Therapeutic binding molecules

FIELD: bioengineering.

SUBSTANCE: versions of the molecule binding CD45RO and CD45RB, and the anti-CD45RO and anti-CD45RB antibody are invented. In one of versions, the said molecule contains at least one antigen-binding site and includes the subsequently located hypervariable sites CDR1, CDR2 and CDR3. The molecule represents the humanised or monoclonal antibody. CDR1 has the amino acid sequence NYIIH, CDR2 has the amino acid sequence YFNPYNHGTKYNEKFKG and CDR3 has the amino acid sequence SGPYAWFDT. The molecule can additionally contain the subsequently located hypervariable sites CDR1', CDR2' and CDR3'. CDR1' has the amino acid sequence RASQNIGTSIQ, CDR2' has the amino acid sequence SSSESIS and CDR3' has the amino acid sequence QQSNTWPFT. In another version, the molecule contains both heavy and light chains where the amino acid sequences contain the corresponding CDR. The versions of the corresponding coding polynucleotide are disclosed; expression vector and based on it expression system. The host cell is disclosed basing on the expression system. The application of the molecule in treatment of autoimmune diseases, graft rejection, psoriasis, intestine inflammatory disease and allergy is described. The pharmaceutical composition for the said application is disclosed.

EFFECT: enables immunosuppressant induction; inhibiting T-cell response and primary lymphocyte response in mixed lymphocyte culture (MLC); prolongs survival period in mice with severe combined immunodeficiency SCID.

20 cl, 5 dwg, 2 tbl, 8 ex

 

The technical field to which the invention relates.

The present invention relates to organic compounds, such as adhesion molecule isoforms antigen CD45, such as monoclonal antibodies (MAB).

Background of invention

One approach to the treatment of various diseases consists in the removal or inactivation of pathogenic cells and in the induction of tolerance to inactivate pathological immune responses.

The rejection of organ transplants, cells and tissues, and various autoimmune diseases are probably primarily the result of a mediated T-cell immune response, which is triggered by T-cell-helper with the ability to recognize specific antigens, which they capture, ProcessInput and present to T cells-helper cells with antigen presenting cells (APCS)such as macrophages and dendritic cells, in the form of complex antigen-GKS (major histocompatibility complex), i.e. the recognition of specific antigens leads to stimulation of T cells-helper in the production of cytokines, such as IL-2 expression or improving the regulation of some receptors of cytokines and activation of other molecules and proliferation. Some of these activated T cells-helper cells can act neposredno the but or indirect, i.e. helping effector cytotoxic T-cells or b-cells destroy the cells or tissue expressing the selected antigen. After termination of the immune response, some Mature clonal selected cells are stored in the form of helper or cytotoxic T-cell memory, which circulate in the body and quickly recognize the antigen, if it appears again. If the antigen that triggers this response is a harmless existing in the external environment antigen, then the result is allergic, if the antigen is not a foreign antigen, autoantigen, it can lead to autoimmune diseases; if the antigen is an antigen transplanted organ, may result in graft rejection.

The immune system is designed to recognize "their" from "not his own". This property allows the organism to survive in conditions of permanent contamination by pathogens from the environment. This specificity against "foreign" and tolerance in relation to "their" occurs in the development process of a population of T cells in the thymus as a process of positive and negative selection, which also includes the recognition and elimination of self-reactive T cells. This type of tolerance is designated as the main tolerance. However, some of the C of these self-reactive cells avoid this mechanism of selection and are potentially dangerous from the point of view of the development of autoimmune diseases. For the destruction of self-reactive T cells, which were on the periphery, the immune system has a peripheral regulatory mechanisms, providing protection from autoimmunity. These mechanisms are the basis of peripheral tolerance.

The antigens on the cell surface that are recognized by specific Mat, usually denoted as CD (differencirovany leukocyte antigen identified by cluster monoclinal antibodies) with them assign International committees leukocyte typing serial numbers, and the concept of CD45 in the context of the present description refers to the common leukocyte antigen CD45, located on the cell surface, and the Mate to this antigen identified in the context of the present invention as "antibody to CD45 (anti-CD45")".

Total leukocyte antigen (LOA) or CD45 is a major component antilymphocyte globulin (ALG). CD45 belongs to the family of transmembrane tyrosinosis and is both positive and negative regulator of cell activation depending on the interaction with the receptor. Fosfataza activity of CD45 is likely required for the activation of the kinases Src family-related receptor antigen b - and T-lymphocytes (I.S. Trowbridge and others, Annu Rev Immunol., 12 (1994), cc.85-116). So, in the mechanism of T-cell activation, CD45 is critical for signal 1, and the entrances with CD45 deficiency have severe defects in relation mediated by the TCR (T cell receptor) activation process.

Antigen CD45 exists in different isoforms, which represent a family of transmembrane glycoproteins. Different CD45 isoforms differ in the structure of their extracellular domain, which is due to different splicing three variable exons encoding part of the extracellular region of CD45 (Streuli M.F., and others, J. Exp. Med., 166 (1987), cc.1548-1566). Different CD45 isoforms have different extracellular domains, but have the same transmembrane and cytoplasmic segments that have two highly conserved homologous fosfatnykh domain consisting of approximately 300 residues. Various combinations of isoforms are expressed differently in the subpopulations of T - and b-lymphocytes (Thomas M.L., and others, Immunol. Today, 9 (1988), cc.320-325). Some monoclonal antibodies recognize an epitope that is common to all the various isoforms, and other Mat have limited (CD45R) specificity, depending on this, they recognize resulting from alternative splicing of the exons (a, b or C). For example, monoclonal antibodies that recognize the product of exon A, denoted respectively as CD45RA antibodies that recognize different isoforms containing exon, were identified as CD45RB (Beverley P.C.L and others, Iimnunol. Supp. 1988; I: cc.3-5). Antibodies such as UCHL1, selectively contact having a molecular weight of 180 kDa isoform CD45RO (without any variable aksonova, B or C), which are likely to be limited to a subset of activated T-cells, memory cells and cortical thymocytes and is not present on b cells (Terry L.A., and others, Immunol., 64 (1988), cc.331-336).

Description of the drawings

Figure 1 shows that the inhibition of primary MLR (reaction of lymphocytes in the mixed culture) "Mat-candidate depends on the dose in the range from 0.001 to 10 μg/ml "Concentration" means the concentration of the Mat candidate".

Figure 2 shows the plasmid map of the expression vector HCMV-G1 HuAb-VHQ containing heavy chain, which has the nucleotide sequence SEQ ID NO:12 (3921-4274), a subset of the full nucleotide sequence of SEQ ID NO:15 expression vector.

Figure 3 shows the plasmid map of the expression vector HCMV-G1 HuAb-VHE containing heavy chain, which has the nucleotide sequence SEQ ID NO:11 (3921-4274), a subset of the full nucleotide sequence of SEQ ID NO:16 expression vector.

Figure 4 shows a plasmid map of the expression vector HCMV-K HuAb-humV1 containing light chain, which has the nucleotide sequence SEQ ID NO:14 (3964-4284), a subset of the nucleotide sequence of SEQ ID NO:17 expression vector.

Figure 5 shows the plasmid map of the expression vector HCMV-K HuAb-humV2 containing light chain, which has a nucleotide follower of the awn SEQ ID NO:13 (3926-4246), part of the nucleotide sequence of SEQ ID NO:18 expression vector.

Description of the invention

While the invention has been identified linking molecule that contains a polypeptide sequence that communicates with CD45RO and CD45RB, later in the context of the present description is also marked as "CD45RO/RB binding molecule". These binding molecules according to the invention can induce immunosuppression, to inhibit primary T-cell responses and to induce T-cell tolerance. Furthermore, the binding molecules according to the invention inhibit the primary reaction of lymphocytes in a mixed culture (MLR). Cells from cultures treated D45RO/RD-binding molecules, preferably also give weak proliferative responses in the secondary MLR, even in the absence D45RO/RD-binding molecules in the secondary MLR. Such weak proliferative responses in the secondary MLR are an indicator of the ability of the binding molecules according to the invention to induce tolerance. In addition, the introduction of in vivo D45RO/RD-binding molecules to mice with severe combined immunodeficiency (SCID), followed by the introduction of human RVMS (mononuclear cells peripheral blood), followed by reaction of the xenograft versus-host) (Xeno-GVHD), can lengthen the time vyjivaniya compared to control-treated mice, although even in mice treated D45RO/KD-binding molecule in the bloodstream may still be present in human T cells.

The concept of "D45RO/RB-binding molecule" refers to any molecule that has a specific ability to contact isoforms CD45RB and CD45RO antigen CD45, either individually or in combination with other molecules. The binding reaction can be detected using standard methods (qualitative analysis), including, for example, any type of analysis of binding, such as direct or indirect analysis of the immunofluorescence assay in combination with fluorescence microscopy or cytofluorimetrically (FACS [fluorescent method for separating cells lymphocytes]) analysis, enzyme-linked immunosorbent assay (ELISA) or radioimmunoassay, using which it is possible to visualize the binding of molecules to cells expressing specific isoforms of CD45. In addition, the binding of this molecule may lead to a change in the function of cells expressing these isoforms. For example, you can determine the inhibition of primary or secondary reactions of lymphocytes in a mixed culture (MLR), including using in vitro assays or biological analysis, designed to assess inhibition of primary or secondary MLR in the presence D45RO/RB-binding molecules or without it, and identify differences in the inhibition of ervices MLR.

In other variant is possible also to define the function modulating action in vitro by assessing proliferation RVMS or T cells or CD4+-T cells, production of cytokines, changes in the expression of cell surface molecules, for example, after activation of cells with MLR or after stimulation with a specific antigen, such as toxoid tetanus, or other antigens, or using polyclonal stimulants, such as phytohemagglutinin (PHA) or antibody to CD3 and antibody to CD28 or complex forblue esters and CA2+- ionophores. Culture creates in the same way as described for MLR, except that instead of allogeneic cells as stimulators use of soluble antigen or polyclonal stimulants, such as described above stimulants. T-cell proliferation preferably evaluated by the method described above by including3H-thymidine.

The production of cytokines preferably evaluated using a sandwich ELISA, the implementation of which is immobilized antibody to the cytokine sensibiliser the surface of the 96-hole tablet, add supernatant cultures and incubated for 1 h at room temperature and then add identifying an antibody that is specific for a particular cytokine, and then the secondary antibody, anywhereman the enzyme such as peroxidase from horseradish, and then add the appropriate substrate and with the help of planetradio appreciate absorption. The change of cell surface molecules preferably can be evaluated by direct or indirect immunofluorescence assay method after staining of target cells with antibodies specific for particular cell surface molecules. The antibody can either be marked directly with fluorochrome or you can use fluorescencebased secondary antibody specific for the first antibody, and analyze the cells using a flow cytometer.

The binding molecule according to the invention has the specific ability to communicate with both CD45RO and CD45RB ("CD45RB/RO-binding molecule").

Preferably the binding of the binding molecules with CD45RO isoforms characterized by the value of the dissociation constants (Kd) <20 nm, preferably Kd<15 nm or <10 nm, more preferably Kd<5 nm.

According to another preferred variant of the invention, the binding molecule according to the invention is associated with the isoforms of CD45, which

1) include epitopes a and b, but does not include the epitope of CD45 molecule, and/or

2) include the epitope In, but do not include the epitope And or epitope of CD45 molecule, and/or

3) do not include any of the epitopes a, b or C of the CD45 molecule.

According to the another preferred variant of the invention, the binding molecule according to the invention does not bind to the CD45 isoforms, which include

1) all epitopes a, b and C molecules CD45, and/or

2) epitopes b and C, but does not include the epitope And the CD45 molecule.

According to other preferred variants of the invention, the binding molecule according to the invention additionally

1) recognize possessing memory and in vivo alloantibodies T cells, and/or

2) communicates with its target on human T-cells, such as PEER-cells, and this binding is preferably characterized by a Kd<15 nm, more preferably Kd<10 nm, most preferably Kd<5 nm, and/or

3) inhibits in vitro the function alloreactive T-cells, preferably the value of the IC50is about 5 nm, more preferably IC50approximately 1 nm, most preferably IC50is about 0.5 nm or even 0.1 nm, and/or

4) induces tolerance alloantigenic T cells in vitro and/or

5) prevents a lethal reaction xenogeneic graft-versus-host (GVHD)induced in SCID mice by injection of human RVMS, when introduced in an effective amount.

According to the following preferred variant of the invention, the binding molecule of the invention binds to the same epitope as monoclonal antibody "A6", described in Aversa, etc., Cellular Immunology 158 (1994), cc.314-328.

The benefit is are described above abilities to bind and their biological activities such binding molecules according to the invention is particularly suitable for use in medicine for the treatment and/or prevention. Diseases in which it is preferable to apply a binding molecule according to the invention include autoimmune diseases, graft rejection, psoriasis, inflammatory bowel disease and allergies, as described below.

In the claimed invention, it was found that the molecule, which contains a polypeptide having the sequence of SEQ ID NO:1, and the polypeptide having the sequence of SEQ ID NO:2 is a CD45RO/RB binding molecule. We have also identified hypervariable sites CDR1', CDR2' and CDR3' in CD45RO/RB binding molecule having the sequence of SEQ ID NO:1, where CDR1' has the amino acid sequence Arg-Ala-Ser-Gln-Asn-Ile-Gly-Thr-Ser-Ile-Gln (RASQNIGTSIQ), CDR2' has the amino acid sequence Ser-Ser-Ser-Glu-Ser-Ile-Ser (SSSESIS) and CDR3' has the amino acid sequence Gln-Gln-Ser-Asn-Thr-Trp-Pro-Phe-Thr (QQSNTWPFT).

We have also identified hypervariable sites CDR1, CDR2 and CDR3 in CD45RO/RB binding molecule having the sequence of SEQ ID NO:2 in which CDR1 has the amino acid sequence Asn-Tyr-Ile-Ile-His (NYIIH), CDR2 has the amino acid sequence Tyr-Phe-Asn-Pro-Tyr-Asn-His-Gly-Thr-Lys-Tyr-Asn-Glu-Lys-Phe-Lys-Gly (YFNPYNHGTKYNEKFKG) and CDR3 has the amino acid sequence Ser-Gly-Pro-Tyr-Ala-Trp-Phe-Asp-Thr (SGPYAWFDT).

CDR are 3 specific "complementarity determining region", also called hypervariable sites that VI is m determine antigennegative characteristics. These CDRs are part of the variable regions, for example the sequence SEQ ID NO:1 or SEQ ID NO:2, respectively, and these CDR alternate with frame regions (FR), for example a constant regions of SEQ ID NO:1 is part of the light chain, for example, SEQ ID NO:3, a SEQ ID NO:2 are part of the heavy chain, for example, SEQ ID NO:4, a chimeric antibody of the present invention. CDR heavy chain combined with the corresponding CDR light chain basically form antigennegative the center of the molecule of the present invention. It is known that the contribution of the variable region of the light chain binding energy is small compared to the contribution of the variable regions of the corresponding heavy chain and that the selected variable regions of the heavy chain have antigennegative activity. Such molecules are usually referred to as antibodies with a single domain.

One of the objects of the present invention is a molecule comprising at least one antigennegative centre, for example CD45RO/RB binding molecule that contains consistently located hypervariable sites CDR1, CDR2 and CDR3, for example, where the specified CDR1 has the amino acid sequence Asn-Tyr-Ile-Ile-His (NYIIH)specified CDR2 has the amino acid sequence Tyr-Phe-Asn-Pro-Tyr-Asn-His-Gly-Thr-Lys-Tyr-Asn-Glu-Lys-Phe-Lys-Gly (YFNPYNHGTKYNEKFKG) and the specified CDR3 has the amino acid sequence Ser-Gly-Pro-Tyr-Ala-Tr-Phe-Asp-Thr (SGPYAWFDT), and its direct equivalents.

The next object of the present invention is a molecule comprising at least one antigennegative centre, for example, CD45RO/RB binding molecule, which includes

a) a first domain containing consistently located hypervariable sites CDR1, CDR2 and CDR3, where specified CDR1 has the amino acid sequence Asn-Tyr-Ile-Ile-His (NYIIH)specified CDR2 has the amino acid sequence Tyr-Phe-Asn-Pro-Tyr-Asn-His-Gly-Thr-Lys-Tyr-Asn-Glu-Lys-Phe-Lys-Gly (YFNPYNHGTKYNEKFKG) and said CDR3 has the amino acid sequence Ser-Gly-Pro-Tyr-Ala-Trp-Phe-Asp-Thr (SGYAWFDT), and b) a second domain containing consistently located hypervariable sites CDR1', CDR2' and CDR3', for example, where CDR1' has the amino acid sequence Arg-Ala-Ser-Gln-Asn-Ile-Gly-Thr-Ser-Ile-Gln (RASQNIGTSIQ), CDR2' has the amino acid sequence Ser-Ser-Ser-Glu-Ser-Ile-Ser (SSSESIS) and CDR3' has the amino acid sequence Gln-Gln-Ser-Asn-Thr-Trp-Pro-Phe-Thr (QQSNTWPFT), and its direct equivalents.

According to a preferred variant of the invention, the first domain that contains consistently located hypervariable sites CDR1, CDR2 and CDR3, is a heavy chain immunoglobulin and a second domain, which contains consistently located hypervariable sites CDR1', CDR2' and CDR3', is a light chain immunos is Abolina.

The next object of the present invention is a molecule, such as CD45RO/RB binding molecule comprising a polypeptide having the sequence of SEQ ID NO:1 and/or the polypeptide having the sequence of SEQ ID NO:2, preferably the carrier in the same domain polypeptide having the sequence of SEQ ID NO:1, and in another domain polypeptide having the sequence of SEQ ID NO:2, for example, a chimeric monoclonal antibody, and another object is a molecule, such as CD45RO/RB binding molecule that contains a polypeptide having the sequence of SEQ ID NO:3, and/or the polypeptide having the sequence of SEQ ID NO:4, preferably the carrier in the same domain polypeptide having the sequence of SEQ ID NO:3, and in another domain polypeptide having the sequence of SEQ ID NO:4, for example, a chimeric monoclonal antibody.

When antigennegative the site includes the first and second domains, or the polypeptide having the sequence of SEQ ID NO:1 or SEQ ID NO:3, respectively, and a polypeptide having the sequence of SEQ ID NO:2 or SEQ ID NO:4, respectively, they can be localized on the same polypeptide or preferably each domain can be located on different circuits, for example, the first domain may be a part of the heavy chain, for example the heavy chain of the immunoglobulin or its fragment, and a second domain to represent the way the second part of the light chain, for example, the light chain of the immunoglobulin or its fragment.

In the claimed invention, it was found that CD45RO/RB binding molecule according to the present invention is a D45RO/RB-binding molecule from the environment of the organism of a mammal, such as man. Thus, CD45RO/RB binding molecule according to the present invention can be described as monoclonal antibody (MAB), while binding activity is determined mainly by CDR-plots, as described above, for example, these CDR regions can be associated with other molecules, which do not have the ability to specific binding, such as frame parts, such as a constant region, which are primarily human.

Another object of the present invention is a CD45RO/RB binding molecule that is not a monoclonal antibody "A6", described in Aversa, etc., Cellular Immunology 158 (1994), cc.314-328.

The next object of the present invention is a CD45RO/RB binding molecule according to the present invention, which is a chimeric, humanitariannet or fully human monoclonal antibody.

Examples D45RO/PRB-binding molecules include chimeric or humanized antibodies, for example, derived from antibodies produced by b-cells or hybridomas, and Liu the s fragments, for example F(ab')2or Fab fragments and single-chain antibodies or antibodies with a single domain. Single-chain antibody consists of the variable regions of the heavy and light chains of the antibody, covalently linked with a peptide linker, usually consisting of 10 to 30 amino acids, preferably 15 to 25 amino acids. Thus, this structure does not include a constant part of the heavy and light chains and, we can assume that a small peptide spacer must be less antigenic properties compared with full constant field. Under chimeric antibody understand antibody in which the constant region of the heavy and light chain or both chains derived from human antibodies and the variable region of both heavy and light chains derived from antibodies of the body, except the person (e.g., a mouse). Under humanized antibody antibody understand in which hypervariable sites (CDR) derived from the organism than humans (e.g., a mouse), while all or almost all other components, such as a constant region and a highly conserved parts of the variable regions are derived from the human body. However humanitariannet antibody may include a small number of amino acids from the sequence of the mouse in the areas of variable regions adjacent to pervariabilis areas.

Hypervariable sites, i.e. the CDR, the present invention can be associated with any type of frame sections, for example, the constant regions of the heavy and light chains derived from the human body. Acceptable frame sections are described, for example, in "Sequences of Proteins of Immunological Interest", Kabat E.A. and others, US Department of Health and Human Services, Public Health Service, National Institute of Health. Preferably, the constant region of a human heavy chain may be of the IgG1 type, subtypes, preferably constant region of human light chain may be κor λ-type, more preferably κ-type. Preferred constant region of the heavy chain is a polypeptide having the sequence of SEQ ID NO:4 (without plots sequences CDR1', CDR2' and CDR3', described above), and the preferred constant region of the light chain is a polypeptide having the sequence of SEQ ID NO:3 (without plots sequences CDR1, CDR2 and CDR3 described above).

It was also created humanitariannet antibody, which contains a variable region light chain having the amino acid sequence of SEQ ID NO:7 or the amino acid sequence of SEQ ID NO:8, which contains CDR1', CDR2' and CDR3' of the present invention, and the variable region of the heavy chain having the sequence of SEQ ID NO: 9 or SEQ ID NO:10, which contains CDR1, CDR2 and CDR3 on the right is bretania.

The next object of the present invention is humanitariannet antibody that includes a polypeptide having the sequence of SEQ ID NO:9 or SEQ ID NO:10, a polypeptide having the sequence of SEQ ID NO:7 or SEQ ID NO:8.

Another object of the present invention is humanitariannet antibody, which includes

the polypeptide having the sequence of SEQ ID NO:9, and the polypeptide having the sequence of SEQ ID NO:7,

the polypeptide having the sequence of SEQ ID NO:9, and the polypeptide having the sequence of SEQ ID NO:8,

the polypeptide having the sequence of SEQ ID NO:10, a polypeptide having the sequence of SEQ ID NO:7, or

the polypeptide having the sequence of SEQ ID NO:10, a polypeptide having the sequence of SEQ ID NO:8.

The polypeptide of the present invention, for example, having the sequence of, for example, CDR1, CDR2, CDR3, CDR1', CDR2', and CDR3', or SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3. SEQ ID NO:4. SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10, includes direct equivalents of these (poly)peptides (sequence); for example, includes a functional derivative of the specified polypeptide. The functional derivative may include covalent modification of specific sequence and/or functional derivative may include amino acid sequence variants of a particular sequence.

The EU is not specified, the term "polypeptide" includes any peptide or protein comprising amino acids joined together by peptide bonds, amino acid sequence which starts at the N-end and ends at the C-end. Preferably the polypeptide of the present invention is a monoclonal antibody, more preferably a chimeric (transplanted variable regions [V-transplantirovannam]) or humanitariannet (transplanted hypervariable sites [CDR transplantirovannam]) monoclonal antibody. Humanitariannet (CDR transplantirovannam) monoclonal antibody may include additional mutations introduced in the framework (FR) sequences of antibody-acceptor or may not include such mutations.

In the context of the present description functional derivative of the polypeptide includes a molecule that has a qualitative biological activity, the activity of the polypeptide of the present invention, i.e. which has the ability to contact CD45RO and CD45RB. Functional derivative includes fragments and peptide analogs of the polypeptide of the present invention. The fragments represent the region within the sequence of the polypeptide of the present invention, for example, with specific performance is undertaken in the present description the sequence. In the context of the present description, the term "derivative" refers to amino acid sequence variants and covalent modifications of the polypeptide of the present invention, for example, specifically presented in this description of the sequence. Functional derivatives of the polypeptide of the present invention, for example, specifically presented in this description of the sequence, preferably at least about 65%, more preferably at least about 75%, even more preferably about at least 85%, most preferably at least about 95% homologous to a complete sequence of the amino acid sequence of the polypeptide of the present invention, for example, specifically presented in this description of the sequence, and retain in General the ability to communicate with CD45RO and CD45RB.

The term "covalent modification includes modification of the polypeptide of the present invention, for example, specifically presented in this description of the sequence; or a fragment using organic protein or non-protein derivatizing agent, fusions with heterologous polypeptide sequences and post-translational modifications. Covalently option is lirovannye polypeptides, for example, with specific presents in the present description the sequence, still retain the ability to communicate by cross connection with CD45RO and CD45RB. Typically, covalent modification being introduced by the interaction of amino acid residues of target proteins with organic derivatizing agent who has the ability to interact with the selected lateral or terminal residues, or by accepted mechanisms of post-translational modifications that function in selected recombinant target cells. Certain post-translational modifications are the result of exposure to recombinant target cells on expressively polypeptide. Glutaminyl and asparaginyl remains often diamidino after the broadcast and receipt of relevant glutamine and aspartyl residues. In another embodiment, these residues deaminase in mild acidic conditions. Other post-translational modifications include hydroxylation of Proline and lysine, phosphorylation of hydroxyl groups of the residues was serila, tyrosine or threonine, methylation α-amino group of the side chains of lysine, arginine and histidine (see, for example, ..Creighton, Proteins: Structure and Molecular Properties, W.H.Freeman & Co., San Francisco, cc.79-86 (1983)). Covalent modifications include, for example, a fusion protein containing the polypeptide according to us is oasea the invention, for example, with specific presents in this sequence, and their variants, amino acid sequence, for example, using immunoadhesins, and N-terminal fusion with heterologous signal sequences.

The term "homology" with respect to the native polypeptide and its functional derivative in the context of the present description refers to the percentage of amino acid residues in the sequence is the candidate that is identical to the residues of a corresponding native polypeptide, after aligning the sequences and, if necessary, the introduction of gaps to achieve the maximum percent homology, and in assessing homology are not taken into account any conservative substitutions as one of the criteria of identity of the sequence. No N - or C-terminal extension or insertions are not considered as elements that reduce identity or homology. Methods and computer programs used for the comparative analysis are well known.

The term "amino acid(s)" refers to all naturally occurring, for example, L-α-amino acids and includes D-amino acids. Amino acids represent either using the well-known single-letter code, or by using the three-letter code.

The term "variant of the amino acids of the second sequence" refers to molecules, which have some differences in their amino acid sequences compared to the polypeptide of the present invention, for example, specifically presented in this description of the sequence. Variants of the amino acid sequences of the present invention, for example, a particular in this description of the sequence, still retain the ability to bind to CD45RO and CD45RB. Obtained by replacing options are options in which at least one amino acid residue is deleted and replaced it with another amino acid incorporated at the same position in the polypeptide of the present invention, for example, specifically presented in this description of the sequence. These replacements can be single, when replaced by only one amino acid in the molecule, or they can be multiple, when the same molecule is replaced by two or more amino acids. Obtained through insertion variants are variants in which one or more amino acids is built directly adjacent to an amino acid in a particular position in the polypeptide of the present invention, for example, specifically presented in this description of the sequence. The term "directly adjacent to am what nomikoto" means a connection or α -carboxy-or α-amino functional group of amino acids. Obtained through deletion options means options, in which one or several amino acids in the polypeptide of the present invention, for example, specifically presented in this description of the sequence deleted. As a rule, obtained by deletion of the options should have one or two deletions of amino acids in a specific region of the molecule.

When creating inventions were also identified polynucleotide sequence

- GGCCAGTCAGAACATTGGCACAAGCATACAGTG, which encodes the amino acid sequence of CDR1,

- TTCTTCTGAGTCTATCTCTGG, which encodes the amino acid sequence of CDR 2,

- ACAAAGTAATACCTGGCCATTCACGTT, which encodes the amino acid sequence of CDR 3,

- TTATATTATCCACTG, which encodes the amino acid sequence of CDR1',

- TTTTAATCCTTACAATCATGGTACTAAGTACAATGAGAAGTTCAAAGGCAG, which encodes the amino acid sequence of CDR2',

- AGGACCCTATGCCTGGTTTGACACCTG, which encodes the amino acid sequence of CDR3',

- SEQ ID NO:5, which encodes a polypeptide having the sequence of SEQ ID NO:1, i.e. variable region light chain Mat according to the present invention;

- SEQ ID NO:6 which encodes a polypeptide having the sequence of SEQ ID NO:2, i.e. the variable region of the heavy chain Mat according to the present invention;

- SEQ ID NO:11, which is th encodes the polypeptide, having the sequence of SEQ ID NO:9, i.e. warbelow region of the heavy chain, including CDR1, CDR2 and CDR3 of the present invention;

SEQ ID NO:12, which encodes a polypeptide having the sequence of SEQ ID NO:10, i.e. the variable region of the heavy chain, including CDR1, CDR2 and CDR3 of the present invention;

- SEQ ID NO:13, which encodes a polypeptide having the sequence of SEQ ID NO:7, i.e. the variable region of light chain, including CDR1', CDR2' and CDR3' of the present invention, and

- SEQ ID NO:14, which encodes a polypeptide having the sequence of SEQ ID NO:8, i.e. the variable region of light chain, including CDR1', CDR2' and CDR3' according to the present invention. Another object of the present invention are selected polynucleotide containing polynucleotide that encode CD45RO/RB binding molecule, for example, which encode the amino acid sequence of CDR1, CDR2 and CDR3 of the present invention and/or, preferably and polynucleotide that encode the amino acid sequence of CDR1', CDR2' and CDR3' according to the present invention; and polynucleotide containing polynucleotide having the sequence of SEQ ID NO:5, and/or, preferably and polynucleotide having the sequence of SEQ ID NO:6; and polynucleotide containing polynucleotide that encode the polypeptide having the sequence of SEQ ID NO:7 or SEQ ID NO:8, a polypeptide having the series is here SEQ ID NO:9 or SEQ ID NO:10, for example, encoding

the polypeptide having the sequence of SEQ ID NO:7, and the polypeptide having the sequence of SEQ ID NO:9,

the polypeptide having the sequence of SEQ ID NO:7, and the polypeptide having the sequence of SEQ ID NO:10,

the polypeptide having the sequence of SEQ ID NO:8, a polypeptide having the sequence of SEQ ID NO:9, or

the polypeptide having the sequence of SEQ ID NO:8, a polypeptide having the sequence of SEQ ID NO:10, and

- polynucleotide containing polynucleotide having the sequence of SEQ ID NO:11 or SEQ ID NO:12, and polynucleotide having the sequence of SEQ ID NO:13, or polynucleotide having the sequence of SEQ ID NO:14, preferably containing

- polynucleotide having the sequence of SEQ ID NO:11, and polynucleotide having the sequence of SEQ ID NO:13,

- polynucleotide having the sequence of SEQ ID NO:11, and polynucleotide having the sequence of SEQ ID NO:14,

- polynucleotide having the sequence of SEQ ID NO:12, and polynucleotide having the sequence of SEQ ID NO:13, or

- polynucleotide having the sequence of SEQ ID NO:12, and polynucleotide having the sequence of SEQ ID NO:14.

Unless otherwise indicated, the term "polynucleotide" in the context of the present description includes any polyribonucleotide or polyethoxylated, which may represent remodification or DNA or modified RNA or DNA including (but not limited to) single - and double-stranded RNA, and RNA that is a mixture of single - and double-stranded regions.

Polynucleotide of the present invention, for example polynucleotide encoding the amino acid sequence of CDR1, CDR2, CDR3, CDR1', CDR2', and CDR3', or SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3. SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10, respectively, such as polynucleotide having the sequence of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13 or SEQ ID NO:14, respectively, includes allelic variants and/or their complements; for example, includes polynucleotide that hybridizes with nucleotide sequence SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13 or SEQ ID NO:14, respectively; for example, which encodes a polypeptide that is identical to 80% SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10, respectively, for example, including a functional derivative of this polypeptide, for example, functional derivative, which is at least 65% homologous to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7, SEQ ID N0:8, SEQ ID NO:9 or SEQ ID NO:10, respectively, for example, functional derivative, which involves covalent modification of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10, respectively, for example, functional derivative, which includes variants amino acid sequence SEQ ID NO:1, SEQ ID NO:2, SQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7. SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10, respectively; for example, SEQ ID NO:5, SEQ ID NO:6. SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13 or SEQ ID NO:14, respectively, includes the sequence obtained as a result of the redundancy (degeneracy) of the genetic code which encodes the polypeptide having the sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10, respectively, or encodes a polypeptide, the amino acid sequence of which at least 80% identical to the amino acid sequence of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10, respectively.

CD45RO/RB binding molecule, for example, represents a chimeric or humanitariannet antibody can be obtained using methods of recombinant DNA. Thus, it is possible to construct one or more DNA molecules encoding CD45RO/RB, placing them under the control of appropriate regulatory sequences and transferring in a suitable host (the body) for expression using the appropriate vector.

The next object of the present invention is polynucleotide, which encodes one of the heavy and/or light chain CD45RO/RB binding molecule according to the present invention, and the use of polynucleotide of the present invention to obtain a CD45RO/RB binding molecule according to the present invention, the methods of recombinase is.

CD45RO/RB binding molecule can be obtained, for example, using a method similar to conventional, in combination with information provided in the present description, for example, based on amino acid sequence hypervariable or variable regions and polynucleotide sequences encoding these areas. Method of constructing variable domain gene is described, for example, in EP 239400 and can be summarized as follows: this method allows you to clone the gene encoding the variable region of the Mat, regardless of its specificity. Define the segments of DNA that encode frame and hypervariable sites, and remove segments of DNA encoding the hypervariable sites. Cartridge bearing double-stranded synthetic CDR produced by DNA synthesis on the basis presented in the present description sequence data CDR and CDR'. These tapes are creating so that they had a "sticky" ends, so that they can be embedded by ligating into the joints of the required frame of human origin. Polynucleotide encoding single-chain antibodies, can also be obtained, for example, using a method similar to conventional. Thus obtained polynucleotide of the present invention is conveniently carried in an appropriate expression vector.

P is ielemia cell line can be created, for example, using a method similar to conventional. Expression vectors, for example, contains acceptable(s) promoter(s) and the genes encoding the constant region of the heavy and light chain, for example, are known and are commercially available. Acceptable hosts are known or they can be obtained, for example, using a method similar to conventional, and they include cell culture or transgenic animals.

Another object of the present invention is an expression vector containing polynucleotide, which encodes a CD45RO/RB binding molecule according to the present invention, for example, having the sequence of SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or SEQ ID NO:18.

The next object of the present invention is

the expression system containing polynucleotide of the present invention, and this expression system or part thereof has the ability to produce a CD45RO/RB binding molecule according to the present invention, when the expression system or part thereof is present in a compatible cell host, and

- selected a host cell containing an expression system as defined above.

In the claimed invention was also found to be a CD45RO/RB binding molecule according to the present invention inhibits primary alloimmune responses depending on the dose that was determined in vitro with what omashu MLR. These results suggest that in cells that were alloantibodies, in the presence of CD45RO/RB binding molecule according to the present invention, decreased responses to alloantigen. This confirms the assumption that the CD45RO/RB binding molecule according to the present invention can have a direct impact on effector alloreactive T cells and modulate their function. In addition, the functional properties of T cells obtained through primary MLR, additionally investigated in experiments on repeated stimulation (restimulation) using secondary MLR, using specific cell stimulants or more secondary stimulants to assess the specificity of the observed functional effects. In the claimed invention, it was found that the cells obtained by the primary MLR, which was attended by D45RO/RB binding molecule according to the present invention, decreased ability to respond to subsequent optimal stimulation with specific cell-stimulants, although in the secondary culture has not added any antibodies. The specificity of inhibition was assessed by the ability of cells treated CD45RO/RB binding molecule according to the present invention, it is normal to respond to cell stimulants from the unrelated additional WTO is ostatnich donors. Thus, the restimulation experiments using T cells derived from primary MLR cultures, suggests that the cells that were alloantibodies, in the presence of CD45RO/RB binding molecule according to the present invention was hyporeactivity, i.e. tolerant to the original alloantigen.

In addition, it was found that cell proliferation in cells pre-treated D45RO/RB binding molecule according to the present invention, it is possible to stop using exogenous IL-2. This suggests that the processing alloreactive T cells CD45RO/RB binding molecule according to the present invention induces a state of tolerance. Thus, the reduced capacity for proliferation observed in cells treated D45RO/RB binding molecule according to the present invention results in reduced T-cell function, and these cells acquire the ability to respond to exogenous IL-2, suggesting that these cells acquire anergicakimi, the true state of immunologic tolerance. The specificity of this response proved by the ability of cells treated D45RO/RB binding molecule according to the present invention, it is normal for an unrelated cell donor proliferation, corresponding to the level of proliferation control untreated cells./p>

In addition, experiments indicate that the binding D45RO/RB-binding molecules of the present invention with CD45RO and CD45RB may inhibit secondary immune responses (booster response) mononuclear cells of peripheral blood (RVMS) immunized donors on specific "resurrected" antigen. Thus, the binding D45RO/RB-binding molecules of the present invention with CD45RO and CD45RB effectively in relation to inhibition of secondary immune responses to soluble antigen (AG). The ability CD45RO/RB - connected component molecules of the present invention to inhibit secondary immune responses to tetanus toxin in RVMS immunized donors suggests that D45RO/RB binding molecule according to the present invention has the ability to direct and modulate the activation of T-cell memory. For example, these data indicate that CD45RO/RB binding molecule according to the present invention in addition to the ability to recognize alloreactive and activated T cells can modulate their function, which leads to the induction of T-cell tolerance. This feature may be important for the treatment of inducing immune responses to autoantigens and allergens and possibly alloantigen that are found in autoimmune diseases, allergies and chronic rejection, and when t is such illnesses, as psoriasis, chronic inflammatory bowel disease, in which secondary immune responses play a role in maintaining the disease condition. It is likely to be important for painful conditions, such as autoimmune diseases, in which secondary immune responses to autoantigens may play a major role in maintaining the disease condition.

In the claimed invention, it was found that CD45RO/RB binding molecule according to the present invention can modulate T-cell proliferative immune responses in the response of lymphocytes in a mixed culture (MLR) in vivo, i.e. it is established that CD45RO/RB binding molecule according to the present invention has the appropriate any abscopal properties when tested in vivo.

Thus, D45RO/RB binding molecule according to the present invention may possess immunosuppressive and causing immunological tolerance properties and it can be used in vivo and ex vivo for the induction of tolerance to alloantigens, autoantigens, allergens and antigens of bacterial flora, for example, CD45RO/RB binding molecule according to the present invention can be used for the treatment and prevention of diseases, for example, including autoimmune diseases such as (but not limited to) rheumatoid arthritis, autoimmune thyroiditis, graves ' disease diabetes type I and type II multiple sclerosis, systemic lupus erythematosus, Sjogren syndrome, scleroderma, autoimmune gastritis, glomerulonephritis, graft rejection, for example, rejection of the allograft and xenograft organ and tissue, graft-versus-host (GVHD), as well as psoriasis, inflammatory bowel disease and allergies.

Another object of the present invention is the use of D45RO/RB-binding molecules of the present invention as a pharmaceutical agent intended, for example, for the treatment and prevention of autoimmune diseases, transplant rejection, psoriasis, inflammatory bowel disease, and various types of allergies.

The next object of the present invention is a CD45RO/RB binding molecule according to the present invention, intended for the preparation of a medicine for the treatment and prevention of diseases associated with autoimmune diseases, graft rejection, psoriasis, inflammatory bowel disease and allergies.

Another object of the present invention is a pharmaceutical composition comprising D45RO/RB binding molecule according to the present invention in combination with at least one pharmaceutically acceptable carrier or diluent.

Pharmaceutical composition which may contain additional, for example, active substances, for example, other antibodies-immune modulators, such as (but not limited to, antibodies to ICOS antibodies to CD154 antibodies to CD134L, or recombinant proteins, such as (but not limited to) rCTLA-4 (CD152), Goh (CD134), or immunomodulators, such as (but not limited to, cyclosporin A, FTY720, RAD, rapamycin, FK506, 15-desoxypeganine, steroids.

The next object of the present invention is a method of treatment and/or prevention of diseases associated with autoimmune diseases, graft rejection, psoriasis, inflammatory bowel disease and allergies, which provides for introduction to a patient in need of such treatment and/or prevention, an effective amount D45RO/RB-binding molecules of the present invention, for example, in the form of pharmaceutical compositions of the present invention.

Autoimmune disease to be treated with the binding molecules of the present invention, include additional (but not limited to) rheumatoid arthritis, autoimmune thyroiditis, graves ' disease, diabetes type I and type II, multiple sclerosis, systemic lupus erythematosus, Sjogren syndrome, scleroderma, autoimmune gastritis, glomerulonephritis; graft rejection, such as rejection of the allograft and xenograft organ and the Kani, the graft-versus-host (GVHD).

Examples

Below the invention is illustrated in the examples which do not limit its scope. In the examples below, all temperatures are given in degrees Celsius.

"Mat candidate" or "chimeric antibody" is a CD45RO/RB binding molecule according to the present invention, which contains a light chain having the sequence of SEQ ID NO:3 and a heavy chain having the sequence of SEQ ID NO:4.

Used the following abbreviations:

Solid-phase ELISA immunnofermentye analysis

FACS fluorescence method for separating cells lymphocytes

FITZ fluorescently

FBS fetal bovine serum

GVHD graft-versus-host"

HCMV promoter of the human cytomegalovirus

IgE immunoglobulin isotype E

IgG immunoglobulin isotype G

SFR phosphate buffered saline

PCR (polymer chain reaction

crtp reaction "xenograft versus host"

Example 1. The primary reaction of lymphocytes in a mixed culture (MLR)

Cells

Blood samples obtained from blood of healthy volunteers. Mononuclear cells from peripheral blood (RVMS) was isolated by centrifugation in picole Pak (firm Pharmacia LKB) from peripheral leucocytes in peripheral blood leukocytes obtained as a result of proceed the market, related reinfuse purified blood or leukocyte films known type of blood, but of unknown HLA type. In some MLR experiments RUMS used directly as a cell stimulant after irradiation (40 Gy). In other experiments, T cells obtained from RPMS using pellet-type CD2 or CD3 Dynabead (firm Dynal, Oslo, Norway). Granules and associated cells emit magnetic fields. RVMS with remote T-cells ("exhausted" RVMS) after irradiation is used as a cell stimulant.

RVMS, CD3+-T cells or CD4+T-cells are used in MLR as cell-responders. Cells obtained from donors other than cell-stimulants. CD3+-T cells purified by negative selection using the Mat to CD16 (firm Zymed, California, granules type Dynabead loaded with goat antibody to mouse IgG, granules type Dynabead loaded with antibody to CD14, granules type Dynabead loaded with antibody to CD19. In addition, for the purification of CD4+-T-cells using pellets type Dynabead loaded with antibody to CD8. Derived cells analyzed by FACScan or FACSCalibur, Becton Dickinson & Co., California, the purity of the obtained cells is >75%. Cells suspended in RPMI1640 medium, supplemented with 10% inactivated using heat treatment FBS, penicillin, stratoni the other and L-glutamine.

Reagents

Also construct chimeric Mat to CD45RO/RB, i.e. the Mat candidate", and chimeric body of the appropriate isotype. Mouse (human) control antibody IgG1specific against KLH (hemocyanin lymph snails) or recombinant human IL-10 receive from the company BD Pharmingen (San Diego, California). Mat to human CD154 s receive according to the method described by Lederman and others, 1992.

The primary reaction of lymphocytes in a mixed culture (MLR)

Aliquot 1×105RVMS or 5×104CD3+- or CD4+cells mixed with 1×105irradiated RVMS or 5×104irradiated (50 Gy) RVMS with remote T-cells in each well of 96-well culture plates (firm Costar, Cambridge, Massachusetts) in the presence of the specified Mat or without Al. In some experiments to Mat-candidate add F(ab')2-fragment goat antimisting Ig or goat anti-human Ig specific for the Fc fragment (firm Jackson Measurement Research, West grove, PA) at 10 µg/ml in order to ensure optimal binding in vitro with molecules of target CD45.

Mixed cells were cultured for 4-5 days at 37°With 5% CO2and determine their proliferation by introducing into the cell tags3H-thymidine during the last 16 to 20 h of cultivation.

Other pilot phase of the coefficients have the same method but with the following changes: 1) used the environment represents the environment EX VIVO (firm Bio-Whittaker)containing 10% FBS and 1% human plasma; 2) at the stage of secondary cross-linkage using the total antibody to mouse IgG (5 μg/ml); 3) the irradiation is carried out at 60 Gy.

Primary MLR is carried out in the presence of the Mat candidate or control chimeric IgG1(10 µg/ml) in both cases with the reagent for the second stage, F(ab')2fragment goat antibodies to human Ig specific for the Fc fragment (10 μg/ml). The percentage of inhibition "Mat-candidate calculated by comparing the cell proliferation in the presence of control IgG1. The results are presented below in table 1.

Table 1
Inhibition of primary MLR with 10 μg/ml "Mat candidate" according to the present invention
ResponderThe stimulator (irradiated, RVMS)% inhibition
No. 211 CD4No. 219 CD363,51
No. 220 CD4No. 219 CD3, "exhausted"63,07
No. 227 CD4No. 220 CD3, "exhausted"65,96
No. 229 CD4No. 219 CD3, "exhausted"50,76
Average±SKO60,83±6,83*
* Significant difference from control data (P<0,001)

As can be seen from table 1, the Mat candidate" of the present invention inhibits the primary MLR. The average inhibitory effect is 60,83±6.83 per cent when using CD4+-T cells, obtained from 4 different donors, and is statistically significant.

It is established that the inhibition of primary MLR "Mat-candidate depends on the dose in the range from 0.001 to 10 μg/ml "Mat-candidate", which can be seen from figure 1.

The value of the IC50for inhibition of primary MLR "Mat-candidate is determined on the basis of the results of three different MLR experiments using RVMS a single donor as cell-responders. So, respondere CD4+-T-cells of donor No. 229 and # 219 and irradiated RVMS with remote T-cells as stimulators are mixed in the presence of the Mat candidate or chimeric Antibody with 10 μg/ml F(ab')2fragment goat anti-human Ig. The experiment was repeated three times and calculate the percentage of proliferation in the presence of the Mat candidate" in comparison with T-cell proliferation in the presence of a control Antibody. The value of the IC50estimated using the program Origin (V. 6.0®). The calculated value IC50for cellular activity is 0,87±,35 nm (0,13± 0,052 µg/ml).

Example 2. Secondary MLR

To assess the ability of the Mat candidate" to induce immunological tolerance in CD4+-T cells to specific alloantigens after initial work in secondary MLR MLR in the absence of any antibody. CD4+-T cells were cultured together with irradiated allogeneic cells stimulants (RVMS with remote T-cells) in the presence of the indicated antibodies in 96-lunar cultural tablets for 10 days (primary MLR). The cells are then harvested, layer in the gradient fecal pack to remove dead cells are washed twice with RPMI medium and re-stimulated with the same stimulator, other secondary cells stimulants or IL-2 (50 units/ml). Cells cultured for 3 days and determine the proliferative response by introducing into the cell tags3H-thymidine during the last 16 -20 h of cultivation.

In particular, CD4+-T cells were cultured with irradiated allogeneic cells stimulants (obtained from the blood of other donors RVMS with remote T-cells) in the presence of 10 μg/ml "Mat-candidate", the control IgG1, chimeric Antibodies and F(ab')2fragment goat anti-human Ig. Proliferation in primary MLR determined on the 5th day. For the secondary MLR responder and cell stimulants cultured for 10 days in the presence of the Mat candidate", the cells are then harvested, washed twice with RPMI 1640 and re-stimulate specific stimulator, other minor stimulants or IL-2 (50 units/ml) in the absence of any Antibody. Cell proliferation assessed on day 3. The results are presented in table 2.

Table 2
No. of donor CD4+ T-cell responders% inhibition in secondary MLR
No. 21149,90*
No. 22059,33*
No. 22758,68*
* Significantly difference from the control data (p=<0.001 at the evaluation with t-test, the program SigmaStat V.2.03). #R=<0,046

To assess whether the deterioration in the proliferation of the result of immunological tolerance due process "Mat-candidate", the resulting primary MLR cells cultured in the presence of IL-2 (50 units/ml). In the primary MLR adding IL-2 leads to the restoration of proliferative responses of T cells treated "Mat-candidate", to levels similar to the levels observed in the presence of control antibodies as IgG1. These data suggest that the deterioration of the secondary reaction of T cells treated "Mat-candidate is R is the result of functional changes in T-cell-responders, they become insensitive with respect to specific cells stimulants.

The percentage of inhibition calculated from the following formula:

Statistical analysis performed using the program SigmaStat (version 2.03).

Data analyzed by bidirectional analysis of variance with subsequent analysis according to the method of Dunnett. All procedures analysis probability <0.05 is considered as statistically significant. In some experiments using t-test (program SigmaStat V.2.03).

Example 3. Survival analysis in vivo using SCID mice

Engraftment of hu-PBL (human peripheral blood lymphocytes) in SCID mice

Mononuclear cells from human peripheral blood (RVMS) injected intraperitoneally SCID-mice SV/GbmsTac-PrkdcscidLystbg(firm Taconic, Germantown, NY) in a quantity sufficient for the induction of lethal reactions "xenograft versus host (crtp) >90% of mice within 4 weeks after transfer of cells. Thus treated SCID mice indicated hereinafter referred to as hu-PBL-SCID mouse.

Processing the Mat hu-PBL-SCID mice

Hu-PBL-SCID mice treated with the Mat candidate" or murine or chimeric an appropriate isotype control pad on day 0, i.e. immediately after injection RPMS, then on day 3, day 7, and then the one-week intervals. Mat injected subcutaneously in 100 μl SFR at a final concentration of 5 mg/kg of body weight. Processing stops after the death of all control mice.

Evaluation of treatment results

In this experiment, the main criterion for evaluating the effectiveness of the Mat candidate" is the survival of hu-PBL-SCID mice. The reliability of these results were evaluated using statistical methods survival analysis with Log-rank criterion (method of Mantel (Mantel)) using the program Systat v9.01. Method of survival analysis is a nonparametric test, which takes into account not only the data about the survival of a particular mouse, but the fact that the mouse was put to death for reasons not related to treatment/disease, for example to analyze its organs/cells in vitro. Additional studies take a biopsy of the liver, lung, kidney and spleen of the dead mice. In addition, hu-PBL-SCID mice are weighed at the beginning (before migrating cells) and in the course of the experiment (every two experiment), an indirect criterion of their health. Build the graph of the linear regression line based on the body weight of each mouse depending on the number of days after transfer RPMS and then compare the slopes of the curves (obtained for control mice in comparison with the processed antibody CD45 mice) with Nepal is emeticheskogo criterion Mann-Whitney (Mann-Whitney).

Results

All hu-PBL-SCID mice treated with mouse control pad detected by the human leukocyte infiltration in the lung, liver and spleen, and they died (4/4) for about 2-3 weeks after transfer of cells. Their death is probably the result of crtp. In addition, the processed control Mat mice was linear weight loss of about 10% or more within 3 weeks.

All hu-PBL-SCID mice treated "Mat candidate, has survived (4/4) and had no symptoms of the disease for more than 4 weeks, even if the processing of the Mat candidate was stopped after 3 weeks. The finished Mat candidate mice was linear addition of weight to about 5% within 4 weeks.

Example 4. Expression of antibodies according to the invention

Expression gumanitarnogo antibodies containing SEQ ID NO:7, SEO ID NO:8, SEQ ID NO:9 or SEO ID NO:10

Construct expression vectors, plasmid map of which is presented in figure 2-5, containing the appropriate nucleotides that encode the amino acid sequence of humanized variable region of the light chain humVl (SEQ ID NO:7), humanized variable region of the light chain humV2 (SEQ ID NO:8), humanized variable regions of the heavy chain VHE (SEQ ID NO:9) or humanized variable regions of the heavy chain VHQ (SEQ ID NO:10), respectively. These expressions the e vectors are nucleotide (DNA) sequence is SEQ ID NO 15, SEQ ID NO 16, SEQ ID NO 17 or SEQ ID NO 18, respectively.

Construction of expression vectors carrying the heavy and light chain gumanitarnogo antibodies

Expression vectors for versions VLh and VLm human Kappa light-chain

To construct the final expression vector encoding full humanitarian light chain of the human Kappa isotype, DNA fragments encoding the variable regions of complete light chain (VLh and VLm), cut out from the containing VLh and VLm cloning vector PCR-Script (the company Stratagene) (VLm-region)using HindIII and BglII. Purified by gel fragments then subcloning sites HindIII and BamHI expression vector C21-HCMV Carr created in the design process gumanitarnogo antibodies to IgE TESC-21 (Kolbinger and others 1993), which was originally obtained from M. Bendig (MRC Collaborative Centre, London, UK) (Maeda and others 1991). Obtained by ligating the products are purified by extraction with phenol/chloroform and transferred by electroporation into competent for electroporation strain Epicurian Coli® XL1-Blue (catalog No. 200228, the company Stratagene). After plating on agar plates LB/amp (Wednesday LB/ampicillin) and incubation overnight at 37°With every 12 colonies are harvested for preparation of plasmid DNA from 3 ml of culture using the device BioRobot 9600 (firm Qiagen). This allows to obtain expressio the vectors for light chain version VLh and VLm respectively gumanitarnogo antibodies what is additionally presented on the drawings.

Expression vectors for version VHO human heavy gamma-1 chain

To construct the expression vector VHQ use a staged approach. First, using PCR create variable region VHQ according to the procedure described in Kolbinger and others (Protein Eng., 1993 Nov; 6(8): cc.971-80), and subcloning in the expression vector C21-HCMV-gamma-1, from which the insert C21 was removed using the same enzymes. Then HindIII/BamHI-fragment PCRScript clone VHQ, containing the complete variable region, subcloning in the expression vector C21-HCMV-gamma-1, cleaved with the same enzymes. So get the final expression vector for version VHQ gumanitarnogo antibodies.

Expression vectors for version VHE human heavy gamma-1 chain

Designing end-VHE-expression vector encoding full humanitarian heavy chain of the human gamma-1-isotype, direct injection by ligating the cleaved with HindIII and BamHI PCR fragment encoding the variable region, sites HindIII and BamHI expression vector C21-HCMV gamma-1, which was created when designing gumanitarnogo antibodies to IgE TESC-21 (Kolbinger and others 1993), which was originally obtained from M. Bendig (MRC Collaborative Centre, London, UK) (Maed and other 1991).

Transient expression in COS cells

Following the transfection Protocol used for attached COS cells in 150 mm plates for culturing using SuperFect reagent™ Transfection Reagent (catalog No. 301305, the company Qiagen). For transient transfection of cells using 4 different above-described expression vector. For expression gumanitarnogo antibodies each of the two clones containing integrated heavy chain (VHE or VHQ, respectively), transfection cells together with each of the two clones encoding a light chain (humVl or humV2 respectively), receiving a total of 4 different combinations of expression vectors of the heavy and light chains (VHE/humVl, VHE/humV2, VHQ/humV1 and VHQ/humV2). Before transfection the plasmids linearized using restrictase PvuI, which carries out the cleavage in the region that encodes a gene of resistance to ampicillin. 1 day before transfection 4×106of COS cells in 30 ml of fresh culture medium were seeded in 150-mm Cup for cultivation. Seeding of cells with the specified density, as a rule, allows to achieve 80%confluently in 24 hours on the day of transfection with 4 different combinations of the linearized expression vectors carrying DNA heavy and light chains (15 μg each), diluted in a total volume of 900 μl of fresh serum-free the Reda, not containing antibiotics. Then 180 μl of reagent SuperFect Transfection Reagent thoroughly mixed with the DNA solution. Containing DNA mixture was incubated for 10 min at room temperature, allowing to form the complex. After the formation of the complex from cell cultures of COS remove environment for the growth and the cells washed once SFR. Then 9 ml of fresh culture medium (containing 10% FBS and antibiotics) is added to each reaction tube containing complex for transfection, and mix well. The final product is immediately transferred into each of the 4 cultures, subject transfection, and gently mix. Then the cell culture is incubated with DNA complexes for 3 h at 37°C and 5% CO2. After inkable environment containing complexes for transfection, removed and replaced with 30 ml of fresh culture medium. 48 h after transfection collect supernatant cultures.

The concentration of supernatant cultures

For analysis by ELISA and FACS supernatant cultures collected from COS cells, transfection plasmids that carry heavy and light chains, concentrate using the following methodology. 10 ml of each supernatant add a device to filter by centrifugation type Centriprep YM-50 Centrifugal Filter Devices (catalogue number 4310, the company Millipore) according to manufacturer's instructions. Filters Cntriprep centrifuged for 10 min at 3000 rpm at room temperature. Then the stage of centrifugation is repeated again using the remaining 20 ml of the supernatant, while the centrifugation during 5 min and monitoring the change in concentration. Obtained as an intermediate product 500 ál of the concentrated supernatant is taken, transferred to a new device type Microcon Centrifugal Filter Devices (catalogue number 42412, firm Microcon) and further concentrated using the Protocol of the manufacturer. Concentrated supernatant centrifuged 4 times for 24 min at 3000 rpm at room temperature, once for 10 min at 6000 rpm and then three times for 5 min, exercising control over the change of concentration. The final volume of the concentrated conditioned medium is 100-120 μl, which corresponds to the original culture medium, concentrated in 250-300 times, and the resulting product is stored at 4°before applying. For comparison and control culture medium retrospectively cells concentrate in the same way, using the above centrifugation Protocol.

Example 5. Evaluation of expression of recombinant human IgG using ELISA

To estimate concentrations of recombinant human IgG antibodies expressed in supernatant cultures was developed and optimized a Protocol is andwich-ELISA, involving the use of human IgG as a standard. Flat-bottomed 96-well titration microplates (catalog number 4-39454, firm Nunc Immunoplate Maxisorp) sensibiliser overnight at 4°With 100 μl of goat anti-human IgG (whole molecule, catalogue number I1011, the company SIGMA) at a final concentration of 0.5 μg/ml in SFR. Then the wells are washed three times with buffer for washing (SFR containing 0.05% Tween-20) and blocked for 1.5 h at 37°With blocking buffer (0.5% BSA in SFR). After three cycles of washing the samples antibodies and standard human IgG (catalog number I4506, the company SIGMA) prepared by serial 1,5-fold dilutions in blocking buffer. 100 ál of diluted sample or standard tolerate duplication in sensitized tablet and incubated for 1 h at room temperature. After incubation tablets washed three times with buffer for washing and then incubated for 1 h with 100 μl of peroxidase from horseradish conjugated with Kappa light-chain goat anti-human IgG (catalog number A-7164, firm SIGMA), diluted based 1/4000 blocking buffer. In the control wells contribute 100 ál of blocking buffer and concentrated normal culture medium. After washing perform colorimetric quantitative determination of bound peroxidase in containing samples experienced) and standard holes, using a set of TMB EIA Buffer Substrate (catalog number 172-1067, the company Bio-Rad), according to manufacturer's instructions. Containing peroxidase mixture was added at the rate of 100 μl per well and incubated for 30 min at room temperature in the dark. The colorimetric reaction is stopped by adding 100 μl of 1 M sulfuric acid, and measure the absorbance in each well at 450 nm using a tablet reader for ELISA (model 3350-UV, the company BioRad).

When the correlation coefficient is 0.998 for the standard curve IgG were obtained following concentration concentrates on four different cultures (concentrated around 250-300 times):

the supernatant VHE/humV1=compared to 8.26 mg/ml

the supernatant VHE/humV2=6,27 mg/ml

the supernatant VHQ/humV1=5,3 mg/ml

the supernatant VHQ/humV2=5,56 mg/ml

Example 6. Competitive analysis FACS (affinity binding)

Human T-cell line PEER is chosen as target cells for FACS analysis due to the fact that they Express on their cell surface antigen CD45. To assess the affinity of binding of supernatants humanized antibodies perform competitive analyses using labeled with FITZ chimeric antibodies as standard and conduct a comparison with the inhibition of purified mouse antibodies and chimeric antibodies. Culture of cell line PEER centrifuged for 10 seconds at 3000 rpm and the environment prowess is so Cells re-suspended in FACS buffer (SFR containing 1% FBS and 0.1% sodium azide) and seeded in 96-well round-bottom tetrazinni the microplate with a density of cells 1×105cells per well. The tablet is centrifuged and the supernatant discarded. For the experiments on the evaluation of the blocking action first in each of the wells add 25 ál were taken at the indicated concentrations concentrated retrospektivnoi environment or isotype corresponding control antibody (negative control), unlabeled murine antibodies or chimeric antibodies (positive control), and concentrated supernatant containing various combinations gumanitarnogo antibodies (samples experienced antibodies). After incubation for 1 h at 4°cell line PEER washed with 200 μl of FACS buffer by centrifugation. The cells are then incubated for 1 h at 4°With chimeric antibody conjugated with FITZ, 25 μl of FACS buffer at a final concentration of 20 μg/ml, the Cells are washed and resuspended in 300 μl of FACS buffer containing 2 μg/ml of iodide of propecia that allows you to open the window in the cell sorting device for viable cells. Preparation of cells analyzed by flow cytometer (FACSCalibur, firm Becton Dickinson).

FACS analysis shows a dose-dependent blockade labeled with fluorochrome Chimera is ntitle concentrated cell supernatants gumanitarnogo antibodies. When using isotype corresponding control antibody not detected no dose-dependent blockade of binding of chimeric antibodies, suggesting that the blocking effect of various combinations gumanitarnogo antibodies is epitopespecific and that epitopespecific probably persists after the humanization process.

Example 7. Biological activity D45RB/RO-binding molecules

In this experiment, we evaluate the possibility D45RB/RO-binding chimeric antibodies, if present in polyclonal cultures of activated primary human T-cells, (I) to support the differentiation of T-cells with a characteristic Treg-phenotype (phenotype of T-regulatory cells), (II) to prevent or enhance apoptosis after activation of T cells and (III) to affect the expression of a subpopulation of antigens and receptors after restimulation.

D45RB/RO-binding chimeric antibody increases cell death in cultures polyclonal activated T-cells

Primary T-cells (a mixture of CD4+and CD8+T-cell subpopulations) is subjected to activation by using the Mat to CD3 plus CD28 (200 ng/ml each) in the presence of D45RB/RO-binding chimeric antibody or without it (control). Excess antibody is removed by washing on the second day. To assess cell death after activation using 7-aminoach inomycin D (7-AAD) as a dye for DNA which is taken up apoptotic and necrotic cells. The results suggest that the activation of T cells in the presence D45RB/RO-binding chimeric antibody increases the fraction of 7-AAD-positive cells more than 2 times on the second day after activation. On the seventh day of the faction of 7-AAD-positive cells again become almost the same in cultures treated with CD45RB/RO-binding chimeric antibody, and in the control cultures.

D45RB/RO-binding chimeric antibody does not control the processed Mat T cells exhibiting the phenotype of T-regulatory cells (Treg)

Increased expression of CD25 and causing the lower regulation of protein CTLA-4 (CD 152) is a marker of Treg cells. Functional suppression of primary and secondary T-cell responses CD45RB/RO-binding chimeric antibody may be a consequence of the induction of Treg cells. To prove this assumption T cells activate using the Mat to CD3+CD28 and cultured in the presence of CD45RB/RO-binding chimeric antibody or control pad to LPS (lipopolysaccharide). The study of the expression of CTLA-4 and CD25 depending on time shows pronounced differences between T-cells treated with control antibodies and CD45RB/RO-binding chimeric antibody on days 1 and 3 after secondary stimulation.

Intracellular expression of CTLA-4 support is zivaetsja in the presence D45RB/RO-binding chimeric antibody

Known evidence that significant amounts of CTLA-4 can be detected within the cells. Therefore, in parallel with staining CTLA-4 on the cell surface analyze intracellular expression of CTLA-4. On day 4 after stimulation between T-cell cultures revealed small differences. However, after prolonged cultivation of high levels of intracellular CTLA-4 was detected only in T-cells treated D45RB/RO-binding chimeric antibody, but not in the control of T-cells.

T cells treated D45RB/RO-binding chimeric antibody, become double-positive for both CD4 and CD8

After stimulation of T-cells is the induction and increasing regulation of expression of several localized surface receptors, such as CD25, CD152 (CTLA-4), CD154 (CD40-ligand) and others In contrast, the level of expression of CD4 or CD8, probably remains relatively constant. Obtained reproducible results regarding the significant increase in the level of both antigens CD4 and CD8 on the surface of T cells treated with CD45RB/RO-binding chimeric antibody, but not on the surface-treated control At T-cells after their activation. The appearance of double-positive in respect of CD4/CD8 T-cell population, probably the result of increasing regulation of CD4 to CD8+-subpopulations and Vice versa, i.e CD8 to CD4+subpopulations. This contrasts with a relatively low percentage of double-positive T cells in the control cultures.

High level of expression of the alpha chain of the receptor for IL-2, but a very low level of expression of beta chain after processing T cells CD45RB/RO-binding chimeric antibody

It is known that Treg cells are constitutive positive against CD25, i.e., alpha-chain of IL-2. There are no data on the regulation of other subunits of the trimeric receptor of IL-2 in Treg cells. In the claimed invention, the comparison of the expression of the beta-chain of the receptor for IL-2, such as a CD 122 on the T-cells activated and expanded in the presence of CD45RB/RO-binding chimeric antibody or without him. The results indicate that T cells treated CD4 5 RB/RO-binding chimeric antibody, have approximately 10-fold lower expression level of CD 122 compared with T cells in the control cultures. This difference may indicate that Treg cells for proliferation requires factors other than IL-2.

Example 8. Sequence according to the invention, (the CDR sequences according to the invention are underlined), look after the claims.

1. Linking molecule that is a humanized antibody to bind to the CD45RO and CD45RB containing at least one antigennegative website, which includes posledovatelnostyu hypervariable sites CDR1, CDR2 and CDR3 of the heavy chain, where the CDR1 has the amino acid sequence Asn-Tyr-Ile-Ile-His (NYIIH), CDR2 has the amino acid sequence Tyr-Phe-Asn-Pro-Tyr-Asn-His-Gly-Thr-Lys-Tyr-Asn-Glu-Lys-Phe-Lys-Gly (YFNPYNHGTKYNEKFKG) and CDR3 has the amino acid sequence Ser-Gly-Pro-Tyr-Ala-Trp-Phc-Asp-Thr(SGPYAWFDT).

2. The binding molecule according to claim 1, which includes

a) a first domain comprising sequentially located hypervariable sites CDR1, CDR2 and CDR3, where CDR1 has the amino acid sequence Asn-Tyr-Ile-Ile-His (NYIIH), CDR2 has the amino acid sequence Tyr-Phe-Asn-Pro-Tyr-Asn-His-Gly-Thr-Lys-Tyr-Asn-Glu-Lys-Phe-Lys-Gly (YFNPYNHGTKYNEKFKG) and CDR3 has the amino acid sequence Ser-Gly-Pro-Tyr-Ala-Trp-Phe-Asp-Thr (SGPYAWFDT); and additionally

b) a second domain comprising sequentially located hypervariable sites CDR1', CDR2' and CDR3' light chain, where CDR1' has the amino acid sequence Arg-Ala-Ser-Gln-Asn-Ile-Gly-Thr-Ser-Ile-Ghi (RASQNIGTSIQ), CDR2' has the amino acid sequence Ser-Ser-Ser-Glu-Ser-Ile-Ser (SSSESIS) and CDR3' has the amino acid sequence of GIn-Gln-Ser-Asn-Thr-Trp-Pro-Phe-Thr (QQSNTWPFT).

3. The binding molecule according to claim 1 or 2, representing humanitariannet monoclonal antibody.

4. The binding molecule according to claim 2, representing a polypeptide that has the sequence of SEQ ID NO:1 and a polypeptide that has the sequence of SEQ ID NO:2.

5. The binding molecule according to claim 2, vklyuchayuschaya, which has the sequence of SEQ ID NO:3 and a polypeptide that has the sequence of SEQ ID NO:4.

6. The binding molecule according to any one of claims 4 or 5, a monoclonal antibody.

7. Linking molecule, representing humanitariannet antibody that binds to CD45RO and CD45RB and includes a polypeptide having the sequence of SEQ ID NO:9 or SEQ ID NO:10, a polypeptide having the sequence of SEQ ID NO:7 or SEQ ID NO:8.

8. The antibody that binds to CD45RO and CD45RB, including

polypeptide that has the sequence of SEQ ID NO:9 and a polypeptide that has the sequence of SEQ ID NO:7,

polypeptide that has the sequence of SEQ ID NO:9 and a polypeptide that has the sequence of SEQ ID NO:8,

polypeptide that has the sequence of SEQ ID NO:10 or a polypeptide that has the sequence SEQ ID N0:7, or

polypeptide that has the sequence SEQ ID N0:10 or a polypeptide that has the sequence of SEQ ID NO:8.

9. Polynucleotide encoding a binding molecule according to any one of claims 1 to 8.

10. Polynucleotide according to claim 9, encoding the amino acid sequence of CDR1, CDR2 and CDR3, CDR1', CDR2' and CDR3' binding molecule according to claim 2.

11. Polynucleotide encoding hypervariable area light chain sequence SEQ ID NO:1 and having the sequence presented is built in SEQ ID NO:5.

12. Polynucleotide encoding hypervariable plot heavy chain sequence of SEQ ID NO:2 and having the sequence represented in SEQ ID NO:6.

13. Polynucleotide encoding hypervariable area light chain sequence SEQ ID NO:7 or SEQ ID NO:8, and hypervariable plot heavy chain sequence of SEQ ID NO:9 or SEQ ID NO:10.

14. Polynucleotide with

the nucleotide sequence of SEQ ID NO:11, coding for hypervariable plot heavy chain sequence of SEQ ID NO:9 and a nucleotide sequence of SEQ ID NO:13 encoding hypervariable area light chain sequence SEQ ID NO:7

15. Polynucleotide with

the nucleotide sequence of SEQ ID NO:12 encoding hypervariable plot heavy chain sequence of SEQ ID NO:10 and the nucleotide sequence of SEQ ID NO:14, coding for hypervariable area light chain sequence SEQ ID NO:8.

16. The expression vector including polynucleotide on any of PP-15.

17. The expression system, including polynucleotide on any of PP-15, where the expression system or part thereof has the ability to produce the polypeptide according to any one of claims 1 to 8, when the expression system or part thereof is present in a compatible cell host.

18. Selected a host cell comprising si is the subject expression by 17.

19. The use of molecules or gumanitarnogo antibody according to any one of claims 1 to 8 to obtain drugs for the treatment of autoimmune diseases, transplant rejection, psoriasis, inflammatory bowel disease and allergies.

20. Pharmaceutical composition for the treatment of autoimmune diseases, transplant rejection, psoriasis, inflammatory bowel disease and allergies, including a molecule or humanitarians antibody according to any one of claims 1 to 8 in combination with at least one pharmaceutically acceptable carrier or diluent.



 

Same patents:

FIELD: genetic engineering.

SUBSTANCE: provides genetic sequence of grass pollen main allergen Phi p 4. Fragments of this sequence, combinations of its partial sequences and point mutants have hypoallergenic action. Recombinant molecules of DNA and derivative polypeptides, fragments, new combination of partial sequences and versions can be applied for treatment of diseases associated with grass pollen allergy.

EFFECT: proteins produced by recombinant methods can be applied for diagnostics of grass pollen allergosis.

16 cl, 8 dwg, 6 tbl

FIELD: gene engineering.

SUBSTANCE: invention can be used for production of recombinant polypeptide of human granulocyte colony-stimulating factor. Recombinant plasmid DNA is constructed in vitro. It includes synthetic gene of human granulocyte colony-stimulating factor, strong constitutive promoter A3 from the early stage of bacteriophage T7 and synthetic section - translation enhancer (TREN) of gene 10 in bacteriophage T7. This DNA in combination with high copy number of plasmid and optimisation of cultivation conditions ensures constitutive biosynthesis of target protein in transformed by this DNA race of Escherichia coli SGK25/pA3GF with high yield.

EFFECT: constitutive biosynthesis of target protein in cells; high yield.

2 cl, 4 dwg, 7 ex

FIELD: gene engineering.

SUBSTANCE: invention relates to gene engineering and may be used for production of recombinant polypeptide of human alfa-2b interferon. Recombinant plasmid DNA is constructed in vitro. It includes synthetic gene of human alfa-2b interferon, tandem of A2 and A3 promoters from the early stage of bacteriophage T7 and synthetic section - translation enhancer. All these elements determine constitutive biosynthesis of target protein in transformed by this DNA race of Escherichia coli SGK25 /pIF TREN with high yield.

EFFECT: high yield.

2 cl, 5 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: described humanised and chimeric CD20 antibodies are designed for treatment of CD20-positive malignant and autoimmune diseases. Antibody is effective with respect to depletion of B-cells of mammals in vivo, contains in variable region of H-chain of CDR3- sequence from antibody to human CD20 and practically all remains of consensus frame region (FR) of human H-chain of subgroup 111. According to invention antibody is used in composition or product, binding CD20. Besides, antibody is used for apoptosis induction, treatment of CB20-positive cancer, autoimmune disease, and rheumatic arthritis. Invention contains nucleic acid (NA) coding antibody, expression vector containing specified NA, and host cell producing recombinant antibody, as well as method of specified antibody production. According to invention antibodies are characterised by minimum antigenicity or no antigenicity at all, that enables to use them for continuous treatment overcoming limits of existing therapeutic compositions application.

EFFECT: enables to use for continuous treatment.

83 cl, 32 dwg, 12 tbl, 16 ex

FIELD: organic chemistry, genetics.

SUBSTANCE: invention refers to genetic engineering. Recombinant plasmid DNA pYAll-39 contains: - Pstl-Pstl-DNA vector fragment pUC19 sized 2700 nucleotide pairs, - Pstl- Pstl - alphoid DNA fragment of human lymphocytes high-specific for centromeric areas of 4th and 9th human chromosomes sized 680 nucleotide pairs. The latter is produced from Pstl restriction fragments of alphoid DNA total fraction as chromosomes hybridization in situ under special conditions of high stiffness with standard saline solution with 55% phormamide. Genetic marker is -Ampr - gen of ampicillin-resistance. Invention enables to reliably identify 4th and 9th human chromosomes in norm and pathology, including preimplantation, prenatal and postnatal diagnostics of chromosome anomaly including aneuploidy at various cancer types, as well as for cytogenetic human genome mapping.

EFFECT: identification of 4th and 9th human chromosomes in norm and pathology.

1 cl, 4 ex

FIELD: technological processess.

SUBSTANCE: oligomeric polypeptide dimmers include ligand-binding leptyne domains. Domains are connected by means of flexible polypeptide linker molecules. Linker molecules might possibly include sites of sensitivity to proteases.

EFFECT: releases biologically active cytokines when injecting to human being or animal.

31 cl, 13 dwg

FIELD: technological processes.

SUBSTANCE: protein variants are suggested that possess lysozyme activity. Protein-based antibacterial substance is described. DNA molecule is discovered that codes the specified protein, and also procariotic cell is discovered that contained the specified DNA molecule. Method is described to prepare protein with the help of procariotic cell.

EFFECT: simplifies preparation of antibacterial substance in commercially significant volumes.

13 cl, 3 ex

FIELD: medicine, molecular biology, antibodies.

SUBSTANCE: invention relates to an antibody raised against CCR5 and comprising: (i) two light chains wherein each light chain comprises product of plasmid expression and designated as pVK:HuPRO140-VK (ATCC - PTA-4097), and (ii) two heavy chains wherein each heavy chain comprises product of plasmid expression and designated as pVg4:HuPRO140 HG2-VH (ATCC - PTA-4098), or plasmid designated as pVg4:HuPRO140 (mut B+D+I)-VH (ATCC - PTA-4099), or fragment of such antibody binding with CCR5 on a human cell surface. Invention relates to nucleic acid encoding light and heavy chains of antibody, expression vector, cell-host transformed with at least one vector, and a method for preparing antibody. Antibody is used as an active component in composition used for inhibition of infection of cells CD4 + HIV-1, and to a pharmaceutical composition used in treatment of a patient with HIV-1 infection. Also, invention relates to antibody conjugate against CCR5 and its using. Use of antibodies provides enhancing effectiveness of prophylaxis and treatment of HIV-1 infection.

EFFECT: valuable medicinal properties of antibody.

31 cl, 23 dwg, 3 ex

FIELD: medicine, immunology, chemistry of peptides.

SUBSTANCE: invention discloses peptides GNA33 representing mimetics of epitopes of microorganisms Neisseria meningitides of the serogroup B showing definite amino acid sequences given in the description and able to induce production of antibodies eliciting complement-mediated bactericidal activity and/or opsonic activity against indicated microorganisms in a mammalian subject. Indicated peptides are used as components of a composition used in a method for production of the immune response reaction against indicated microorganisms in a mammalian subject. Also invention concerns a polynucleotide encoding indicated peptide and recombinant expression vector comprising indicated polynucleotide. Also invention discloses a method for preparing peptide GNA33 by culturing the cell-host comprising recombinant expression vector and assay for the presence of antibodies raised against meningococci B in biological sample using GNA33 peptide. Using the invention provides effectiveness of vaccine raised against MenB and safety for its using for a patient.

EFFECT: valuable biological and medicinal properties of peptides.

11 cl, 6 tbl, 8 dwg, 6 ex

FIELD: biotechnology, biochemistry, molecular biology.

SUBSTANCE: invention represents eucaryotic cell-host that expresses the first polynucleotide encoding the first propeptide and FVII or its functional variants and relates to the first expression unit, and expresses the second polynucleotide encoding the second free propeptide. Each of indicated the first and second propeptides comprises amino acid sequence chosen independently from group consisting of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 and 18. Also, invention relates to a method for preparing vitamin K-dependent proteins, among them and FVII, using abovementioned cell-host, and to a method for preparing this cell-host. Invention provides preparing vitamin K-dependent proteins with the high degree of effectiveness.

EFFECT: improved preparing method of proteins.

38 cl, 3 tbl, 3 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: described humanised and chimeric CD20 antibodies are designed for treatment of CD20-positive malignant and autoimmune diseases. Antibody is effective with respect to depletion of B-cells of mammals in vivo, contains in variable region of H-chain of CDR3- sequence from antibody to human CD20 and practically all remains of consensus frame region (FR) of human H-chain of subgroup 111. According to invention antibody is used in composition or product, binding CD20. Besides, antibody is used for apoptosis induction, treatment of CB20-positive cancer, autoimmune disease, and rheumatic arthritis. Invention contains nucleic acid (NA) coding antibody, expression vector containing specified NA, and host cell producing recombinant antibody, as well as method of specified antibody production. According to invention antibodies are characterised by minimum antigenicity or no antigenicity at all, that enables to use them for continuous treatment overcoming limits of existing therapeutic compositions application.

EFFECT: enables to use for continuous treatment.

83 cl, 32 dwg, 12 tbl, 16 ex

FIELD: medicine, molecular biology, antibodies.

SUBSTANCE: invention relates to an antibody raised against CCR5 and comprising: (i) two light chains wherein each light chain comprises product of plasmid expression and designated as pVK:HuPRO140-VK (ATCC - PTA-4097), and (ii) two heavy chains wherein each heavy chain comprises product of plasmid expression and designated as pVg4:HuPRO140 HG2-VH (ATCC - PTA-4098), or plasmid designated as pVg4:HuPRO140 (mut B+D+I)-VH (ATCC - PTA-4099), or fragment of such antibody binding with CCR5 on a human cell surface. Invention relates to nucleic acid encoding light and heavy chains of antibody, expression vector, cell-host transformed with at least one vector, and a method for preparing antibody. Antibody is used as an active component in composition used for inhibition of infection of cells CD4 + HIV-1, and to a pharmaceutical composition used in treatment of a patient with HIV-1 infection. Also, invention relates to antibody conjugate against CCR5 and its using. Use of antibodies provides enhancing effectiveness of prophylaxis and treatment of HIV-1 infection.

EFFECT: valuable medicinal properties of antibody.

31 cl, 23 dwg, 3 ex

FIELD: biotechnology, immunology.

SUBSTANCE: disclosed are variants of chimerical anti-IL-6 antibodies based on mice CLB-8 antibody. Each antibody contains constant region from one or more human antibodies. Described are variants of nuclear acids encoding anti-IL-6 antibody, vectors and host cells. Developed is method for production of anti-IL-6 antibody by using nuclear acid or vector. Described are variants of composition for application in method for modulation of malignant disease or immune disorder mediated with IL-6. Developed is method for treatment or modulation of malignant disease or immune disorder mediated with IL-6.

EFFECT: variant of chimerical anti-IL-6 antibody with high affinity of mice anti-IL-6 antibody and reduced immonogenicity.

26 cl, 16 dwg, 1 tbl, 8 ex

FIELD: biotechnology, proteins, immunology.

SUBSTANCE: invention proposes fragment of antibody MR1-1 that retains capacity for recognition and binding EGFRvIII and nucleic acid encoding its. Polypeptide is prepared from the known antibody MR1 by mutation of CDR3 VH- and VL-chains. Also, invention describes using a polypeptide for preparing immunotoxin possessing the cytotoxicity property to cells carrying antigen of epidermal growth factor EGFRvIII receptors. Also, invention disclosed immunotoxin based on this polypeptide. Also, invention proposes a method for preparing polypeptide comprising amino acid substitution of at least one amino acid in hypervariable region CDR with amino acid encoded by a codon comprising nucleotide belonging to a hot point motif. The hot point motif is chosen from AGY or RGYW wherein R represents A or G; Y represents C or T, and W represents A or T. Prepared polypeptide is characterized by value Kd for EGFRvIII 7 nM or less. Also, invention describes a method for cell killing that expresses antigen EGFRvIII using a polypeptide. Using this invention provides preparing antibodies showing enhanced cytotoxicity and improved binding EGFRvIII as compared with the parent antibody MR1 that can be used for target-directed delivery of immunotoxins in treatment of malignant neoplasms.

EFFECT: valuable medicinal properties of polypeptide.

34 cl, 7 tbl, 6 dwg, 8 ex

FIELD: biotechnology, genetic engineering.

SUBSTANCE: invention describes recombinant plasmid DNAs constructed in vitro that comprise artificial genes for light and heavy chains of full-scale human antibody prepared by genetic engineering methods. These genes are created on basis of variable fragments of light and heavy chains of recombinant antibody 1F4 and constant human genes IgG1, cytomegalovirus promoter and polyadenylation site BGH. Plasmids provide biosynthesis of recombinant full-scale human antibodies of class IgG1 in mammalian cells. These antibodies interact specifically with smallpox vaccine virus. The affinity constant for prepared recombinant antibodies is 3.54 x 109 ± 0.38 x 109 M-1. Plasmids are used by combined transfection of human cells HEK 293T. Prepared full-scale recombinant antibody against protein of size 27 kDa of smallpox virus vaccine can be used as a base for creature of pharmaceutical preparations used for diagnosis of some post-vaccine complications caused by smallpox virus vaccine. Also, preparations will comprise decreased therapeutic doses of immunoglobulins that will provide minimal undesirable immune response in patients after administration of the preparation.

EFFECT: valuable medicinal properties of plasmid DNA.

4 cl, 7 dwg, 6 ex

FIELD: biotechnology, immunology.

SUBSTANCE: invention describes a monoclonal anti-IFNα antibody that binds with the following subtypes of IFNα: IFNα1, IFNα2, IFNα4, IFNα5, IFNα8, IFNα10 and IFNα21 and comprises three CDR-sites of heavy chain. Amino acid is given in the invention description. Invention discloses heavy chain of anti-IFNα antibody or its fragment that comprise indicated CDR-sites also. Invention describes anti-IFNα antibody that comprises at least one light chain and one heavy chain. Invention discloses variants of nucleic acids encoding indicated antibodies and variants of vectors used for expression of nucleic acids, and variants of transformed host-cells. Among expression vectors invention describes also vectors deposited at № 2881 and № 2882 carrying heavy and light chain of antibody, respectively. Invention describes a method for preparing antibody from indicated cells. Invention discloses the murine hybridoma cell line deposited in ATCC at number № РТА-2917, and antibody produced by indicated cell line. Also, invention describes variants of the antibody-base pharmaceutical composition and a method used for diagnosis of autoimmune disease. Also, invention discloses using antibodies in treatment of disease or state associated with enhanced level of IFNα in a patient. Using the invention provides inhibiting biological activity of at least seven human IFNα subtypes simultaneously, namely: IFNα1, IFNα2, IFNα4, IFNα5, IFNα8, IFNα10 and IFNα12 that can be used in diagnosis and therapy of different human diseases mediated by IFNα, such as insulin-dependent diabetes mellitus or erythematosus lupus.

EFFECT: valuable biological and medicinal properties of antibodies.

53 cl, 4 tbl, 10 dwg, 2 ex

FIELD: biotechnology, immunology, molecular biology, pharmacy.

SUBSTANCE: invention describes variants of MCP-1-binding molecules. One of MCP-1-binding molecule comprises at least one variable region of immunoglobulin (VH) heavy chain comprising of hypervariable sites CDR1, CDR2 and CDR3 while other molecules comprises both light and heavy chains. Invention proposes DNA constructs encoding indicated MCP-1-binding molecules and expressing vector carrying at least one of these DNA constructs. Invention describes a method for preparing MCP-1-binding molecule. Invention discloses a method for treatment of disease or disorder mediated by MCP-1 or eotaxine-1 based on antibody raised to MCP-1 that binds eotaxine-1 by cross mode. Invention describes a pharmaceutical composition based on antibody raised to MCP-1 that binds eotaxine-1 by cross mode and used in treatment of disease or disorder mediated by MCP-1 or eotaxine-1 in a patient. MCP-1-binding molecules inhibit binding MCP-1 with its receptor. The full immobilized antibody is highly specific as far as it binds human recombinant MCP-1 with value KD = (43 ± 2.9) x 1012 and can be used in medicine.

EFFECT: valuable medicinal properties of antibodies, improved method of treatment.

13 cl, 5 dwg, 4 tbl, 2 ex

FIELD: biotechnology, immunology, medicine, oncology.

SUBSTANCE: invention describes variants of monoclonal antibodies showing specificity to TRAIL-receptor DR4. By one of variant antibodies are produced by hybridoma 2E12 recorded in ATCC at number PTA-3798. Each of antibody variants possesses apoptosis-inducing activity both in vivo - in the concentrations less 10 mg/kg in target cells expressing DR4 and in vitro - in the presence of a cross-linking agent in the concentrations less 1 mcg/ml in target cells. Invention discloses variants of methods for selective induction of apoptosis in cells expressing DR4, and variants of methods for inhibition of DR4-expressing cells based on using antibodies. Invention describes variants of compositions, methods for treatment of a patient suffering from inflammatory or autoimmune disease and methods in treatment of a patient suffering from malignant tumor wherein these compositions are based on antibody to DR4 for inducing apoptosis in cells expressing DR4. Also, invention discloses variants of nucleic acids, purified polypeptides, expression vectors and host-cells used in preparing antibody. Using the invention provides delaying tumor growth and decreasing case of its regression that can be used in tumor therapy.

EFFECT: improved and valuable properties of antibody.

103 cl, 169 dwg, 6 tbl, 30 ex

FIELD: biotechnology, microbiology, immunology.

SUBSTANCE: invention proposes peptide from N. meningitides eliciting a sequence SEQ ID NO:10 that is used in treatment or diagnosis. Also, invention proposes polynucleotide encoding this peptide, a host-cell expressing peptide, microorganism, vaccine and antibody showing specificity to peptide proposed. Invention can be used in medicine.

EFFECT: valuable medicinal properties of peptide.

16 cl, 2 tbl

FIELD: gene engineering.

SUBSTANCE: recombinant fragmid DNA pHEN-TAB, containing unique human single-strand antibody gene is selected from constructed in vitro combinatorial phage library udder controlling of lactose operon promoter. Then Escherichia coli HB2151 cells are transformed with obtained fragmid DNA to produce recombinant bacterium strain Escherichia coli HB2151/pHEN-TAB as producer of human single-strand antibody capable of binding of human tumor necrosis factor alpha. Said antibody gas affinity constant of Kaf = 3.96±0.52x108 M-1.

EFFECT: new soluble human single-strand antibody scTAB against human tumor necrosis factor alpha with high affinity.

3 cl, 6 dwg, 6 ex

FIELD: biotechnology, immunology.

SUBSTANCE: disclosed are variants of chimerical anti-IL-6 antibodies based on mice CLB-8 antibody. Each antibody contains constant region from one or more human antibodies. Described are variants of nuclear acids encoding anti-IL-6 antibody, vectors and host cells. Developed is method for production of anti-IL-6 antibody by using nuclear acid or vector. Described are variants of composition for application in method for modulation of malignant disease or immune disorder mediated with IL-6. Developed is method for treatment or modulation of malignant disease or immune disorder mediated with IL-6.

EFFECT: variant of chimerical anti-IL-6 antibody with high affinity of mice anti-IL-6 antibody and reduced immonogenicity.

26 cl, 16 dwg, 1 tbl, 8 ex

Up!