m/z: 271 [MH+].1H NMR (CDCl3) δ 12,65 (s, 1H×2/3), cent to 8.85 (s, 1H×l/3), 8,84 (s, 1H×2/3), 6,03 (s, 1H×2/3), 4.26 deaths (square, 2H×2/3), 4,19 (square, 2H×1/3), 4,10 (s, 3H×2/3), 4.09 to (s, 3H×1/3), to 3.92 (s, 2H×1/3), 2,60 (s, 3H×1H), 2,59 (s, 3H×2/3), of 1.34 (t, 3H×2/3), of 1.26 (3H×1/3).

Example 66

Ethyl 2-(4-methoxy-2-(methylthio)pyrimidine-5-carbonyl)-3,3-bis(methylthiourea).To a solution of ethyl 3-(4-methoxy-2-(methylthio)pyrimidine-5-yl)-3-oxopropanoic in DMF (85 ml) was added methyliodide (5,3 ml of 85.1 mmol), carbon disulfide (2,6 ml, 43,0 mmol) at -5°C. was Slowly added solid To2CO3maintaining the temperature of the mixture below -3°C. the Reaction mixture was stirred at -5°there are over 1 h and at room temperature for 1 h Was diluted with EtOAc (300 ml), washed with H2About (2×200 ml) and dried over Na2SO4. The solvent was removed under reduced pressure and the crude substance was purified flash chromatography (mixture of 20% EtOAc/hexane) to give the desired product as a yellow oil (7,60 g, 71%yield). MS m/z: 375 [MH+].1H NMR (CDCl3) δ 8,82 (s, 1H), 4,16 (square, 2H), a 4.03 (s, 3H), 2,61 (s, 3H), of 2.51 (users, 3H), 2,28 (users, 3H)and 1.15 (t, 3H).

Example 67

Ethyl ester of 2-methylsulfanyl-5-oxo-5H-7-thia-1,3,11b-tratamento[with]fluoren-6-carboxylic acid.A solution of ethyl 2-(4-methoxy-2-(methylthio)pyrimidine-5-carbonyl)-3,3-bis(methylthio)acrylate (475 mg, of 1.27 mmol) and 2-aminobenzamide (200 mg, to 1.60 mmol) in toluene (5 ml) was heated to dryness and continued heating without dilution at 140°C for 1 h To the reaction mixture were added toluene (30 ml) and K2CO3(350 mg, 2,53 mmol) and was heated for another 1 h, the Reaction mixture was cooled to room temperature and was added EtOAc (100 ml) and N2About (50 ml). The layers were separated and the organic layer was washed with saturated salt solution (100 ml), dried over Na2SO4and concentrated. The crude solid is triturated with Et2O to give the desired product as a yellow solid (260 mg, yield 55%). MS m/z: 372 [MH+].1H NMR (DMSO-d6) δ: 9,37 (d, 1H), of 9.30 (s, 1H), of 8.06 (m, 1H), ,65 (m, 1H), 7,54 (m, 1H), 4,35 (square, 2H), 2,78 (s, 3H), l,34 (t, 3H).

Example 68

(2-Cyclopentylmethyl)amide 2-methylsulfanyl-5-oxo-5H-7-thia-1,3,11b-tratamento[with]fluoren-6-carboxylic acid.To a solution of ethyl ester of 2-methylsulfanyl-5-oxo-5H-7-thia-1,3,11b-tratamento[with]fluoren-6-carboxylic acid (230 mg, 0,619 mmol) and 2-(pyrrolidin-1-yl)ethanamine (of 0.24 ml, 1,854 mmol) in DCM (15 ml) was added solid AlCl3(250 mg, 1,875 mmol) at room temperature. The reaction mixture was stirred for 1 h at room temperature and diluted with DCM (100 ml), concentrated solution of tartrate of potassium-sodium (30 ml) and NaOH (6N. the solution, 10 ml). The mixture was stirred for 15 min and the layers were separated. The aqueous layer was extracted with DCM (50 ml) and the combined organic layer was washed with saturated salt solution (50 ml). The crude reaction mixture was dried over Na2SO4and concentrated to give the desired product as a yellow solid (250 mg, yield 92%). MS m/z: 440 [MH+].1H NMR (CDCl3) δ 10,26 (user., 1H), being 9.61 (s, 1H), of 9.55 (m, 1H), to 7.77 (m, 1H), EUR 7.57 (m, 1H), 7,50 (m, 1H), 3,67 (square, 2H), of 2.81 (s, 3H), 2,77 (t, 2H), 2.63 in (m, 4H), equal to 1.82 (m, 4H).

Example 69

(2-Pyrrolidin-1-retil)amide 2-(4-acetylpiperidine-1-yl)-5-oxo-5H-7-thia-1,3,11b-tratamento[with]fluoren-6-carboxylic acid.A solution of (2-cyclopentylmethyl)amide 2-metilsulfate the Il-5-oxo-5H-7-thia-1,3,11b-tratamento[with]fluoren-6-carboxylic acid (25 mg, 0,057 mmol) and 1-(piperazine-1-yl)ethanone (75 mg, 0,585 mmol) in NMP (1.0 ml) was heated for 20 min at 200°in a microwave oven. The crude reaction mixture was purified HPLC with reversed phase. MS m/z: 520 [MH+].

Example 70

Ethyl ester 7-methyl-2-methylsulfanyl-5,8-dioxo-7,8-dihydro-5H-1,3,7,12b-tetrazoles[C]phenanthrene-6-carboxylic acid.A solution of ethyl 2-(4-methoxy-2-(methylthio)pyrimidine-5-carbonyl)-3,3-bis(methylthio)acrylate (775 mg, 2,069 mmol) and 2-amino-N-methylbenzamide (475 mg, 3,163 mmol) in toluene (5 ml) was heated in a stream of nitrogen, giving to evaporate the toluene, and continued heating without dilution at 140°With during the night. Was cooled to room temperature and formed from DCM (10 ml), the precipitate was filtered. The solvent mother liquor was removed under reduced pressure and the deposition process was repeated with Et2O (10 ml). Rubbing with methanol (10 ml) gave the desired product as a yellow solid (30 mg, yield 4%). MS m/z: 397 [MH+].1H NMR (CDCl3) δ 9,37 (s, 1H), of 8.37 (d, 1H), compared to 8.26 (DD, 1H), of 7.70 (m, 1H), 7,49 (m, 1H), 4,46 (square, 2H), 3,61 (s, 3H), 2,60 (s, 3H), USD 1.43 (t, 3H).

Example 71

Ethyl ester of 2-methylsulfanyl-5,8-dioxo-7,8-dihydro-5H-1,3,7,12b-tetrazoles[C]phenanthrene-6-carboxylic acid.A solution of ethyl 2-(4-methoxy-2-(methylthio)pyrimidine-5-carbonyl)-3,3-bis(IU is ylthio)acrylate (250 mg, 0,668 mmol) and 2-aminobenzamide (118 mg, 0,867 mmol) in DCM (5 ml) was heated in a stream of nitrogen, giving DCM to evaporate, and continued heating without dilution at 140°With during the night. The residue was dissolved in DMF (7 ml) after cooling to room temperature and was treated with NaH (60 mg, 1500 mmol). The reaction mixture was stirred at room temperature for 1 h and diluted with DCM (20 ml) and N2O (20 ml). The layers were separated and the DCM was removed under reduced pressure. Rubbing raw substances with Et2O (10 ml) gave the desired product as yellow solid (50 mg, 20%). MS m/z: 383 [MH+].1H NMR (CDCl3) δ of 13.58 (users, 1H), 9,43 (s, 1H), at 8.60 (d, 1H), 8,33 (DD, 1H), 7,79 (m, 1H), to 7.59 (m, 1H), 4,48 (square, 2H), 2,62 (s, 3H), of 1.46 (t, 3H).

Example 72

The substance was received on the published methodology, which is slightly modified (J. Med. Chem., 2003, 46, 1661-1669). In nitrogen atmosphere 2-aminobenzoylamino (2.0 equiv, of 2.45 g, 20,05 mmol) was dissolved in THF (25 ml). Was slowly added a solution of di-tert-BUTYLCARBAMATE (1.0 EQ, 2,19 g, there is a 10.03 mmol) in THF (25 ml) via syringe pump over 30 minutes After a few minutes, was added THF (25 ml) to ensure effective mixing of dense suspensions. After stirring at room temperature overnight resulting white solid was filtered. The filtrate was concentrated the vacuum, poured on top of the column with silica gel and purified by chromatography (10-20% EtOAc gradient in hexane). The obtained solid substance was recrystallized from a mixture of EtOAc/hexane to obtain a white crystalline substance (1,95 g, yield 87% based on Vos2About). IHMS (ES): purity 95%, m/z 224 [M+H]+, 224 [M+Na]+;1H NMR (CDCl3, 400 MHz) δ the 1.44 (s, 9H), to 4.23 (d, J=6,0, 2H), 4.2V (users, 2H), 4,80 (users, 1H), of 6.68 (t, J=7,6, 2H), 7,02 (d, J=6,8, 1H), 7,10 (dt, J=8,0, J=1,6, 1H) ppm

Example 73

A mixture of compound 1 (1.22 g, 5,49 mmol) and compound 2 (2,01 g, 5,49 mmol) in DMF (10 ml) was stirred at 80°C for 5 h, at the same time barbotine in solution nitrogen. Added To2CO3(1.2 EQ, 910 mg, to 6.58 mmol) and the mixture was stirred at 80°C for 40 minutes was Added water and the resulting sticky substance was extracted with CH2Cl2(3×). The combined extracts were washed with water (1×), dried over Na2SO4and volatiles were removed in vacuum to obtain a thick oil (3.2 g solvent substances, output >100%). The resulting material had a purity of more than 85% and it was used in the next stage without additional purification. A small part of him was purified preparative HPLC to characterize. IHMS (ES): purity 95%, m/z 504 [M]+, 506 [M+2]+;1H NMR (CDCl3, 400 MHz) δ to 1.38 (s, 9H), of 1.40 (m, 3H), and 32 (s, 3H), 3,93 (DD, J=15,2, J=5,5, 1H), 4,24 (DD, J=14,8, J=4,2, 1H),4,43 (m, 2H), 4,84 (ushort, 1H), 7,15 (m, 1H), 7,29 (m, 1H), 7,45 (m, 1H), EUR 7.57 (m, 2H), 8,61 (d, J=8,8, 1H) ppm

Example 74

Compound 3 (1.5 g, 2,98 mmol) was dissolved in 5 ml triperoxonane acid. The mixture was stirred at room temperature for 2 hours Volatiles were removed in vacuo and the resulting thick oil was heated using a heat gun under vacuum. This operation is continued until the formation of compounds 4 cyclization (control according to GHMC). The compound was purified flash chromatography on silica gel (30-80% EtOAc gradient in hexane). The solid which has precipitated during the evaporation of the solvent was filtered and dried to obtain compound 4 as a white microcrystalline solid (434 mg, yield 41%). IHMS (ES): purity 95%, m/z 356 [M+H]+, 378 [M+Na]+, 310 [M+1-EtOH]+;1H NMR (CDCl3, 400 MHz) δ of 1.43 (t, J=6,8, 3H), 4,40 (sq, J=7,2, 2H), 4,46 (d, J=2,4, 2H), 7.24 to 7,40 (m, 4H), of 7.69 (d, J=8,4, 1H), to 8.62 (d, J=8,0, 1H), a 10.74 (users, 1H) ppm

Example 75

Compound 4 (1.0 EQ, 198 mg, 0,556 mmol) and K2CO3(2.0 EQ, 154 mg, 1.11 mmol) suspended in DMF (1.5 ml). Added iodomethane (1.4 EQ, 0.05 ml, 0.80 mmol) and the mixture was stirred at 70°C for 40 minutes was Added water and the substance was extracted with CH2Cl2(3×). Merge is installed extracts were washed with water, dried over Na2SO4and volatiles removed in vacuum. After purification with flash chromatography on silica gel (40-80% EtOAc gradient in hexane) compound 5 was isolated in the form of not-quite-white solid (181 mg, yield 88%). IHMS (ES): purity 95%, m/z 370 [M+H]+, 324 [M+1-EtOH]+;1H NMR (CDCl3, 400 MHz) δ of 1.41 (t, J=7,2, 3H), 3,17 (s, 3H), 4,29 (s, 2H), to 4.41 (sq, J=7,2, 2H), 7,27 (d, J=7,2, 1H), 7,33 (t, J=7,6, 1H), was 7.36 (d, J=8,4, 1H), 7,39 (TD, J=7,2, J=1,2, 1H), EUR 7.57 (d, J=8,4, 1H), 8,61 (d, J=8,4, 1H) ppm

Example 76

Compound 4 (1.0 EQ, 104 mg, 0.29 mmol) suspended in THF. Was added dropwise a solution of DDQ (1.1 EQ, 73 mg, 0.32 mmol) in THF (1 ml) and the resulting mixture was stirred at 70°C for 24 h was Added 1N. an aqueous solution of NaOH and the solution was extracted with CH2Cl2(4×). The combined extracts washed with saturated aqueous NaHCO3and the solvents were removed in vacuum. The compound was purified preparative HPLC (mixture of MeCN/water). MeCN evaporated, added NaHCO3and the compound was extracted with CH2Cl2. The combined extracts were dried over Na2SO4and the solvent was removed in vacuum to obtain compound 6 as not quite white solid (18 mg, yield 17%). IHMS (ES): purity 95%, m/z 372 [M+H]+, 326 [M+1-EtOH]+;1H NMR (CDCl3, 400 MHz) δ the 1.44 (t, J=6,8, 3H), 4,42 (sq, J=7,2, 2H), 6,01 (d, J=4,4, 1H), 7,4-of 7.55 (m, 4H), 7,98 (d, J=8,8, 1), 8,64 (d, J=8,4, 1H), 11,53 (users, 1H) ppm

Example 77

Compound 6 (8 mg, 0,021 mmol) suspended in dioxane (0.5 ml). Added one drop of concentrated aqueous HCl and the resulting yellow solution was stirred at room temperature. After 2 h was added one drop of concentrated HCl and was barbotirovany some air into the solution. The solution was stirred at room temperature for 24 h the Solvent was removed in vacuum, NMP was added and the compound was purified preparative HPLC (mixture of MeCN/water). The acetonitrile is evaporated, the product was extracted with CH2Cl2(3×) and the combined extracts were dried over Na2SO4. The solvent was removed to obtain compound 7 in the form of a solid (5 mg, yield 62%). IHMS (ES): purity 95%, m/z 370 [M+H]+, 392 [M+23]+, 324 [M+1-EtOH]+;1H NMR (CDCl3, 400 MHz) δ of 1.46 (t, J=7,2, 3H), 4,48 (sq, J=7,2, 2H), 7,52 (d, J=8,0, 1H), 7,58 (t, J=6,8, 1H), 7,81 (dt, J=6,8, J=1,6, 1H), with 8.33 (DD, J=7,6, J=1,2, 1H), 8,56 (d, J=8,8, 1H), to 8.70 (d, J=8,0, 1H), of 13.58 (users, 1H) ppm

Example 78

Compound 4 (1.0 EQ, 218 mg, 0,613 mmol) and K2CO3(2.0 EQ, 169 mg, 1,22 mmol) suspended in DMF (1.5 ml). Added iodomethane (1.2 EQ, 0,059 ml to 0.74 mmol) and the mixture was stirred at 70°C for 35 minutes was Added water and the substance was extracted with CH2Cl22SO4and volatiles removed in vacuum. After purification preparative HPLC pH of the resulting solution in a mixture of MeCN/water brought the addition of NaHCO3and MeCN evaporated. The substance was extracted with CH2Cl2and the combined extracts were dried over Na2SO4. The deposition of a mixture of CH2Cl2/hexane gave compound 8 as not quite white solid (77 mg, yield 33%). IHMS (ES): purity 95%, m/z 384 [M+H]+, 406 [M+Na]+, 338 [M+1-EtOH]+.

Example 79

Compound 4 (1.0 EQ, 110 mg, 0,309 mmol) and N-acetylpiperidine (4.0 EQ, 158 mg, 1,233 mmol) were mixed in NMP (0.3 ml) and the resulting solution was heated by microwave at 100°C for 5 minutes was Added a mixture of EtOAc and hexane and the resulting solid was filtered and dried. Compound 9 was isolated in the form of not-quite-white solid (145 mg, yield 100%). IHMS (ES): purity 95%, m/z 448 [M+H]+.

Example 80

Compound 10 was obtained in accordance with the methodology used to obtain compound 9. Compound 10 was isolated as not quite white solid (147 mg, yield 70%). IHMS (ES): purity 95%, m/z 462 [M+H]+, 416 [M+H-EtOH]+.

Example 81

Compound 9 (1.0 EQ, 131 mg, 0,293 mmol) and 1-(2-am is noetic)pyrrolidine (1.5 EQ, 0.05 ml, 0,394 mmol) were mixed in CH2Cl2(5 ml). Added AlCl3(2.0 equiv, 80 mg of 0.60 mmol) and the resulting solution was vigorously stirred at room temperature. After 3 h was added 0.1 ml of 1-(2-amino-ethyl)pyrrolidine and 2 ml of CH2Cl2and the reaction mixture was stirred over night. After removal of CH2Cl2in vacuum, the resulting suspension was treated with a saturated aqueous solution of tartaric acid and stirred until the disappearance of all solids (approximately 1 h to complete the hydrolysis). Added water and the pH was brought to 14 the addition of NaOH. The product was extracted with CH2Cl2(4×). The combined extracts were washed with saturated salt solution (1×) and dried over Na2SO4. After removal of solvent the crude substance was dissolved in a mixture of NMP and triperoxonane acid and was purified preparative HPLC (MeCN, water). After adjusting the pH with NaOH and evaporation of MeCN substance was extracted with CH2Cl2. After drying over Na2SO4and evaporation of volatiles compound 11 was inundated with mixture of EtOAc/hexane, filtered and dried to obtain white solid (60 mg, yield 40%). IHMS (ES): purity 95%, m/z 516 [M+H]+.

Example 82

Compound 12 was obtained in accordance with the methodology used to obtain compound 11. Connect the s 12 was isolated in the form of not-quite-white solid (28 mg, yield 17%). IHMS (ES): purity 95%, m/z 530 [M+H]+.

Example 83

Compound 8 (1.0 EQ, 77 mg, 0,201 mmol) and N-acetylpiperidine (4.0 EQ, 103 mg, 0,803 mmol) were mixed in NMP (0.5 ml) and was heated by microwave at 100°C for 10 minutes was Added water and a saturated solution of salt and sticky substance was separated by filtration. This crude substance was dissolved in CH2Cl2the solution was dried over Na2SO4and volatiles removed in vacuum. Then there was the final stage of the reaction with the crude ester in accordance with the methodology used to obtain compound 11. Compound 13 was isolated in the form of not-quite-white solid (7 mg, yield 6%). IHMS (ES): purity 95%, m/z 544 [M+H]+.

Example 84

Compound 14 was obtained in accordance with the methodology used to obtain compound 13 as described in example 83. Compound 14 was isolated in the form of not-quite-white solid. IHMS (ES): purity 91%, m/z 530 [M+H]+.

Example 85

Ethyl 2-(4-chlorobenzothiazole-2-yl)acetate was obtained by way Abbotto, Bradamante et al. (J. Org. Chem., 2002, 16, 5753). Undiluted mixture of 4-chloro-2-aminothiophenol (6,36 g, 40 mmol) and ethylcyanoacrylate (6.8 g, 60 mmol) was heated at 125°C for 2 h, at this time, TLC analysis indicated that the reaction C is ended, what was judged by the disappearance of the parent compound. The mixture is triturated with a mixture of diethyl ether and hexane to obtain to $ 7.91 g of yellow crystals in the first game and 0.75 g of crystals in the second game, which was in General 8,66 g (85%). JHMS: 256,2 [M+H]+.

2,6-dichlorphenol acid (1.80 g, 9.5 mmol) suspended in dichloromethane (10 ml) and treated with oxalylamino (1,53 g, 12,0 mmol). The mixture was cooled in an ice bath and added two drops of dimethylformamide. After the initial vigorous evolution of gas in the ice bath was removed and the solution was stirred for 18 h at room temperature. Aliquot portion of the reaction mixture extinguished with methanol and analyzed IHMS, data which indicated that all the acid has turned into the acid chloride. The solution was concentrated on a rotary evaporator to obtain the acid chloride as a light brown crystalline solid, which was used in the next stage without additional purification. JHMS: 206,2 (methyl ether M+N)+.

Tetrahydrofuran (25 ml) was added to a mixture of ethyl 2-(4-chlorobenzothiazole-2-yl)acetate (2.2 g, 8.6 mmol), magnesium chloride (1.19 g, 12.9 mmol) and 2,6-dichlorophenylamino obtained at the previous stage. The resulting suspension was cooled in an ice bath and was added to ply the triethylamine (2.4 g, to 17.2 mmol) at such a speed that the temperature of the mixture did not rise above 10°s, which was determined using a temperature sensor. After the addition the ice bath was removed and the mixture was stirred until the temperature rises to room within 2 hours the Reaction mixture was diluted with dimethylformamide, was added potassium carbonate (1.19 g, 8.6 mmol) and was heated up to 80°C for 1 h, at this time, data IHMS indicated that the reaction had ended. The reaction mixture was diluted with water and filtered. The solid was dissolved in a mixture of dichloromethane and chloroform, washed with water and the organic phase was dried over sodium sulfate. After concentration on a rotary evaporator, the product was purified by rubbing with diethyl ether to obtain 2.5 g (yield 74%) of dichloramine in the form of a beige solid. JHMS: 393,2 (M+N)+.

Example 86

A solution of 2-(1-methylpyrrolidine-2-yl)ethylamine (295 mg, 2.3 mmol) in dichloromethane (5 ml) was treated with trimethylaluminum (0,99 ml, 25% solution in hexane, is 2.37 mmol). This solution was added to the solution containing dichlorethyl A (600 mg, 1.53 mmol) and dichloromethane (10 ml)at such a speed that the temperature of the mixture did not exceed 10°C. the Solution was stirred for 18 h, at this time, data IHMS indicated that the reaction had ended. The reaction mixture was treated sign the postal salt and three times was extracted with dichloromethane. The organic extracts were dried over sodium sulfate to obtain a residue, which was purified by rubbing with dichloromethane and diethyl ether to obtain 450 mg (yield 62%) dichloride In the form of a beige solid. JHMS: 475,5 (M+N)+.

Example 87

A mixture of the BOC-amine (250 mg, 1.0 mmol) was subjected to unprotect processing triperoxonane acid (1 ml) and dichloromethane (1 ml) at 50°C for 2 hours, the Obtained residue was concentrated on a rotary evaporator, and then connects to a deep vacuum. To this residue was added dichlormid In (200 mg, 0.42 mmol) and N-methylpyrrolidinone (0.8 ml) and diisopropylethylamine (0.5 ml). The mixture was stirred at 80°C for 72 h, at this time, data IHMS indicated that the reaction had ended. The mixture was diluted with water (containing 10% triperoxonane acid) and purified preparative HPLC with getting 286 mg (yield 97%) of the connections in terms of the relevant trifenatate. JHMS: 588,3 (M+N)+.

Example 88

In this example evaluated the activity of the tested compounds are presented below, which was administered intravenously.

Methodology

Female mice of nu/nu at the age of 6 weeks were obtained from nursery Taconic Farms, Germantown NY. They were drawn 5×106cells NST subcutaneously into the right side. When tumors is and has reached sufficient for setting of the study size, the animals were randomly divided into groups.

Solvent:242,9 mm3
Test the connection:251,0 mm3

Animals did/bolus-injection in the lateral tail vein for five days in a row. The caliper measurement was performed at 1, 4 and 6 days. Figure 3 shows data on the activity of the test compounds at a dose of 25 mg/kg without any observed side effects.

Example 89

In this example evaluated the activity of the tested compounds are presented below, which was administered intravenously.

Methodology

Female mice of nu/nu at the age of 6 weeks were obtained from nursery Simonsen Labs, Gilroy, CA. They were drawn 5×106cells NST subcutaneously into the right side. When the tumor reached sufficient for setting of the study size, the animals were randomly divided into groups.

Solvent:101,9 mm3
Test the connection:152,8 mm3

Animals did/bolus-injection in the lateral tail vein within fourteen days in a row. The caliper measurement was carried out on 1, 3, 5, 7, 10, 12, 14 and 18 days. Figure 4 summarizes the activity under test with the organisations at a dose of 12.5 mg/kg without any observed side effects.

Example 90

In this example evaluated the activity of the test compound from example 89, which was administered intravenously at different doses.

Methodology

Female mice of nu/nu at the age of 6 weeks were obtained from nursery Simonsen Labs, Gilroy, CA. They were drawn 5×106cells NST subcutaneously into the right side. When the tumor reached sufficient for setting of the study size, the animals were randomly divided into groups.

Solvent:114,6 mm3
Test the connection:106,1 mm3
Test the connection:84,1 mm3

Animals did/bolus-injection in the lateral tail vein within fourteen days in a row. The caliper measurement was performed at 1, 4, 6, 8, 12 and 15 days. Figure 5 shows dose-dependent activity without any observed side effects.

Example 91

In this example evaluated the activity of the tested compounds are presented below, which was administered intravenously.

Methodology

Female mice of nu/nu at the age of 6 weeks were obtained from nursery Taconic Farms, Germantown NY. They were drawn 5×106cells NST subcutaneously into the right side. When the tumor reached quite the full-time to the formulation of the study size, the animals were randomly divided into groups.

Solvent:242,9 mm3
Test the connection:252,1 mm3

Animals did/bolus-injection in the lateral tail lateral vein for five days in a row. The caliper measurement was performed at 1, 4 and 6 days. Figure 6 presents data on the activity of the test compounds at a dose of 25 mg/kg without any observed side effects.

Example 92

In this example evaluated the activity of the tested compounds are presented below, which was administered intravenously.

Methodology

Female mice of nu/nu at the age of 6 weeks were obtained from nursery Taconic Farms, Germantown NY. They were drawn 5×106cells NST subcutaneously into the right side. When the tumor reached sufficient for setting of the study size, the animals were randomly divided into groups.

Solvent:242,9 mm3
Test the connection:236,1 mm3

Animals did/bolus-injection in the lateral tail vein for five days in a row. The caliper measurement was performed at 1, 4 and 6 days. Figure 7 shows the activity of the tested compounds the Oia at a dose of 25 mg/kg without any observed side effects.

Example 93

In this example evaluated the activity of the tested compounds are presented below, which was administered intravenously.

Methodology

Female mice of nu/nu at the age of 6 weeks were obtained from nursery Taconic Farms, Germantown NY. They were drawn 5×106cells NST subcutaneously into the right side. When the tumor reached sufficient for setting of the study size, the animals were randomly divided into groups.

Solvent:242,9 mm3
Test the connection:254,7 mm3

Animals did/bolus-injection in the lateral tail vein for five days in a row. The caliper measurement was performed at 1, 4 and 6 days. On Fig the data on the activity of the test compounds at a dose of 25 mg/kg without any observed side effects.

Example 94

In this example evaluated the activity of the tested compounds are presented below, which was administered intravenously.

Methodology

Female mice of nu/nu at the age of 6 weeks were obtained from nursery Taconic Farms, Germantown NY. They were drawn 5×106cells NST subcutaneously into the right side. When the tumor reached sufficient for the production of issledovanieyami animals were randomly divided into groups.

Solvent:112,7 mm3
Test the connection:113,1 mm325 mg/kg
Test the connection:110,1 mm312.5 mg/kg
SRT:109.4 mm3

Animals did/bolus-injection in the lateral tail vein for nine days in a row. The caliper measurement was performed at 1, 3, 5 and 7 days. Figure 9 shows evidence of limited activity of compounds at the highest dose and there is no activity in an average dose without any observed side effects.

Example 95

In this example evaluated the activity of the tested compounds are presented below, which was administered intravenously.

Methodology

Female mice of nu/nu at the age of 6 weeks were obtained from nursery Taconic Farms, Germantown NY. They were drawn 5×106cells NST subcutaneously into the right side. When the tumor reached sufficient for setting of the study size, the animals were randomly divided into groups.

Solvent:112,7 mm3
Test the connection:107,1 mm325 mg/kg
Test the connection:108,9 mm312.5 mg/kg
SRT:109.4 mm3

Animals did/bolus-injection in the lateral tail vein for nine days in a row. The caliper measurement was performed at 1, 3, 5 and 7 days. Figure 10 shows high activity at the lowest dose. No observed side effects.

Example 96

Test evaluation of cell proliferation and/or cytotoxicity

Antiproliferative effects of these compounds can be tested using test evaluation of cell proliferation and/or cytotoxicity, following the protocols described below.

Cell culture.Epithelial cells of human malignant tumors of the cervix (HeLa cells) obtained from the American type culture collection (Manassas, VA). Cells were cultured in minimum essential medium Needle (MEM, Hyclone, Utah) supplemented with 2 mm glutamine, 0.1 mm nonessential amino acids, 1 mm Na pyruvate, 1.5 g/l NaHCO3, 50 mg/l gentamicin and 10% fetal calf serum (Hyclone, USA) in a humid atmosphere of 5% CO2at 37°C.

MTS tests.Antiproliferative effects of anticancer drugs evaluate test CellTiter 96 Aueous (Promega, WI), which is a colorimetric test to determine the number of viable cells. (See, for example, Wang L., et al., Methods Cell Sci. (1996) 18: 249-255). Typically, cells (2000-5000 cells/well) were seeded in 96-well plate with flat bottom (Corning, NY) in 100 μl culture medium without anticancer drug on 0 day and the culture medium for 1 day substitute containing anticancer drugs in different concentrations. After incubation for 3 days under normal culture conditions (4 day) monolayers once washed with PBS and the medium replaced with 100 μl of PBS in each well of 96-well plate. After mixing MTS and PBS in a ratio of 20:1 to each well of 96-hole of the tablet is made of 20 μl of MTS solution/PBS and incubated for 4 h in a humid atmosphere of 5% CO2at 37°C. the Absorption is determined at 490 nm using a reader for 96-well plates FLUOstar Galaxy (BMG Labtechnologies, Germany).

Example 97

Test determination of the concentration of mRNA in the cell

To detect changes with-ICC-target and endogenous copies of the standard gene GAPDH in the same tubeyou can use the method of quantitative PCR in real time (QPCR). Typically, cells (15,000 cells/well) were seeded in 96-well tablets with a flat bottom (Corning, NY) and incubated under normal culture conditions during the night. In following with the TCI culture medium substitute containing anticancer drugs in different concentrations and incubated for 4 h in a humid atmosphere of 5% CO 2at 37°C. the Total RNA fraction (ornc) is extracted using the RNeasy kit 96 (QIAGEN, CA). The concentration of ink determined using reagent for the quantitative determination of RNA RiboGreen (Molecular Probes, OR).

The reaction of reverse transcription (RT) can be performed using 50 ng of ink of each hole in a 25 µl reaction mixture containing buffer 1× TaqMan RT, 2.5 μm random mixture of hexamers, 5.5 mm MgCl2, 0.5 mm of each deoxynucleotide (dNTP), 30 E MultiScribe reverse transcriptase and 10 E of RNase inhibitor. The reaction mixture for the production RT incubated for 10 min at 25°To conduct the reaction of reverse transcription for 30 min at 48°, inactivate for 5 min at 95°and placed at 4°C. All reagents for the production of RT can be obtained from Applied Biosystems, CA.

The reaction quantitative PCR in real time you can spend in a 50 µl reaction mixture containing 5 μl cDNA, universal mixture for PCR 1×previously obtained with primers-the ICC and the set of probes 1× and prior GAPDH primers and probe set to 0.8×. Due to the abundance of gene GAPDH in HeLa cells the concentration of primers and GAPDH probes is brought to the exact values for cycles (CTfor both genes in a single tube. The threshold cycle (CTindicates the number of fractional cycles, in which the ohms amount of amplified target reaches a fixed threshold. In this implementation amplification of GAPDH stops before reached the limit of ordinary reagents available for amplification with the ICC. Value ▵Rnrepresents the normalized reporter signal minus the background signal. Value ▵Rnincreases during PCR increases the number of copies of amplicon, until the reaction reaches a plateau.

The probe-ICC marking paint MGB 6FAMTMand the GAPDH probe mark paint MGB VIMTM. Conduct pre-incubation for 2 min at 50°With the activating AmpErase UNG and then for 10 min at 95°to activate the enzyme DNA polymerase AmpliTaq. DNA amplified in 40 cycles with a duration of 15 sec at 95°C and 1 min at 60°C. Amplified cDNA with human-ICC and GAPDH, detect and quantify in real-time using the system to identify sequences ABI Prism 7000 (Applied Biosystems, CA), which is set for simultaneous detection of reporter dyes 6FAM and VIM.

Data can be analyzed using the system to identify sequences ABI Prism and Microsoft Excel. Relative quantification is performed using the standard curve and comparative method WithTat the same time, and both methods provide the same the results. It is known that the cycle at which the graph of amplification crosses WithTthat accurately reflects the relative amount of mRNA. (See Heid et al., Genome Res. (1996) 6: 986-994; Gibson et al., Genome Res. (1996) 6: 995-1001). The reaction quantitative PCR in real time is carried out in three parallel with each break of the cDNA and calculate the average valueTof the three values. All reagents, including prior primers and probes can be obtained from Applied Biosystems, CA.

Example 98

Characterization of in vitro

You can use various methods to characterize the compounds of the present invention, including, but not limited to (i) stop-tests; (ii) methods of competition QUADRUPLEX/duplex; (iii) method footprints quadroma and iv) direct method in the absence of competitive molecules.

Stop the tests.Stop test is the primary screening methods for high-throughput designed for the detection of drugs that bind and stabilize G-QUADRUPLEX target. Usually prepare oligonucleotide DNA template, which contains the nucleotide sequence of QUADRUPLEX-"targets" for a medicinal product, which is subjected to screening. Then labeled with fluorescent-labeled DNA primer are annealed with the 3'-end of the DNA template. Then enter On The K-polymerase, such as Taq polymerase to synthesize a complementary DNA chain elongation from labeled fluorescent-labeled primer. In that case, if the action of Taq polymerase is not difficult, it synthesizes a full-size copy of the matrix. Making test a drug that binds specifically to duplex DNA, but does not bind selectively with quadruplexes area, leads to a decrease of the synthesis of full length product and a concomitant increase in the synthesis of DNA copies of various lengths. However, if the tested drug selectively binds to and stabilizes QUADRUPLEX, the promotion of the polymerase is blocked only on quadruplexes, and is synthesized specific stop-product".

Initially, compounds are screened at a single concentration, and "hit" re-assayed at various concentrations in order to establish the values of the IC50(i.e. the concentration of drug required to obtain the ratio of the product block/full size product 1:1). These products determine capillary electrophoresis.

Method of competition QUADRUPLEX/duplex. The selectivity of the compounds in relation to quadruplexes target sequence compared to the DNA duplex can be estimated using a competitive method (i.e. "screening for selectivity IN this screening selectivity is used stop the test as a reporter system to determine the relative ability of the introduced DNA sequences to compete with quadruplexes structure target in DNA matrix for binding with the drug. For example, competitors are QUADRUPLEX sequence with the ICC, which is identical quadruplexes sequence present in the DNA-matrix; or a DNA plasmid, which is a mimetic complex genomic duplex DNA. The degree to which each competitor successfully "washes out" the drug in solution, is a reflection of the quantitative reduction of the synthesis of the stop product. Thus, to determine the relative binding affinity of the medicinal product in relation to both Milenium QUADRUPLEX and duplex DNA.

Method footprints quadroma.Compounds can also be assessed on their ability to communicate with other natural QUADRUPLEX structures with biological importance, including quadruplexes regulatory elements that regulate a number of different oncogenes. The resulting data is used to create footprints quadroma.

Test of direct interaction.Compounds can be evaluated for their ability to interact directly with nucleic acids are capable of forming QUADRUPLEX structures, where the nucleic acid is not telomeric nucleic acid. The test can be performed in the same or different containers. For example, the connection can podvernuvshiysya with each nucleic acid in the same container. Alternatively, the connection can individually interact with each nucleic acid in a variety of containers. The term telomeric nucleic acid, as used herein, is a region of highly repetitive nucleic acid at the end of the chromosome. As used in this description, a direct interaction determine without the presence of competitive nucleic acids.

The interaction between the compound and the nucleic acid can be assessed, for example, when determining the value of the IC50that indicate the binding and/or stabilization of QUADRUPLEX. You can determine the selectivity of the interactions, for example, when comparing the set IC50. For example, you can use the lowest IC50indicating a strong interaction between the compound and the nucleic acid, while the highest values IC50indicative of the weak interaction and, thus, a measure of the selectivity of the interaction. The reaction products can be determined by capillary electrophoresis.

Example 99

Test direct interaction

Usually 5'-labeled with a fluorescent label (FAM) primer (P45, 15 nm) is mixed with the DNA-matrix (15 nm) in Tris-HCl buffer (15 mm Tris, pH 7.5)containing 10 mm MgCl2, 0.1 mm EDTA and 0.1 mm mixture deoxynucleotide is fosfato (dNTP). The mixture was denatured at 95°C for 5 min and after cooling to room temperature, incubated at 37°within 15 minutes After cooling to room temperature, make a 1 mm KCl and the test compound (various concentrations) and the mixture incubated for 15 min at room temperature.

The elongation of the primer carried out by adding 13 mm KCl and DNA Taq polymerase (2.5 u/reaction, Promega) and incubation at 70°C for 20 minutes the Reaction is stopped by adding 1 µl of the reaction mixture to 10 μl of formamide Hi-Di and 0.25 ál of standard size LIZ120. The method is repeated with the addition of competitive nucleic acids in various concentrations in the first stage, together with the primer and template sequences. Add binding to the G-QUADRUPLEX ligand in a previously installed concentrations, as leading to the formation ratio of the stop product and a full-sized product, equal to 1:1. Define SS for each competitive nucleic acid in a concentration of competitor required to change the ratio of the product block to the full-size product in the range from 1:1 to 1:2. Nukleinovokisly sequence quadruplexes that can be used for this test are given in table 4.

Example 100

Test of inhibition zithro is and P450 (CYP450)

Compounds of the present invention can be evaluated for potential inhibitory activity against isozymes of cytochrome P450. Typically, prepare six test tubes with the reaction mixture of 100 μl of a solution containing 50 mm potassium phosphate, pH 7.4, 2.6 mm NADP+, 6,6 mm glucose-6-phosphate, 0.8 E. glucose-6-phosphate dehydrogenase/ml and serial dilution 1:6 test compounds together with 6 test tubes with serial dilutions of 1:6 of the corresponding positive control inhibitor. The reaction starts with adding in the reaction tube is preheated solution of the enzyme/substrate. Prepare a control reaction, the corresponding zero time, add 50 ál of acetonitrile to 100 μl of a solution of cofactor for the inactivation of enzymes, followed by addition of 100 μl of a solution of enzyme/substrate. It is also possible to prepare a control reaction mixture without any inhibitor. After appropriate incubation at 37°the reaction is stopped by adding 50 μl of acetonitrile. The reaction mixture is analyzed by the content of metabolites substrate probe using LC/MS/MS.

Example 101

Evaluation of the effectiveness of the compounds to suppress the growth of tumors

You can plan a revealing experience to evaluate the effectiveness of the compounds of the present invention on the model of human carcinomas is on the Nude nod-mice, as is described below. Use males or females (mouse, Sim) (NCR, nu/nu) at 5-6 weeks of age and weighing more than 20 Animals, intentionally cultivated, and at the beginning of the experience they are intact. Tumor reproduce the result of inoculation of cells or passage of fragments of the tumor. Cell lines for use include, but are not limited Paca-2, HPAC, Hs700T, Panc 10.05, Panc 02.13, PL45, SW 190, Hs 766T, CFPAC-1 and PANC-1.

Implantation of cells.In the right side 60 animals injected subcutaneously 1-10 million cells suspended in 0.1 ml of culture medium, with or without Matrigel (Collaborative Biomedical Products, Inc., Bedford, MA). Required only one injection to the animal. Within 7-14 days after vaccination developed tumors with a size suitable for the study, approximately 1.0 cm3. Provides a small sub-group (<10/60) animals. Donors and the tumors grow within 10-28 days and up to 1.5 cm3for purposes of serial transplantation.

Transplantation of fragments.Donor animals subjected to euthanasia and surgically remove the tumor and cut into fragments of size 2 mm3using aseptic technique. Animals that are intended for implantation, is subjected to light anesthesia with isoflurane. The site of the implantation process 70% alcohol and Betadine. Then one fragment implanted under the skin using a trocar.

Experiments to assess the effectiveness.50-60 animals with tumors randomly divided into groups. For example, in the specific experience of animals can randomly distribute 3-8 groups of 7 animals each, as presented in table 5.

Table 5
Group numberThe number of males and< / br>
females
DoseThe amount of dose (ál)The concentration of the solution for injection (mg/ml)The number of animals subjected to euthanasia< / br>
day 28-42
1N=7Tricatel. control*250All
2N=7Pological. control**10-40/B2-5/BAll
10-250/2,5-5/
125-500≤10
Group 3-8N=7/group <56Test connectionAll
1-25/B10-40/B2-5/B
1-50/10-250/2,5-5/
125-200125-500≤10
*solvent/thinner

**industrial available anticancer drugs, including, but not limited to, Taxol, SRT and gemcitabine, used as positive controls.

Method of administration.The compound is administered every day, every 2 days, every 3 days or once a week intraperitoneally, intravenously (lateral tail vein) or orally. The introduction of animals is carried out in a systematic manner that allows you to evenly distribute time across all groups. With/or oral introduction animals fixed manually. When the/in the introduction of a bolus or short I.V. infusion (within 1 min) animals fixed mechanically, but not euthanized. For each animal/dose use disposable sterile syringes. Also conduct testing of the test compound in combination with a chemotherapeutic agent, at a dose of 10-100 mg/kg (e.g., 40 mg/kg), such as gemcitabine, usually with intraperitoneal injection once a week.

Example 102

Determination of maximum tolerated doses

You can plan a revealing experience to determine the maximum tolerated dose (MTD) of the compounds of the present invention, as presented below. The selection of animals in the experience of p is avodat, as described in example 101.

Experiments on determination of acute toxicity.In the demonstration experiment for the determination of MTD after a single injection, for example, 60 intact animals randomly distributed into groups of 10 animals (5 males and 5 females) and one compound is administered in two ways or two connections one way. It was found that transferred in a single/in a dose of 50 mg/kg, and it was used as a preliminary lower dose. Lower dose for experiments with orally administered based on the perceived acceptability, and if necessary, bring it. A typical scheme doses, volumes of administration and concentration of the injected solution are shown in table 6.

Table 6
Group numberThe number of females and malesDose< / br>
(mg/kg)
The amount of dose (ál)The concentration of the solution for injection (mg/ml)The number of animals subjected to euthanasia on day 7
1N=5 males

N=5 females
Test the connection 1

50/

100
250/

500
5/In

5
All
2N=5 males

N=5 females
Test Obedinenie 1

75/In

200
250/

500
8,25/

10
All
3N=5 males

N=5 females
Test the connection 1

100 In/In

300
250/

500
10 In/In

15
All
4N=5 males

N=5 females
Test the connection 2

50/

100
250/

500
5/In

5
All
5N=5 males

N=5 females
Test the connection 2

75/In

200
250/

500
8,25/

10
All
6N=5 males

N=5 females
Test the connection 2

50/

100
250/

500
10 In/In

15
All

Studies sub-chronic toxicity.In the relevant experience to assess the dependence of the dose-response after repeated injections, for example, 25 intact animals randomly assigned to groups of 5 animals each, as presented in table 7. Every two weeks test only one connection with the same route of administration in the optimal dose prescribed on the basis of data for acute toxicity.

Table 7Group numberThe number of females or malesDose< / br>
(mg/kg)The amount of dose (ál)The concentration of the solution for injection (mg/ml)The number of animals subjected to euthanasia at day 141N=5Negative control250/

500Depends on doseAll2

QDN=5Test the connection, according to the determination of the maximum tolerated dose (MTD)250/

500Depends on doseAll3

QODN=5Test the connection, according to the determination of the maximum tolerated dose (MTD)250/

500Depends on doseAll4

Q3DN=5Test the connection, according to the determination of the maximum tolerated dose (MTD)250/

500Depends on doseAll5

Q7DN=5Test the connection, according to the determination of the maximum tolerated dose (MTD)250/

500 Depends on doseAll

Method of administration.The compound is administered every day, every 2 days, every 3 days or once a week intravenous (lateral tail vein) or orally. The introduction of animals is carried out in a systematic manner that allows you to evenly distribute time across all groups. Oral introduction of animals fixed manually. When the/in the introduction of a bolus or short I.V. infusion (within 1 min) animals fixed mechanically, but not euthanized. For each animal/dose use disposable sterile syringes.

Example 103

Evaluation of pharmacokinetic properties

You can plan a demonstration pharmacokinetic study to evaluate the pharmacokinetic properties of these compounds, as shown below. Use animals-males (mice Balb/C or rats, SD) at the age of 5-6 weeks. In the experiment on rats using animals weighing more than 200 g In a typical experience, for example, 20 animals randomly assigned to 4 groups as shown in table 8. Animals of one group not treated and sampled used as background control. There are animals other three groups and injected with a single dose of compounds intravenous injection.

Group numberThe number of animalsTime after injection (hours)
12The intact
260,25, 2, 8
36of 0.5, 4, 12
461, 6, 24

Method of administration.Connections give/in (lateral tail vein), in b/W or oral. The introduction of animals is carried out in a systematic manner that allows you to evenly distribute time across all groups. When in b/W or oral introduction animals fixed manually. When the/in the introduction of a bolus or short I.V. infusion (within 1 min) animals fixed mechanically, but not euthanized. For each animal/dose use disposable sterile syringes.

Select approximately 0.5 ml of blood from healthy animals by puncture of the heart before the first dose. Final blood samples (0.5 ml) taken by puncture of the heart from two animals per group at each time point according to the diagram above. All samples are placed in tubes containing lithium salt of heparin as an anticoagulant, and immediately stirred by the rotation of the tubes. The samples are centrifuged, and the plasma frozen in liquid nitrogen, stored at -70°or n the same and determine the concentration of the drug.

Example 104

Determination of metabolic stability in hepatocytes in vitro

You can plan an illustrative Protocol for determining the stability of the new chemical compounds in the presence of hepatocytes (human, rat, dog, monkey) during incubation in vitro, as shown below. The test compound is incubated with hepatocytes and a suitable environment for various time periods at 37°C. the Reaction mixture is extracted and analyze LC/MS/MS on the content of the original compounds and putative metabolites. If applicable, determine the half-life of the test compounds. Conducting a study of metabolic control in order to compare the values of the half-life obtained for the studied compounds. Controls in the study of metabolism can be tolbutamide, desipramine and naloxone, which have established pharmacokinetic parameters corresponding to low, medium and high values clearance in vivo.

The study of metabolic stability.Usually prepare solutions of the test compounds, along with a mixed solution of metabolic controls that are intended for use as a standard enzyme activity. The reaction starts with a blend of data predvaritelnogo solutions with suspensions of hepatocytes and environment control solution. Immediately after the beginning of the data reaction mixtures selected control sample corresponding to zero time. At appropriate time points, you can select additional samples. Each sample was immediately placed in a solution to stop reaction (acidified MeCN containing IS). Prepare the control suspensions of hepatocytes and the standard solutions of the test compounds.

Samples and standards of the tested compounds, as well as appropriate controls, prepare the usual procedure for sample preparation and analysis on the content of the parent compound and/or metabolites tested compounds using HPLC coupled with mass spectrometry. Samples and standards for metabolic control can be subjected to investigation by the analytical method described in this description. In those cases, when making the buffer Krebs-Henseleit, buffer miss 5% CO2in air at room temperature for 5-10 min before adding BSA to a final concentration of 0.2 wt.%/about. The volume of solution to stop the reaction and the method of sample preparation to determine the object of testing during development of the method.

Solution test the connection environment.A solution of the test compound is prepared by adding the appropriate volume of stock solution to 0.2% solution of BSA in Krebs buffer-Henseleit, uranov the greater of 5% CO 2in the air. The final concentration is in the range from 5 μm to 20 μm, and the final concentration in the formulation of the test in the beginning of the reaction is from 1 μm to 10 μm.

Solution controls for metabolism studies/environment.Solutions of tolbutamide, desipramine and naloxone is prepared by adding the appropriate volume of 10 mm stock solution of each compound to 0.2% solution of BSA in Krebs buffer-Henseleit, equilibrated with 5% CO2in the air. The final concentration of 20 μm for each of metabolic control and the final concentration in the formulation of the test is 10 μm at the beginning of the reaction.

A suspension of hepatocytes.The thawed hepatocytes and produce according to the manufacturer's instructions (Invitrotech, Inc.). At the final stage of the test determine cell viability using displacement Trypanosoma blue. Then the hepatocytes resuspended in 0.2% BSA in Krebs buffer-Henseleit, equilibrated with 5% CO2in the air, to a final concentration of 0.5 million viable cells/ml Concentration at the beginning of the reaction is 0.25 million viable cells/ml

Initiating the test compound incubation.Equal volumes of a solution of test compound prepared in stage 2.1.3, poured into 4 polypropylene scintillation vial. The vials pre-heated during the 5-0 min at 37° C at 95% humidity and 5% CO2. In two bottles contribute 0.2% BSA in Krebs buffer-Henseleit, equilibrated with 5% CO2in the air, and mix thoroughly. Immediately after start of the reaction include a timer and a sample volume of 100 μl are taken from each vial and placed in centrifuge tubes with a capacity of 1.7 ml, containing an appropriate volume of solution to stop. These samples serve as controls for Wednesday to determine enzymatic degradation and non-specific binding to the vessel.

Equal volumes of a suspension of hepatocytes, prepared as described above, bring in two bottles and mix thoroughly. Immediately after start of the reaction include a timer and a sample volume of 100 μl are taken from each vial and placed in centrifuge tubes with a capacity of 1.7 ml, containing an appropriate volume of solution to stop reaction. All the vials are placed in a thermostat at 37°C, 95% humidity and 5% CO2.

Initiating metabolic control incubation.Equal volumes of a solution of controls for studying the metabolism poured into 2 polypropylene scintillation vial. The bottles are pre-heated for 5-10 min at 37°C at 95% humidity and 5% CO2. In each of the two vials contribute equal amounts of suspended hepatocytes and mix thoroughly. Immediately after start of the reaction include a timer iPROBE volume of 100 μl are taken from each vial and placed in centrifuge tubes with a capacity of 1.7 ml, containing an equal volume of solution to stop. All the vials are placed in a thermostat at 37°C, 95% humidity and 5% CO2.

The sampling.The vials gently shaken and samples (100 μl) are selected and placed in centrifuge tubes with a capacity of 1.7 ml, containing an appropriate volume of solution to stop the reaction, according to the following scheme: test with test drug is taken through 5, 10, 15, 30, 60, 90 and 120 min; samples with controls for metabolic studies taken after 30, 60, 90 and 120 minutes Immediately after sampling, the bottles are placed back in the unit to the last sample is taken.

Preparation of control samples.A sample (100 μl) suspended hepatocytes add an equal volume of 0.2% BSA in Krebs buffer-Henseleit and mix thoroughly. Select a sample of this solution volume of 100 μl and placed in centrifuge tubes with a capacity of 1.7 ml, containing the same volume of solution to stop reaction, used for the reaction with the test compound. Sample environment for incubation (0.2% BSA in Krebs buffer-Henseleit) placed in centrifuge tubes with a capacity of 1.7 ml, containing the same volume of solution to stop used for the reaction with the test compound.

Preparation and analysis of samples.All the bottles are centrifuged at 16000 g for 3 min Supernatant placed in plastic containers for autosampler and storing the Yat at 4° With (≤1 day) or -70° (≥1 day) prior to analysis. Solutions of the test compound analyzed using HPLC/MS/MS according to standard methods. In one example, you can use the following HPLC conditions: column (Phenomenex Synergi Hydro-RP, 100,0×2.0 mm, 5 μm); predalone (Phenomenex C18, 4,0×2,0 , 5 μm); flow rate (0.3 ml/min); column temperature 45°; volume of 10 µl and the room temperature of the autosampler.

Example 105

Determination of metabolic stability inmicrosomes in vitro

You can plan an illustrative Protocol for stability studies of new chemical compounds in the presence of liver microsomal fraction (human, rat, dog, monkey) during incubation in vitro, which are presented below. The test compound is incubated with microsomes and a suitable environment for various time periods at 37°C. the Reaction mixture is extracted and analyze LC/MS/MS on the content of the original compounds and putative metabolites. If applicable, determine the half-life of the test compounds. Conducting a study of metabolic control in order to compare the values of the half-life obtained for the studied compounds. Controls in the study of metabolism can be tolbutamide, desipramine and naloxone, which is EUT certain pharmacokinetic parameters, the corresponding low, medium and high values clearance in vivo.

The study of metabolic stability.Usually cook 6 vials with pre-heated reaction mixture with 100 μl of a solution containing 50 mm potassium phosphate, pH 7.4, 2.6 mm NADP+, 6,6 mm glucose-6-phosphate, and 0.8 u/ml glucose-6-phosphate dehydrogenase and 1, 10 and 50 μm test compound. At the same time put a similar reaction with metabolic controls, which are compounds with low (tolbutamide), medium (desipramine) and high (testosterone) clearance with a solution of the same enzyme. The reaction starts with the addition of 100 ál of pre-warmed solution of enzyme and incubated at 37°C. the Reaction corresponding to the zero point, is prepared by adding 50 μl of acetonitrile (containing internal standard) to a solution of test compound/cofactor before the introduction of an enzyme solution. After 15, 30, 60, 90 and 120 min the tube with the reaction mixture are removed from the water bath and the reaction stopped by adding 50 μl of acetonitrile containing internal standard. The reaction mixture is extracted and the samples analyzed on the content of the original shape of the tested compounds and one metabolite using a C18 column with detection MS/MS. Each analysis is performed in two Parallels.

The concentration of the solution is the cofactor/test connection. Prepare the mother solution of 10 mm NCE in 10% DMSO (vol./vol.). For all analyses, cook 2, 20 or 100 μm solution of test compound in 50 mm potassium phosphate, pH 7.4, 2.6 mm NADP+, 6,6 mm glucose-6-phosphate, and 0.8 u/ml glucose-6-phosphate dehydrogenase (solution cofactor).

The solution concentration of cofactor/metabolic controls.Royal solutions of metabolic control (tolbutamide, desipramine and testosterone) are used for the preparation of 6 μm solution of metabolic control in the solution of the cofactor, described at the previous stage.

The solution concentration of the enzyme.Solutions of enzymes prepared by adding microsomal fraction of the liver to 50 mm potassium phosphate, pH 7.4 to a final concentration of 1 mg/ml. All microsomal fraction receive from Xeno Tech or InvitroTech, Inc.

The beginning of the reactions.All test tubes with reaction mixture is pre-heated at 37°With water bath for about 3-5 minutes Control reaction mixture corresponding to the zero point in time, is prepared for each parallel by adding 50 μl of acetonitrile containing of 15.9 μm nebularia (internal standard), 100 μl of a solution of cofactor for the inactivation of enzymes, and then stirred on the vortex. The reaction starts with the addition of 100 μl of an enzyme solution to each tube and mix by vortex. All tubes, including control of the e l e C the corresponding zero time point, incubated in a water bath at 37°C. the Final concentrations of all components in the test tubes after the start of the reaction equals 50 mm potassium phosphate, pH 7.4, 1.3 mm NADP+, 3.3 mm glucose-6-phosphate, 0.4 u/ml glucose-6-phosphate dehydrogenase, 0.5 mg/ml microsomal fractions of liver and 1, 10 or 50 μm test compound.

Stop the reaction and extraction reaction mixtures.After 15, 30, 60, 90 and 120 min at 37°With all the reactions stopped by the addition of 150 μl of acetonitrile containing of 15.9 μm nebularia (internal standard). Control corresponding to the zero time point, remove from the water bath after 120 minutes All the bottles are centrifuged at 16000 g for 3 min Supernatant placed in plastic containers autosampler and stored at 4° (<1 day) or -70° (>1 day) prior to analysis.

Analysis of solutions of the tested compounds.Solutions of test compounds analyzed using HPLC/MS/MS according to standard methods, which were described in example 39.

Example 106

Test evaluation of the mutagenic properties in bacteria

Using this test, evaluate mutagenic properties (Ames test) assess the potential ability of the extracts of the tested compounds to induce the reversion of histidine (his) in S. typhimurium (his - to his+) or reversion of tryptophan (trp) in E. coli (trp - trp+), caused by changes in the bases or mutations shift the reading frame in the genome of the test microorganisms. Typically, the test enable on the Cup hold for 5 Salmonella typhimurium strains (TA, ÒÀ98, TA100, TA and TA) and one strain of Escherichia coli (WP2-uvrA-) in the presence and absence of an exogenous activating system mammalian (S9). The test compound is dissolved in a 5% solution of dextrose. Then prepare a series of dilutions in saline solution before testing. For this test, conducted a study limits the search to establish appropriate doses for the final evaluation of certain mutagenic properties.

Preparation of test compounds

Prepare the mother solution of test compounds with a concentration of 20.0 mg/ml as follows: 1.0 g of test compound is added to 15.0 ml 0,1N. HCl solution for 1 min. Test the connection, stirred for 15 min at room temperature. Then add 33,0 ml of deionized water and stirred for 30 minutes and Then the pH was adjusted to 3.53. Lower concentrations are prepared by dilution of this stock solution with 5% dextrose immediately before use. To minimize any changes in the degradation solutions of the tested compounds stored on ice after cooking and prior to application of the m The test compound used in vitro in a solvent which is compatible with the system under test.

Genotypic characteristics of the test strains

Working uterine culture strains used in the test, examined the genotypic markers and acceptable levels of spontaneous reversion. All working uterine culture show the need for histidine or tryptophan (only E. coli). In addition, for each test conducted additional relevant confirmation: the sensitivity to the dye purple crystal due to mutations wall rfa; sensitivity to ultraviolet light due to the deletion of the gene uvr B (uvr in E. coli); resistance to ampicillin due to the presence of plasmids RCM and resistance to tetracycline due to the presence of plasmids AQ1. The levels of spontaneous reversion determined using negative controls.

Test compounds that are water soluble, dissolved in isotonic saline solution or other suitable solvent. Test compounds that are not water-soluble, dissolved in dimethyl sulfoxide (DMSO) or other suitable solvent. If DMSO is not acceptable due to adverse reactions with the test compound, the test compound is suspended in carboxymethyl is ulose. To facilitate dissolution, you can use heat, vigorous stirring on a vortex or alternative solvents.

System for testing

This test is carried out according to the methodology of inclusion on cups, originally described by Ames (Ames et al., Mutation Research (1975) 31: 347-364) and updated by Maron and Ames (Maron et al., Mutation Research (1983) 113: 173-215). Historically, this test was used to detect mutations in the gene of strain that requires histidine, in order to obtain independent histidine strain and, accordingly, detection of mutations in the gene of strain that requires tryptophan, to obtain independent from tryptophan strain. In addition, it was shown that it is suitable for testing of various groups of chemical mutagens that induce heritable mutations in the DNA of the type that is associated with side effects.

Salmonella typhimurium strains that can be used in this test, TAA, ÒÀ98, TA100 and TA described by Maron and Ames, above; Green et al., Mutation Research (1976) 38: 33-42; and Brusick et al., Mutation Research (1980) 76: 169-190)). The strain S. typhimurium TA and E. coli strain Wp2-uvrA-can be obtained from the American type culture collection, Manassas, VA (on ATS: 29629 and 49979). All workers uterine cultures of strains for testing to determine genotypic markers and levels of acceptable reversion. Working match the diversified culture must demonstrate the need for histidine or tryptophan (only E. coli).

Experimental methods

Cook Cup test strains from frozen working uterine cultures. To obtain working cultures for each strain of bacteria used in the test, a single colony is transferred from the Cup in Oxoid nutrient broth and incubated with shaking at 37±2°to obtain the optical density (650 nm), equal to 0.6 to 1.6. This overnight culture is used for production test evaluation of the mutagenic properties and genotypic control. Tests on genotypes were carried out as described in the Protocol.

For determination of limits of concentrations and performances mutagenic test the top layer of agar, consisting of 0.6% agar, Difco 0.5% NaCl, melted and melted the top layer of agar add 0.5 mm L-histidine/0.5 mm Biotin or 0.5 mm L-tryptophan in the ratio of 10 ml per 100 ml of agar. Enriched agar is poured at the rate of 2 ml per tube and incubated at 45-47°C. For the preparation of the top layer of agar to treatment, 0.1 ml of test compound or control, 0.1 ml culture of bacteria and 0.5 ml of phosphate buffered saline contribute to the molten agar. The mixture is quickly stirred on the vortex and poured at room temperature for a Cup of agar with minimal glucose (1.5% agar, Difco, 2% glucose in the medium Vogel-Bonner E). Metabolic activation is performed by adding 5 ml of S9 mixture instead of PBS. The agar plate allow to harden and then incubated for 48-72 h at 37±2°C. All cups cheated using automated analytical system visualization. The Cup represents the negative control, and cups treated with the test compound, is also examined for the presence of bacterial lawn.

Exogenous metabolic activation

System metabolic activation in vitro conditions used in this test consists of enzymes of rat liver Sprague-dauli and a mixture of cofactors. Enzymes are part of the preparation of liver microsomes (S9 fraction) from rats treated with arochlor, for the purpose of inducing the production of enzymes capable of transforming chemical compounds into more active forms. Immediately before use the S9 fraction was thawed and mixed with cofactors containing 5% S9, 5 mm glucose-6-phosphate, 4 mm β-nikotinamidadenindinukleotida, 8 mm MgCl2and 33 mm KCl in 200 mm phosphate buffer at pH 7.4.

Concentration and parallel samples

Test connection test in three Parallels 5 concentrations (20,0, 10,0, 5,0, 2.5 and 1.25 mg/ml) together with an appropriate solvent (5% dextrose) and positive controls in the range of concentrations for the test. That is equivalent to 2.0, and 1.0 to 0.5, 0.25 and 0.125 mg/Cup.

For the final those who choose the three concentrations (20,0, of 10.0 and 5.0 mg/ml), which is the equivalent of 2.0, 1.0 and 0.5 mg/Cup. All processing, including negative and positive controls, plated on cups in three Parallels with the test strains TA, ÒÀ98, TA100, TA, TA and WP2-uvrA-in the presence and absence of metabolic activation. Data concentration is chosen on the basis of the induction limit the toxicity of the tested compounds and the maximum response of the used dose.

The control connection

You can cook and use the control connection for staging test for mutagenicity, as presented in table 9.

Table 9
ControlStrainConcentration
Acridine ICR-191TA97a1.0 microgram/Cup
2-nitrofluoreneA98 motorway10,0 mg/Cup
Sodium azideTA100 and TA15351.5 mcg/Cup
1-methyl-3-nitro-1-nitrosoguanidineWP2-uvrA-4.0 µg/Cup
2-aminoanthraceneAll strains (except TA1 535)10,0 mg/Cup
2-aminoanthraceneTA15351.6 ĩg/Cup

The negative control (solvent)

The strain is to test sown with untreated dextrose in the respective maximum concentrations (0.1 ml) with and without making S9. These cups are used as negative controls, and information concerning the background lawn and education revertant colonies.

The limits of concentration for test

Original boundary concentrations for setting test start with a maximum concentration of 2.0 mg/Cup. 4 lower concentrations used for testing, get a serial dilution of 1:2.

Test reverse mutation

Each strain of bacteria with and without making S9 considered as a separate experience, with its own attendant positive control and control on the solvent. Growth on all cups scored using an automatic counter colonies and make pictures. Positive controls consist of direct mutagens and mutagens requiring metabolic transformation. For all strains, representing the positive control, one can observe a twofold or more increase in levels of reversion. Indicators reversion to negative control for each strain should be at or slightly below the anticipated limits for laboratory historical data. The metric induced a positive result for any strain will be at least a two-fold increase in the number revertant colonies the and Cup compared with values for the negative control.

Example 107

Test chromosomal aberrations in vitro on cells SNO

Test chromosomal aberrations can be one of several tests in vitro, which can be used for screening compounds for their potential genetic toxicity. Chromosomal aberrations represent mutations that are associated with carcinogenesis. Therefore, the test chromosomal aberrations relates to the testing of potential mutagens and carcinogens (Galloway et al., Environ. Mut. (1985) 7: 1-51; Galloway et al., Environ. Mut. (1987) 10: 1-175). Using this test, chromosome aberrations assess the potential ability of the extracts of the tested compounds to induce damage in the cells of the Chinese hamster ovary (Cho). This test is carried out in the presence and absence of an exogenous activating system mammalian (S9) in the three treatment period. In all cultures treated with negative control, must be observed normal levels of spontaneous aberrations, whereas in cultures treated with the positive control must have a significant, dose-dependent increase in the number of aberrant chromosomes.

You can plan a demonstration test of determining whether the test compound is clastogenic, i.e. how it has the ability to rupture the chromosomes, as shown below. Klas is hennoste is an important endpoint, because by means of chromosome damage and improper re-pairing can activate certain oncogenes (e.g., ICC) and can activate some genes tumor suppressors (e.g., suppressing development of retinoblastoma). In this test mammalian cells, cells of the Chinese hamster ovary (Cho), are exposed to test compounds and blocked in metaphase using mitotic spindle poison. Visualization of chromosomes carried out microscopically after swelling in hypotonic conditions, fixation and staining of the treated cells SNO. Facility with installed capacity to induce rupture of the chromosomes have a high probability to be carcinogens and also have a potential ability to induce the occurrence of inherited chromosomal defects.

The cell line Cho-K1(the number in ADS: CCL-61) is auxotroph in relation to Proline with a modal chromosome number equal to 20, and the doubling time of a population, comprising 10-14 hours, it Was shown that this system is sensitive to the clastogenic activity of various chemical compounds (Preston et al., Mutation Research (1981) 87: 143-188). Cells SNO cultivate in the environment MSO 5A with the addition of 10% fetal bovine serum, 1% L-glutamine (2 mm), penicillin (100 u/ml) and streptomycin (ág/m is). The culture is incubated in an atmosphere of 5-7% CO2with loose cups in the wet thermostat at 37±2°C.

Staging test

Preparing a mother liquor with a concentration of 5 mg/ml lower concentrations are prepared by dilution of this stock solution 5% dextrose and immediately prior to use. To minimize any possible degradation of the solutions of the test compounds after cooking store on ice and directly before you. Cells were seeded at the rate of about 1-1,5×106cells per flask for culturing tissues with a capacity of 75 cm2in 10 ml of fresh medium the day before the formulation of the test. For processing used the medium replaced with fresh culture medium in each flask contribute extract of the tested compounds, negative or positive control. Positive controls contribute in a volume of 0.1 ml for minimizing the toxicity of the solvent. Cultivation of the tested compounds and the negative control contribute to a volume of 1 ml Add fresh medium to bring the total volume of the mixture to 10 ml For part of the test with metabolic activation add the mixture to activate S9 to serum-free medium at a final concentration of 1.5% (vol./vol.). All processing is carried out in two Parallels. Cells are incubated at 37±2°p is outstay extract of the tested compounds the reaction mixture S9 (only part of the experience with metabolic activation) and culture medium. The test is divided into three processing period: 3 h, 3 h with S9 activation and 20 p.m.

After a period of processing the contents of all flasks examined microscopically significant toxicity, i.e. the presence of morphological changes in cells or a significant detachment of cells. All flasks twice washed with phosphate buffered saline (PBS). To the washed cells add normal culture medium containing 10% fetal bovine serum (FBS), and the flask is placed back in thermostat is on 14,5-15,5 hours Directly before collecting cells conduct microscopic evaluation. For 2 h before harvesting the cells in all flasks make 1 µg of colcemid (final concentration of 0.1 μg/ml) to stop cell division.

Extracts of the tested compounds is subjected to testing in two Parallels 6 concentrations (final concentration in the culture to 0.5, 0,16, 0,05, to 0.016, 0.005 and 0,0016 mg/ml) together with an appropriate solvent and positive controls.

The metabolic activation system

The use of metabolic activation system is an important aspect in the evaluation of the tested compounds, because some compounds are only promotional form. I.e. they become mutagens only after the hcpa is istia an external metabolic source. In systems in vitro lacks the ability to metabolize a compound, unless you add an external system, such as S9.

System metabolic activation in vitro, intended for use in this test may include enzymes of rat liver Sprague-dauli and producing energy system (NADP and solimena acid; the basis of the reaction mixture) for their operation. Enzymes are part of liver microsomes (S9 fraction) from rats treated with arochlor 1254 for induction of enzymes capable of transforming chemical compounds into more active forms. The S9 fraction can be obtained from Moltox (Boone, NC) and stored frozen at a temperature below -70°s to use. The S9 fraction was thawed immediately before use and applied to the base of the reaction mixture.

Fixation, staining and evaluation of cells

Select the metaphase mitotic cells "shock", is subjected to swelling, using 75 mm KCl, fixed in methanol:glacial acetic acid (3:1 vol./vol.). The cells are then applied with a dropper to the slide after resuspendable in a fresh portion of the retainer and air-dried. Glass mark "blind" codes. To each flask to prepare three glasses. Glass paint paint the Institute and prepare regular drugs. All glasses represent "blind" codes, except positive controls in high concentrations, that research first to make sure that the frequency of aberrations was adequate. For each concentration examined 200 cells at a concentration (100 for each of the two parallel flasks). 100 cells examined from each of the positive control in high concentrations, the following definitions and evaluation criteria.

Chromaticy type aberrations

TG (chromaticy space): the space bar Tid". Achromatic (unpainted) area in one chromatid, the amount of which is equal to or less than the width of the chromatids. Their say, but as a rule, do not include in the final total number of aberrations, because they may not be real breaks.

IG (isochromatid space): chromosome space. Gaps in the same locus in both sister chromatid. Their say, but as a rule, do not include in the final total number of aberrations, because they may not be real breaks.

TB (chromatid gap): achromatic region in one chromatid, is larger than the width of the chromatids. Associated fragment can be partially or completely displaced or lost.

ID (deletion chromatids): the length of the chromatids cut from the center of the chromatids, which leads to the formation of a small slice or ring behind shortened chromatid or space in the chromatid.

TR (tardily): exchange between two chromosomes that if the result in the formation of three-arm configuration. Can be acentricity fragment.

QR (quadriradial): same thing triadically, but leads to the formation of chetyrehluchevoy configuration.

CR (complex rearrangement): exchange between more than two chromosomes, which leads to the formation of multiple breaks and exchanges.

TI (chromaticy currency): currency within chromosomes, involving one or both shoulders.

Chromosomal type aberrations

SB (gap chromosomes): terminal deletion. The chromosome has a clear gap, forming anomalous (exposed deletions) chromosome with centricism fragment, which may be biased and may still be connected, or it can be found anywhere in the cell.

DM (double short fragment): intermediate deletion chromosomes. They are shown as small double "points" or they can be paired rings. In some cases, they cannot be distinguished from acentricity fragments that result from exchanges or terminal deletions.

D (dicentrics): exchange between two chromosomes, which leads to the formation of chromosomes with two centromeres. It is often associated with centricism a slice when it is classified as dicentrics fragment (DF).

MS (multicenter chromosome): the exchange between chromosomes, which leads to the formation of chromosome b is more than two centromere.

R (ring): chromosome, which forms a ring containing centromere. It is frequently associated with centricism fragment, in this case this type is classified as a ring fragment (RF). Centricitee rings are also included in this category.

Ab (abnormal monocentric chromosome: the chromosome morphology is abnormal for karyotype and often leads to such things as translocation or barycentrically inversion. If the anomaly cannot be attributed, then it is classified as a reciprocal translocation.

T (translocation): obvious transfer of a substance between two chromosomes, leading to the formation of two abnormal chromosomes. When identified, assessed as "T"and not "2 Ab.

Other

SD (badly damaged cell): cell with 10 or more aberrations of any type. Badly damaged the cell should be analyzed to identify the type of aberrations and may not have 10 or more, for example, as a result of multiple fragments, as is the case in the formation of tricentenary.

PU (sprayed chromosome): despiralization or fragmented chromosome. This can simply be installed on different stages of condensation of chromosomes.

R (+sprayed chromosome): more than one chromosome, until the whole kernel, "sprayed".

PP (polyploid cell: a cell containing notestine copies of the haploid number of chromosomes. Sometimes polyploid cells found in normal bone marrow or cell cultures. They register, but do not include in the final total number of aberrations.

The control connection

In this test, prepare and use the control connection as described in the published reports. Positive controls that you can use are: cyclophosphamide in high concentration 15 μg/ml; cyclophosphamide in a low concentration of 5 µg/ml mitomycin C in high concentrations of 1.0 μg/ml; and cidomycin in a low concentration of 0.25 µg/ml For negative control (solvent) cells SNO treated negative control 5% dextrose with and without S9 activation. The data provide information on the background to the number of aberrant cells.

Assessment of validity and statistical analysis of test data

The total number of aberrations (%SA) in the control culture(x) with the solvent should be in the range of 1-14%. Positive controls in high concentrations are required to give a statistically significant increase in the number of aberrations in the confidence level of 95% (p<0,05) according to the statistical analysis. The analysis of variance (ANOVA) can be used to establish statistically significant differences between the groups of positive and negative control or group of test compounds is Oia and the negative control. The difference is considered statistically significant when the p value is less than 0.05.

Example 108

Assessment of safety and tolerability in dogs

You can plan a revealing experience to evaluate the safety and tolerability of the compounds in doses, administered intravenously once daily for 5 consecutive days, for example, dogs Beagle, as presented below. Safety performance control according to the observations, clinical pathology and histopathological results of research.

Protocol experience

Table 10 presents exemplary experience. For example, the experience carried out with three groups (3) test connection and one (1) control group. Control is a solution (5% dextrose in water)used for cultivation test the connection before the introduction, and it is administered in the same volume, as with the introduction of high-dose. Doses of the test compounds for this experience will be approximately 12 to 3.8 and 1.2 mg/kg of the Test compound and control injected once intravenous (IV) infusion over approximately one hour for 5 days in a row.

Blood samples for analysis of concentration of test compounds in the blood are selected in the following way (i.e. sampling for pk/tk (pharmacokinetic/toxicokinetic research)).

Approximately 1.0 ml of blood from eraut three cables and three females in the group with low dose after about 20 min and 40 min after the start of infusion and then at the end of infusion (0 time) and after 5, 10, 15 and 30 min and 1, 2, 4, 8, 12 and 24 h after infusion after the introduction of the first and fifth doses. Before and immediately after administration of dose 1 and dose 5 in all animals and animals in the recovery period prior to euthanasia ECG is performed for approximately 5-10 seconds in the second abstraction. Animals subjected to euthanasia on day 1 and day 15 after the last dose. Blood for clinical and biochemical assay, before the introduction and prior to euthanasia at the end of the experience. After euthanasia performed the autopsy, which includes the selection of main organs for microscopic examination.

Table 10
Group numberVersion of experienceandDose (mg/kg)The main number of animals (males/females)The number of animals in the recovery period (males/females)
1Control0,03/31/1
2Test connectionto 12.03/31/1
3Test connectionthe 3.83/31/1
4Test connection1,23/31/1
andthe introduction of infusion for about 1 h

Test methods

In the exemplary experience of animals assigned to groups as follows: the dog with the greatest body weight for each sex assigned to group 1, the following mass dog for each sex assigned to group 2, the following mass dog in group 3, following mass dog in group 4, then continue this pattern with groups 2, 3, 4 and 1, then from groups 3, 4, 1, and 2, continuing up until each group is fully stocked animals. Test the connection and control is administered in each dose as an intravenous infusion in the lateral saphenous vein of the fore limb or subcutaneous vein of the hind limbs for about 1 o'clock

Animals daily weighed before entering and before euthanasia. All animals see the display of signs pharmacological activity, changes in behavior and toxicity immediately after injection and 1 h after injection. Also conduct monitoring of the regenerating animals once a day during the recovery period. Before and immediately after doses of 1 and 5 in all animals and in animals after a period of recovery before euthanasia ECG is performed for about 5 seconds in the second abstraction. The data of the electrocardiogram using the comfort for interpreting changes in rhythm and amplitude of the QRS peak and wave T and to determine the QT interval on the number of segments on the electrocardiogram (about 5-10).

Sampling blood

RK/TK.Take blood samples for analysis of concentration of test compounds in the blood. Approximately 1 ml of blood taken from three males and three females in the group with low dose after about 20 min and 40 min after the start of infusion and then at the end of infusion (0 time) and after 5, 10, 15 and 30 min and 1, 2, 4, 8, 12 and 24 h after infusion after the introduction of the first and fifth doses. For analysis prepare the blood plasma (lithium salt of heparin as an anticoagulant).

Clinical pathology.After fasting throughout the night and before the first dose (background; all animals), and then before euthanasia taken blood samples for determination of hematological and biochemical parameters. When setting hematological analysis blood samples collected in the background and before euthanasia (PCP), determine the content of the erythrocytes, haematocrit level, sit, WBC count, differential WC, ICSU, concentration of hemoglobin, MCV, platelet count, PT and ART. When carrying out biochemical analysis blood samples collected in the background and before euthanasia (PCP), determine the activity of aspartate aminotransferase (AST), globulin & the ratio of A/G, the activity of alanine aminotransferase (ALT), sodium concentration, activity of alkaline phosphatase, potassium level, the activity of gamma-glutamyl transferase GGT), the concentration of chloride, glucose, calcium, urea nitrogen, blood (BUN), total bilirubin, creatinine, inorganic phosphorus, total protein, cholesterol, albumin and triglycerides.

The autopsy

After sampling the blood of animals after the main treatment and recovery period is subjected to euthanasia in appropriate periods of time and reveal. Selected major organs weighed and preserved for microscopic examination. Research at the opening includes examination of the cranial, thoracic, abdominal and pelvic cavities and their viscera, tissues, organs, and carcasses.

Methods of statistical processing

Statistical processing of data on biochemical and hematological indicators and data on the mass of bodies and body mass conducted by comparing the groups with the processing of the test compound and the control group. The choice of which statistical methods were carried out as this corresponds to: parametric data analyzed using one-way ANOVA analysis, nonparametric data analyzed using the method Kurskai-Wallis. Also used paired t-test for comparison of baseline data and the biochemical and hematological parameters after treatment for each animal. Probability values (p)equal to 0.05 or below, taking as statisticheski true for all statistical tests.

Example 109

Assessment of safety and tolerability in rats

You can plan a revealing experience to evaluate the safety and tolerability of the test compounds in three doses, administered intravenously once daily for 5 consecutive days, for example, rats, as shown below. Safety performance control according to the observations, clinical pathology, and the results of histopathological studies. The selected animals also take blood samples to conduct pharmacokinetic/toxicokinetic research.

Protocol experience

Table 11 presents exemplary experience. The experience carried out on three groups of (3) with the test compound and one (1) control group. The group with the introduction of the test compounds at high and low doses and the control group consists of 28 animals each, and use them to assess tolerability. The group with the introduction of the test drug average dose includes 64 animals, of which 28 are used to assess the tolerability and 36 animals are used to determine the concentration of test compounds in the blood at different time periods after the introduction of the first and fifth doses in the part of the RK/TK experience. Control is a solution (5% dextrose in water)used for cultivation test the connection before the introduction, and its input is drawn in the same volume, as the test compound at a high dose. Doses of the test compounds for this experience will be approximately 24, 7.6 and 2.4 mg/kg of the Test compound and control injected once intravenous (IV) injection into the tail vein within one minute for 5 days in a row.

Blood samples for analysis of concentration of test compounds in the blood are selected as follows. Approximately 0.3-0.5 ml of blood taken from three male and three female rats under anesthesia at each time point before the introduction and at the end of injection (0 time) and after about 0,08, 0,25, 0,5, 1, 2, 4, 8, 12 and 24 h post-injection after the introduction of the first and fifth doses. Animals used to assess tolerability, subjected to euthanasia on day (1) (main group) and day 15 (group recovery) after the last dose. At the end of the experiment to assess the endurance test compounds are selected blood for clinical and biochemical analysis prior to euthanasia and after it. At autopsy, select the main organs for microscopic examination. Animals used only for screening blood for RK/tk, for determining the concentration of the test compound, is subjected to euthanasia after the final blood collection without any additional sampling or observation.

the figure 11
Group numberVersion of experienceandDose (mg/kg)The main number of animals (males/females)The number of animals in the recovery period (males/females)
1Control0,03/31/1
2Test connectionto 12.03/31/1
3Test connectionthe 3.83/31/1
4Test connection1,23/31/1
andthe introduction of infusion for about 1 h

Test methods

Test the connection and control is administered in each dose as an intravenous infusion into the tail vein for about 1 min. Animals daily weighed before entering and before euthanasia. All animals see the display of signs pharmacological activity, changes in behavior and toxicity immediately after injection and 1 h after injection. Also conduct monitoring of the recovery of the animals once a day during the recovery period. Control animals injected D5W at the rate of about 6 ml/kg Alive who Tim, intended for the introduction of test compounds in high, medium and low doses of injected dose corresponding to about 24 mg/kg and 7.6 mg/kg and 2.4 mg/kg, respectively.

Sampling blood

RK/TK.Take blood samples for analysis of concentration of test compounds in the blood. 18 males and 18 females, which enter the average dose of the drug, taken approximately 0.3-0.5 ml of blood from three male and three female rats under anesthesia at each time point before the introduction and at the end of injection (0 time) and after about 0,08, 0,25, 0,5, 1, 2, 4, 8, 12 and 24 h post-injection after the introduction of the first and fifth doses. Blood is taken by puncture of the retro-bulbar plexus or heart for the selection of the final sample. For analysis prepare the blood plasma (lithium salt of heparin as an anticoagulant). Performed General methods for the determination of biochemical parameters, autopsy and histopathology, as well as statistical data processing, as described above.

Example 110

The Protocol definition of phosphorylated and total p53

You can schedule a Protocol determination of phosphorylated and total p53, as shown below. On day 1 cells were seeded at the rate of 2×106cells/Cup with a diameter of 10 cm/10 ml of medium. On day 2 cells treated as follows: control=0,05% DMSO (5 ál of a solution of DMSO/10 ml medium); 1 μm is esteruelas compounds (1 mm stock solution (10 mm)/10 ml medium); 2 μm of test compounds (2 μl stock solution (10 mm)/10 ml medium); 3 μm test compound (3 ál stock solution (10 mm)/10 ml medium); 4 μm test compound (4 ál stock solution (10 mm)/10 ml medium) and 5 μm test compound (5 μl of stock solution (10 mm)/10 ml medium).

On day 3 the day the cells are harvested and selected attached and floating cells. Cells are washed twice by PBS, and count their number and select 4×106cells/sample. The precipitate after centrifugation of the cells frozen at -80°s to use. On the same day or 4 day cells extracted using buffer for extraction of cells (3 ml buffer for extraction of cells, 300 μl of protease inhibitor and 10 ál of 0.3 m PMSF). In each sample contribute 200 µl buffer and the solution is stirred on the vortex, placed on ice for 30 min and then stirred on a vortex every 10 min Then the solution is centrifuged at 13,000 rpm for 10 min and from each tube selected aliquot portion with a volume of 100 μl of the supernatant and stored at -80°C.

Staging test (5 days).Anti-rabbit peroxidase labeled IgG horseradish is prepared by diluting 10 ál of dilution 100× 1 ml of diluent for peroxidase from horseradish for each strip of 8 wells. Prepare a buffer solution for washing the dilution of the contents of the source to the amp is s (× 25) using distilled water to obtain a solution ×1. You can prepare a dilution of a standard solution of p53 or General solution of p53, as described in the exemplary data of table 12. To guarantee full recovery standard 1 gently mixed and incubated for 10 min at room temperature.

Table 12
ConcentrationStandard solutionThe dilution buffer
Standard 1100 u/mlRestore the contents of the ampoule 1 0.7 ml standard buffer for cultivation
Standard 250 u/ml250 ál of standard 1250 ál
Standard 325 u/ml250 μl standard 2250 ál
Standard 4of 12.5 u/ml250 μl standard 3250 ál
Standard 5at 6.25 u/ml250 μl standard 4250 ál
Standard 63,12 u/ml250 μl standard 5250 ál
Standard 7of 1.6 u/ml250 μl standard 6250 ál
Standard 80250 ál

Protocol experience.All solutions allow to reach room temperature and gently mixed before use. Cooked and seasoned 8-hole band. Introduce 100 μl of standard buffer for cultivation in the hole for standard 8 (0 ng/ml/well or 0 U/well). In chromogenic control well don't add anything. To the appropriate microtiter plate wells, make 100 ál of standard or diluted sample. Usually the sample is diluted in standard buffer for dilution in a ratio of at least 1:10 or higher. Each sample was put in two Parallels. Gently Pat on the edge of the tablet for thorough mixing. Tablet cover cover for tablets and incubated for 2 h at room temperature or at 4°C. the Wells are washed four times with 400 µl of assay buffer for washing. Incubated for 15-30 seconds and then the liquid aspirinum. After washing tablet overturn and dried at absorbing cloth. To each well, except chromogenic control, introduce 100 μl of anti-p53 antibodies [pS15] or anti-p53 antibodies (total) (antibody detection). Gently Pat for mixing; the tablet is covered and incubated for 1 h at room temperature. Carefully aspiritual solution from the wells

The wells washed four times with 400 µl of assay buffer for washing. Incubated for 15-30 seconds and then the liquid aspirinum. After washing tablet overturn and dried at absorbing cloth. To each well, except chromogenic control, make 100 ál anti-rabbit peroxidase labeled IgG horseradish. The tablet is covered and incubated for 30 min at room temperature. The wells washed four times with 400 µl of assay buffer for washing. Incubated for 15-30 seconds and then the liquid aspirinum. After washing tablet overturn and dried at absorbing cloth. In each well contribute 100 μl of TMB (stable chromogenic substrate) and incubated for 30 min at room temperature in the dark. Color becomes blue. Introduce 100 μl of stop solution. The tablet gently Pat for mixing. The color should change to yellow. The colour intensity is determined on the reader at a wavelength of A450 nm against chromogenic control (=100 μl of TMB+100 ál of stop solution) as a control. Absorption determined within 2 h after the end of analysis.

Example 111

The Protocol for determining the activity of caspase-3/7

You can plan an illustrative Protocol for determining the activity of caspase-3/7, as presented below. 1 day cells HCT-116 seeded based 0,015×106 cells/50 μl/well. Incubated at 37°in CO2thermostat. On the 2nd day of holes remove 25 ál environment. Cells HCT-116 treated with 1, 3 and 5 μm test compound. The positive control process of 0.01, 0.1 and 1 μm staurosporine. Six holes with a negative control treated only with medium (add 25 ál of diluted samples into appropriate wells). Incubated for 24 h at 37°in CO2thermostat. On the 3rd day of preparing homogeneous reagent for the production of the test for determining the activity of caspase-3/7 Apo-ONE (Promega) at the rate of 10 ál/1 ml buffer. Make 50 ál of diluted reagent. Incubated for 1 h at room temperature. Determine the fluorescence at wavelengths 485/520.

Example 112

Protocol for staining with annexin V-Alexa 488

You can plan Protocol staining with annexin V-Alexa 488, as shown below. 1 day cells HCT-116 sown at the rate of 1.5 to 2.0×106cells/Cup with a diameter of 10 cm/10 ml of medium. Incubated for 24 h at 37°in CO2thermostat. On the following day, cells treated with 1, 2, 3, 4, and 5 μm test compound. One or two tablets left not treated (only Wednesday) in the quality control of tablets. Use the following controls: untreated samples (without Alexa or iodide of propecia), controls treated only with iodide of propecia or Alexa 488, and to the trolls, processed both Alexa 488 and iodide of propecia. Collect cells (harvested attached and floating cells). Cells are washed twice with cold PBS. Cells respidered in the buffer for the binding of annexin 1×.

Count the number of cells and diluted in 1× buffer for binding of annexin to titer ≈1×106cells/0.1 ml with cooking sufficient to ensure 100 ál for analysis. Add 5 ál conjugate annexin V for every 100 ál of cell suspension. Add 4 μl of a solution of iodide of propecia (mother solution=1 mg/ml) to each 100 μl of cell suspension. The sample is incubated at room temperature for 15 minutes Make 400 µl buffer to bind annexin, gently mixed and the samples stored on ice. Stained cells immediately analyze flow cytometry.

Example 113

The Protocol for cell cycle analysis by DNA

You can plan an illustrative Protocol for cell cycle analysis by DNA, as shown below. Seeded cells at the rate of 1.5 to 2.0×106cells/Cup with a diameter of 10 cm (conducted by seeding cells on additional Cup for unstained cells). Cells are incubated at 37°C in a humid atmosphere of 5% CO2-thermostat for 24 hours To synchronize cells in a state of weak growth in order to obtain cells at rest redwoods and once washed with serum-free medium, for every Cup of make a 10 ml serum-free medium. Cells incubated for 24 h at 37°C in a humid atmosphere of 5% CO2-thermostat. The medium is removed and the process is repeated (diluted in medium containing serum, 10 ml): 1-5 μm test compound plus control. Cells incubated for 24 h at 37°C in a humid atmosphere of 5% CO2-thermostat.

Spend processing for trypsinisation/cell isolation. Make 3 ml trypsin/EDTA. Floating cells preserve and unite with adherent cells. Incubated for 24 h at 37°C in a humid atmosphere of 5% CO2-thermostat. In wells add 3 ml of medium (containing FBS) and transferred by pipette into centrifuge tubes. Centrifuged at 1000 rpm for 5 minutes the Supernatant was separated and the precipitate resuspended in 2-3 ml of PBS. Count the number of cells and the cells washed once transfer 2×106cells/vial, add 2 ml PBS and centrifugation at 1000 rpm for 5 minutes the Precipitate after centrifugation cells resuspended in 0.3 ml of cold PBS.

For fixation of the cells gently make dropwise 0.7 ml chilled on ice 70% ethanol in a test tube with 0.3 ml of cell suspension in PBS, while stirring on a vortex. The mixture was incubated on ice for 1 h (or up to several days at 4°). Centrifuged at 1000 g for 5 mi the. Washed once with cold PBS (1-2 ml). Centrifuged at 1000 g for 5 minutes the Precipitate after centrifugation cells resuspended in 0.25 ml of cold PBS, add 5 ál of RNA solution-the basics And with a concentration of 10 mg/ml (final concentration of 0.2-0.5 mg/ml). Incubated at 37°C for 1 h Contribute 10 μl of a solution of propecia iodide with a concentration of 1 mg/ml in deionized water (final concentration of 10 μl/ml) and to the analysis stored in the dark at 4°C. the Samples analyzed using FACS on the testimony cytometer at a wavelength of 488 nm. Cells can be painted of propecia iodide on the day of analysis.

It is clear that the above detailed description and accompanying examples are merely illustrative, and should not be construed as limiting the scope of the invention. Specialists in this field will be apparent various changes and modifications of the disclosed embodiments. Such changes and modifications, including without limitation, related to the chemical formula, substituents, derivatives, intermediates compounds, synthesis, compositions and/or methods of use of the invention can be made without departing from its essence and volume. The above U.S. patents and publications incorporated in this description by reference.

1. The compound of formula (1)

/img>

and its pharmaceutically acceptable salt;

where B, X, or V is absent if Z1, Z2, Z3or Z4respectively represent N, and independently H, halogen atom, azido, R2CH2R2, SR2, OR2or NR1R2when Z1, Z2, Z3or Z4imagine;

where each NR1R2, R1and R2together with N may form an optionally substituted piperidine, pyrolidine, pieperazinove or morpholino ring;

Z1represents N and Z2, Z3and Z4are, or

Z1and Z3are N and Z2and Z4imagine;

W together with N and Z form an optionally substituted thiazole, imidazole, or pyrimidine ring, which is condensed with an optionally substituted ring selected from the group consisting of:

or

U is NR1R2, NR1-(CR12)n-NR3R4,

where NR3R4, R3and R4together with N may form an optionally substituted piperidine, pyrolidine, pieperazinove or morpholino ring;

R1and R3independently represent N or C-6 alkyl;

each R2represents N or C1-10alkyl, each optionally substituted by a halogen atom, or With3-6cycloalkyl, aryl, heteroaryl or pyridine, pyrolidine, pieperazinove or morpholino ring,

where each ring optionally substituted; or

R2optionally substituted piperidine, pyrrolidine, pyridine, piperazine, pyrazino, morpholine or benzimidazole;

R4represents N or C1-10alkyl;

each R5represents a substituent in any position in the ring W; and is H, OR2, amino, alkoxy, amido, halogen atom or cyano;

or R5is1-6alkyl, -CONHR1-, each optionally substituted by a halogen atom;

or two adjacent R5associated with the formation of 5-6-membered rings, optionally substituted heterocyclic ring selected from piperidino, pyrolidine, pieperazinove or morpholino ring;

n is 1-6; and

each optionally substituted part may be substituted by one or more halogen, OR2, NR1R2, carbamate,1-10the alkyl, each optionally substituted by a halogen atom,=O, cyano, nitro, COR2, NR2COR2, sulfonylamides; NR2SOOR2; SR2, SOR2, COR 2, CONR22, OCOR2, OCOOR2or OCONR22.

2. The compound according to claim 1, where W together with N and Z form a ring, which is condensed with phenyl.

3. The compound according to claim 1, where U is NR1R2where R1is N, and R2is1-10the alkyl, optionally substituted by a heteroatom, With3-6cycloalkyl, aryl or piperidine, pyrrolidine, piperazine or morpholine.

4. The compound according to claim 3, where U is NR1R2where R2is1-10alkyl, substituted morpholine, pyrrolidine, piperazine, pyridine or piperidine.

5. The compound according to claim 1, where U is NR1(CR12)n-NR3R4; n is 1-4; and R3and R4in NR3R4together form an optionally substituted piperidine, pyrrolidine, piperazine or morpholine.

6. The compound according to claim 1, where U represents NH-(CH2)n-NR3R4; where R3and R4together with N form an optionally substituted pyrrolidine.

7. The compound according to claim 1, where U is 2-(N-methylpyrrolidine-2-yl)ethylamino or (2-pyrrolidin-1-yl)ethanamine.

8. The compound according to claim 1, where a and X independently represent a halogen atom or SR2where R2is0-10the alkyl, optionally substituted C3-6cycloalkyl, aryl, heteroaryl the m or piperidine, pyrrolidine, piperazine or morpholine.

9. The connection of claim 8, where R2is0-10alkyl, substituted phenyl or pyrazino.

10. The compound according to claim 1, where each of the Z2, Z3and Z4are, and Z1is N.

11. The compound according to claim 1, where two of the Z1and Z3each is N, and Z and Z4each represent C.

12. The compound according to claim 1, where Z represents NR1and R1is1-6the alkyl.

13. The connection section 12, where R1represents methyl.

14. The compound according to claim 1, where at least one of b, a, X, or V is a halogen atom, and the corresponding adjacent Z1-Z4is C.

15. The compound according to claim 1, where V is N.

16. Pharmaceutical composition, which can suppress cell proliferation and/or induce apoptosis of the cells containing the compound according to claim 1 and a pharmaceutically acceptable carrier.

17. A method of suppressing cell proliferation and/or attenuation of cell proliferative disorders, including the introduction of a system or subject in need, an effective amount of a compound according to claim 1 or the pharmaceutical composition, and optional with the procedure and/or chemotherapeutic agent, thereby inhibiting cell proliferation and/or weakening the specified cell proliferative disorder.

18. the manual on 17, in which the specified cell proliferative violation is a tumor or a cancer.

19. The method according to p, in which said system is a cell or tissue, and the specified subject is a human or an animal.

20. The way to reduce titers of microbes and/or attenuation of microbial infection, comprising contacting system or subject in need thereof, an effective amount of a compound according to claim 1 or the pharmaceutical composition, and optionally with antimicrobial agent, thereby reducing the titles of microbes and/or weakening the specified microbial infection.

21. The method according to claim 20, in which said system is a cell or tissue, and the specified subject is a human or an animal.

22. The method according to claim 20, in which the titles of microbes and/or microbial infection are the titers of viruses, bacteria or fungi.

23. Method of inducing cell death and/or induction of apoptosis, including the introduction of a system or subject in need, an effective amount of a composition containing the compound according to claim 1, or pharmaceutical composition, and optional with the procedure and/or chemotherapeutic agent, thereby inducyruya cell death and/or inducyruya apoptosis.

24. The method according to item 23, in which said system is a cell or tissue, and specified what bhakta is a person or an animal.

25. The method according to item 23, in which the specified chemotherapeutic agent is gemcitabine.

26. The method according to paragraph 24, in which the above procedure is a radiation therapy or surgery.

27. The compound of the formula

or

28. Pharmaceutical composition, which can suppress cell proliferation and/or induce apoptosis of the cells containing the compound according to item 27, and a pharmaceutically acceptable carrier.

29. The method of obtaining compounds of formula (1)

comprising contacting a complex ester of formula 3, an amine of the formula with other1R2and Lewis acid of the formula m lnwhere L represents a halogen atom or an organic radical, n is 3-5, and M represents an atom of an element of group III atoms of the element of group IV, As, Sb, V or Fe,

where B, X, or V is absent if Z1, Z2, Z3or Z4respectively represent N, and independently H, halogen atom, azido, R2CH 2R2, SR2, OR2or NR1R2when Z1, Z2, Z3or Z4imagine;

where each NR1R2, R1and R2together with N may form an optionally substituted piperidine, pyrolidine, pieperazinove or morpholino ring;

Z1represents N and Z2, Z3and Z4are, or

Z1and Z3are N and Z2and Z4imagine;

W together with N and Z form an optionally substituted thiazole, imidazole, or pyrimidine ring, which is condensed with an optionally substituted ring selected from the group consisting of:

or

U is NR1R2, NR1-(CR12)n-NR3R4,

where NR3R4, R3and R4together with N may form an optionally substituted piperidine, pyrolidine, pieperazinove or morpholino ring;

R1and R3independently represent N or C1-6alkyl;

each R2represents N or C1-10alkyl, each optionally substituted by a halogen atom, or With3-6cycloalkyl, aryl, heteroaryl or pyridine, pyrolidine, piperazine is or morpholino ring,

where each ring optionally substituted; or

R2optionally substituted piperidine, pyrrolidine, pyridine, piperazine, pyrazino, morpholine or benzimidazole;

R4represents N or C1-10alkyl;

each R5represents a substituent in any position in the ring W; and is H, OR2, amino, alkoxy, amido, halogen atom or cyano;

or R5is1-10alkyl, -CONHR1-, each optionally substituted by a halogen atom;

or two adjacent R5associated with the formation of 5-6-membered rings, optionally substituted heterocyclic ring selected from piperidino, pyrolidine, pieperazinove or morpholino ring;

n is 1-6; and

each optionally substituted part may be substituted by one or more halogen, OR2, NR1R2, carbamate,1-10the alkyl, each optionally substituted by a halogen atom,=O, cyano, nitro, COR2, NR2COR2, sulfonylamides; NR2SOOR2; SR2, SOR2, COOR2, CONR22, OCOR2, OCOOR2or OCONR22.

30. The method according to clause 29, wherein said ether amine and the Lewis acid is subjected to interaction at room temperature.

31. The method according to clause 29, enabling the th interaction the specified ether and amine in an organic solvent to form a solution and the interaction of the specified solution of a Lewis acid.

32. The method according to p in which the specified organic solvent is methylene chloride.

33. The method according to clause 29, which use an excess of amine relative to the ether.

34. The method according to p, in which the ratio of ester to amine is about 1:2, 1:1.5 or 1:1,25.

35. The method according to clause 29, in which the use of equimolar amounts of Lewis acid relative to the amine.

36. The method according to clause 29, further comprising allocating the compounds of formula 1, and optional purification of selected compounds of formula 1.

37. The method according to p, which specified a dedicated connection purified column chromatography, recrystallization or by both methods.

38. The method according to clause 37, in which the purity of the selected compound is in the range from 90 to 99% or in the range from 90 to 95%.

39. The method according to clause 29, which specified the Lewis acid is a BL3AlL3, FeL3GaL3, SbL5, InL3, ZrL4, SnL4, TiL4, TiL3AsL3or SbL3where L represents a halogen atom or alkyl.

40. The method according to § 39, in which this Lewis acid is an aluminum chloride.

41. The method according to clause 29 to obtain compounds selected from the group consisting of:

and



 

Same patents:

FIELD: organic chemistry, medicine, pharmacy.

SUBSTANCE: invention relates to using phenylethenyl- or phenylethynyl-derivatives as antagonists of glutamates receptors. Invention describes using compound of the general formula (I):

wherein each among R1, R2, R3, R4 and R5 means independently of one another hydrogen atom, (C1-C6)-alkyl, -(CH2)n-halogen, (C1-C6)-alkoxy-group, -(CH2)n-NRR', -(CH2)n-N(R)-C(O)-C1-C6)-alkyl, phenyl or pyrrolyl that can be unsubstituted or substituted with one or more (C1-C6)-alkyl; each among R, R' and R'' means independently of one another hydrogen atom or (C1-C6)-alkyl; A means -CH=CH- or C≡C; B means ,, , , or wherein R6 means hydrogen atom, (C1-C)-alkyl, -(CH2)n-C(O)OR, or halogen atom; R7 means hydrogen atom, (C1-C6)-alkyl, -(CH2)n-C(O)OR', halogen atom, nitro-group or oxodiazolyl group that can be unsubstituted or substituted with (C1-C6)-alkyl or cycloalkyl; R8 means hydrogen atom, (C1-C6)-alkyl, -(CH2)n-OH, -(CH2)n-C(O)OR'' or phenyl; R9 means (C1-C6)-alkyl; R10 and R11 mean hydrogen atom; R12 means -(CH2)n-N(R)-C(O)-(C1-C6)-alkyl; R13 means hydrogen atom; each R14, R15, R16 and R17 independently of one another means hydrogen atom or (C1-C6)-alkoxy-group; each R18, R19 and R20 independently of one another means hydrogen atom; R21 means hydrogen atom or (C1-C6)-alkyl; R22 means hydrogen atom, (C1-C6)-alkyl or (C1-C6)-alkyl comprising one or more substitutes chosen from groups hydroxy- or halogen atom; R23 means hydrogen atom, (C1-C6)-alkanoyl or nitro-group; each among R24, R25 and R26 independently of one another means hydrogen atom or (C1-C6)-alkyl; n = 0, 1, 2, 3, 4, 5 or 6; X means -O- or -S-; Y means -CH= or -N=, and its pharmaceutically acceptable salts used in preparing medicinal agents designates for treatment or prophylaxis of disorders mediated by mGluR5-receptors. Also, invention describes compounds of the formula (I-A), compound of the formula (I-B-1) given in the invention description, and a medicinal agent used in treatment or prophylaxis of disorders mediated by mGluR5-receptors.

EFFECT: valuable medicinal properties of compounds.

44 cl, 1 tbl, 44 ex

FIELD: organic chemistry, chemical technology, medicine, pharmacy.

SUBSTANCE: invention relates to novel heterocyclic compounds comprising 2-aminopyridin-3-sulfonic fragment of the general formula (1) or their pharmaceutically acceptable salts, N-oxides or hydrates possessing properties of antagonists of glutamate-induced calcium ions transport, in particular, neuroprotective effect. Also, invention relates to the focused library for the search of biologically active leader-compounds comprising at least one heterocyclic compound of the general formula (1) and to pharmaceutical composition if form of tablets, capsules or injections placed into pharmaceutically acceptable package containing compounds of invention as an active substance. In compound of the general formula (1) R1 represents hydrogen atom; R2 represents chlorine atom, optionally substituted hydroxyl group, optionally substituted amino-group, optionally substituted azaheterocyclyl; or R1 and R2 in common with nitrogen and sulfur atoms to which they are bound form optionally substituted and optionally condensed with other cycles 1,1-dioxo-4H-pyrido[2,3-e][1,2,4]thiadiazine or optionally substituted and optionally condensed with other cycles 5,5-dioxo-5,6,7,9-tetrahydro-5-thia-1,6,9-triazabenzocyclohepten-8-one. Also, invention discloses methods for preparing different compounds of the general formula (1).

EFFECT: improved preparing methods, valuable medicinal properties of compounds.

10 cl, 4 sch, 4 tbl, 9 ex

FIELD: organic chemistry, medicine, pharmacy.

SUBSTANCE: invention relates to derivatives of benzodiazepine. Invention describes a derivative of benzodiazepine of the formula (I): wherein dotted lines show the possible presence of a double bond; R1, R2, R3, R4 and R5 are given in the invention claim; n represents 0, 1, 2, 3 or 4; X represents sulfur atom (S) or -NT wherein T is give in the invention claim; A represents hydrogen atom, (C6-C18)-aryl group substituted optionally with one or more substitutes Su (as given in the invention claim) or (C1-C12)-alkyl; or in alternative variant R4 and R5 form in common the group -CR6=CR7 wherein CR6 is bound with X and wherein R6 and R7 are given in the invention claim, and their pharmaceutically acceptable salts with acids or bases. It is implied that compounds corresponding to one of points (a)-(e) enumerated in the invention claim are excluded from the invention text. Also, invention describes methods for preparing compounds of the formula (I) and a pharmaceutical composition eliciting the hypolipidemic activity. Invention provides preparing new compounds eliciting the useful biological properties.

EFFECT: improved preparing method, valuable medicinal properties of compounds.

20 cl, 6 tbl, 192 ex

FIELD: organic chemistry, medicine, pharmacy.

SUBSTANCE: invention relates to oxazolo- and thiazolo-[4,5-c]-quinoline-4-amines of the general formula (I)

wherein R1 is taken among group consisting of oxygen and sulfur atoms; R2 is taken among hydrogen atom, alkyl, alkyl-OH (hydroxyalkyl), alkyl-X-alkyl, alkyl-O-C(O)-N(R5)2, morpholinyl, pyrrolidinyl, alkyl-X-aryl radical, alkenyl-X-aryl radical; each substitute R3 and R4 represents hydrogen atom or substitutes R3 and R4 taken in common form the condensed aromatic or [1,5]-naphthiridine system; X represents -O- or a single bond; R5 represents hydrogen atom. Also, invention describes intermediate compounds, pharmaceutical composition and a method for stimulating biosynthesis of cytokinins (cytokines) based on these compounds. Invention provides preparing new compounds eliciting valuable biological properties.

EFFECT: valuable properties of compounds.

21 cl, 2 tbl, 64 ex

The invention relates to organic chemistry and can find application in medicine

The invention relates to an improved process for the preparation of 6,8-dimethyl-2-piperidinomethyl-2,3-dihydrothiazolo[2,3-f] xanthine of the formula I, causing the induction of microsomal liver enzymes

FIELD: chemistry, pharmacology.

SUBSTANCE: described are novel pyridopyrrolizine and pyridoindolizine derivatives of general formula I and their pharmaceutically acceptable salts and hydrates, where A is C1-3alkyl; Ar stands for naphtyl or phenyl optionally substituted with one or two groups, selected from halogen, C1-6alkyl or C1-6alkyl haloid; Q stands for COOH; one of X1, X2, X3 or X4 stands for nitrogen, others are independently selected from CH and C-Rg, where Rg stands for C1-6alkyl or S(O)nC1-6alkyl, where n=0, 2; Y1 stands for S or C(O); Y2 stands for (CRdRe)m, where Rd and Re - hydrogen, m is integer 1 or 2; R1, R2, R3 stands for hydrogen, pharmaceutical composition, containing them, and method of treatment of diseases, mediated by prostaglandin D2.

EFFECT: obtaining novel pyridopyrrolizine and pyridoindolizine derivatives which possess useful properties.

22 cl, 2 tbl, 17 ex

FIELD: chemistry.

SUBSTANCE: novel compounds are selected from group, consisting of: 4-(2-cyclopropyl-ethyl)-piperazine-1-carboxylic acid 2-methyl-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclopropylmethyl-piperazine-1-carboxylic acid 3-methyl-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclopropylmethyl-piperazine-1-carboxylic acid 3-fluorine-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-(2-hydroxymethyl-cyclopropylmethyl)-piperazine-1-carboxylic acid 2-methyl-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclopentylmethyl-piperazine-1-carboxylic acid 2-methyl-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclopropylmethyl-piperazine-1-carboxylic acid 3-chlorine-4-(3-methyl- 4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclobutylmethyl-piperazine-1-carboxylic acid 3-chlorine-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclobutylmethyl-piperazine-1-carboxylic acid 2-methyl-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-(2-cyclopropyl-ethyl)-piperazine-1-carboxylic acid 3-methyl-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclobutylmethyl-piperazine-1-carboxylic acid 3-methyl-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclobutylmethyl-piperazine-1-carboxylic acid 3-fluorine-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclobutylmethyl-piperazine-1-carboxylic acid 2-fluorine-4-(3-methyl-4,10-dihudro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclopropylmethyl-piperazine-1-carboxylic acid 2-fluorine-4-(3-methyl-4,10-dihydro-3H-2,3,4;9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclobutylmethyl-piperazine-1-carboxylic acid 4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclopropylmethyl-piperazine-1-carboxylic acid 3-ethyl-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclobutylmethyl-piperazine-1-carboxylic acid 2-chlorine-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide; 4-cyclopropylmethyl-piperazine-1-carboxylic acid 2-chlorine-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraaza-benzo[f]azulene-9-carbonyl)-benzylamide and 4-cyclobutylmethyl-piperazine-1-carboxylic acid 3-methoxy-4-(3-methyl-4,10-dihydro-3H-2,3,4,9-tetraazabenzo[f]azulene-9-carbonyl)-benzylamide. Invention also relates to pharmaceutical composition and to application of compounds of general formula 1.

EFFECT: obtaining novel biologically active compounds and based on them pharmaceutical composition, possessing antagonistic activity with respect to vasopressin receptors.

60 cl, 153 ex

FIELD: chemistry.

SUBSTANCE: invention relates to the novel compounds with the common formula III: where, if X is selected from the group containing NH and S, R1, R2, R3, R4, R5, R6, R7, R8 and R9, each independently is selected from the group containing H, OH, OR', substituted or unsubstituted aryl, where substitutes independently correspond to H, OH, C1-C12alkoxy; where, if X means O, R1, R2, R3, R4, R5, R6, R7 and R8, each independently, selected from the group containing H, OH, OR', SH, SR', SOR', SO2R', OSO2R', NHR', N(R') CO2R', OC(=O)R'; and R9 independently selected from the group containing H, OR', unsubstituted or substituted with aminogroup or halogen C2-C12 alkenyl, unsubstituted C2- C12 alkenyl, unsubstituted thienyl and halogen; where each of the R' groups are independently selected from the group containing H, substituted or unsubstituted C1-C18 alkyl, substituted or unsubstituted aryl; where substitutes are independently selected from the group containing halogen, OH, CN, C1-C12 alkoxy, phenyl; and the dotted line represents the simple or double bind; or its pharmaceutically compatible salt or complex ether. Other novel lamellarin analogs are described.

EFFECT: compounds have antitumor activity.

24 cl, 2 tbl, 3 ex

FIELD: organic chemistry, biochemistry.

SUBSTANCE: invention describes novel substituted pyrazoles of the general formula (I): wherein values of radicals Ar, Ar2, W, G, R5-R8, RZ and n are given in the invention claim. Also, invention relates to a pharmaceutical composition based on these compounds, using this pharmaceutical composition for manufacturing agent designated for treatment of asthma, and a method for inhibition of activity of cathepsin S. Compounds indicated above can be used in medicine.

EFFECT: valuable medicinal and biochemical properties of compounds and pharmaceutical composition.

27 cl, 3 tbl, 352 ex

FIELD: organic chemistry, pharmacy, veterinary science.

SUBSTANCE: invention relates to compound comprising 1-(2-methylpropyl)-1H-imidazo[4,5-c][1,5]naphthyridine-4-amine or pharmaceutically acceptable salt of this compound and pharmaceutical composition used for stimulation of biosynthesis of cytokine based on abovementioned compound Also, invention claims a method for stimulation of biosynthesis of cytokines in animal body involving administration in animal body of above described compound or its salt. Invention provides preparing a novel compound possessing useful biological properties.

EFFECT: valuable biological properties of compound and pharmaceutical composition.

3 cl, 12 tbl, 213 ex

FIELD: organic chemistry, medicine, biochemistry, pharmacy.

SUBSTANCE: invention describes novel imidazo-condensed compounds of the general formula (I): wherein Z represents nitrogen atom (N); Z1 represents N whein a bond between C5 and Z1 represents a simple bond, and Z1 represents carbon atom (C) when a bond between C5 and Z1 represents a double bond; R1 represents hydrogen atom; R2 represents (C1-C6)-alkyl, (C1-C6)-hydroxyalkyl, phenyl-(C1-C4)-alkyl substituted with halogen atom, ((C1-C4)-alkyl)-SO2, (C1-C6)-alkyl, (C5-C6)-cycloalkyl possibly substituted with hydroxy-group, phenyl substituted with halogen atom, heterocyclyl possibly substituted and chosen from group consisting of tetrahydropyranyl, (N-methylsulfonyl)piperidinyl or tetrahydro-1,1-dioxide-2H-thiopyranyl; A is absent or represents -O-; a bond between C5 and Z1 is a simple or double bond; a bond between C8 and C9 is a simple or double bond; Y represents phenyl substituted with halogen atom, or their pharmaceutically acceptable salts possessing inhibitory activity with respect to p38 MAP kinase, and pharmaceutical composition containing thereof. Proposed compounds can be used, for example, in treatment/or prophylaxis of such diseases as rheumatic arthritis, fever and reduced bone resorption.

EFFECT: valuable medicinal properties of compounds and pharmaceutical composition.

16 cl, 2 tbl

FIELD: organic chemistry.

SUBSTANCE: invention relates to method for synthesis of nitrogen containing heterocyclic compounds, in particular compounds of formula I , wherein 1) R and R1 are H; 2) R is H, R1 is CH3; 3) R and R1 are CH3. Claimed method includes reaction of 2-chloro-3-nitropyridine with 3-R-5-R1-pyridine at 30°C in molar ratio of 1:7 followed by reduction and simultaneous cyclization of produce salt of N-(nitro-2-pyridyl)-3-R-5-R1-pyridinium of general formula II , wherein R and R1 are as defined above, by treatment of alcohol solution of abovementioned salt with SnCl2 solution in hydrochloric acid in molar ratio of N-(nitro-2-pyridyl)-3-R-5-R1-pyridinium salt : SnCl2 = 1:3 at 20°C for 0.12 hours.

EFFECT: reduced synthesis cost, decreased time and temperature of process, target product with increased yield and purity.

2 tbl, 6 ex

FIELD: organic chemistry, chemical technology, medicine, pharmacy.

SUBSTANCE: invention relates to novel derivatives of varioline and their pharmaceutically acceptable salts and esters possessing anti-tumor activity. In compound of the formula (I): each among R1 and R2 is chosen independently from group comprising hydrogen atom (H), -OH, -OR', -SH, -SR', -SOR', -SO2R', -NO2, -NH2, -NHR', -N(R')2, -NHCOR'. -N-(COR')2, -NHSO2R', (C1-C12)-alkyl, (C1-C12)-halogenalkyl, substituted or unsubstituted aryl, substituted or unsubstituted aralkyl and substituted or unsubstituted heteroaromatic group; R3 is chosen from group comprising -OH and -OMe wherein group R' or each among groups R' is chosen independently from group comprising -OH, (C1-C12)-alkyl, (C1-C12)-halogenalkyl, substituted or unsubstituted aryl, substituted or unsubstituted aralkyl, substituted or unsubstituted arylalkenyl and substituted or unsubstituted heteroaromatic group; if group R1 or R2 represents group of the formula -N(R')2 or -N(COR')2 then all groups R' can comprise similar or different values, either groups R' in common with nitrogen atom to which they are added can form 5-7-membered heterocyclic ring. Aryl group or aryl moiety of aralkyl and arylalkenyl group represents a carbocyclic aryl group comprising 6 carbon atoms in carbocyclic ring; aralkyl group represents (C1-C6)-alkyl group substituted with abovementioned aryl group; arylalkenyl group represents (C2-C6)-alkenyl group substituted with abovementioned aryl group; heteroaromatic group represents a heterocyclic aromatic group comprising from 5 to 7 atoms in ring wherein heteroatoms in ring are chosen from nitrogen atom; substituted in aryl and heteroaromatic groups and in aryl moiety of aralkyl and arylalkenyl groups are chosen from group comprising (C1-C12)-alkyl, (C1-C12)-halogenalkyl, (C1-C12)-alkoxy-, (C1-C12)-alkylthio-group, -NH2, (C1-C6)-alkylamino-, di-(C1-C6)-alkyl)-amino-, (C1-C4)-alkanoylamino-, di-(C1-C4)-alkanoylamino-group, -NO2, -CN and halogen atom, its derivatives wherein nitrogen atom is quaternized. Proposed compounds possess anti-tumor activity and can be used in treatment or prophylaxis of cancerous diseases, for example, ovary cancer, prostate cancer, mammary cancer and melanoma.

EFFECT: valuable medicinal properties of compounds and pharmaceutical composition, improved methods of treatment, improved methods of synthesis.

38 cl, 10 sch, 2 tbl, 25 ex

FIELD: organic chemistry, medicine, pharmacy.

SUBSTANCE: invention describes novel derivatives of dihydroimidazo[5,1-a]-β-carboline of the general formula (I): wherein R1 = R3 = R4 mean hydrogen atom (H); R2 means hydrogen, halogen atom, (C1-C6)-alkyl, hydroxyl, (C1-C6)-alkoxyl; R5 means hydrogen atom or (C1-C6)-alkyl; R6 and R7 mean independently hydrogen atom or (C1-C6)-alkyl or phenyl with exception compounds of the general formula (I) wherein R1-R6 mean hydrogen atom, and R7 means group -CH or phenyl, and their isomers and additive salts with pharmaceutically acceptable acid also, and a method for their synthesis and pharmaceutical composition. Novel compounds possess soporific effect and can be used in producing a medicinal agent.

EFFECT: improved method of synthesis and preparing, valuable medicinal properties of compounds and pharmaceutical composition.

5 cl, 10 tbl, 25 ex

FIELD: organic chemistry, chemical technology, medicine, oncology, pharmacy.

SUBSTANCE: invention relates to novel derivative of variolin B of the general formula (I) or their pharmaceutically acceptable salts possessing antitumor activity. In the general formula (I) radical R1 means aromatic group representing aromatic group representing phenyl optionally substituted with nitro-group, amino-group or alkyl-substituted amino-group, or aromatic group represents 5-6-membered heterocycle with two nitrogen atoms or sulfur atom as heteroatoms optionally substituted with (C1-C12)-alkyl, -OH, unsubstituted amino-group or amino-group substituted with (C1-C4)-acyl, phenyl-(C1-C4)-alkyl wherein phenyl group can be substituted with -OR1, or (C1-C12)-alkylthio-group, (C1-C12)-alkyl- or phenylsulfonyl, (C1-C12)-alkyl- or phenylsulfinyl or -OR1 wherein R1 is chosen from (C1-C12)-alkyl or phenyl; R2 represents hydrogen atom; R3 represents oxo-group when a dotted line is between nitrogen atom to which R2 is bound and carbon atom to which R3 is absent, or R2 is absent when R3 represents optionally protected amino-group wherein a substitute is chosen from (C1-C4)-acyl, phenylsulfonyl and (C1-C4)-alkylphenylsulfonyl when a dotted line forms a double bond between nitrogen atom to which R2 is bound and carbon atom to which R2 is bound; R4 represent hydrogen atom. Also, invention relates to a method for synthesis of compounds of the invention and to intermediate substances for their realization. Also, invention relates to a pharmaceutical composition based on variolin B derivatives.

EFFECT: improved method of synthesis, valuable medicinal property of compounds and pharmaceutical composition.

22 cl, 5 sch, 1 tbl, 50 ex

FIELD: chemistry.

SUBSTANCE: in compound of formula I , R1 is hydrogen; R2 is phenyl substituted by trifluoromethyl and optionally by other substitute selected out of a group including lower hydroxyl alkyl, lower alkylamino, lower hydroxyl alkylamino, dilower alkylamino, 1H-imidazolyl, lower alkyl-1H-imidazolyl, carbamoyl, lower alkylcarbamoyl, pyrrolidino, piperazino, lower alkylpiperazino, morpholino, lower alkoxy, trilfuoro-lower alkoxy, phenyl, pyridyl and halogenyl; R4 is methyl; where 'lower' prefix denotes radical with up to 7 carbon atoms. Also invention concerns pharmaceutical composition and method of treatment, as well as application of the claimed compounds in obtaining pharmaceutical composition.

EFFECT: improved proteinkinase inhibition properties.

9 cl, 98 ex

FIELD: chemistry.

SUBSTANCE: invention concerns new compounds of formula I or its pharmaceutically acceptable salts: , where R1 is phenyl group optionally substituted by substitutes selected out of halogen atom, -O-C1-6-alkyl; or R1 is phenyl condensed with aromatic or non-aromatic 5-7-member ring where the ring can optionally include up to three heteroatoms selected independently out of N, O and S; R2 is hydrogen, -O-C1-6-alkyl, -C1-6-alkyl or halogen atom; R3 is C1-6-alkyl, -(CH2)P-NO2, -(CH2)p-NR4R5, -(CH2)P-CONHOH, -(CH2)p-CN, -(CH2)P-CO2H, -(CH2)p-CO2R4, -(CH2)P-CONR4R5, -(CH2)p-OR4, -(CH2)p-NHCOR4 or -(CH2)p-NHSO2R4; R4 and R5 are independently hydrogen or C1-6-alkyl; p is 0, 1, 2, 3 or 4; X is C1-10-alkylene group; one of A1 and A2 is nitrogen atom, while the other is NR7; and R7 is hydrogen atom or OH-group. Also invention concerns pharmaceutical composition, method of TGF-β and/or activine signal transit route inhibition, method of reduction of excessive exocellular matrix accumulation for mammals, method of tumour cell metastasis inhibition for mammals, method of treatment of cancer neoplasm caused by TGF-β superexpression by TGF-β signal transit route inhibition for mammals, method of disease treatment, and method of thrombosis inhibition for mammals.

EFFECT: new compounds with useful biological properties.

16 cl, 19 ex, 2 tbl, 8 dwg

FIELD: chemistry.

SUBSTANCE: invention concerns method of treatment, alleviation and/or prevention of neurological state, particularly neurodegenerative disorders, involving administration of effective quantity of compound with formula I: . Also invention concerns application of compound of the formula I as neurotherapeutical, neuroprotective or antimyloid agent, pharmaceutical or veterinary composition for treatment, alleviation and/or prevention of neurological states, and compounds of the formula I on the following additional terms: (b) if R3, R and R' are H, and R2 is (CH2)2NR9R10, then both R9 and R10 are not ethyl or methyl; (c) if R3, R and R' are H, and R2 is (CH2)2NR9R10, then both R9 and R10 are not hydrogen or ethyl; (d) if R3, R and R' are H, and R2 is NR11R12, then both R11 and R12 are not hydrogen; (e) if R3, R and R' are H, and R2 is COR6, then R6 is not H, OH or CH2Cl; (f) if R3, R and R' are H, and R2 is not CH3 or CH2Cl; (g) if R3, R and R' are H, and R2 is HCNN R9R10, then both R9 and R10 are not H.

EFFECT: efficient treatment, alleviation and prevention of neurological state.

24 cl, 14 tbl, 21 ex, 14 dwg

FIELD: chemistry.

SUBSTANCE: present invention pertains to a compound with general formula where R' stands for phenyl, unsubstituted or substituted with one or more substitutes, chosen from a group comprising alkyl, alkoxy group, halogen, -(CH2)oOH, -C(O)H, CF3, CN, S-alkyl, -S(O)1,2-alkyl, -C(O)NR'R", -NR'R"; R2 and R3 independently stand for hydrogen, halogen, alkyl, alkoxy group, OCHF2, OCH2F, OCF3 or CF3 and R4 and R5 independently stand for hydrogen, -(CH2)2SCH3, -(CH2)2S(O)2CH3, -(CH2)2S(O)2NHCH3, -(CH2)2NH2, -(CH2)2NHS(O)2CH3 or -(CH2)2NHC(O)CH3, R' stands for hydrogen, alkyl, -(CH2)oOH, -S(O)2- alkyl, -S(O)-alkyl, -S-alkyl; R" stands for hydrogen or alkyl; o stands for 0, 1, 2 or 3. The invention also relates to use of formula I compounds in making medicinal preparations for treating schizophrenia, for treating positive and negative symptoms of schizophrenia and medicine for treating schizophrenia.

EFFECT: obtaining new compounds with useful biological properties.

55 cl, 421 ex, 1 tbl

FIELD: chemistry.

SUBSTANCE: invention claims derivatives of pyridazin-3(2H)-one of formula (I), where R1, R2 and R4 are organic radicals described in the claim 1, R3 is cyclic group described in the claim, and R5 is phenyl or heteroaryl group described in the claim. Compounds of formula (I) inhibit phosphodiesterase 4 (PDE-4) and can be applied in treatment of various diseases or pathological states alleviated by PDE-4 inhibition, and in medicine production for treatment of aforesaid diseases. Also invention claims method of obtaining these compounds and intermediate compounds for their obtainment.

EFFECT: obtaining compounds which can be used in treatment of various diseases or pathological states and in medicine production for treatment of aforesaid diseases.

25 cl, 28 tbl, 243 ex

Up!