Morphogene bone proteins (bmp), bmp receptors and binding bmp proteins and their application for diagnostics and glaucoma treatment

FIELD: medicine.

SUBSTANCE: invention concerns medicine, namely to ophthalmology. It is offered to use a composition containing, at least one agonist BMP-4 for treatment of glaucoma. Thus administer the composition with immediate delivery into an eye of the patient, for example using local eye drops; an oculentum; devices of the slowed down release implanted into a cul-de-sac of an eye either about a sclera of an eye or in an eye; by means of an injection. Concentration of BMP-4 in the composition preferably makes from 0.01 to 2%. The method is based on property of BMP-4 to reduce an ophthalmotonus.

EFFECT: creation of a composition for glaucoma treatment.

8 cl, 15 dwg, 2 tbl, 1 ex

 

1. The scope of the invention

The present invention discloses methods and reagents for the diagnosis and treatment of glaucoma and friends violations.

2. Description technical field

"Glaucoma" represent a group violates the sight of the eye diseases that are the leading cause of irreversible blindness in the U.S. and other developed countries. Primary open-angle glaucoma ("POAG") is the most common form of glaucoma is characterized by degeneration of the trabecular network, leading to the blockade of the normal ability of the ocular fluid outflow from the eye without overlapping space (for example, "angle") between the iris and the cornea (D. Vaughan et al. (1992)). Characteristic of such blockade in this disease is elevated intraocular pressure ("IOP"), which ultimately in the absence of appropriate and timely treatment leads to progressive loss of vision and blindness. It is established that the disease affects 0,4-3,3% of adults over the age of 40 years (Leske M.C. et al. (1986); Bengtsson B. (1989); Strong N.P. (1992)). In addition, the spread of the disease increases to 6% in people aged 75 years or older (Strong N.P. (1992)).

Because elevated IOP is a well-defined sign of glaucoma, the diagnosis is mostly based on the measurement of intraocular pressure is (tonometry) (Strong N.P. (1992); M. Greve et al. (1993)). Unfortunately, because the limits pressure in glaucoma and normal pressure overlap, such methods have limited value, unless there are multiple definitions (R.A. Hitchings (1993); Tuck M.W. et al. (1993); D. Vaughan et al. (1992); Vernon S.A. (1993)). For this reason, often use additional methods, such as direct examination of the optic nerve and determination of the degree of loss of visual field of the patient to improve the accuracy of diagnosis (M. Greve et al. (1993)).

Glaucoma affects three separate tissue in the eye. Increased IOP associated with POAG, occurs due to the morphological and biochemical changes in the trabecular network (TM), tissue located in the corner between the cornea and the iris. A large part of the power of eye fluid passes through the anterior segment of the eye on TM. Progressive loss of TM cells and the accumulation of extracellular debris in TM eye with glaucoma leads to increased resistance to the outflow of eye fluid (Lutjen-Drecoll and Rohen, 1996; Rohen, 1983; Rohen et al., 1993; Grierson and Calthorpe, 1988), resulting in increased IOP. Increased IOP, as well as other factors, such as ischemia, lead to degenerative changes in the head of the optic nerve (ONH), causing progressive "deepening" ONH (Varma and Minckler, 1996; Hernandez and Gong, 1996; Hernandez et al., 1990; Hernandez and Pena, 1997; Morrison et al., 1990) and the loss of ganglion cells of the mesh and (Quigley et al., 2000; Quigley, 1999; Quigley et al., 1995; Kerrigan et al., 1997) and axons. The detailed molecular mechanism responsible for damage to the TM, ONH and ganglion cells of the retina in glaucoma remains unknown.

Treatment of glaucoma is currently aimed at reducing IOP, the main risk factor for development and progression of glaucoma. As a result of such treatment decreases IOP, but it does not directly address the mechanism of pathogenesis, and the disease continues to progress. At least half of the patients with glaucoma is not diagnosed, and over time, as patients still glaucoma is diagnosed, the loss of ganglion cells of the retina is already about 40%. Therefore, there is a need for methods for early identification and diagnosis of glaucoma.

In view of the importance of glaucoma and at least partial inadequacy of the diagnostic methods of the prior art would be desirable to have an improved, more accurate way to diagnose glaucoma in the early stages of the disease. In addition, it would be desirable to have a new therapeutic agent aimed at the mechanism of the pathogenesis of glaucoma.

Brief description of the invention

In the present invention to overcome data and other disadvantages of the prior art by providing methods and the Directors for the early diagnosis of glaucoma, for the treatment of glaucoma and for the identification of compounds suitable for the treatment of glaucoma.

In some specific embodiments the invention provides a method for diagnosing glaucoma in a sample obtained from a cell or body fluid, detection of altered gene expression, a member of the family of morphogenic proteins of bone. In General, the method involves the following stages:

a) obtaining a sample of tissue or fluid from a patient with suspected glaucoma;

b) extracting DNA from the indicated samples;

C) getting multiple PCR primers, each of these primers comprises a sequence consisting of 18-1547 contiguous nucleotides of the sequence SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47 or SEQ ID NO:53;

d) amplification of regions extracted DNA using these primers with PCR product;

e) allocation of PCR product; and

f) identifying differences between the sequence of the PCR product and the normal sequence of a gene;

thus the difference between the amplified sequence and the normal sequence of a gene is a diagnostic sign of glaucoma.

Basically, the methods of the invention can include obtaining a sample from an individual, extracting DNA from the indicated samples. Selected PCR primers for Conques is to maintain family members BMP genes are then used to amplify the corresponding regions extracted gene with the PCR product. The PCR product emit method, with which you can effectively establish differences in DNA sequences between normal and mutant-specific gene family GIR under evaluation (extracted DNA). The established differences between the sequences indicate the presence of glaucoma.

The breakdown of tissue or fluid for use in the methods according to the invention may be blood or cells cheeks.

Typically, the sequence of the primers will have a length in the range from about 10, 15, or 18 nucleotides to about 20 or about 30 nucleotides. A larger sequence, for example, from 40, 50, 80, 90, 95, 100 nucleotides, even before the full-length sequences are even more preferred for some embodiments. Specialists in this field is considered valid oligonucleotides in length, at least 18-20 nucleotides, as sufficient for sufficiently specific hybridization, as a molecular probe, described Lathe (1985), this source specifically for this purpose is included here for information. Preferably the nucleotide sequence will consist of 20 to 100 contiguous nucleotides of the sequence SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47 or SEQ ID NO:53. Also ensure that the reproduction is Telenesti primers may consist of sequences at least 10, 15, or 18 contiguous nucleotides of the sequences of genes of BMP receptors and associated with BMP proteins, the sequence of which is well known.

The nucleic acid molecules having stretches of 10, 18, 20, 30, 50, 60, 65 or even up to and including 100 nucleotides, and so on, complementary to any of sequences of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47 or SEQ ID NO:53, suitable as probes for hybridization. Specialists in this field recognize that the primers or probes having a nucleotide length of about 18 nucleotides, provide high specificity of hybridization with sequence-target. The total size of the fragment, and the size of the complementary areas ultimately will depend on the intended application of a particular segment of nucleic acid. In embodiments of hybridization, as a rule, will find the use of smaller fragments, in which the length of the complementary region may be varied, for example, within about 10, 18, 20, or 30 to about 50, 60, 70, 80, 90 or 100 nucleotides, or even a full size, respectively, complementary to sequences that are subject to detection.

In particularly preferred embodiments the primers are composed of contiguous sequences of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47 or SEQ ID NO:53. In other preferred embodiments, the primers are composed of contiguous sequences of genes BMP-receptor (disclosed in Dijke et al., 1993; Astrom et al., 1999; Nohno et al., 1995, all included here for information) or associated with BMP genes, such as hordin (NCBI NM_029130), gremlin (Murphy et al., 1999; McMahon et al., 2000), follistatin (NCBI NM_003892) or Bambi (NCBI NM_005791). Most preferably, the primers will consist of a contiguous sequence from SEQ ID NO:3. In some aspects, at least some of the primers may additionally include detektiruya tag.

In some embodiments the invention provides a method of treating glaucoma introduction to a patient in need this, the compositions containing the sequence consisting of at least one compound selected from the group consisting of agonist BMP-2, BMP agonist-4, agonist BMP-5, BMP agonist-7, agonist Smad 1/5 antagonist hardina, antagonist gremlin and antagonist follistatin.

In additional aspects the present invention provides a method of identifying a therapeutic agent for the treatment of glaucoma. A therapeutic agent can be identified, for example:

a) obtaining a first composition comprising a population of recombinant cells expressing BMP-2A, BMP-4, BMP-5 and BMP-7;

b) the floor is the group of compounds of the candidate;

C) incubation of the indicated composition and the specified connection candidate;

testing of the specified composition on its ability to influence induced by BMP transmission signal involving Smad and/or regulated BMP gene expression; and the identification of the connection candidate that inhibits or stimulates these effects in the forward direction GIR.

Another aspect of the invention are diagnostic kits comprising sequences of the present invention and suitable reagents, such as detected by a label associated with the protein, peptide or by the antibody. Alternative detected label may be linked to the second sequence, which selectively hybridizes sequence according to the invention.

Close embodiments include therapeutic kits that contain pharmaceutically acceptable compositions or sequences of nucleic acids or sequences of peptides or proteins disclosed here. Such kits suitable for the detection of altered expression of BMP genes and proteins in clinical samples for diagnosis of glaucoma.

Brief description of figures

The figures form part of the present description and are included to further demonstrate certain aspects of the present invention. The invention monoluge to understand when referring to one or more shapes in combination with the detailed description of specific embodiments, presented here.

Figure 1. Nucleotide and amino acid sequence of BMP-2A.

Figure 2. Nucleotide and amino acid sequence of BMP-4.

Figure 3. Nucleotide and amino acid sequence of BMP-5.

Figure 4. Nucleotide and amino acid sequence of BMP-7.

Figure 5. The transmission signal with the participation of the morphogenic proteins of bone. The dimers morphogenic proteins, bone (GIR) in contact with the membrane complex consisting of BMP-receptors 1 and 2, which are serine/trionychinae. Regulatory Smad (Smad 1/Smad 5) fosfauriliruyutza and communicate with co-Smad (Smad 4). This formed Smad-complex enters the nucleus, where it binds to transcription factors (TF) and regulates gene expression. Associated with BMP proteins act as antagonists of BMP binding to BMP and preventing interaction with GIR GIR-receptors.

6. The expression of BMP in human cells and tissues TM. Painted bromide by ethidium agarose gel of PCR products for GIR from cDNA samples obtained in the analysis of RT-PCR the expression of BMP in human cells (lanes 1-5) and tissues (lanes 6-7) TM. L = markers base pairs. C = negative control strip PCR. β-actin was used as positive internal controls in RT-PCR.

7. The expression of BMP-receptor in human cells and TC the levels of TM. Painted bromide by ethidium agarose gel of PCR products from cDNA samples obtained in the analysis of RT-PCR the expression of BMP receptors in human cells (lanes 1-5) and tissues (lanes 6-7) TM. L = markers base pairs. C = negative control strip PCR. β-actin was used as positive internal controls in RT-PCR.

Fig. The expression of BMP in human ONH astrocytes, the tissues of the ONH and astrocytes of the human brain. Painted bromide by ethidium agarose gel of PCR products from cDNA samples obtained in the analysis of RT-PCR the expression of BMP in human ONH astrocytes (lanes 1-5), the tissues of the ONH (lane 6) and astrocytes of human brain (lane 7). L = markers base pairs. C = negative control strip PCR. β-actin was used as positive internal controls in RT-PCR.

Fig.9. The expression of BMP in the lines of human cells in the ethmoid cavity of the sclera. Painted bromide by ethidium agarose gel of PCR products from cDNA samples obtained in the analysis of RT-PCR of human cells in the ethmoid cavity sclera (lanes 1-9). L = markers base pairs. C = negative control strip PCR. β-actin was used as positive internal controls in RT-PCR.

Figure 10. The expression of BMP-receptor in human ONH astrocytes, the tissues of the ONH is the astrocytes of the human brain. Painted bromide by ethidium agarose gel of PCR products from cDNA samples obtained in the analysis of RT-PCR the expression of BMP receptors in astrocytes in the optic nerve head of a man (ONA) (lanes 1-5), ONH tissue (lane 6) and astrocytes of human brain (lane 7). L = markers base pairs. C = negative control strip PCR. β-actin was used as positive internal controls in RT-PCR.

11. The expression of BMP receptors in human cell lines ethmoid cavity of the sclera. Painted bromide by ethidium agarose gel of PCR products from cDNA samples obtained in the analysis of RT-PCR of human cells in the ethmoid cavity sclera (lanes 1-9). L = markers base pairs. C = negative control strip PCR. β-actin was used as positive internal controls in RT-PCR.

Fig. Western Western blot turns of expression of BMP and BMP receptor in cultured human TM cells, the astrocytes in the optic nerve head (ONA) and the cells of the ethmoid cavity of the sclera. Chemiluminescent detection of BMP-proteins and BMP receptors in human cells of the trabecular network (lanes 1-2), ONH astrocytes (lanes 3-4) and cells of the ethmoid cavity sclera (lanes 5-6). The mass of the proteins are indicated in kDa.

Fig. Expression of mRNA associated with BMP proteins in human glue is under TM. Painted bromide by ethidium agarose gel of PCR products from cDNA samples obtained in the analysis of RT-PCR of human TM cells (lanes 1-5). L = markers base pairs. C = negative control strip PCR. β-actin was used as positive internal controls in RT-PCR.

Fig. Expression of mRNA associated with BMP proteins in human cells ethmoid cavity sclera and ONH astrocytes. Painted bromide by ethidium agarose gel of PCR products from cDNA samples obtained in the analysis of RT-PCR cells ethmoid cavity sclera (LC) (lanes 1-7) and ONH astrocytes (lanes 8-11). L = markers base pairs. C = negative control strip PCR. β-actin was used as positive internal controls in RT-PCR.

Fig. Illustration of enhanced expression of the BMP antagonist of the gremlin (CTSF1B1) in TM cells in glaucoma. Gene expression was evaluated using a set of genes Affymetrix (gene chip U133 Affymetrix).

A detailed description of the preferred embodiments

It has been suggested that trabecular network plays an important role in the movement of the ocular fluid in the norm, and it is believed that it is the main place of resistance to outflow in the eye with glaucoma. Cells of the trabecular network of the person (NTMs) are specialized cells that form channels for the outflow, which eye fluid exits the eye. Modified synthetic function of cells may participate in the pathogenesis of POAG, steroid glaucoma and other types of glaucoma.

Despite years of intensive research, the exact molecular mechanism responsible for eye damage resulting from glaucoma remains unknown. In recent studies it has been suggested that growth factors may be important in maintaining normal homeostasis in tissues of the eye associated with the development of glaucoma, and changes in growth factors/receptors of growth factors may play a role in the pathogenesis of glaucoma. Growth factors represent a very large family of polypeptides that regulate the growth and differentiation of cells. These molecules have different specific cell effects in relation to gene expression, composition and deposition of extracellular matrix, cytoskeleton organization and regulation of cell function. TM expresses a wide range of growth factors, receptors, growth factors (Tripathi et al., 1993a; Tripathi et al., 1993b; Tripathi et al., 1994a; Tripathi et al., 1994b; Wordinger et al., 1998; Wordinger et al., 1999), and neurotrophins/neurotrophic factors and their receptors (Liu et al., 2001; Wordinger et al., 2000). ONH astrocytes and cells of the ethmoid cavity sclera, two types of cells in the optic nerve head, Express factors R is a hundred, neurotrophins and their receptors (Lambert et al., 2001; Pena et al., 1999). Ocular fluid also contains various growth factors, including FGF2, EGF, TGFβ, HGH (Tripathi et al., 1996; Tripathi et al., 1991; Tripathi et al., 1992; Hu and Ritch, 2001), and neurotrophins (Chundru et al., 2000). It was reported about an increased level of TGFβ-2 and HGF in ocular fluid of patients with POAG (Tripathi et al., 1994c; Inatani et al., 2001; Picht et al., 2001). The growth factors may be involved in the development of glaucoma, altering the normal development and/or function of TM and ONH.

The present invention is partly from the idea that morphogenic proteins, bone (GIR) induce the formation of not only bone and cartilage, but are multifunctional cytokines, offering a wide range of effects on multiple cell types (Hogan, 1996; Reddi, 1997), and expressed as cells of the trabecular network (NTMs)and the optic nerve head (ONH) of the person (Wordinger et al., 2002). GIR are members of the superfamily of TGFβand a person has about 15-20 genes GIR, GIR 3-receptor and a number associated with BMP proteins that function as antagonists of BMP (Yamashita et al., 1996). GIR transmit a signal through a receptor complex consisting of BMPR-I and BMPR-II. It was reported that members of the TGF superfamily,β and TGFβR (Agarwal et al., 1997; Lambert et al., 1997) and GDNF and GDNFR (Wordinger et al., 1999; Liu et al., 1999) expressed as NTM cells and ONH.

BMP and BMP receptors are expressed in tissues g the Aza (Obata et al., 1999; You et al., 1999), but the previous messages were mainly related to the development of the eye. Function GIR is important for the development of the eye as directed gap genes encoding BMP in mice leads to severe defects in the retina and lens (Jena et al., 1997; Luo et al., 1995; Dudley et al., 1995). BMP-2, BMP-4 and BMP-7 participate in the development of the crystalline lens and retina (Jena et al., 1997; Furuta and Hogan, 1998; Reddi, 2000; Trousse et al., 2001). It turned out that BMP-6 and BMP-7 play a role in protecting neurons from damage caused by hypoglycemia or ischemia (Nonner et al., 2001; Liu et al., 2001), and it has been shown that BMP-2 increases the expression of neurotrophin in ganglion cells (Zhang et al., 1998). Heterozygous "knock-out" mouse haploidentical by Bmp4 have visual phenotypes, including dysgenesis of the anterior segment, increased IOP, and anomalies of the optic nerve (Chang et al., 2001). There is very limited published information regarding the role of BMP for the human eye in the postnatal period.

Mohan and colleagues (1998) reported that BMP-2-, BMP-4 and BMP-receptors expressibility in the cells of the cornea of an adult, and suggested that the functions of the BMP may include effects on the proliferation and apoptosis of keratocytes of the cornea. You and colleagues (1999) confirmed the results of this study and also reported the expression of BMP-3, BMP-5 and BMP-7 in terms ofex vivoand cultured cell is x of the corneal epithelium and stroma. They reported that the level of transcription of BMP was higher in the stroma, while the level of receptors was higher in cultured epithelial cells of the cornea.

Using RT-PCR, the authors present invention revealed mRNA GIR, GIR-receptors BMPR-IA, BMPR-IB and BMPR-II, as well as associated with BMP proteins bikes, hardina, follistatin and Bambi in NTM, ethmoid cavity sclera (LC) and cell lines of astrocytes and tissues of the ONH (Wordinger et al., 2002). In addition, the authors of the present invention found that NTM cells and ONH Express proteins BMP-2, BMP-4, BMP-5 and BMP-7.

Glaucoma can be diagnosed by the detection of genetic alterations in the genes of members of the signal collection GIR. In the sense in which they are used here, the expression "gene, a member of the family of morphogenic proteins, bone and signal collection BMP" refers to BMP, BMP-receptors and associated proteins. The term "genetic modification" is well known to specialists in this field. There are numerous examples of diseases associated with genetic changes in certain genes (see examples in Cummings, 1997; Strachan et al., 1996; Jorde et al., 1999). Genetic changes in a particular gene (e.g., BMP) can be determined using various methods well-known to specialists in this field, such as SSCP, DGGE, ASO, RFLP, heteroduplex analysis, CCM, PTT and split the s-RNase (see Birren et al., 1998).

Glaucoma can be caused by the altered expression of one or more genes of the family of GIR in the eye, which leads to increased IOP and/or neuropathy of the optic nerve in glaucoma. "Altered gene expression BMP" means the expression product of this gene, which is different from that of the norm. The term may also refer to changes in gene sequence or protein. Gene GIR in the norm has been well characterized (see above), and reported the expression of BMP in various tissues, including TM and ONH. Genetic changes in the coding region of the genes of the family GIR can change the function of these proteins. Genetic mutations outside the coding region also may lead to glaucoma.

Specialists in this field it is well known that "change out" the coding region of a particular gene are important for regulating gene expression. For example, it is known that the area above (5') of the coding region of most genes serves as a promoter region, which promotes and regulates the expression of this gene. The promoter region contains numerous nucleotide sequences recognized by various transcription factors and DNA-binding proteins, which are responsible for activation or suppression of gene expression. The lower pane (3') of the gene can also determine polyadenylic the Finance gene product, thereby regulating RNA processing and translation of the gene product.

Altered expression of BMP genes or mutations in the sequence of genes, which indicates the presence of glaucoma can be detected using methods well known to specialists in this field. For example, it is envisaged that it is possible to use the fragment of the nucleic acid of practically any length, at full length, it is preferable to limit the ease of production and use in the targeted Protocol. Nucleic acid sequence disclosed herein may also be used as probes or primers in the embodiments of the hybridization of nucleic acids. If so, then it is assumed that nucleic acid segments that comprise a region of the sequence consisting of the sequence of at least 14 contiguous nucleotides that have the same sequence or complementary sequence of 14 contiguous nucleotides BMP-2A (SEQ ID NO:1), BMP-4 (SEQ ID NO:3), BMP-5 (SEQ ID NO:5), BMP-7 (SEQ ID NO:7), BMP-RIA (SEQ ID NO:37), GIR-RIB (SEQ ID NO:39), BMP-RII (SEQ ID NO:41), hardina (SEQ ID NO:43), gremlin (SEQ ID NO:45), follistatin (SEQ ID NO:47) or Bambi (SEQ ID NO:53), will be of particular applicability. In some embodiments can be used contiguous identical or complementary sequences of greater length, for example, from about 20, 30 40, 50, 100, 200, 500, 1000 nucleotides (including all sequences with intermediate lengths) and up to a full-sized sequences of about 1547 nucleotides (BMP-2A), 1946 nucleotides (BMP-4), 2153 nucleotides (BMP-5) and 1878 nucleotides (BMP-7), 2932 nucleotides (for BMP-RIA), 2032 nucleotides (for BMP-RIB), 3611 nucleotides (BMP-RII), 3561 (hardina), 4049 nucleotides (for bikes), 1386 nucleotides (for follistatin) and 1523 nucleotides (Bambi).

It is easy to understand that the "sequence with intermediate lengths", in this context, means any length between the stated limits, such as 14, 15, 16, 17, 18, 19, 20 etc.; 21, 22, 23, etc., 30, 31, 32, 50, 51, 52, 53, etc., 100, 101, 102, 103, etc., 150, 151, 152, 153, etc. including all integers in the range 200-500, 500-1000, 1000-2000, up to and including sequences from 2001, 2002, 2050, 2051 nucleotides and the like.

The ability of such nucleic acid probes and primers to specifically gibridizatsiya with coding sequences GIR and primers for specific amplification of sequences GIR will allow you to use them to detect the presence of complementary sequences in a given sample. However, provided other applications, including application information sequencing to obtain mutant primers or primers for other genetic constructions.

The nucleic acid molecules having the sequences pane, consisting of patches of contiguous nucleotides in length 10, 20, 30, 50 and even of 100-200 nucleotides or so, identical or complementary to the sequences of BMP-2A (SEQ ID NO:1), BMP-4 (SEQ ID NO:3), BMP-5 (SEQ ID NO:5), BMP-7 (SEQ ID NO:7), BMP-RIA (SEQ ID NO:37), BMP-RIB (SEQ ID NO:39), GIR-RII (SEQ ID NO:41), hardina (SEQ ID NO:43), gremlin (SEQ ID NO:45), follistatin (SEQ ID NO:47) or Bambi (SEQ ID NO:53), especially suitable for use as probes for hybridization, for example, when assessing SNP and tests hybridization on a solid phase, in addition to the southern - and Northern-blotting. This will allow for the analysis of structural and regulatory genes GIR in tissues and cells. The total size of the fragment, and the size of the complementary area(s), ultimately will depend on the intended application of a particular segment of nucleic acid. Smaller fragments will generally be used in hybridization, when the length of the contiguous complementary region may be varied, for example, within about 10 to about 100 nucleotides, but you can use larger adjacent complementary areas up to approximately 1547 nucleotides (BMP-2A), 1946 nucleotides (BMP-4), 2153 nucleotides (BMP-5) and 1878 nucleotides (BMP-7), 2932 nucleotides (for BMP-RIA), 2032 nucleotides (for BMP-RIB), 3611 nucleotides (for BMP-RII), 3561 (lahardane), 4049 nucleotides (for bikes), 1386 nucleotides (for follistatin) and 1523 nucleotides (Bambi) nucleotides, respectively, to the length complementary sequences, which it is desirable to detect.

When using the probe for hybridization length of about 10-14 nucleotides forms a duplex molecule that is both stable and selective. Molecules with adjacent complementary sequences to areas longer than 10 bases are generally preferred, though, to increase stability and selectivity of the hybrid, and thereby improve the quality and degree received specific hybrid molecules, as a rule, it is preferable to construct molecules of nucleic acids with complementary sites for genes consisting of 15-20 contiguous nucleotides or, if necessary, longer.

Probes for hybridization can be selected from any part of any of the sequences disclosed here. All that is required is to review the sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47 or SEQ ID NO:53 and choose any contiguous sequence length of about 10 nucleotides and up to the full sequence, which is desirable for use as a probe or primer. When in the bore of the sequences of probes and primers can be guided by various factors, just as an example, for example, it is desirable to use the primers to the ends of a sequence, or from all functional coding domain sequences for subsequent DNA amplification.

The method of selection and obtain a segment of nucleic acid that includes a contiguous sequence from the sequences of BMP-2A (SEQ ID NO:1), BMP-4 (SEQ ID NO:3), BMP-5 (SEQ ID NO:5), BMP-7 (SEQ ID NO:7), BMP-RIA (SEQ ID NO:37), BMP-RIB (SEQ ID NO:39), BMP-RII (SEQ ID NO:41), hardina (SEQ ID NO:43), the gremlin (SEQ ID NO:45), follistatin (SEQ ID NO:47) or Bambi (SEQ ID NO:53), an alternative can be defined as obtaining a fragment of nucleic acid. Of course, the fragments can also be obtained by other methods, such as, for example, mechanical hydrodynamic fragmenting DNA or cleavage by the restriction enzyme. Small segments or fragments of the nucleic acid can be easily obtained, for example, directly synthesizing the fragment by chemical means, as it is widely spread in practice, using an automatic synthesizer of oligonucleotides. In addition, fragments can be obtained by application of the methods of reproduction of nucleic acid, such as PCRaccording to U.S. patent No. 4683202 and U.S. patent No. 4682195 (each is included here for information), by introducing selected sequences into recombinant vectors for recombinant PR the products, and other methods of recombinant DNA, are well known to specialists in the field of molecular biology.

Therefore, the nucleotide sequence according to the invention can be used on their ability to selective formation of duplex molecules with complementary regions of genes or cDNA GIR. Depending on the intended approach will be desirable to use different degrees of selectivity of hybridization to achieve varying degrees of selectivity of probe towards target sequence. For applications requiring high selectivity, as a rule, it is desirable to use a relatively hard conditions for the formation of hybrids, for example, it is necessary to choose conditions with relatively low salt concentration and/or high temperatures, such as are provided when using 0.02 to 0.15 M NaCl at temperatures of 50 to 70°C. In such conditions, there is little, if at all it exists, the probability of an incorrect mating of the probe and the matrix circuit or target, and they are particularly suitable for studies of genes GIR.

Of course, for some applications, for example when it is desirable to obtain or identify mutants using a chain mutant primer, hybridizing with the underlying matrix, or when it is necessary to allocate the coded sequence is GIR from similar species functional equivalent variants, and the like, typically require less stringent conditions of hybridization to form heteroduplex. In these circumstances, it may be desirable to use such conditions as salt concentration of 0.15-1.0 M at a temperature in the range of about from 20 to 55°C. thereby, it is possible to easily identify cross-species hybridization as a positive hybridization signals with respect to control hybridizations. In any case, in General, provided that the conditions can be made more rigid at lower NaCl concentration or the addition of increasing amounts of formamide, which serves to destabilize the hybrid duplex in the same way as the raised temperature. Thus, you can easily manipulate the hybridization conditions, and, thus, there is a method of choice depending on the desired results.

In some embodiments be preferential to use the nucleic acid sequences of the present invention in combination with suitable means, such as a label, for determining hybridization results. This area is known for a variety of appropriate indicator means, including fluorescent, radioisotopic, enzymatic or other ligands, such as avidin/Biotin, which are capable of vos is proizvoditel the detected signal. In the preferred embodiments, it is desirable to use a fluorescent label or an enzyme tag such as urease, alkaline phosphatase or peroxidase, instead of radioactive or other undesirable environmental agents. In the case of enzymatic labels known indicator substrates for colorimetry that can be used to provide a means visible to the human eye or can be detected by spectrophotometry, to identify specific hybridization with samples containing complementary nucleic acids.

In General it is envisaged that the probes for hybridization described herein are suitable as reagents for hybridization in solution, and in embodiments using a solid phase. In embodiments with the solid phase of the analyzed DNA (or RNA) is adsorbed or otherwise fixed on the selected matrix or surface. Then this fixed single-stranded nucleic acid is subjected to specific hybridization with selected probes in the desired conditions. The selected conditions will depend on the particular circumstances based on specific required criteria (based, for example, from the content of G+C, type nucleic acid target, source of nucleic acid, size of the probe for hybridization, and so on). After washing guy who editando surface to remove nonspecific related molecules of the probe, spend the detection of specific hybridization, or even quantify, using the label.

Also it should be understood that this invention is not limited to the specific nucleotide and amino acid sequences of BMP-2A (SEQ ID NO:1), BMP-4 (SEQ ID NO:3), BMP-5 (SEQ ID NO:5), BMP-7 (SEQ ID NO:7), BMP-RIA (SEQ ID NO:37), BMP-RIB (SEQ ID NO:39), BMP-RII (SEQ ID NO:41), hardina (SEQ ID NO:43), the gremlin (SEQ ID NO:45), follistatin (SEQ ID NO:47) or Bambi (SEQ ID NO:53). Thus, recombinant vectors and selected segments of DNA may include the coding region GIR themselves, "upper" or "lower" genes encoding region, bearing selected alterations or modifications of the basic coding region, or they may encode larger polypeptides that nevertheless include coding region GIR, or can encode biologically functional equivalent proteins or peptides that have variant amino acid sequences.

The DNA segments of the present invention include biologically functional equivalent proteins and polypeptides GIR. Sequence data can be obtained as a result of codon redundancy and functional equivalency that are known to occur under natural conditions in the nucleic acid sequences and the proteins they encode. Alternatively, functionally equivalent belkhiri polypeptides can be obtained using recombinant DNA technology, with the help of which you can make changes in the protein structure, based on properties of the amino acids that are replaced. Designed by human beings changes can be entered using the methods of site-directed mutagenesis, for example, to increase the antigenic properties of the protein or to test mutants GIR for research linking activity at the molecular level.

Therapeutic agent for the treatment of glaucoma may be a peptide or protein, peptidomimetic, the oligonucleotide or derivateservlet the oligonucleotide, or small similar drug drug molecule that act on one or more sides of the visual pathways involving GIR. Preferred therapeutic means are: (1) agonists BMP-2, BMP-4, BMP-5 and BMP-7; (2) antagonists hardina, bikes, follistatin or Bambi; and/or (3) agonists Smad1, Smad5 and/or Smad4.

The tool can be typed directly in the eye (for example, in the form of eye drops or ointments for topical use; devices with a slow release in a blind pouch or implanted near the sclera or within the eye; through periocular, conjunctival, teanaway the fascia in the camera or in the vitreous body injection) or parenteral (e.g., orally, via intravenous, subcutaneous or nutribase the Noah injection; through the skin and so on) using methods well known in the field. Subsequent presents examples of possible compositions embodied in this invention.

(a) the Ophthalmic composition for local usewt.%
The tool, which increases the expression of BMP-4 in the eye0.01 to 2
A receiver array0,5
Sodium chloride0,8
YOU0,01
EDTA0,01
NaOH/HClto pH 7.4
Purified waterto 100 ml
(b) the Ophthalmic composition for local usewt.%
The antagonist gremlin0.01 to 2
A receiver array0,5
Sodium chloride0,8
YOU0,01
EDTA0,01
NaOH/HClto pH 7.4
Purified waterto 100 ml
(C) the Ophthalmic composition for local usewt.%
Agonist Smad 1/50.01 to 2
A receiver array0,5
Sodium chloride0,8
YOUEDTA0,01
NaOH/HClto a pH of 7.2
Purified waterto 100 ml

Additionally it is envisaged that the compounds according to the invention can be prepared in the form of devices for intraocular delivery.

A. Analysis of therapeutic agents

This invention is also suitable for the discovery of new therapeutic agents against glaucoma, which participate in the transmission of signals from the BMP (see figure 5). Selective BMP ligands bind to BMP-receptor serine/trionychinae type I and type II (GIR-RI and BMP-RII) and transmit a signal through Smad proteins. The signal GIR extends through Smad protein-protein and protein-DNA interactions (Attisano and Tuen Lee-Hoeflich, 2001). Regulatory proteins Smad1 and Smad5 are activated (through phosphorylation) associated with the BMP ligand-receptor (Bubnoff and Cho, 2001). Then the data regulatory proteins interact with Smad Smad4 education heteromera complex moves into the nucleus. This complex is able to activate or repress transcription of selective genes that recognize this transcriptional complex depending on what nuclear cofactors are present.

The transmission signals with the participation of the BMP/Smad negatively regulated by several mechanisms. Some of the s BMP-binding proteins (such as the gremlin, BABMI or follistatin) bind BMP and inhibit their interaction with BMP receptors. In addition, there are inhibiting Smad proteins (for example, Smad6 and Smad7)that bind and inactivate BMP receptors (Kowabata et al., 1998; Itoh et al., 2000; Miyazono, 2000). The authors of the present invention have found that human TM cells, ONH astrocytes and cells of the ethmoid cavity sclera Express mRNA and protein for BMP receptor complex. Thus, these cells can give response to endogenous BMP ligands.

For the discovery of new therapeutic agents against glaucoma can use a variety of methods, and these methods are well known to specialists in this field. For example, tools based on peptides or peptidomimetics, which act as agonists or inhibitors GIR, you can install using molecular modeling BMP/BMP-retseptornyh structures (Nickel et al., 2001). The signal transmission part GIR includes constituency Smad-proteins (Kawabata et al., 1998; Itoh et al., 2000; Attiseno et al., 2000). Election BMP agonists and agonists Smad can be detected using cell tests. The test cell must Express the appropriate BMP-receptor(s) and arrange appropriate by the transmission signal with the participation of GIR. Since the main effects of signal transmission GIR is changing expre the FIC gene, the BMP agonists and agonists Smad you can detect when the screening BMP-induced genes. The induction of regulated BMP genes also can be measured by quantification of mRNA levels using quantitative RT-PCR (Wang et al., 2001), microsoftupdate DNA or structures reporter gene. There are natural inhibitors of signal transmission involving GIR, GIR-binding proteins (known to be associated with BMP proteins) such as hordin, gremlin and follistatin. Antagonists inhibitors of protein can be detected using tests of binding ligand. For example, the analyzed agents can be added to purified recombinant gremlin, and to identify those agents that will connect with the gremlin, using a variety of methods known to experts in this field. To determine whether these agents are antagonists of gremlin, use the cellular test, similar to that described above.

It is assumed that in combination with the present invention can use any known model of screeningin vitroandin vivoto identify new medicines for glaucoma, with the impact on the family genes GIR. Such models are well known to specialists in this field and their putting into practice is common. Small peptides or pepti is mimetico can be constructed, based on the knowledge about the structure/function GIR, BMPR and/or gene products that bind to the BMP proteins. You can use the test binding of a ligand to detect small molecules that bind to BMP, BMPR, or proteins that bind to the BMP. When setting cell tests can detect the effect of various agents on the transmission path of the signal with the participation of GIR. You can get cell line "Nokin, including the promoters of the genes of the family GIR associated with a reporter gene to detect tools that modify the expression of a member of the BMP gene family. These tests can be used to identify a molecule agonists and antagonists. Testsex vivosuch as the cultivation of anterior segments of human eyes when perfusion (Clark et al., 1995a; Pang et al., 2000), can be used to study the effects of money on IOP and signal transmission with the participation of GIR in the tissue of the TM. You can create models of glaucoma in rodents using well-known methods to generate stable transgenic member of the family GIR, without the "knock-out" or "nacinovich" strains of mice and rats. The data model in rodents can be used for screening tools that change glaucomatous phenotype(s) (for example, using tonometry determine the effect on IOP, using histology to assess the impact on Nar is the psychology of vision in glaucoma).

Century Sets

The present invention provides methods, compositions and kits for early detection of glaucoma. The kits can include a nucleic acid segment that encodes a polypeptide or protein is BMP. The kit may further include reagents for detecting the interaction between the sample and the nucleic acid or peptide of the present invention. Provided the reagent may include a radioisotope, a fluorescent or enzymatic label. The set can contain known labeled with a radioisotope, the agent has the ability to communicate or interact with nucleic acid or peptide, or protein of the present invention.

The reagent kit may be provided in the form of a liquid solution, associated with a solid substrate or in the form of a dry powder. Preferably, when the reagent is provided in a liquid solution, in this case, the liquid solution is an aqueous solution. Preferably, when the provided reagent bound to a solid substrate, in this case, the solid substrate can be a medium for chromatography, analytical tablet, with many holes, or microscopic glass. When the provided reagent is a dry powder, the powder can be restored by adding a suitable solvent, which can also be set.

In yet additional embodiments of the present invention relates to diagnostic methods and related kits for the diagnosis of glaucoma. It is assumed that associated with BMP peptides and nucleic acids of the invention can be used for detection of polymorphisms or mutations in nucleic acids GIR from patient samples. Basically these methods will include in the beginning obtaining a sample suspected the presence of a polymorphism or mutation, contacting the sample with a peptide or nucleic acid of the present invention under conditions effective for the formation of the complex and then detecting the presence of the complex.

Basically, the detection of complex formation is fairly well known in this field and it can be done using different approaches. For example, the present invention provides for the use of ELISA, RIA, methods, indirect fluorescence, and the like. Typically, the formation of the complex is detected using a label such as a radioactive label or an enzyme label such as alkaline phosphatase, horseradish peroxidase, and the like). Of course, you can find additional advantages of using secondary binding ligand.

The following examples are representative of the techniques used by the inventors for implementing aspects of the present invention. Despite the fact that these methods are examples of preferred embodiments in practice and is gaining, specialists in this field in the light of the present description should be understood that it is possible to make numerous modifications without departing from the nature and intended scope of the invention.

Example 1

Cell culture:human TM cells and ONH cells were obtained from eye donors as described (Steely et al., 1992; Steely et al., 2000; Wilson et al., 1993; Clark et al., 1994; Clark et al., 1995b; Clark et al., 1995c; Clark et al., 1996; Clark et al., 2001a; Clark et al., 2001b; Dickerson et al., 1998; Wordinger et al., 1998; Wordinger et al., 1999; Wordinger et al., 2000; Wordinger et al., 2002; Lambert et al., 2001; Agarwal et al., 1999; Liu et al., 2001). The TM cells were cultured from explants of TM from donors ranging in age from 6 days to 90 years. Astrocytes in the optic nerve head cells and ethmoid cavity sclera (LC) the person received from carefully prepared heads optic nerve (donors aged from 2 days to 90 years) and characterized as previously described (Lambert et al., 2001; Clark et al., 1995a). Cells were cultured to confluence in the following environment: environment ham F10 (JRH Biosciences, Lenexa, KS)containing 10% fetal bovine serum (FBS) (HyClone, Logan, UT) and antibiotics (Gibco BRL-Life Technologies, Grand Island, NY) for cells TM; modified by Dulbecco Wednesday Needle (DMEM, HyClone)containing 10% FBS for cell LC; and the medium for culturing astrocytes (AGM, Clonetics, San Diego, CA)containing 5% FBS for ONH astrocytes.

RT-PCR:fabric TM and ONH also dissected from the eyes of donors (Wordinger et al., 1998; Wang et al., 2001). The total fraction R of The To was isolated from cells and tissues TM and ONH using extraction with TRIzol (Gibco BRL-Life Technologies), and cDNA was obtained by reverse transcription using conventional methods (Wordinger et al., 1998; Wordinger et al., 1999; Wordinger et al., 2000; Wordinger et al., 2002). Primers for PCR were designed using the software Oligos 4,0 (see pairs of primers in table 1). All pairs of primers were designed so that the amplification of potentially contaminated sequences genomic DNA was obtained PCR products, mRNAs that were significantly greater than anticipated, because intron sequences that were cut during processing RNA was included in the genomic DNA. The PCR primers β-actin AGGCCAACCGCGAGAAGATGACC (top) and GAAGTCCAGGGCGACGTAGCAC (bottom) when the annealing temperature 55°gave a PCR product size of 350 BP

The PCR reaction was performed as described (Wordinger et al., 1998; Wordinger et al., 1999; Wordinger et al., 2000; Lambert et al., 2001; Wordinger et al., 2002) using Taq Start Antibody Hot Start under the following conditions, cycles: 2 min at 94°C, 2 min at 92°and 40 cycles for 30 seconds at the optimum temperature of annealing, extension for 90 seconds at 72°and denaturation for 45 seconds at 92°C. Amplificatoare PCR products were analyzed by horizontal electrophoresis in a 1.5% agarose gel. To ensure the specificity of the products of RT-PCR was performed southern blotting with probes designed using Oligo 4.0, which is hybridized with a region in amplificatoare the PCR product. The PCR products sequenced is to confirm the specificity of PCR reactions. Table 2 presents the members of the family GIR, which is expressed in TM and ONH person.

Table 2< / br>
Family members GIR, expressed in TM and ONH man
Member of the family GIRTrabecular networkThe head of the optic nerve
BMP-2++
BMP-4++
BMP-5++
BMP-7++
BMPR-IA++
BMPR-IB++
BMPR-II++
Hordin++
Gremlin++
Follistatin++
Bambi++
Noggin--
CER-1--

Western Western blot turns:protein was extracted from cultured cells using lyse buffer, and proteins were separated by polyacrylamide gel electrophoresis under denaturing conditions before electrophor the political transferred to nitrocellulose membranes (Lambert et al., 2001). The membrane was blocked with 5% milk (GIR) or 3% gelatin (BMPR) and incubated with the following primary antibodies against: BMP-2, BMP-4, BMP-5, BMP-7 (all productions Santa Cruz, Santa Cruz, CA) or BMP-RIA, BMP-RIB, BMP-RII (produced by Jackson Measurement Research, West Grove, PA). Membranes were washed, incubated with secondary antibodies (goat anti-mouse IgG-horseradish peroxidase antibodies to BMP, Santa Cruz; donkey anti-goat IgG-horseradish peroxidase antibodies to BMP-retseptorov, Jackson Measurement Research), and showed using a chemiluminescent system for immunodetection WesternBreeze (Invitrogen, Carlsbad, CA).

The expression of mRNA of BMP, BMPR in human cells and tissues TM:amplification products of the proposed size for primer pairs BMP-2, BMP-4, BMP-5 and BMP-7 in human cells and tissues TM presented on Fig.6. When setting southern blotting using specific probes was confirmed that these were the expected PCR products. All human cell lines and tissues TM expressed mRNA for BMP-2, BMP-4 and BMP-7. However, the level of mRNA for BMP-5 was low until undetectable in samples of tissue TM humans (6, lanes 6 and 7). Control reactions without cDNA did not give amplification products, which indicates that the reagents and primers were not contaminated with DNA or RNA (6, lane C).

7 shows amplification products predpolagaemoj the size for primer pairs BMP-RIA, BMP-RIB, and BMP-RII in cells and tissues TM person. All human cells and tissues TM expressed mRNA for BMP receptor complexes. When setting southern blotting using specific primers was confirmed that these were the expected PCR products. In PCR reaction with BMP-RII were detected alternative amplification product (350 BP). Alternative amplification product was present in all cells and tissues TM person. This alternative band identified to determine whether it meets the alternative splanirovannaya form of the receptor. Control reactions without cDNA did not give amplification products (7, lane C), which indicates no contamination of reagents and primers DNA or RNA.

The expression of mRNA of BMP and BMP receptor in human cells and tissues of the ONH:amplification products of the proposed size for primer pairs BMP-2, BMP-4, BMP-5 and BMP-7 in human ONH astrocytes and tissues of the ONH presented on Fig. All ONH astrocytes and fabric ONH expressed mRNA for the appropriate BMP. Astrocytes of human brain was used as positive control cell line. When setting southern blotting using specific probes was confirmed that these were the expected PCR products. With the exception of BMP-2 all other BMP of expr who was Skaroulis astrocytes of human brain (Fig, band 7). Control reactions without cDNA did not give amplification products (Fig, lane C), which indicates that the reagents and primers were not contaminated with DNA or RNA.

Figure 9 shows the amplification products of the anticipated size for primer pairs BMP-2, BMP-4, BMP-5 and BMP-7 in cultured human cells LC. All cell lines LC expressed mRNA for each BMP. When setting southern blotting confirmed that they were expected PCR products. Control reactions without cDNA did not give amplification products (figure 9, lane C), which indicates that the reagents and primers were not contaminated with DNA or RNA.

The products of amplification of the expected size for primer pairs BMP-RIA, BMP-RIB, and BMP-RII in human ONH astrocytes and tissues of the ONH presented on figure 10. All cell lines of astrocytes and ONH tissue expressed mRNA for BMP-RIA and BMP-RIB. When setting southern blotting using specific probes was confirmed that these were the expected PCR products. Except ONH tissue (figure 10, lane 6), BMP-RII expressively all cell lines of ONH astrocytes. mRNA for all BMP receptors (figure 10, lane 7) expressives cell line astrocytes in the human brain, which served as a positive control. It turned out that there are differences in the expression of BMP-RII ONH tissue and cell lines ONH. Low expression in ONH tissue may reflect a low level of expression. Control reactions without cDNA did not give amplification products (figure 5, lane C), which indicates that the reagents and primers were not contaminated with DNA or RNA.

Figure 11 shows the amplification products of the anticipated size for primer pairs BMP-RIA, BMP-RIB, and BMP-RII in cultured human cells LC. All cell lines LC expressed mRNA for each BMP-receptor. When setting southern blotting using specific probes was confirmed that these were the expected PCR products. Control reactions without cDNA did not give amplification products (11, lane C), which indicates that the reagents and primers were not contaminated with DNA or RNA.

The expression of BMP-proteins and BMP-receptor proteins in human cells and tissues TM and ONH:on Fig presents the results of the detection of proteins BMP-2, BMP-4, BMP-5, BMP-7, BMP-RIA, BMP-RIB, and BMP-RII in human cells and tissues TM and ONH using chemiluminescent Western blot turns. All investigated cell lines expressed the corresponding proteins BMP. Proteins BMP were detected in the cell lines with the following values of molecular weight: 54-56 kDa for BMP-2, 25-27 kDa for BMP-4, 55-57 kDa for BMP-5 and 77 kDa for BMP-7. For BMP-2 and BMP-4 were detected many of the bands that are most ve is Aetna correspond to glycosylated and partially glycosylated forms of data GIR, as shown in other studies. However, the authors did not conduct studies on glycosylation, since they were outside the scope of this study. BMP-receptor proteins were detected in the cell lines with the values of molecular weight: 38 kDa for BMP-RIA, 64 kDa for BMP-RIB, and 57 kDa for BMP-RII. For BMP-RIB, and BMP-RII were detected multiple bands in the TM cells, which most likely correspond to glycosylated and partially glycosylated forms, as it follows from the results of other studies. It was found that the levels of protein expression by BMP receptors is lower in TM cells compared with cells ONH. For example, BMP-RII was not detected in the cells of the TM, and BMP-RIB was significantly reduced.

Expression of mRNA associated with BMP proteins in cultured human TM cells and human cells ONH:the products of amplification of the expected size for primer pairs of proteins associated with GIR in human cell lines TM presented on Fig. The human line TM expressed mRNA for DRM (gremlin), hardina, follistatin and NMA (BAMBI). When setting southern blotting using specific probes was confirmed that these were the expected PCR products. A clear difference in the mRNA expression between cell lines were absent. All investigated human TM cells not expressio the Ali mRNA for associated with BMP proteins of noggin and Cer-1. Control reactions without cDNA did not give amplification products, which indicates that the reagents and primers were not contaminated with DNA or RNA.

The products of amplification of the expected size for primer pairs associated with BMP proteins in ONH astrocytes and cell lines LC are presented on Fig. All ONH astrocytes and cell line LC expressed mRNA for DRM (gremlin), follistatin and NMA (BAMBI). When setting southern blotting using specific probes was confirmed that these were the expected PCR products. A large part of LC cells and ONH astrocytes expressed mRNA for Jordin. All investigated human ONH astrocytes and LC cells is not expressed mRNA associated with BMP proteins of noggin and Cer-1. Control reactions without cDNA did not give amplification products, which indicates that the reagents and primers were not contaminated with DNA or RNA.

On Fig shown increased expression of the BMP antagonist of the gremlin (CRTSF1B1) in TM cells in glaucoma. Gene expression was evaluated using a set of genes Affymetrix (gene chips U133A Affymetrix).

All compositions and/or methods disclosed and claimed in this document can be made and executed without undue experimentation in light of the present description. Although the compositions and methods according to this invention is described herein in the preferred form of the nutrient embodiments, specialists in this field, obviously, it is clear that you can make variations in compositions and/or methods, and the steps or sequence of stages of the method described herein, without departing from the concept, nature and scope of the invention. Specifically, obviously, it is clear that some of the tools that are close in chemical and structural attitude, can be used here instead of the means described herein to achieve similar results. It is assumed that all substitutions and modifications known to specialists in this field, are in accordance with the nature, scope and concept of the invention defined in the attached claims.

References

Subsequent references in the extent to which they provide examples of methodological and other details in addition to presented in this document, specifically included here for information.

Books

Other publications

1. A method of treating glaucoma, involving the administration to a patient in need this, the composition containing at least one agonist of BMP-4, where the composition is administered by direct delivery to the patient's eye.

2. The method according to claim 1, where the agonist of BMP-4 is administered through local eye drops.

3. The method according to claim 1, where the agonist of BMP-4 is administered through local eye ointment.

4. The method according to claim 1, where the agonist of BMP-4 is administered via a slow-release device, implanted in blind eye bag.

5. The method according to claim 1, where the agonist of BMP-4 is administered via a slow-release device implanted near the sclera of the eye.

6. The method according to claim 1, where the agonist of BMP-4 is administered via a slow-release device implanted inside the eye.

7. The method according to claim 1, where the agonist of BMP-4 is administered by injection.

8. The method according to claim 1 where the concentration of the agonist of BMP-4 in the composition is from 0.01 to 2%.



 

Same patents:

FIELD: medicine; ophthalmology.

SUBSTANCE: cytostatic agent is subconjuctive introduced. Agent introduced is added with 0.08% trypan blue solution in amount 0.05 ml. Introduced agent localisation is visualised. In case agent becomes localized in anterior chamber or escapes through conjunctive suture introduction is stopped. In case agent spreads under conjunctiva dose in required amount is introduced.

EFFECT: lower rate of complications caused by cytostatics introduction.

2 ex

FIELD: medicine; ophthalmology.

SUBSTANCE: carbonic anhydrase inhibitor is instilled. One day after medicamentous therapy started. Azopt therapy is combined with vasotonic massage of anterior ciliary arteries (ACA) that is transconjunctiva ACA effect using multiple alternation of their mechanical compression and decompression by vasotonometer.

EFFECT: higher efficiency of treatment of primary open-angle glaucoma and blood flow improvement of eye great vessel.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: Invention relates to ophthalmology, and can be used for treatment of glaucoma optic neuropathy. Dibicor in dose 0.5g two times a day during 1 month, then cortexin and retinalamin in dose 10 mg intramuscular every second day during 20 days are prescribed. Method allows to increase electrophysiological activity of visual analyser in patients with primary open-angular glaucoma due to pathogenically grounded successive application of said medications, on the first stage of treatment intracellular exchange in ganglionar cells of retina improves, then synaptic lesions and transmission of nerve impulse from retina to cortical centre of visual analyser are activated.

EFFECT: increase of electrophysiological activity of visual analyser in patients with primary open-angular glaucoma.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: method involves introducing anecortavi acetas at a dose of 3-15 mg in posterior juxtascleral injection or injection into vitreous body or as implant.

EFFECT: enhanced effectiveness of treatment.

18 cl, 5 dwg, 4 tbl

FIELD: organic chemistry, medicine, biochemistry pharmacy.

SUBSTANCE: invention relates to using the known 2-phenyl-substituted imidazotriazinone of the formula (I): (vardenafil) possessing improved properties as compared with other known inhibitors of phosphodiesterase-5 (PDE-5), such as sildenafil and tadalafil. Proposed compound is used for preparing drugs used in treatment of cardiac insufficiency.

EFFECT: valuable medicinal and biochemical properties of compound.

1 tbl

FIELD: medicine, ophthalmology, chemical-pharmaceutical industry, pharmacy.

SUBSTANCE: invention relates to design of ophthalmological agents of broad spectrum based on vegetable components, vitamins and trace elements. Agent for treatment of eye diseases comprises bilberry berries of sublimation drying, dihydroquercetin, beta-carotene, selexen, lutein, vitamins B1, B2, B6, B12 and zinc. Agent shows the effect of broad spectrum and possesses regenerating, tonic and regenerative effect being without irritating, allergizing, inflammatory and other undesirable effects, and excluding mechanical contact with eye surface.

EFFECT: valuable medicinal properties of agent.

5 cl

FIELD: medicine.

SUBSTANCE: method involves carrying out tonometry, patient examination in slit lamp light, determining filtration cushion size and relief, carrying out test with sterile air introduced under conjunctiva in operation zone in combination with glycocorticosteroid preparation. Filtration cushion height increasing and air entering the anterior chamber, diuretic drugs are prescribed and preparations inhibiting intraocular fluid secretion. Filtration cushion becoming flat, glycocorticosteroid preparations, enzyme preparations are introduced and antimetabolite is introduced under conjunctiva outside of operation field. Filtration cushion relief being variable and air passes into the anterior chamber, anti-inflammatory therapy, anti-proliferative treatment course, glycocorticosteroid and enzyme preparations are prescribed. Filtration cushion becoming flat, and air does not enter the anterior chamber, gonioscopy is carried out and surgical intervention zones are revised in the cases of open internal fistula and antibiotic of cytostatic activity is to be prescribed. Internal fistula being blocked, laser surgical intervention is carried out. Hypertension being persistent, anti-glaucoma intervention is carried out in another eyeball segment with antibiotic of cytostatic activity being applied.

EFFECT: enhanced effectiveness of treatment selection.

FIELD: organic chemistry, medicine, ophthalmology, pharmacy.

SUBSTANCE: invention relates to novel derivatives of benzo[g]quinoline of the formula (I): as a free base or acid-additive salt used in treatment of glaucoma and myopia, and to a method for their synthesis and a pharmaceutical composition. In compound of the formula (I) each A and B means hydrogen atom (H); X means -CH2; Y means sulfur atom (S); R1 means H or (C1-C4)-alkyl wherein this compound can be in form of a free base or acid-additive salt. Method for synthesis of compound of the formula (I) by claim 1 or its salt involves the conversion step of alkoxy-group in compound of the formula (II): wherein A, B, X, Y and R1 have values given in claim 1; R3 means (C1-C4)-alkyl to hydroxy-group, and conversion of synthesized compounds of the formula (I) to free base or its acid-additive salt.

EFFECT: improved method of synthesis, valuable medicinal properties of compounds and pharmaceutical composition.

7 cl, 1 ex

FIELD: medicine, ophthalmology.

SUBSTANCE: method involves administration of chitosan sponge with square up to 2 cm2 into sub-Tenon's space wherein chitosan sponge shows the deacetylation degree 98%, its molecular mass is 1000 kDa and it comprises 2.8 x 10-9 g of hyaluronic acid, 27.8 x 10-8 g of chondroitinsulfuric acid, 3.06 x 10-11 g of cattle serum growth factor and 7 x 10-9 g of heparin per 1 mm2 of chitosan sponge. Method provides stabilizing visual function, to improving vision and expanding vision field based on enhancing sensitivity of optic nerve as result of blood stream enhancing. Invention can be used in treatment of progressing glaucoma with non-stabilizing functions.

EFFECT: improved method of treatment.

1 tbl, 1 ex

FIELD: medicine, ophthalmology, medicinal biochemistry.

SUBSTANCE: invention relates to manufacturing ophthalmic composition used for reducing intraocular pressure. Invention proposes using inhibitors of glycogen synthase kinase-3. Proposed composition provides reducing intraocular pressure by increasing intraocular liquid efflux and to prevent loss of retina ganglion cells.

EFFECT: valuable medicinal properties of inhibitors.

19 cl, 6 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine and pharmacology and concerns application of [6-(4-(chlorfenil)-2,2-dimethyl-7-fenil-2,3-digidro-1H-pyrrolivin-5-il] of acetic acid for preparation of pharmaceutical composition for inhibition of gastral protonic pump, combination for treatment of inflammatory states and pharmaceutic composition for inflammatory states treatment.

EFFECT: provision of high efficiency of gastral protonic pump inhibition.

15 cl, 20 dwg, 3 ex

FIELD: medicine, pharmacology.

SUBSTANCE: invention relates to pharmaceutical combination including: i) antagonist AT-1 valsartan or its pharmaceutically acceptable salt in single day dose from approximately 20 mg to approximately 320 mg, and (ii) inhibitor NEP representing ethyl ether of N-(3-carboxy-1-oxopropyl)-(4S)-n-phenylphenylmethyl)-4-amino-2R-methylbutane acid or N-(3-carboxy-1-oxopropyl)-(4S)-n-phenylphenylmethyl)-4-amino-2R-methylbutanic acid or their pharmaceutically acceptable salt in a single day dose from approximately 20 mg to approximately 800 mg. In addition, invention relates to kit for treatment including said combination.

EFFECT: synergetic effect of hypertensia treatment when using said combination.

5 cl, 6 tbl, 7 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention concerns chemical pharmaceutical industry, particularly a combination including selective cyclooxygenase-2 (COX-2) inhibitor and epothilone. COX-2 inhibitor can be 5-methyl-2-(2'-chlor-6'-fluoranilino)phenylacetic acid or its pharmaceutically acceptable salt. The combination can be applied in treatment of precancerous colon lesions or colon cancer as well as other malignant diseases. The invention also claims consumer package including cyclooxygenase-2 inhibitor and epothilone with manual for simultaneous, separate or alternating application of the medications for proliferative disease treatment.

EFFECT: reduction of side effects during epothilone treatment.

12 cl, 8 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention concerns chemical pharmaceutical industry, particularly pharmaceutical administration forms with delayed liberation, containing at least one active peptide. The invention also concerns method for obtaining such forms, a kit containing liophilised peptide and water non-organic salt or acetate solution, and application of water non-organic salt or acetate solution in obtaining a pharmaceutical administration form sustaining continuous peptide liberation for a prolonged time.

EFFECT: prolonged liberation of active peptide due to the depot effect.

42 cl, 7 ex, 4 tbl

FIELD: medicine, pharmacology.

SUBSTANCE: invention relates to applying alpha-2-delta ligand to producing medicinal means for lower urinary tract symptoms treatment, except for urinary incontinence caused by HUB (hyperactive urinary bladder) and/or BHPG (benignant hyperplasia of prostate gland).

EFFECT: medicinal means has increased efficiency.

12 cl, 2 ex

FIELD: medicine, pharmacology.

SUBSTANCE: invention relates to pharmaceutical composition for senile osteoporosis, post-menopausal osteoporosis, bone fractures, bone transplant, and osteopenia or male osteoporosis treatment, that include effective therapeutic quantity, in amount 0.01 mcg/kg/day to 10 mcg/kg/day of compound 2-methylene-19-nor-20(S)-1α,25-dihydroxyvitamin D3, and effective therapeutic quantity, in amount 0.01 mcg/kg/day to 200 mcg/kg/day of selective estrogen receptor modulator, which bounds to estrogen receptor; the selective estrogen receptor modulator mentioned being chosen from the group comprising estrogen agonist, estrogen antagonist, or its pharmaceutically acceptable salt.

EFFECT: efficiency of medication is increased.

6 cl, 2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: invention relates to pharmacology and medicine, particularly: the set applied to treatment for thrombosis, which includes compound with formula and aspirin; pharmaceutical composition, which includes compound with formula (1) and aspirin; and application of pharmaceutical composition, which includes compound with formula (1), and pharmaceutical composition, which includes aspirin to treatment for thrombosis.

EFFECT: providing of increased thrombosis therapy efficacy.

6 cl, 1 dwg, 1 ex

FIELD: medicine; pharmacology.

SUBSTANCE: invention refers to method of residual lipoproteins producing inhibition by inhibition of HDL cholesteryl aether transport to chylomicron and/or VLDL, including introduction of composition with SeTr-inhibiting activity to patient for treatment of hyperlipidemia, arteriosclerosis or hyper(residual lipoprotein)emy where composition represents S-8{2-([[1-(2-ethylbutyl) cyclohexyl] carbonyl] amino) phenyl}-2-methylpropanethioat or methane sulfonate trans-(4-{[N-(2-{[N'-[3,5-bis(trifluoromethyl)benzyl]-N'-(2-methyl-2H-tetrazolum-5-yl)amino]-methyl}-5-methyl-4-trifluoromethylphenyl)-N-ethylamino] methyl} cyclohexyl) acetic acid, as active component.

EFFECT: improved efficiency of treatment.

8 cl, 2 ex, 10 tbl

FIELD: medicine; pharmacology.

SUBSTANCE: invention concerns a combination for proliferative disease treatment which contains antidiarrheal agent and epothylon derivative of formula (1) or epothylon derivative, method of diarrhoeia management, associated with epothylon introduction of formula (1), pharmaceutical composition, trade packing and medical product, including antidiarrheal agent and epothylon derivative.

EFFECT: compositions have improved efficiency.

9 cl, 6 ex

FIELD: medicine.

SUBSTANCE: invention refers to methods and compositions for treatment and/or prevention maintenance of infectious condition in liquid-containing organ or organ with natural external aperture. Composition includes antibacterial agent, and also, probably, other active agents, amphipathic oil which is soluble in water and insoluble in ethanol, microcrystalline wax and pharmaceutically acceptable nonaqueous carrier. The method of treatment is realised by introduction of a pharmaceutical composition in body through natural external aperture.

EFFECT: regarding composition, invention provides stability of the active agent against oxidising decomposition, low interfacial tension of composition, easy solubility in liquids, and short time of excretion; invention provides effective treatment and reduction of by-effects and toxicity.

61 cl, 12 ex

FIELD: medicine, endocrinology, pharmacology, pharmacy.

SUBSTANCE: invention relates to a pharmaceutical combined composition used for treatment or prophylaxis of hypertension in patients suffering with diabetes mellitus. The composition comprises AT1-antagonist valsartan or its pharmaceutically acceptable salt and calcium channel blocking agent or its pharmaceutically acceptable salt, and pharmaceutically acceptable carrier. The composition elicits synergistic effect and expanded spectrum effect.

EFFECT: improved and valuable medicinal properties of composition.

10 cl, 3 tbl

Up!