Peptide capable of binding with β and inhibiting biological activity of β in vitro and/or in vivo, application of peptide, pharmaceutical composition, dna sequence, dna structure, expression vector, host-cell and method of obtaining peptide

FIELD: chemistry.

SUBSTANCE: invention relates to genetic engineering, namely, to obtaining inhibitors of TGF-β1 and can be used in medicine. Obtained peptides are capable of binding with transforming growth factor TGF-β1 and are potential inhibitors of biological activity of TGF-β1, binding with this cytokine directly. Peptides are obtained by recombinant method using transformed host-cell, by cultivating host-cell in conditions which ensure production of the said peptide, and its separation. The invention allows for efficiently treatment of diseases or pathological disorders connected with hyperexpression or disregulated expression of TGF-β1.

EFFECT: possibility to efficiently treat diseases or pathological disorders connected with hyperexpression or disregulated expression of TGF-β1.

12 cl, 6 dwg, 4 tbl, 4 ex

 

The technical field to which the invention relates.

The invention generally relates to peptides capable of contact with transforming growth factor β1 (TGF-β1), and to the use of such peptides. In particular, the invention relates to peptides which inhibit the biological activity of TGF-β1 as a result of direct binding of TGF-β1, and to their use in the treatment of diseases or pathological disorders associated with overexpression or misaligned expression of TGF-β1.

The level of technology

TGF-β1 is glikoproteinom belonging to the superfamily of structurally related regulatory proteins (cytokines)that are included with one of the three isoforms described in mammals (TGF-β1, 2 and 3). The most common is the isoform TGF-β1, which consists of glycosilated 25 kDa, composed of two subunits connected by a disulfide bond. Amino acid sequence of human TGF-β1 is described by a number of authors, for example, Derynck K. et al., in "Human transforming growth factor-beta complementary DNA sequence and expression in normal and transformed cells", Nature 316 (6030), 701-705 (1985).

TGF-β1 is a molecule with a sequence that is highly preserved during evolution. Although its primary characteristic was the ability to induction of adhesion regardless of proliferation and morphology is of izmenenii in fibroblasts of rats, in subsequent studies revealed that TGF-β1 is a General inhibitor of proliferation of a wide range of cell types. This molecule is produced by various cell types and in different tissues, during all phases of cell differentiation. She has a wide range of biological effects by generating potency and often opposite effects relating to the development, physiology and immune response. In Spanish patent application ES 2146552 A1 can find information regarding the role of TGF-β1 in liver regeneration and differentiation, and in the development of liver fibrosis, and the impact of these molecules on the extracellular matrix.

To study the mechanism of action of TGF-β1 studied (literature data) interaction about ten proteins (membrane receptors and extracellular matrix proteins) with this cytokine.

On the other hand, due to the fact that there are many diseases or pathological disorders associated with overexpression or misaligned expression of TGF-β1, for example, fibrosis associated with loss of function of an organ or tissue, or surgical or aesthetic complications, it is interesting to find out what products are capable of inhibiting the biological activity of TGF-β1, because such products can potentially be used in the treatment of the human or animal to b is Ocharovanie pathological consequences of overexpression of this gene or misaligned expression of TGF-β 1.

It was used several strategies of inhibiting the biological activity of TGF-β1, which includes the use of: (1) specific neutralizing antibodies; (2) antisense oligonucleotide sequences of the gene encoding TGF-β1, which block its expression; or (3) soluble receptors for TGF-β1, which are similar to antibodies. The use of antibodies provides a complete and specific blocking this cytokine (TGF-β1), although some adverse effects are amplified as the presence in the blood of exogenous immunoglobulins, and the impact of the system blocking TGF-β1. In addition, the stability of immunoglobulin over time does not allow short-term control of the blocking activity of this cytokine. Antisense oligonucleotide sequences inhibit the production of TGF-β1 at the level of gene expression - this phenomenon can cause significant razregulyatsii all processes involving this cytokine.

Recently developed another strategy based on the use of peptides inhibiting the biological activity of TGF-β1. In this regard, in Spanish patent application ES 2146552 A1 describes some synthetic peptides originating from both TGF-β1 and its receptors, or proteins, the FPIC of the service to bind to TGF-β 1, and which can be used as inhibitors of the biological activity of TGF-β1.

The invention

The present invention generally relates to the problem of finding new compounds able to inhibit the biological activity of TGF-β1.

The present invention provides a solution based on the fact that the authors of the present invention has identified a number of peptides that have the ability not only to communicate with TGF-β1, but also to inhibit the biological activity of TGF-β1 through direct binding to it. Identification of some of these peptides with the use of technology libraries of peptide phage display, which allows you to identify peptides with a normal size in the range from 6 to 15 amino acids capable of binding with high affinity to TGF-β1, with subsequent quantification in in vitro and in vivo for their ability to inhibit the biological activity of TGF-β1. Other peptides were obtained by truncation peptides previously identified, using the technology of phage libraries.

Peptides capable of binding to TGF-β1, and in particular peptides, is capable of direct binding to TGF-β1 to inhibit its biological activity, are potentially useful for treating diseases and pathological disorders, is knitted with overexpression or misaligned expression of TGF-β 1. Similarly, peptides capable of binding to TGF-β1, are a tool for studying the biological role of TGF-β1 (aspect necessary to explain the regulation of various biological processes in many areas).

Thus, one aspect of the present invention relates to peptides capable of binding to TGF-β1. In the private and preferred embodiment, these peptides are also capable of inhibiting the biological activity of TGF-β1.

In another aspect, the present invention relates to pharmaceutical compositions containing at least one of these peptides.

In another aspect, the present invention relates to the use of these peptides for pharmaceutical compositions for treating diseases and pathological disorders associated with overexpression or misaligned expression of TGF-β1. Typical examples of such diseases or pathological disorders associated with overexpression or misaligned expression of TGF-β1, include fibrosis, associated with loss of function of an organ or tissue, as well as surgical and/or aesthetic complications.

In another aspect, the present invention relates to DNA sequences that encode these peptides.

In another aspect of the present invention is worn to the structure of DNA, containing a DNA sequence which encodes a peptide provided by the present invention.

In another aspect, the present invention relates to a vector containing this DNA sequence or structure of DNA.

In another aspect, the present invention relates to a cell host, such as transformed by a host cell that contains the specified design DNA or vector.

In another aspect, the present invention relates to a method for producing a peptide provided by the present invention, which includes the cultivation of these host cells under conditions allowing the expression of the indicated peptide, and, if desired, separation of the resulting peptide.

In another aspect, the present invention relates to the use of these DNA sequences and structures of the DNA in the production of vectors and cells for the treatment of diseases and pathological disorders associated with overexpression or misaligned expression of TGF-β1, using the technologies of gene therapy.

Brief description of drawings

1 schematically shows the position of the 15-amino acid (AA) peptide genetically fused with protein pIII on the surface of filamentous bacteriophage M13.

Figure 2 schematically shows the genetic position of insertion in the genome of the bacteriophage M13, which encodes a 15-AK p is ptid, and the position of the peptide in the sequence of the protein pIII.

Figure 3 schematically shows a selection of peptides based on the technology of biopanning". Biotinylated TGF-β1 immobilizerpower in Petri dishes containing streptavidin (via Biotin-streptavidin binding). Selected phages from the library based on the interaction between TGF-β1 and the peptides presented by the phages. Phages with low affinity to TGF-β1 was removed by washing. The phage remaining in the Petri dish, was suirable a lowering of pH. Phages were isolated and sequenced after three cycles of enrichment of phages with high affinity to TGF-β1 (see example 1) [Caption 3: "a library of phages representing 15-AA peptides; b: infection with E. coli (Kip) (amplification); c: purification of phages; "d": incubation of phage with lower concentrations of TGF-β1; "e": washing; "f": elution related phages (↓N); "g": the infected strain of E. coli; h: selection of positive colonies (tetracycline); "i": amplification of selected phages; and j: DNA sequencing (corresponding to the peptide) after three cycles of biopanning"].

Figure 4 represents the sample analog of the tree sequence among 15-AA peptides identified using a library of peptide phage display.

Figure 5 the graph shows the effect of the concentration of TGF-β1 on the growth of the cell line Mv-1-Lu, expressed nakoplenii titiraupenga thymidine in the number of pulses per minute (pulse/min).

6 is a chart Protocol induced acute liver damage (see example 3).

Detailed description of the invention

In one aspect the present invention relates to a peptide, hereinafter referred to as the peptide of the present invention, an amino acid sequence which contains from 3 to 15 consecutive amino acid residues of the amino acid sequence selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21 and 15 of SEQ ID NO:22, and their pharmaceutically acceptable salts.

The peptides of the present invention is able to communicate with TGF-β1. Some of these peptides are able to inhibit the biological activity of TGF-β1in vitroand/orin vivo.

The ability of the peptides of the present invention to contact with TGF-β1 can be defined in any suitable way, allowing to establish a binding between two molecules, for example, by affinity analysis, which includes ensuring contact of TGF-β1 with the test peptide under conditions that allow binding of the peptide with TGF-β1; and evaluation of the binding peptide and TGF-β1. In the private embodiment, it is possible to conduct an affine analysis using radioactively labeled TGF-β1, for example, che is otecheskii 125I-TGF-β1, as described in the ES 2146552 A1. Alternatively, the test peptide can be labeled component. In General, these varieties of affine analysis provide contact TGF-β1 (for example, immobilized in a Cup Petra blocked by streptavidin) with the tested peptide, affinity which you want to define, and the analysis of binding of the peptide with TGF-β1 after incubation for adequate incubation period. Peptides with low affinity to TGF-β1 was removed by washing, whereas peptides with high affinity remained associated with TGF-β1 and could be isolated by disrupting the molecular bonds between the two molecules (e.g., low pH). Through the test peptide at various concentrations of TGF-β1 or Vice versa, you can get an idea about the affinity of the test peptide to TGF-β1. Can be assessed and, if it is desirable to quantify the ability of the peptides of the present invention to inhibit the biological activity of TGF-β1in vitrousing the test of inhibition of growth of the cell line Mv-1-Lu on receiving these cell lines, proliferation which inhibited TGF-β1, of the pulmonary epithelium mink (see example 2).

Can be assessed and, if it is desirable to quantify the ability of the peptides Nast is asego of the invention to inhibit the biological activity of TGF-β 1in vivousing testing on animal models with acute liver injury caused by, for example, the influence of carbon tetrachloride (CCl4) (see example 3). It is known that acute liver damage causes a cascade of effects and physiological responses, including increased levels of TGF-β1, which in turn is responsible (among other effects) for the expression of type 1 collagen gene.

In the scope of the present invention includes pharmaceutically acceptable salts of the peptide of the present invention. The term "pharmaceutically acceptable salt" includes salts, which usually form metal salts or addition salts of the acids. The nature of salt is not crucial to ensure pharmaceutical acceptability. Pharmaceutically acceptable salts of the peptide of the present invention can be obtained from acids or bases (organic or inorganic), using conventional methods, well known to specialists in this field.

In the private embodiment, the present invention provides a peptide containing 3, 4, 5, b, 7, 8, 9, 10, 11, 12, 13, 14 or 15 consecutive amino acid residues of the amino acid sequence selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO20, SEQ ID NO:21 and SEQ ID NO:22, and their pharmaceutically acceptable salts.

In another private embodiment, the present invention provides a peptide selected from the group formed by the peptides identified by the sequences SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21 and SEQ ID NO:22, and their pharmaceutically acceptable salts.

In another private embodiment, the present invention provides a peptide selected from the group formed by the peptides identified by the sequences SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO: 27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35 and SEQ ID NO:36, and their pharmaceutically acceptable salts. These peptides contain from 9 to 14 consecutive amino acid residues of the amino acid sequence of a peptide identified as SEQ ID No:17, and was obtained by truncation of the indicated peptide (example 4).

In another private embodiment, the present invention provides a peptide selected from the group formed by the peptides identified as SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:33 and SEQ ID NO:34, and their pharmaceutically acceptable salts. The peptides identified as SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:11, SEQ ID NO:14 and SEQ ID NO:17, reavley the ability to inhibit the biological activity of TGF-β 1 asin vitroandin vivo; the peptide identified as SEQ ID NO:2, shows the ability to inhibit the biological activity of TGF-β1 onlyin vivo; while the peptides identified as SEQ ID NO:3 and SEQ ID NO:18, exhibit the ability to inhibit the biological activity of TGF-β1 onlyin vitro. The peptides identified as SEQ ID NO:33 and SEQ ID NO:34, exhibit the ability to inhibit the biological activity of TGF-β1in vitro.

For the source identification of peptides capable of contact with TGF-β1, was beneficial use technologies to attract libraries of peptide phage display, which allow you to define the peptides with high affinity binding to TGF-β1, and further quantitative determination ofin vitroandin vivotheir ability to inhibit the biological activity of TGF-β1. The sequence of these peptides that bind to TGF-β1, inhibition of the biological activity of TGF-β1in vitroorin vivooutput from the corresponding DNA sequence after various cycles of biopanning (usually 3 cycles). Using libraries of peptide phage display to identify inhibitors of some of the products described, for example, Chirinos-Rojas .L. et al., in Immunology, 1999, Jan. 96(1): 109-113; McConnell, S.J., et al., in Gene 1994, Dec. 30, 151 (1-2): 115-118; or Smith G.., Science, 1985, Jun. 14, 228 (4705): 1315-1317.

Thisway, the present invention provides a method for identifying peptides capable of binding to TGF-β1, which provides:

(i) the use of libraries of peptide phage display containing many filamentous phage, each genome contains a nucleotide sequence encoding a single peptide that is associated with the gene coding for the envelope protein of the phage (thus, each phage contains a separate peptide genetically fused with the envelope protein of the phage);

(ii) the selection by conducting analyses on the affinity of the phage-containing peptides, which bind with high affinity to TGF-β1; and

(iii) determining the sequence of the peptides associated with TGF-β1, on the basis of their respective DNA sequences introduced into the phage selected in step (ii), and which encode these peptides bind to the TGF-β1.

In the private embodiment, to obtain a 15-AA peptides capable with high affinity to contact TGF-β1, and also with potential inhibitory activity against the biological activity of the indicated cytokine, useful technology libraries of peptide phage display containing many filamentous phages (M13), each of which contains a different 15-AK peptide genetically fused with the envelope protein of the phage, etc the respect to the occasion, associated with the N-end envelope protein pIII. Thus, the phage is a surface with a 15-AK peptide in each of the 5 surface of protein molecules, while the DNA encoding the indicated peptide sequence is enclosed inside the phage. Libraries of phage sequence encoding the peptide is from a degenerate sequence with 20 natural amino acids in each of these 15 positions, so you can view 1,1×1012possible sequence of 15 amino acids in different phages. Physical 1:1 ratio between the peptide sequence and the DNA encoding it inside bacteriophage allows you to select from a wide range of variants of those sequences, which are specifically associated with TGF-β1. This process is carried out through the analysis of affine binding.

In the private embodiment, the analysis indicated affinity binding consists of a Protocol selectionin vitroknown as the "biopanning". Briefly, this technique involves incubation of the set of phages representing in terms of practice options 15-AA peptides (in this case)in a Petri dish, blocked with streptavidin and to which was added biotinylated TGF-β1. Thus, biotinylated TGF-β1 fixed on the Petri dish Biotin-streptase is in the binding, therefore, the interaction of TGF-β1 with peptides, which are phage display correctly. After incubation the unbound phages were removed by washing and the specifically bound phage are then in a certain way was suirable the lowering of the pH level, a procedure that violates the molecular link between TGF-β1 and the peptides presented by the phages. Then erwerbende phages amplified by infection with the bacterial strain. The process was repeated three times (3 cycles)to achieve high content specifically bind with high affinity to TGF-β1 phage. Gradually in each cycle was reduced concentrations used for blocking in Petri dishes biotinylated TGF-β1, for example, from 2.5 to 0.01, and, finally, up to 0.001 μg/ml Thus, at the end of the process phages selected for their affinity to TGF-β1, sequenced using primers. This allowed to obtain a sequence peptide phage display.

Example 1 shows the selection of peptides associated with TGF-β1, through libraries of phages, "biopanning", and sequencing of peptides that bind with high affinity to TGF-β1.

The present invention also provides a method for identifying peptides capable of binding to TGF-β1, which contains a truncated peptides capable of binding to TGF-β1, followed by analysis of the ability of those who chopped peptides to contact TGF-β 1. Truncated peptides can be obtained by any conventional method, such as, for example, chemical synthesis of peptide variants (for their size), truncated at the N-end and C-end. You can determine the ability of these truncated peptides to bind to TGF-β1, using any suitable method for determining binding between two molecules, for example, affinity analysis, which includes ensuring contact of TGF-β1 with the test peptide under conditions that allow binding of the peptide with TGF-β1; and evaluation of the binding peptide and TGF-β1, as described above. Similarly, the ability of truncated peptides to inhibit the biological activity of TGF-β1in vitroand/orin vivocan be analyzed by any of the methods described in the present description.

Because of the role of TGF-β1 in many biological processes, the value of the inhibitory activity of TGF-β1 peptides of the present invention is related to the potential development of a family of medicines for the treatment of diseases and pathological disorders associated with overexpression or misaligned expression of TGF-β1, since such peptides can block the damage induced by overexpression or misaligned expression of this cytokine.

In this regard, the peptides of the present invention can be used for the ecene diseases and pathological disorders, associated with overexpression or misaligned expression of TGF-β1, such as: (1) fibrosis associated with loss of function of an organ or tissue, for example, pulmonary fibrosis, fibrosis of the liver (cirrhosis), renal fibrosis, corneal fibrosis and so on; and (2) surgical and/or aesthetic complications, for example, fibrosis associated with surgical procedures on the skin or in the abdomen, fibrosis associated with burns, bone-articular fibrosis, keloids, etc.

Thus, in another aspect, the present invention relates to pharmaceutical compositions containing a therapeutically effective amount of the peptide of the present invention together with at least one pharmaceutically acceptable excipient. The pharmaceutical composition provided by the present invention may contain one or more peptides of the present invention, optionally in combination with one or more alternative connections, any abscopal TGF-β1. This pharmaceutical composition is useful for application and/or administration in a human or animal (preferably a human).

There are many advantages to using peptides, such as peptides of the present invention, instead of antibodies or antisense oligonucleotide sequences, as they are small molecules with more than you who akim diffusion capacity and a shorter half-life. Peptides can exhibit a high affinity to TGF-β1, although they disintegrate faster than antibodies, with side effects, you can adjust the dosage. Directional transport of peptides to the organs and target tissues is also easier compared to other types of connections.

The peptides of the present invention for the treatment of diseases and pathological disorders associated with overexpression or misaligned expression of TGF-β1, you can enter any ways that ensure the contact of the peptide of the present invention with a section of its impact or target human or animal. The amount of the peptide, its derivative or pharmaceutically acceptable salts that may be present in the pharmaceutical compositions provided by the present invention can significantly vary.

Dosage determined for the treatment of diseases or pathological disorders associated with overexpression or misaligned expression of TGF-β1 when using the peptides and/or pharmaceutical compositions of the present invention, will depend on numerous factors, including the age of the patient, the condition, the severity of background diseases or pathological disorders, as well as the path and the frequency of introduction of the used peptide of the present invention.

Pharmaceutical compositions containing the peptides of the present invention, can be formed in any form of administration, for example, in solid or liquid form, and can be administered by any appropriate route, e.g. orally, parenterally, rectally or topically. With this purpose it is necessary to include the acceptable pharmaceutical excipients necessary for the formation of the desired form of administration, such as, for example, ointments (fatty gels, hydrogels, etc.), eye drops, aerosol sprays, solutions for injection, osmotic pump systems, etc. an overview of the various required forms of drugs and excipients can be found, for example, in the publication "Tratado de Farmacia Galenica", C. Fauli i Trillo, 1993, Luzan 5, S.. Ediciones, Madrid.

An additional aspect of the present invention is the use of the peptides of the present invention for the manufacture of specified pharmaceutical composition. Thus, in another aspect, the present invention relates to the use of the peptide of the present invention for the manufacture of pharmaceutical compositions for the treatment of diseases or pathological disorders associated with overexpression or misaligned expression of TGF-β1, such as fibrosis, associated with loss of function of an organ or tissue, for example, pulmonary fibrosis, fibrosis of the liver (cirrhosis), renal fibrosis, fibrosis of the cornea and d; and surgical and/or aesthetic complications, for example, fibrosis associated with surgical procedures on the skin or in the abdomen, fibrosis associated with burns, bone-articular fibrosis, keloids, etc.

The peptides of the present invention can be obtained by using common methods such as, for example, solid-phase chemical synthesis, clear high performance liquid chromatography (HPLC) and, if it is desirable to analyze conventional methods, such as, for example, sequencing and mass spectrometry, amino acid analysis, methods of nuclear magnetic resonance, etc.

Alternatively, you can obtain the peptides of the present invention by recombinant DNA technology. Thus, in another aspect the present invention provides a DNA sequence encoding the peptide of the present invention. The sequence of this DNA can be easily deduced from the amino acid sequence of the peptide.

The DNA sequence can be contained inside the structure of DNA. Thus, the present invention provides a design of a DNA containing a DNA sequence which encodes the peptide of the present invention. This design DNA may functionally include a regulatory sequence for expression of the DNA sequence that encodes a PE is Ted of the present invention. Control sequences are sequences that control and regulate the transcription and, where applicable, the translation of the peptide of the present invention; these include promoter and terminal sequences, etc. that are in transformed cells functional owners that contain a specific DNA sequence or construct DNA. In the private embodiment, the specified control expressed sequence is functional in bacteria. This design DNA preferably also contains a marker or gene that encodes a fragment or phenotype, which allows the selection of transformed host cell design DNA. Design DNA provided by the present invention, can be obtained by methods known in this field [Sambrook et al., "Molecular cloning, Laboratory Manual, 2nded., Cold Spring Harbor Laboratory Press, N.Y., 1989. Vol. 1-3].

The DNA sequence or the structure of DNA provided by the present invention can be implemented in a suitable vector. Thus, in another aspect, the present invention relates to a vector such as an expression vector, which contains the specified DNA sequence or construct DNA. The choice of vector will depend on the host cell into which it is subsequently to be implemented. As the example vector, which is introduced DNA sequence may be a plasmid or vector that, upon introduction into the cell, can integrate or not to integrate into the host cell genome. The vector can be obtained by using common methods known to experts in this field [Sambrok et al., 1989, cited above].

In another aspect, the present invention relates to a cell host, such as transformed by a host cell that contains the DNA sequence or the structure of DNA provided by the present invention.

In another aspect, the present invention relates to a method for producing the peptide of the present invention, which involves the cultivation of a host cell with a DNA sequence or structure of DNA provided by the present invention, under conditions that allow production of the specified peptide of the present invention, and, if desired, separation of the peptide of the present invention. The conditions for optimization of the culture of host cell will depend on the type of host cell. If this is desirable, the method of obtaining a peptide of the present invention includes the isolation and purification of the peptide.

In another aspect, the present invention relates to the use of these DNA sequences and structures of DNA to obtain vectors and cells for the treatment of genetic terap is it disease or pathological disorders, associated with overexpression or misaligned expression of TGF-β1. In accordance with this aspect of the present invention the said DNA sequence or structure of the DNA is brought into contact with a genetic vector transfer (e.g., viral or non-viral vector). Suitable viral vectors for the implementation of this aspect of the present invention include the following vectors: adenovirus, adeno-associated, retroviral, lentivirinae, alphaviruses, herpes, coronaviruses derivatives of vectors and so on, but not limited to the above. Suitable non-viral vectors for the implementation of this aspect of the present invention include deproteinizing DNA, liposomes, polyamine, dendrimers, cationic glycopolymer structural researcher, liposome-poly complexes, proteins, receptor-mediated genetic transfer systems and so on, but not limited to the above.

The following examples illustrate the present invention and should not be considered as showing the limitations of the present invention.

EXAMPLE 1

Selection of peptides binding to the TGF-β1, withthe use of libraries of peptide phage display

To obtain a sequence of 15 amino acids, capable of high-affinity binding of TGF-β1 and having potentialyno the inhibitory activity against the biological activity of the indicated cytokine, it was useful to use thein vitrotechnology selection, developed on the basis of technology libraries of peptide phage display. These libraries contain many filamentous bacteriophages (M13), each of which contains a peptide genetically fused with the envelope protein of the phage, in this case linked to the N-end envelope protein pIII (figure 1). Thus, the phage is a 15-AA peptide on the surface of each of the 5 copies of the surface protein pIII, and the DNA sequence encoding this peptide is contained within the phage. Libraries of phage sequence encoding a peptide derived from a degenerate sequence with 20 natural amino acids in each of the 15 positions, so you can view 1,1×1012possible sequence of 15 amino acids in different phages. Physical 1:1 ratio between the peptide sequence and the DNA encoding it inside bacteriophage allows you to select from a wide range of variants of those sequences, which are specifically associated with TGF-β1. This process, known as "biopanning"is carried out byin vitroProtocol selection.

Library of phage display used in this example was obtained from the second amplification of the primary library, described in T. Nishi, N. Tsuri and N. Saya [Exp. 5 Med. (Japan) 11, 1759 (1993)] and provide allenou laboratory George R. Smith. For more information on this technology can be found on the following website:

http://www.biosci.missouri.edu/smithgp/PhageDisplayWebsite/PhageDisplayWebsiteIndex.html

Technology selection ("biopanning")

This technology involves the incubation of a set of phages representing (on the practical effect) all options 15-AA peptides in a Petri dish, blocked with streptavidin (10 μg/ml in 0.1 mol NaHCO3during 2 hours at room temperature), which was added biotinylated TGF-β1. Biotinylated TGF-β1 fixed on the Petri dish by the interaction of the Biotin-streptavidin, therefore, the interaction of TGF-β1 with peptides, portable phages were displayed correctly. TGF-β1 was in contact with peptides, portable phages at a concentration of 3×104virus/ml After 12 hours incubation, unbound phages were removed 5 × washing with PBS/tween (phosphate buffered saline/esters polyoxyalkylene derivatives of sorbitol and fatty acids). Then bound phages were suirable lower pH (eluting buffer), which breaks the link between TGF-β1 and peptide phage display. Then erwerbende phages amplified by infection with the bacterial strain (E. coli). The process was repeated three times (3 cycles) to achieve high content specifically bind with high affin the capacity to TGF-β 1 phage (figure 3). Gradually in each cycle was reduced concentrations used for blocking Petri dishes biotinylated TGF-β1, for example, from 2.5 to 0.01 and, finally, up to 0.001 μg/ml Thus, the phage selected in each cycle, show increased affinity to TGF-β1. At the end of the process phages selected for their affinity to TGF-β1, sequenced using primers after selecting resistant to tetracycline genetically modified phages after infection of E. coli cells. This allows us to obtain the sequence of the peptides in phage displays the number of clones obtained from isolated colonies. The number of repetitions of the sequence, corresponding to a 15-amino acid peptides borne by each clone, from the total number of sequenced colonies, is the exponent of the relative affinity to TGF-β1 specified 15-amino acid sequence.

Peptide sequence

Selection of clones obtained "biopanning", conducted by screening bacterial colonies infected with phages in the presence of bacterial antibiotic; bacterial resistance was acquired using gene resistance to tetracycline encoded by the genome of the phage. Thus, capable of growth were only infected by bacteriophages of the colony. This means that h is about each colony contains a genome of only one bacteriophage coding is only one peptide, located on its surface.

The total number received in the last selective cycle of biopanning bacterial colonies infected with phage, was 108 colonies. Sequence regions that encode peptides that are present in the protein pIII, transferred, using the primers identified from SEQ ID NO:23. This gave different peptide sequences shown in table 1. This table also shows the number of colonies (clones)that carry the specified sequence.

Table 1

Amino acid sequence of phage binding to the TGF-β1
SEQ ID NO:No. colonies
16
21
341
418
51
612
72
82
91
101
114
121
136
142
151
161
173
181
191
201
211
221

The number of clones (colonies) of each sequence gives a rough estimate of the degree of affinity of the peptide to TGF-β1, that is, the more colonies, the higher the affinity of binding. However, there is no correlation between the degree of affinity and the ability of the peptide to block the biological activity of TGF-β1. Moreover, the most active peptide identified as SEQ ID NO:17 (see tables 2 and 3), represented by 3 clones, while the peptide identified as SEQ ID NO:3, 41 presents the clone is much less active in the acute sample of liver damage (table 3). At the same time, not adhering firmly to any specific theory, this observation can be explained by the assertion that the most active peptide, probably blocks the binding of TGF-β1 with its receptor.

Comparison of the peptide sequences

Obtained sequences were analyzed using the program CLUSTAL W program (1.81). This program generates multiple sequences, grouped on the basis of analogues of amino acid sequences. Therefore, peptides gr is pirouet on different structural families based on analogues of the peptide sequences (figure 4). On the basis of these analogues can offer smaller to bind to the TGF-β1 fragments or groups of peptides that are associated with different areas of TGF-β1.

EXAMPLE 2

Inhibition ofin vitrothe biological activity of TGF-β1 using peptides in proliferation assays cell line Mv-1-Lu

Cell line Mv-1-Lu (CCL-64, American Type Cell Culture, Virginia, USA) were obtained from lung epithelium mink, were grown as monolayer, and the presence of TGF-β1 cells responded with a decrease in proliferation (figure 5). Thus, mediated by peptide inhibition of this cytokine is able to restore the growth of cells and reflects the ability of various peptides to inhibit the biological activity of TGF-β1in vitro. The analyzed peptides was obtained by synthesis of a peptide in accordance with conventional methods Merrifield RB. J Am Chem Soc 1963; 85:2149-2154; Atherton, E. et al. J Chem Soc Perkin Trans 1981; 1:538-546).

Cell Mv-1-Lu cultivated to confluently in complete medium [RPMI-1640 with the addition of L-glutamine, sodium pyruvate, antibiotics and 10% fetal calf serum (FBS)] at 37°C and 5% CO2in bottles 162 cm2(Costar Corporation, CA, USA). After trypsinization cells were grown in 200 μl of complete medium in 96-well tablets during the initial density of 5000 cells/well at 37°C and 5% CO2for 6 hours to ensure adhesion. Then added the test is e peptides at various concentrations, starting with 200 μg/ml, and then added to 200 PG/ml of TGF-β1 (Roche). After 12 hours of incubation was added 1 µci methyl-3H-thymidine (Amersham Life Science, Buckinghamshire, United Kingdom) per well in 25 μl of pure medium (RPMI-1640). The plates were incubated for more than 12 hours in the same conditions. Finally, the cells were collected (Filtermate 196 Harvester, Packard) in the plates (UniFilter-96 GfiC Perkin Elmer) transfer titiraupenga thymidine included in the cycle of DNA synthesis. Then were added to scintillation fluid and quantitatively measured the radioactivity using a scintillation counter (top Count Microplate Scintillation Counter, Packard). As positive and negative control is useful inclusion titiraupenga thymidine in the absence and in the presence of TGF-β1, respectively. The inhibition activity of TGF-β1 in this study was calculated by the following formula:

% Inhibition=100×[(imp/min with peptide-pulse/min negative control):(imp/min positive control-pulse/min negative control)].

The negative control is the inclusion titiraupenga thymidine present in TGF-β1 but in the absence of peptide, while the positive control refers to the inclusion of titiraupenga thymidine in the absence of TGF-β1 peptide. Thus, according to the ability of the peptides to pay cytokine repressing effect on the proliferation of CL is the exact line Mv-1-Lu, you can calculate the percentage of inhibition by the peptides of biological activity of TGF-β1 (table 2).

TABLE 2

The effect of peptides obtained by selection "biopanning" on the inhibition ofin vitrothe biological activity of TGF-β1, calculated based on the analysis of the recovery cell line Mv-1-Lu
SEQ ID NO:%Inhibition
13,33±4,3
2-0,96±0,83
325,39±1,7
4of 5.53±7,2
515,78±and 7.7
612,85±4,5
7-24,96±0,75
815,67±8,5
94,98±9,5
10-4,58± 0,9
1127,36±0,9
1210,70±0,9
1317,97±4,3
143,62±5,6
1513,45±9,5
16for 9.47±4,2
1738,92±2,3
1821,29±2,8
199,71±3,2
206,16 9,5
2113,40±3,2
224,13±1,4
P1447,26±3,53

The peptides identified as SEQ ID NO:3, 11, 17 and 18 are the percentage of inhibition of the biological activity of TGF-β1in vitroabove 20%.

Additionally, to assess the ability of the peptides to pay suppressor effect of TGF-β1 on the proliferation of cell line Mv-1-Lu, as described above, compared the activity of the peptide identified in Spanish patent application ES 2146552 A1, as R, with the activity of a peptide identified as SEQ ID NO:17. The peptide identified as SEQ ID NO:17, showed higher ability to inhibition.

EXAMPLE 3

Inhibition of the biological activity of TGF-β1in vivopeptides based on the model of acute induced CCl4liver damage.

Acute liver damage causes a cascade of effects and physiological responses, including increased concentrations of TGF-β1. This increase is responsible, among other things, for the gene expression of collagen type 1. In this model of acute liver damage female mice Balb/C weighing 25 to 30 g oral introduced CCl4dose2 μl of CCl4(per gram of body weight), dissolved in an equivalent volume of corn oil (volume ratio 1:1). Control group p who were given an equivalent volume of only corn oil, and the treatment group received every 24 hours after a single oral administration of CCl4in corn oil) 50 µg peptide in 500 μl of 1% solution of saline solution in DMSO (dimethyl sulfoxide). After 72 hours, all animals were slaughtered and processed samples of the liver. To assess the mRNA expression of the liver tissue was frozen in liquid nitrogen and kept at -80°C until further use. Other samples of liver tissue was preserved in the EAST® or Tissue-Tek® (Sakura Finetek REF.) and was treated in the same way as the samples used to study mRNA. Other samples of liver were fixed in 10% solution of buffered formalin, immersed in paraffin, and processed for histological examination. All groups were counting the amount of mRNA that encodes a collagen type 1, using quantitative polymerase chain reaction (PCR). 6 shows the functional diagram of induction, the sample and the counting results in the acute sample of liver damage. The ability of the tested peptides to block acute damage, assessed by measuring the levels of induction of mRNA of collagen type 1, quantify PCR in real-time. Table 3 shows the degree of inhibition by peptides derived from phage expression of type 1 collagen mRNA. The tested peptides was obtained according to the following standard methods of solid-phase peptide synthesis (Merrifield RB. J Am Chem Soc 1963; 85:2149-2154; Atherton, E. et al. J Chem Soc Perkin Trans 1981; 1:538-546).

Table 3

The effect of peptides obtained by selection "biopanning" on the inhibition ofin vivothe biological activity of TGF-β1, calculated on the basis of inhibiting the induction of mRNA of collagen type 1 in a model of acute liver damage

SEQ ID NO:% Inhibition
10,69
236,6±30,7
32,09
451,30±15,3
5Neg
674,94±25,3
7Neg
8Neg
926,59
10Neg
11to 39.34±21,9
12Neg
1332,70
1449,84±24
1514,26
16Neg
1793,09±9,6
18Neg
1912,12
201,41
21the Tr
22Neg
P144-3,51±36
Ref.: negative

The peptides identified as SEQ ID NO:2, 4, 6, 11, 14 and 17, have the percentage inhibition of the biological activity of TGF-β1in vivoabove 35%.

Additionally, to assess the ability of the peptides to inhibit the induction of mRNA of collagen type 1 in a model of acute liver damage in mice, as described above, compared the activity of the peptide identified in Spanish patent application ES 2146552 A1, as R, with the activity of a peptide identified as SEQ ID NO:17. In this comparative analysis, it was recorded that the peptide identified as SEQ ID NO:17, showed a much higher ability to inhibit the expression of mRNA of collagen type 1 in comparison with the peptide identified in Spanish patent application ES 2146552 A1 as R that this analysis did not show any activity. The results of the comparative tests (examples 2 and 3) showed that the peptide representing the peptides of the present invention (the peptide identified as SEQ ID NO:17), is more active than peptide presented in Spanish patent application ES 2146552 A1 (peptide, identified as R) in tests of cell proliferation Mv-1-Lu and in a model of acute liver damage.

EXAMPLE 4

Ingabire is the W in vitrothe biological activity of TGF-β1 peptides truncated from the peptide SEQ ID NO:17 in the analysis of cell proliferation Mv-1-Lu.

This example shows the inhibitory activity of some peptides, amino acid sequences which contain between 3 and 15 consecutive amino acid residues of one of the amino acid sequences of the present invention.

Compared the activity of truncated peptides (derived from the peptide sequences SEQ ID NO:17) with the complete sequence, in terms of their ability to pay suppressor effect of TGF-β1 on the proliferation of cell lines Mv-1-Lu. For this purpose, and to determine the minimum sequence of the peptide SEQ ID NO:17, is able to inhibit the biological activity of TGF-β1in vitro, synthesized a truncated version of the peptide with truncation at N-end-end or at both ends of the molecule. In the conventional methods of synthesis have been tested peptides (Merrifield RB. J Am Chem Soc 20 1963; 85:2149-2154; Atherton, E. et al. J Chem Soc Perkin Trans 1981; 1:538-546). Quantify the activity of truncated peptides compared to the full sequence of the peptide SEQ ID NO:17, in terms of analysis of proliferation cell line Mv-1-Lu, according to the methods described in example 2.

Table 4

Effect of truncated peptides, Paul is obtained from peptide SEQ ID NO:17, for inhibition of biological activity of TGF-β1in vitrocalculated by the analysis of the recovery cell line Mv-1-Lu

SEQ ID NO:Peptide sequence% Inhibition
17KRIWFIPRSSWYERA28,5±3,9
24 (T1)RIWFIPRSSWYERA9,4±0,4
25 (T2)RIWFIPRSSWYER6,2±1,5
26 (T3)IWFIPRSSWYERA4,5±1,8
27 (T4)IWFIPRSSWYE1,4±2,5
28 (T5)WFIPRSSWY3,1±0,9
29 (T6)WFIPRSSWYERA2,7±1,8
30 (T7)FIPRSSWYERA-0,3±3,0
31 (T8)IPRSSWYERA3,4±1,4
32 (T9)PRSSWYERA3,8±1,6
33 (T10)KRIWFIPRSSWYER31,4±7,0
34 (T1l)KRIWFIPRSSWY34,4±7,9
35 (T12)KRIWFIPRSS6,0±0,4
36 (T13)KRIWFIPRS6,2±2,5

In this comparative analysis, as shown in table 4, the removal of lysine (from N-Terminus entails the loss from 28.5% to 9.4% of the activity of the peptide SEQ ID NO:17. On the contrary, the removal of up to three amino acids from the C-end does not affect the activity of the peptide. Also, the removal of aromatic amino acids tyrosine (Y) and tryptophan (W) reduces to zero the activity of the peptide. This allows to reduce the original peptide SEQ ID NO:17 to 12 amino acid sequence (KRIWFIPRSSWY) [SEQ ID NO:34], do not affect the inhibitory activity of TGF-β1in vitro.

1. The peptide has the ability to communicate with TGF-β1 and to inhibit the biological activity of TGF-β1 in vitro and/or in vivo amino acid sequence selected from any of the sequences SEQ ID NO: 1-SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 11-SEQ ID NO: 22, SEQ ID NO: 24 to SEQ ID NO: 29 and SEQ ID NO: 31-SEQ ID NO: 36 or fragments of these peptides are able to bind to TGF-β1 and to inhibit the biological activity of TGF-β1 in vitro and/or in vivo, containing from 9 to 14 consecutive amino acids, and their pharmaceutically acceptable salts.

2. The peptide according to claim 1, selected from the group formed by the peptides identified as SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 33, SEQ ID NO: 34, and their pharmaceutically acceptable salts.

3. The use of a peptide able to bind to TGF-β1 and to inhibit the biological activity of TGF-β1 in vitro and/or in vivo amino acid sequence selected from any one of the sequences: SEQ ID NO: 1-SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 11-SEQ ID NO: 22, SEQ ID NO: 24 to SEQ ID O: 29 and SEQ ID NO: 31-SEQ ID NO: 36 or fragments of these peptides, containing from 9 to 14 amino acids, which are able to communicate with TGF-β1 and to inhibit the biological activity of TGF-β1 in vitro and/or in vivo, and their pharmaceutically acceptable salts, for the manufacture of pharmaceutical compositions capable of inhibiting the biological activity of TGF-β1.

4. The use according to claim 3 in the manufacture of pharmaceutical compositions for the treatment of diseases or pathological disorders associated with overexpression or misaligned expression of TGF-β1.

5. The use according to claim 4, characterized in that the said disease or pathological disorders associated with overexpression or misaligned expression of TGF-β1, include fibrosis, associated with loss of function in an organ or tissue, and surgical and/or aesthetic complications.

6. The use according to claim 4 or 5, characterized in that the said disease or pathological disorders associated with overexpression or misaligned expression of TGF-β1, selected from pulmonary fibrosis, fibrosis of the liver (cirrhosis), renal fibrosis, corneal fibrosis and fibrosis associated with surgical procedures on the skin or in the abdomen, fibrosis associated with burns, bone-articular fibrosis or keloids.

7. A pharmaceutical composition comprising a therapeutically effective amount of a peptide according to claim 1 or 2 with ENISA least one pharmaceutically acceptable excipient for the treatment of diseases or pathological disorders, associated with overexpression or misaligned expression of TGF-β1.

8. The DNA sequence that encodes the peptide according to claim 1 or 2.

9. Design DNA for expression of the peptide according to claim 1, which contains the DNA sequence of claim 8, which encodes the peptide according to claim 1 or 2, and functionally related sequence regulating the expression of a specified DNA sequence.

10. Expressing the vector containing the DNA sequence of claim 8, which encodes the peptide according to claim 1 or 2, or design DNA according to claim 9.

11. A host cell for producing a peptide according to claim 1, which contains the DNA sequence of claim 8, which encodes the peptide according to claim 1 or 2, or design DNA according to claim 9, or the vector of claim 10.

12. A method of obtaining a peptide according to claim 1 or 2, which comprises growing the host cell according to claim 11 under conditions that provide products specified peptide and its selection.



 

Same patents:

FIELD: technological processes; pharmacology.

SUBSTANCE: antagonist of human interleukine-1 receptor is prepared with the help of recombinant strain E. coli that contains plasmid, which provides production of this protein. For this purpose the strain is cultivated. Then from bacterial cells the target product is separated with application of three-stage chromatography and concentration on hydrophobic sorbent. At that the first and the third stage of mentioned chromatographic purification is performed on cation-exchanging resin, and in the second stage of chromatography the anion-exchanging resin is used.

EFFECT: application of invention allows to prepare antagonist of human receptor of high purity.

7 cl, 1 tbl, 4 ex

FIELD: technological processes; medicine.

SUBSTANCE: invention is related to preparation of recombinant analogues of human gamma-interferon and may be used in medicine for prophylactics and treatment of oncological diseases, neoplasms and inflammatory processes of humans. Highly pure genetically engineered analogue of human gamma-interferon - deltaferon with molecular mass of 16.2 kilo Daltons is produced by microbiological synthesis with further chromatographic purification on "KM"-sepharose - cationic-exchange sorbent with high linear speed of flow and suitable for preparative loads, at different pH values. On the basis of deltaferon, which contains by data of polyacrylamide gel-sodium dodecyl sulfate electrophoresis at least 98% of main substance in the form of monomer that possesses antiproliferative and anti-inflammatory activities inherent in gamma-interferon, medical product is prepared, which also includes low molecular polymer filler-stabiliser (reopolyglukine or polyvinylpyrrolidone) and salt buffer system with pH 7.0-7.1.

EFFECT: highly active and stable preparation of deltaferon is produced.

2 cl, 6 dwg, 1 tbl, 3 ex

FIELD: technological processes.

SUBSTANCE: method suggests protein of adipocyte plasma membrane, method of its preparation and complex based on this protein. Protein has molecular mass of 115 kilodaltons and has the ability to start-up tyr-phosphorylation of insulin-receptor proteins substrate in adipocyte. Method of protein preparation provides for adipocytes preparation out of rat, mouse or human tissues and plasma membranes extraction out of them. Then plenty of domains are isolated with high content of cholesterol hcDIG, which are treated with solution trypsin/NaCl. Centrifugation is done and protein fraction SDS-polyacrylamide gel is segregated with electrophoresis. Prepared protein fraction in amount of 115 kilodaltons is eluated from this gel. Complex constitutes activated protein and is formed during its combination with one of compounds from group: YCN-PIG, YMN-PIG, YCN or lcGcel.

EFFECT: protein in its activated form allows regulating glucose utilization bypassing insulin signal chain.

7 cl, 20 dwg, 1 tbl

FIELD: medicine.

SUBSTANCE: invention concerns glycoforms of VII factor and compositions of VII factor, characterized by modified configurations on basis of asparaginic oligosaccharide chains. In addition invention includes detection method applied for polypeptide glycoforms of VII factor, receiving method and disease treatment method as well.

EFFECT: identification of biologically active forms of recombinant VII factor.

53 cl, 5ex

FIELD: biotechnology, molecular biology, proteins.

SUBSTANCE: invention relates to a method for preparing cytokines of class II and can be used in medicine. Prepared proteins zcyto20, zcyto22, zcyto24 and zcyto25 are the most relative with interferon-α at amino acid sequence level. Receptor of cytokines of class II represents a receptor for this family of proteins. Proteins can be prepared by recombinant way using a cell-host transformed with expression vector that comprises nucleic acids corresponding to proteins. Base on proteins xcyto20, xcyto21, zcyto22, zcyto24 and zcyto25 antiviral pharmaceutical composition and specific antibodies are prepared. Invention provides preparing the novel cytokine that stimulates cells of differentiation hemopoietic line and possesses the expressed antiviral activity.

EFFECT: valuable biological and medicinal properties of polypeptide, improved preparing method.

24 cl, 21 tbl, 32 ex

FIELD: peptides.

SUBSTANCE: invention relates to biologically active peptides possessing antibacterial effect that can be used in biotechnology and medicine. Peptide latarcin shows the following amino acids sequence: H2N-Gly1-Phe2-Phe3-Gly4-Lys5-Met6-Lys7-Glu8-Tyr9-Phe10-Lys11-Lys12-X13-Gly14-Ala15-Ser16-Phe17-Lys18-Arg19-Arg20-Phe21-Ala22-Asn23-Leu24-Lys25-Lys26-Arg27-Leu28-NH2 wherein X represents phenylalanine Phe13 or tryptophan Trp13 residue, and possesses the broad spectrum of antibacterial activity and expressed toxic effect with respect to human promyelocyte leukemia. Using the invention allows expanding assortment of natural peptide antibiotics not containing cysteine residues and possessing high antibacterial activity.

EFFECT: valuable medicinal properties of peptide.

2 tbl, 5 dwg, 8 ex

FIELD: biotechnology, microbiology, peptides.

SUBSTANCE: invention relates to a method for preparing dipeptide from L-amino acid ester and L-amino acid using culture of microorganisms possessing ability for producing dipeptide from L-amino acid ester and L-amino acid. Method involves using cells of microorganisms of genus Pseudomonas or Corynebacterium isolated from culture or disrupted cells of these microorganisms, or lyophilized cells of such microorganisms. By other variant method involves using a protein possessing proline iminopeptidase activity instead microorganism culture. Invention provides preparing dipeptides with high effectiveness degree using inexpensive parent substance by industrially economy and simple way.

EFFECT: improved preparing method.

13 cl, 1 dwg, 4 tbl, 14 ex

FIELD: microbiology, veterinary science, biotechnology.

SUBSTANCE: invention relates to diagnostic immunobiological preparations comprising biologically active components of cells Bacillus anthracis. Method involves submerged culturing the strain B. anthracis, the strain CTI-1 in apparatus BIOP-1,0 in liquid nutrient medium based on hydrochloric hydrolyzate of fish flour for 8-12 h followed by washing out, centrifugation and devitalization of cells. Then alkali-soluble components are extracted from prepared bacterial mass. Borate buffer is added to the substance and dry allergen is prepared in sublimating device LZ-45. Drying temperature regimen is regulated by heat supply to material from -32°C to +28°C. The total duration of lyophilization process is 20-24 h. One dose of the prepared dry allergencomprises 20 mcg of protein. Biological activity of dry anthrax allergen exceeds the activity of commercial analog by two-fold, it is stable in prolonged storage and effective in estimation of anti-anthrax immunity expression and in diagnosis of anthrax infection.

EFFECT: enhanced and valuable properties of allergen.

4 tbl, 2 ex

FIELD: biotechnology, immunology, biochemistry, medicine.

SUBSTANCE: invention proposes peptide concatemer inducing production of antibodies against apolipoprotein B-100 that inhibit lipase effect and inhibit binding LDL with LDL receptors. This concatemer consists of amino acid sequence of peptide repeating four times. Amino acid sequence is given in the invention description. Also, invention describes a concatemer-base vaccine used in treatment and prophylaxis of obesity and a method for preparing concatemer in E. coli cells using a vector. Invention discloses a polynucleotide encoding concatemer and expressing vector comprising the indicated polynucleotide. Using the invention provides inhibition of obesity.

EFFECT: valuable medicinal properties of concatemer and vaccine.

7 cl, 16 dwg, 1 tbl, 6 ex

FIELD: biotechnology, food processing industry, derivatives of amino acids.

SUBSTANCE: invention proposes a method for enzymatic preparing α-L-aspartyl-L-phenylalanine-β-ester (α-L-(β-o-substituted aspartyl)-L-phenylalanine) from L-aspartic acid α,β-diester and L-phenylalanine at temperature 5-400C and pH 7-10 for period sufficient for formation of α-L-aspartyl-L-phenylalanine-β-ester from L-aspartic acid α,β-diester and L-phenylalanine. Proposed method is used in a method for preparing α-L-aspartyl-L-phenylalanine-α-methyl ester that comprises a step for synthesis of α-L-aspartyl-L-phenylalanine-β-methyl ester and step for conversion of indicates ester to α-L-aspartyl-L-phenylalanine-α-methyl ester. Using this invention provides synthesis of α-L-aspartyl-L-phenylalanine-β-ester followed by preparing α-L-aspartyl-L-phenylalanine-α-methyl ester by simplified and inexpensive scheme and with enhanced yield of the end product.

EFFECT: improved method of synthesis.

5 cl, 1 dwg, 4 tbl, 12 ex

FIELD: chemistry.

SUBSTANCE: according to the invention, the recombinant albumen with anti-cancer effect is selected out of the group including 1) albumen with amino acid sequence presented in SEQ ID N0:2 indicated in the sequence list; 2) albumen with amino acid sequence homologous to the sequence presented in SEQ ID NO:2 by more than 90% and featuring the same effect as the albumen 1); 3) albumen obtained by replacement, deletion or addition of one or more residua to the amino acid sequence presented in SEQ ID NO:2 and featuring the same effect as the albumen 1). The invention also claims a gene coding the described recombinant albumen and its variants, expression vector containing the said gene, and cell line containing the said gene and intended for expression of the recombinant albumen. The recombinant albumen can be applied in obtaining cancer treatment medication. A medication including the aforesaid recombinant albumen as active component has strong selective effect on tumour cells and does not cause apoptosis of normal tissue cells.

EFFECT: developed substance for obtaining cancer treating medication.

14 cl, 16 dwg, 7 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: invention claims a vector including one, two or more pgsB, pgsC and pgsA genes encoding poly-gamma-glutamine acid synthase complex, and a gene encoding spike antigen albumen or antigen albumen of SARS coronavirus nucleocapsid. The gene encoding spike or SARS coronavirus nucleocapsid antigen albumen is linked to the C-end part of one, two or more pgsB, pgsC and pgsA genes. The vector enables albumen expression at a cell surface. Also the invention claims a microbe transformed by such vector enabling albumen expression at a cell surface, and a SARS preventing vaccine containing such microbe. The vaccine for SARS prevention and treatment, using recombinant strain expressing SARS coronavirus antigen over its surface, is efficient and cost-effective.

EFFECT: vector enabling albumen expression at a cell surface.

19 cl, 18 dwg, 9 ex

FIELD: medicine.

SUBSTANCE: invention refers to genetic engineering and biotechnology and can be used for labelling of proteins, cells and organisms. Substitutes added to nucleic acid Aequorea coerulescens, coding colourless GFP-like protein acGFP is considered as means of production of nucleic acid coding fluorescent protein. Expression cassette containing this nucleic acid under regulatory elements control provides in-cell biosynthesis of fluorescent protein. This genetic structure is used for production of transgenic organism and cell producing fluorescent protein, coded by specified nucleic acid. This fluorescent protein is applied in methods for labelling of cells, intracellular structure and protein, as well as for promotor transcriptional activity registration.

EFFECT: invention application ensures widen range of labelling means used in biochemistry, molecular biology and medical diagnostics.

11 cl, 34 dwg, 2 ex

FIELD: chemistry.

SUBSTANCE: polynucleotide is obtained, coding chromo- or fluorescen mutant wild type DsRed (SEQ ID N0:2), where chromo- or fluorescent mutant contains a substitute in the amino acid position 42 SEQ ID N0:2, and optionally one or more substitutes in the amino acid positions, chosen from a group, consisting of 4, 2, 5, 6, 21, 41, 44, 117, 217, 145. Using the polynucleotide in the vector, the host cells which express chromo- or fluorescent mutant DsRed are transformed. The invention allows for obtaining chromo- or fluorescent polypeptide DsRed, which matures faster than wild type DsRed.

EFFECT: increased effectiveness.

26 cl, 10 dwg, 2 tbl, 4 ex

Modified phytases // 2329301

FIELD: biotechnologies.

SUBSTANCE: polypeptide with phytase activity is proposed. The sequences are shown in the description. A polynucleotide coding the said polypeptide is described. The application of the said polypeptide for the use in a feed mix or a feed supplement is described.

EFFECT: allows to increase modified phytase resistance against temperature and humidity.

6 cl, 6 ex, 12 tbl, 10 dwg

FIELD: bioengineering.

SUBSTANCE: novel polynucleotide is invented which is produced from the nucleotide sequence of the IFNα-17 gene, containing the single nucleotide polymorphism SNP g771c. Also, the novel polynucleotide is invented which is derived from the natural protein IFNα-17 of the wild type containing SNP G45R.

EFFECT: can be used for producing effective therapeutic agent with antiviral, antiproliferative and/or immunomodulating activity.

13 cl, 5 dwg, 6 ex

FIELD: bioengineering.

SUBSTANCE: versions of the molecule binding CD45RO and CD45RB, and the anti-CD45RO and anti-CD45RB antibody are invented. In one of versions, the said molecule contains at least one antigen-binding site and includes the subsequently located hypervariable sites CDR1, CDR2 and CDR3. The molecule represents the humanised or monoclonal antibody. CDR1 has the amino acid sequence NYIIH, CDR2 has the amino acid sequence YFNPYNHGTKYNEKFKG and CDR3 has the amino acid sequence SGPYAWFDT. The molecule can additionally contain the subsequently located hypervariable sites CDR1', CDR2' and CDR3'. CDR1' has the amino acid sequence RASQNIGTSIQ, CDR2' has the amino acid sequence SSSESIS and CDR3' has the amino acid sequence QQSNTWPFT. In another version, the molecule contains both heavy and light chains where the amino acid sequences contain the corresponding CDR. The versions of the corresponding coding polynucleotide are disclosed; expression vector and based on it expression system. The host cell is disclosed basing on the expression system. The application of the molecule in treatment of autoimmune diseases, graft rejection, psoriasis, intestine inflammatory disease and allergy is described. The pharmaceutical composition for the said application is disclosed.

EFFECT: enables immunosuppressant induction; inhibiting T-cell response and primary lymphocyte response in mixed lymphocyte culture (MLC); prolongs survival period in mice with severe combined immunodeficiency SCID.

20 cl, 5 dwg, 2 tbl, 8 ex

FIELD: genetic engineering.

SUBSTANCE: provides genetic sequence of grass pollen main allergen Phi p 4. Fragments of this sequence, combinations of its partial sequences and point mutants have hypoallergenic action. Recombinant molecules of DNA and derivative polypeptides, fragments, new combination of partial sequences and versions can be applied for treatment of diseases associated with grass pollen allergy.

EFFECT: proteins produced by recombinant methods can be applied for diagnostics of grass pollen allergosis.

16 cl, 8 dwg, 6 tbl

FIELD: gene engineering.

SUBSTANCE: invention can be used for production of recombinant polypeptide of human granulocyte colony-stimulating factor. Recombinant plasmid DNA is constructed in vitro. It includes synthetic gene of human granulocyte colony-stimulating factor, strong constitutive promoter A3 from the early stage of bacteriophage T7 and synthetic section - translation enhancer (TREN) of gene 10 in bacteriophage T7. This DNA in combination with high copy number of plasmid and optimisation of cultivation conditions ensures constitutive biosynthesis of target protein in transformed by this DNA race of Escherichia coli SGK25/pA3GF with high yield.

EFFECT: constitutive biosynthesis of target protein in cells; high yield.

2 cl, 4 dwg, 7 ex

FIELD: gene engineering.

SUBSTANCE: invention relates to gene engineering and may be used for production of recombinant polypeptide of human alfa-2b interferon. Recombinant plasmid DNA is constructed in vitro. It includes synthetic gene of human alfa-2b interferon, tandem of A2 and A3 promoters from the early stage of bacteriophage T7 and synthetic section - translation enhancer. All these elements determine constitutive biosynthesis of target protein in transformed by this DNA race of Escherichia coli SGK25 /pIF TREN with high yield.

EFFECT: high yield.

2 cl, 5 dwg, 5 ex

FIELD: biology.

SUBSTANCE: invention concerns molecular biology and can be applied in epidemiology. It claims a method of cystic echinococcosis agent identification involving extraction of DNA from ehinococcus larvocyst cells and polymerase chain reaction (PCR) using primers specific to mitochondrial gene CO1 of Echinococcus granulosus. Oligonucleotides with sequences 5' TGTGTTGATTTTGCCTGG 3' and 5' GCCACCACAAACCAAGTATC 3' are applied as direct and reverse primers respectively, as they are more universal in relation to various isolates of disease causative agents.

EFFECT: increased analysis reliability for population research in different regions.

2 ex

Up!