7-phenylpyrazolopyridine compounds

FIELD: chemistry; medicine.

SUBSTANCE: invention pertains to derivatives of 7-phenylpyrazolopyridine with formula (I) ,where R1, R5, R6, R40, R41 and R42 represent different hydrocarbon substitutes or functional groups, its salts or hydrates, and especially to salts of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazolo[1,5-a]pyradin-3-yl-N-tetrahydro-2H-4-pyranylmethylamine. The compound with formula (I), especially salts of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazolo[1,5-a]pyradin-3-yl-N-tetrahydro-2H-4-pyranylmethylamine, act as antagonists of the receptor of corticotrophin release factor and can be used in medicine for treating various diseases of the nervous system and the gastrointestinal tract.

EFFECT: obtaining of new biologically active substances.

162 ex, 5 tbl

 

The present invention relates to new compounds with antagonistic activity against the receptor for corticotropin-releasing factor, their salts and hydrates, to methods for their preparation and to their use as pharmaceuticals.

The corticotropin-releasing factor Corticotropin-Releasing Factor (hereinafter abbreviated as "CRF") is a neuropeptide consisting of 41 amino acids, which was first isolated from Ovine hypothalamus [Science, 213, 1394 (1981)], after which its presence was also confirmed in rats [Proc. Natl. Acad. Sci. USA, 80, 4851 (1983)] and in humans [EMBO J. 5, 775 (1983)]. The greatest number of CRF was observed in the pituitary and hypothalamus and is also widely distributed throughout the cerebral cortex, the cerebellum and other brain areas. Its presence was also confirmed in peripheral tissues such as placenta, adrenal glands, lungs, liver, pancreas and gastrointestinal tract [Exp. Clin. Endocrinol. Diabetes, 105, 65 (1997)]. There were described two subtypes of CRF receptors, CRF1 and CRF2, and it is reported that CRF1 receptors are widely distributed in the cerebral cortex, cerebellum, olfactory bulb, pituitary, almond-shaped gland and everywhere.

It was recently confirmed the presence of the 2 subtypes CRF2 receptor CRF2α and CRF2βand it was found that CRF2α receptors in significant amounts are found in the city is metalmouse, septal nucleus of the Central nervous system and gorodno plexus, whereas CRF2β receptors are located mainly in the peripheral tissues such as skeletal muscle, or in cerebral blood vessels of the Central nervous system [Exp. Clin. Endocrinol. Diabetes, 105, 65 (1997)]. The fact that each of these receptors has a different distribution profile, suggests that their role is also different. CRF is produced and secreted into the hypothalamus and promotirovat caused by stress selection adrenocorticotropic hormone (ACTH) [Recent Prog. Horm. Res., 39, 245 (1983)]. In addition to its endocrine role of CRF functions as a neurotransmitter or neuromodulator in the brain, integrating electrophysiological, autonomic and behavioral changes in response to stress [Brain Res. Rev., 15, 71 (1990); Pharmacol. Rev., 43, 425 (1991)].

CRF is involved in various diseases, known to the present time, as is shown by the following publications.

It was reported elevated concentrations of CRF in the cerebrospinal fluid of patients with deep depression compared with similar indices in healthy individuals; CRF mRNA levels in the hypothalamus of depressed patients is higher than in healthy individuals; the content of CRF receptors in the cerebral cortex is reduced in victims of suicide; the increase in ACTH in the plasma decreases with the introduction of CRF depressed patient is m [Journal of Endocrinology, 160, 1 (1999)]; CRF levels in the cerebrospinal fluid of some restless patients with obsessive-compulsive disorders, disorders associated with post traumatic stress disorder or syndrome Tourette, higher than in healthy individuals [Journal of Endocrinology, 160, 1 (1999)]; the increase in ACTH in the plasma decreases with the introduction of CRF patients with panic disorder type [Exp. Clin. Endocrinol. Diabetes, 105, 65 (1997)]; restless behavior was observed in experimental animals in the intracerebral injection of CRF. In addition, restless behavior more often observed in mice with overexpression of CRF than in normal mice [Journal of Endocrinology, 160, 1 (1999)], and the levels of CRF in the blue spot is reduced due to the introduction anxiolytics [Exp. Clin. Endocrinol. Diabetes, 105, 65 (1997)]. In addition, α-helical CRF(9-41), a CRF antagonist peptide exerts a calming effect in animal models [Brain Res., 509, 80 (1990); Regulatory Peptides, 18, 37 (1987); J. Neurosci., 14(5), 2579 (1994)]; and abnormal behavior associated with abstinence from alcohol or discontinuation of drugs such as cocaine, inhibited α-helical CRF(9-41), a CRF antagonist peptide [Psychopharmacology, 103, 227 (1991)].

CRF inhibits sexual behavior in rats [Nature, 305, 232 (1983)]; CRF reduces sleepiness in rats and thereby participates in sleep disorders. [Pharmacol Biochem. Behav., 26, 699 (1987)]; α-helical CRF(9-41), a CRF antagonist peptide, podavlyaetsya damage or electroencephalograms excitation, caused by cerebral ischemia or activation of NMDA receptors [TIPS, 1/7, 166 (1996)]; CRF action is manifested in the EEG and causes convulsions [Brain Res., 278, 332 (1983)]; the spinal levels of CRF increased in patients with schizophrenia compared with normal individuals [Am. J. Psychiatry, 144 (7), 873 (1987)]; the CRF content in the cerebral cortex is reduced in patients with Alzheimer's disease, in patients with Parkinson's disease and in patients with progressive supranuclear palsy [Neurology, 37, 905 (1987)]; and CRF levels decreased in the nerve nodes in Huntington's disease [Neurology, 37, 905 (1987); Brain Res., 437, 355 (1987)]. In addition, it was found that the introduction of CRF enhances learning and memory in rats [Exp. Clin. Endocrinol. Diabetes, 105, 65 (1997)].

The content of CRF in the cerebrospinal fluid is reduced in patients with amyotrophy lateral sclerosis. The overexpression of ACTH and adrenocorticosteroids demonstrate mice with overexpression of CRF, and these mice show abnormalities similar to Cushing's syndrome, including muscle atrophy, alopecia and infertility [Endocrinology, 130(6), 3378 (1992)]; the level of CRF in the cerebrospinal increased in patients with neuro-psychiatric anorexia compared with healthy individuals, and the increase in ACTH in plasma a little with the introduction of CRF patients with neuro-psychiatric anorexia; and CRF suppresses feeding in experimental animals [TIPS, 17, 166 (1996)]. In addition, α-parallelity CRF(9-41), the CRF antagonist peptide, improves stress hypophagia in animal models [Brain Res. Bull., 17(3), 285 (1986)]; CRF suppresses the increase in body weight in hereditary obese animals; it is assumed link between low levels of CRF syndrome and obesity; and anorexically action and weight loss body under the action of inhibitors of serotonin uptake, possibly mediated by secretion of CRF [TIPS, 17, 166 (1996)].

CRF act of the Central or perifericheskie, weakening contractions of the stomach and reducing the gastric emptying [Annals of the New York Academy of Sciences, 697, 233 (1993)]. In addition, the reduction of gastric functions called abdominal surgery, restored under action α-helical CRF(9-41), CRF antagonist peptide [Am. J. Physiol., 262, G616 (1992)]; and CRF promotiom the secretion of bicarbonate ions in the stomach, thus reducing the secretion of gastric juice and suppressing ulcers caused by stress from exposure to the cold [Am. J. Physiol., 258, G152 (1990)]. Further, the introduction of CRF increases ulcers in animals not exposed to stress [Life Sci., 45, 907 (1989)]; and CRF suppresses transit in the small intestine and promotiom transit in the colon and causes a bowel movement. In addition, α-helical CRF(9-41), a CRF antagonist peptide, has inhibitory effect against gastric secretion caused by susceptible to stress, impaired gastric emptying, impaired transit thin is Chechnya and promotiom transit in the colon [Gastroenterology, 95, 1510 (1988)]; psychological stress in healthy individuals increases anxiety and the feeling of gas and abdominal pain during the expansion of the colon, and CFR reduces the level of discomfort [Gastroenterol., 109, 1772 (1995); Neurogastroenterol. Mot., 8, 9 (1996)]; and patients with irritable bowel syndrome experience excessive acceleration motility of the colon with the introduction of CRF compared with healthy individuals [Gut, 42, 845 (1998)].

Introduction CRF increases blood pressure, heart rate and body temperature, while α-helical CRF(9-41), a CRF antagonist peptide, inhibits stress-induced high blood pressure, heart rate and body temperature [J. Physiol., 460, 221 (1993)]. Production of CRF increases locally at sites of inflammation in experimental animals and in synovial fluid from patients with rheumatoid arthritis [TIPS, 17, 166 (1996)]; CRF triggers mast cell degranulation and promotiom vascular permeability [Endocrinology, 139 (1), 403 (1998)]; CRF determine in patients with autoimmune thyroidism [Am. J. Pathol., 145, 1159 (1994)]; introduction CRF rats with experimental autoimmune encephalomyelitis significantly inhibits the development of symptoms, such as paralysis [J. Immunol., 158, 5751 (1997)]; and urocortin (CRF analog) increases the secretion of growth hormone in the system of culture of pituitary adenomas from patients with acromegaly [Endocri. J., 44, 627 (1997)]. Also, CRF simulates the secretion of cytokines, such as interleukin-1 and interleukin-2, leukocytes [J. Neuroimmunol., 23, 256 (1989); Neurosci. Lett., 120, 151 (1990)]; and the introduction of CRF and stress both inhibit the proliferation of T-lymphocytes and the activity of native killer cells. α-Helical CRF(9-41), a CRF antagonist peptide, improves weak function of these immune cells induced CRF or stress [Endocrinology, 128 (3), 1329 (1991)], and breathing is markedly enhanced by the introduction of CRF [Eur. J. Pharmacol., 182, 405 (1990)]. And, finally, bad breath and insomnia were observed as a result of the introduction of CRF elderly patients in a state of chronic artificial respiration [Acta Endocrinol. Copenh., 127, 200 (1992)].

The above-cited studies suggest that it can be expected that antagonists of CRF will demonstrate excellent results in the treatment or prevention of depression and depressive symptoms, such as depression, episodic depression, recurrent depression, caused by the depression, maltreatment of children and post-traumatic depression, mania, anxiety, General anxiety disorders by type of panic, phobias, obsessive-compulsive disorders, post-traumatic stress syndrome Tourette, autism, affective disorders, mental depression, manic depression, cyclothymic personality, schizophrenia, a disease of the al is camera, senile dementia type Alzheimer's disease, neurodegenerative diseases such as Parkinson's disease and Huntington's disease, multi-infarct vascular dementia, senile dementia, anorexia nervosa, bulimia (hyperphagia) and other nutritional disorders, obesity, diabetes, alcohol dependence, pharmacophilia in respect of such drugs as cocaine, heroin or benzodiazepines, symptoms associated with discontinuation of drugs or alcohol, sleep disorders, insomnia, migraine, stress headache, headache caused by muscle contractions, ischemic neuronal damage, excitotoxicity neuronal damage, stroke, progressive supranuclear paralysis, amyotrophy lateral sclerosis, multiple sclerosis, muscle spasms, chronic fatigue syndrome, psychosocial dwarfism, epilepsy, head injury, spinal cord injury, spasm of the muscles of the palm, spastic torticollis, cervical brachial syndrome, primary glaucoma, Meniere syndrome, imbalance, alopecia, neurosis, such as cardiac neurosis, gastric neurosis and neurosis bladder, peptic ulcer, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative ileus, stress-related gastrointestinal disorders and nervous vomiting, the ISU is TONIA, cardiovascular disorders such as angina, tachycardia, congestive heart failure, hyperventilation syndrome, bronchial asthma, apnea syndrome sudden infant mortality, inflammatory diseases (e.g. rheumatoid arthritis, osteoarthritis, lumbago, etc), pain, allergies (for example, atopic dermatitis, eczema, urticaria, psoriasis, etc), impotence (erectile dysfunction), violation of menopause, human fertilization, infertility, cancer, immune dysfunction associated with HIV, the immune dysfunction caused by stress, hemorrhagic stress, Cushing's syndrome (Cushing's), thyroid gland, encephalomyelitis, acromegaly, incontinence, osteoporosis, etc. as examples of CRF antagonists have been reports about the CRF receptor antagonists of the peptide with modifications, or deletions of parts of the amino acid sequence CRF humans or other mammals, and such antagonists demonstrate the inhibiting ACTH secretion action or anxiolytic effects [Science, 224, 889 (1984); J. Pharmacol. Exp. Ther., 269, 564 (1994); Brain Res. Rev., 15, 71 (1990)]. However derived peptides have little applicability in the quality of drugs from the viewpoint of pharmacokinetics, including their in vivo chemical stability, oral absorption, biostatement and intracerebrally transport.

There are reports of the following n the peptide CRF the antagonists:

[1] Connection pyrazoloacridine (WO 0059907), compounds of pyrazolopyrimidine (WO 0059908), compounds of imidazo[1,2-a]pyrazine (WO 0206286, WO 0262800) and connect imidazo[1,2-a]pyridine (WO 9835967, WO 02062800); and

[2] the compounds of benzimidazole (EP 0812831), compounds of imidazopyrimidines and connecting imidazopyridine (EP 0994877), compounds of imidazo[4,5-c]pyrazole (WO 9910350), compounds of benzimidazole compounds imidazopyridine, connection imidazopyridine and connections imidazothiazole (WO 0001697), compounds 1H-imidazo[4,5-d]pyridazin-7-she and connections 3H-imidazo[4,5-c]pyridine-4-it (WO 0039127), compounds of imidazopyrimidines and connecting imidazopyridine (WO 0144248) and connecting indazole (WO 02058704).

However, none of these compounds is a compound containing substituted by the amino group in 3-position and a substituted phenyl group at the 7-position of the molecule pyrazolo[1,5-a]pyridine, and it is not known compounds, demonstrating CRF antagonism and containing pyrazolo[1,5-a]pyridine skeleton is substituted by the amino group in 3-position and a substituted phenyl group at the 7-position.

There are also reports about the following compounds having the structure of pyrazolo[1,5-a]pyridine: US 5457200, US 4925849, US 5565468 and US 5691347.

However, none of the compounds disclosed in these publications, is not mentioned as showing antagonism against CRF receptor, antidepressant or sedative action action is satisfied. (For example, compounds disclosed in US 5457200 mentioned only from the point of view of their use in colorimetry. Compounds disclosed in US 4925849 mentioned only from the point of view of their use as diuretics and agents for the treatment of hypertension. Compounds disclosed in US5565468 mentioned only in connection with their antagonism towards angiotensin II and narrowing the blood vessels of the action. Compounds disclosed in US 5691347 characterized with respect to their use as agents for the treatment of atherosclerosis and hypercholesterolemia).

In addition, if we compare the structures of the compounds disclosed in each of these publications will be that none of these compounds is a compound containing substituted by the amino group in 3-position and a substituted phenyl group at the 7-position of the pyrazolo[1,5-a]pyridine molecules. Thus, there is no connection that would contain substituted by the amino group in 3-position and a substituted phenyl group at the 7-position of the pyrazolo[1,5-a]pyridine molecule, as is typical for compounds of the present invention, and is not known absolutely no way of obtaining such compounds.

As mentioned above, it is highly desirable to obtain antagonists of CRF receptors, which can be used as drugs, clinically effective agents, which is displayed on the Ute excellent antagonism against CRF receptors, and meet the requirements of pharmacology, dosage and safety in the quality of medicines and still have not been detected. Therefore, the present invention is the creation of excellent new antagonists of CRF receptors.

As a result of numerous persistent experimentation and research in the light disclosed above circumstances discovered new connections pyrazolo[1,5-a]pyridine, showing a significant antagonism against CRF receptors.

The present invention relates to

<1> the compound represented by formula (I):

[where R1represents a group represented by the formula-Glz-Rlz(where Glzrepresents a simple bond, oxygen or sulfur, and Rlzrepresents methyl or ethyl) or methoxymethyl;

R5and R6each independently represents hydrogen, tert-butoxycarbonyl or a group represented by formula-X6b-X7b(where X6bis methylene and X7bis1-6alkyl, C3-8cycloalkyl, tetrahydropyranyl or tetrahydrofuranyl); and two of R40, R41and R42submit C1-6alkoxy, and the other represents a group represented by the formula-V1A-V2a(where V1Arepresents a simple bond, -CO -, 1-6alkylene, C2-6albaniles or C2-6akinyan, and V2arepresents hydrogen, hydroxyl, C1-6alkyl, optionally substituted by 1-3 substituents selected from the group of substituents In the following, C1-6alkoxy, optionally substituted by 1-3 substituents selected from the group of substituents In the below, a group represented by-N(R3cR3d(where R3cand R3deach independently represents hydrogen or C1-6alkyl, optionally substituted by 1-3 substituents selected from the group of substituents In the below), methanesulfonate, p-toluensulfonate, pyrrolidinyl, piperazinil, piperidyl, morpholinyl, C3-8cycloalkyl, tetrahydropyranyl or tetrahydrofuranyl), where the group of substituents B is a group consisting of a fluorine atom, chlorine atom, bromine atom, cyano, C1-6alkoxy, pyrrolidinyl, piperazinil, piperidyl, morpholinyl, C3-8cycloalkyl, tetrahydropyranyl and tetrahydrofuranyl], its salt or hydrate;

<2> connection p.<1>, its salt or hydrate, where R1represents methyl, ethyl, methoxy, methylthio or methoxymethyl;

<3> connection p.<1>, its salt or hydrate, where R40and R42each independently represents C1-6alkoxy, and R41represents a group represented by the formula is:

(where R44and R45each independently represents hydrogen, methyl or ethyl; and R43is1-6alkyl, optionally substituted by 1-3 substituents selected from the group of substituents In the below, where a group of deputies represents the group consisting of fluorine atom, chlorine atom, bromine atom, cyano, C1-6alkoxy, pyrrolidinyl, piperazinil, piperidyl, morpholinyl, C3-8cycloalkyl, tetrahydropyranyl and tetrahydrofuranyl);

<4> a compound represented by the formula:

[where R5tand R6teach independently represents cyclopropylmethyl, (4-tetrahydropyranyl)methyl, (3-tetrahydrofuranyl)methyl or (2-tetrahydrofuranyl)methyl;

R1trepresents methoxy, methylthio, methyl, ethyl or methoxymethyl; and

R43tis1-6alkyl], its salt or hydrate;

<5> connection p.<4>, its salt or hydrate, where R43tis methyl;

<6> connection p.<4>, its salt or hydrate, where R1trepresents methoxy, methylthio or ethyl;

<7> connection p.<4>, its salt or hydrate, where R5tis cyclopropylmethyl or (4-tetrahydropyranyl)methyl;

<8> connection p.<4>, its salt or hydrate, where R5tis (4-then it is carbonated shall robinanil)methyl;

<9> connection p.<4>, its salt or hydrate, where R5tis (4-tetrahydropyranyl)methyl, and R6tis cyclopropylmethyl;

<10> connection p.<1>, its salt or hydrate, where the compound is N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino, N-cyclopropylmethyl-N-7-[4-(ethoxymethyl)-2,6-acid]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino or N-cyclopropylmethyl-N-[7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-(methylsulfanyl)pyrazolo[1,5-a]pyridine-3-yl]-N-tetrahydro-2H-4-paradimethylamino;

<11> connection p.<1>, its salt or hydrate, where the compound is N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino;

<12> connection (except (i) 4-(hydroxymethyl)-2,6-dimethoxyaniline acid and (ii) 4-(((tert-butyldiphenylsilyl)oxy)methyl)-2,6-dimethoxyaniline acid),

represented by the formula:

[where R48represents hydrogen, C1-6alkyl, optionally substituted by 1-3 substituents selected from the group of substituents In the below, benzyl, optionally substituted by 1-3 substituents selected from the group of substituents In the following 2-tet is hydroporini or group, represented by the formula:

(where R51, R52and R53each independently represents C1-6alkyl or phenyl);

R46and R47each independently represents C1-6alkyl;

V1Cis1-6alkylen;

M represents a group represented by the formula:

(where R9aand R9beach independently represents hydrogen or C1-6alkyl, where R9aand R9btaken together, may form a 1,2-ethylene, 1,3-propylene or 2,3-Dimethylbutane-2,3-diyl), or a group represented by the formula:

(where R9c, R9dand R9eeach independently represents C1-6alkyl); and a group of deputies represents the group consisting of fluorine atom, chlorine atom, bromine atom, cyano, C1-6alkoxy, pyrrolidinyl, piperazinil, piperidyl, morpholinyl, C3-8cycloalkyl, tetrahydropyranyl and tetrahydrofuranyl],

its salt or hydrate;

<13> connection p.<12>, its salt or hydrate, where R46and R47represent methyl, and V1crepresents methylene;

<14> connection p.<12>, its salt or hydrate, where R46and R47are methyl, V1Cis methylene, and R48is methyl;

<15> antagonist R is Ceptor the corticotropin-releasing factor (CRF), including a connection on p.<1> or its salt;

<16> receptor antagonist of the corticotropin-releasing factor (CRF) 1, including a connection on p.<1>, or its salt;

<17> therapeutic or prophylactic agent for the treatment of diseases associated with the corticotropin-releasing factor (CRF), including a connection on p.<1> or its salt;

<18> therapeutic or prophylactic agent for depression, depressive symptom, mania, anxiety, fears, violations by type panic, phobias, obsessive-compulsive disorders, disorders associated with post-traumatic stress syndrome Tourette, autism, affective disorders, mental depression, manic-depressive psychosis, cyclothymic personality or schizophrenia, including a connection on p.<1> or its salt;

<19> therapeutic or prophylactic agent for the treatment of peptic ulcers, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative ileus, stress-induced gastro-intestinal disorders or nervous vomiting, including a connection on p.<1> or its salt;

<20> method for the treatment or prevention of diseases associated with the corticotropin-releasing factor (CRF), including the introduction of a connection on p.<1> or its salt;

<21> sposobleny or prevention of depression, depressive symptom, mania, anxiety, fears, violations by type panic, phobias, obsessive-compulsive disorders, disorders associated with post-traumatic stress syndrome Tourette, autism, affective disorders, mental depression, manic-depressive psychosis, cyclothymic personality or schizophrenia, including the introduction of a connection on p.<1> or its salt;

<22> method for the treatment or prophylaxis of peptic ulcer, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative ileus, stress-related disorders of the gastrointestinal tract or nervous vomiting, involving the introduction of a connection on p.<1> or its salt;

<23> application connection p.<1>, its salt or hydrate to obtain the drug; and

<24> application connection p.<1>, its salt or hydrate to obtain a therapeutic agent or prophylactic agent for the treatment of diseases for which effective inhibition of the receptor for corticotropin-releasing factor (CRF).

The preferred method of implementation of thisinventions

Next will identify symbols and terms used in this description, along with its more detailed disclosure.

Some structural formula, results which are for connections in the description, are for convenience of specific isomer, but the invention is not restricted to these specific isomers and covers all isomers and mixtures of isomers, including geometric isomers, optical isomers, obtained for asymmetric carbons, stereoisomers and tautomers, provided the structures of the compounds, and you can use any of these isomers or their mixtures. Therefore, compounds of the present invention may include compounds containing asymmetric carbon atoms in their molecules and exist as optically active forms and racemic forms and all such compounds are included within the scope of the invention without limitation. Compounds of the present invention can be crystalline or non-crystalline; there are also no restrictions on any of the polymorphism of crystals, and any crystal forms can be used both separately and as mixtures thereof; and compounds of the present invention also cover anhydrate, hydrates and mixtures thereof. Metabolites of the compounds of the present invention, resulting from the decomposition in vivo, are also included within the scope of formulas of the present invention.

The term "antagonist of CRF receptor", as used in the present description, refers to a substance that is able to inactivate CRF receptors. Such prophetic the CTB include those which can weaken or inhibit the physiological activity of CRF.

As the diseases included in the term "disease associated with CRF or diseases associated with CRF receptors", in accordance with the present description may include depression and depressive symptoms (depression, episodic depression, recurrent depression, caused by the depression, maltreatment of children, post-traumatic depression and so on), mania, anxiety, disturbance type disturbance, disturbance type panic, phobias, obsessive-compulsive disorders, disorders associated with post-traumatic stress syndrome Tourette, autism, affective disorders, mental depression, manic-depressive psychosis, cyclothymic personality, schizophrenia, peptic ulcer, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative ileus, stress-induced gastrointestinal disorders, nervous vomiting, Alzheimer's disease, senile dementia type Alzheimer's disease, neurodegenerative disease, multi-infarct vascular dementia, senile dementia, mental anorexia, malnutrition, obesity, diabetes, alcohol dependence, pharmacophilia, symptoms associated with cessation of the medication, the symptoms SV is related to the cessation of alcohol intake, sleep disorders, insomnia, migraine, stress headache, headache caused by muscle contractions, ischemic neuronal damage, excitotoxicity neuronal damage, stroke, progressive supranuclear paralysis, amyotrophy lateral sclerosis, multiple sclerosis, muscle spasms, chronic fatigue syndrome, psychosocial dwarfism, epilepsy, head injury, spinal cord injury, spasm of the muscles of the palm, spastic Krivoshey, cervico-brachial syndrome, primary glaucoma, Meniere syndrome, imbalance, alopecia, neurosis, hypertension, cardiovascular disorders, tachycardia, congestive heart failure, hyperventilation syndrome, bronchial asthma, apnea syndrome sudden infant mortality, inflammatory diseases, pain, allergies, impotence, impaired menopause, human fertilization, infertility, cancer, immune dysfunction associated with HIV, the immune dysfunction caused by stress, hemorrhagic stress, Cushing's syndrome (Cushing), thyroid gland, encephalomyelitis, acromegaly, incontinence, osteoporosis, and other Compounds of the present invention is effective for treatment and prophylaxis of the abovementioned diseases.

The term "neurodegenerative disease"as used in the present description, refers ka is acute degenerative diseases, and chronic degenerative diseases, and specifically, it includes, for example, neuropathy, such as subarachnoid hemorrhage, acute stage of cerebrovascular disorders, etc. and Alzheimer's disease, Parkinson's disease, Huntington's chorea, amyotrophic lateral sclerosis, spinocerebellar degeneration, etc. the Term "malnutrition"as used in the present description, refers to bulimia, pathological aversion to food, etc. the Term "cardiovascular disorders", as used in the present description, refers to angina nervosa, etc. the Term "inflammatory disorders", as used in the description refers, for example, to rheumatoid arthritis, osteoarthritis, lumbago, etc. and the term "allergies" includes, for example, atopic dermatitis, eczema, urticaria, psoriasis, etc.

In the description text of the "n" means normal, "second-" means "secondary" and "tertiary" and "t-" both mean "tertiary".

[Definition R1]

R1represents a group represented by the formula-Glz-Rlz(where Glzrepresents a simple bond, oxygen or sulfur, and Rlzrepresents methyl or ethyl) or methoxymethyl, preferably methyl, ethyl, methoxy, methylthio, ethoxy and methoxymethyl preferably ethyl, methoxy and methylthio, and even more preferred ethyl.

[Definition R5and R6]

R5and R6each independently represents hydrogen, tert-butoxycarbonyl or a group represented by formula-X6b-X7b(where X6brepresents methylene; and X7bis1-6alkyl, C3-8cycloalkyl, tetrahydropyranyl or tetrahydrofuranyl). Preferably, R5and R6each independently represents n-propyl, n-butyl, (cyclobutyl)methyl, cyclopropylmethyl, (tetrahydropyranyl)methyl or (tetrahydrofuranyl)methyl. More preferably, R5and R6each independently represented cyclopropylmethyl, (4-tetrahydropyranyl)methyl, (3-tetrahydrofuranyl)methyl or (2-tetrahydrofuranyl)methyl. Even more preferably, R5represented cyclopropylmethyl or (4-tetrahydropyranyl)methyl, and most preferably, R5represented cyclopropylmethyl and R6represented (4-tetrahydropyranyl)methyl.

[Definition R40, R41and R42]

Two of R40, R41and R42submit C1-6alkoxy, and the other represents a group represented by the formula-V1A-V2a(where V1Arepresents a simple bond, -CO -,1-6alkylene, C2-6albaniles or C2-6akinyan; and (V2arepresents hydrogen, hydroxyl, C1-6alkyl, optionally containing -3 Deputy, selected from the above group of substituents B, C1-6alkoxy, optionally contains 1-3 substituent selected from the above group of substituents B, a group represented by formula-N(R3cR3d(where R3cand R3deach independently represents hydrogen or C1-6alkyl, optionally contains 1-3 substituent selected from the above group of substituents (B), methanesulfonate, p-toluensulfonate, pyrrolidinyl, piperazinil, piperidyl, morpholinyl, C3-8cycloalkyl, tetrahydropyranyl or tetrahydrofuranyl).

Preferably, two of R40, R41and R42represented methoxy. More preferably, R40and R42represented methoxy.

[Definition R43]

R43is1-6alkyl, optionally contains 1-3 substituent selected from the above group of substituents B. Preferably, R43was represented by methyl, optionally contains 1-3 substituent selected from the above group of substituents B, or ethyl, optionally contains 1-3 substituent selected from the above group of substituents B, more preferably methyl, optionally contains 1-3 substituent selected from the above group of substituents B, and even more preferably methyl.

[Definition R 44and R45]

R44and R45each independently represents hydrogen, methyl or ethyl. Preferably, R44and R45each independently represented by hydrogen or methyl, and more preferably, R44and R45both were represented by hydrogen.

[Definition R1t]

R1trepresents methoxy, methylthio, methyl, ethyl or methoxymethyl. R1tpreferably represents methoxy, methylthio or ethyl, and more preferably ethyl.

[Definition R46and R47]

R46and R47each is1-6alkyl. Preferably, R46and R47both were represented by methyl.

[Define V1C]

V1Cis1-6alkylen. Preferably, V1Crepresented methylene.

[Definition M]

M represents a group represented by the formula:

(where R9aand R9beach independently represents hydrogen or C1-6alkyl, or R9aand R9btaken together, form 1,2-ethylene, 1,3-propylene or 2,3-Dimethylbutane-2,3-diyl), or a group represented by the formula:

(where R9c, R9dand R9eeach independently represents C1-6alkyl).

Preferably M represents a group represented by the formula:

and more preferably a group represented by the formula:

The term "pyrrolidinyl"used in the present description, refers to a monovalent Deputy resulting from removal of a hydrogen atom from pyrrolidine, and specifically, you can specify 1-pyrrolidinyl, 2-pyrrolidinyl or 3-pyrrolidinyl.

The term "piperazinil"used in the present description, refers to a monovalent Deputy resulting from removal of a hydrogen atom of the piperazine and, specifically, you can specify 1-piperazinil, 2-piperazinil, 3-piperazinil or 4-piperazinil.

The term "piperidyl"used in the present description, refers to a monovalent Deputy resulting from removal of a hydrogen atom of the piperidine, and specifically, you can specify 1-piperidyl, 2-piperidyl, 3-piperidyl or 4-piperidyl.

The term "morpholinyl"used in the present description, refers to a monovalent Deputy resulting from removal of a hydrogen atom from the research, and specifically, you can specify 2-morpholinyl, 3-morpholinyl or 4-morpholinyl.

The term "tetrahydropyranyl"used in the present description, refers to a monovalent Deputy resulting from removal of a hydrogen atom from tetrahydropyran, and specifically, you can specify tetrahydropyran-2-yl, Tetra drapery-3-yl or tetrahydropyran-4-yl. Preferred tetrahydropyran-4-yl represented by the formula:

The term "tetrahydrofuranyl"used in the present description, refers to a monovalent Deputy resulting from removal of a hydrogen atom from tetrahydrofuran and, specifically, you can specify tetrahydrofuran-2-yl or tetrahydrofuran-3-yl. Preferred tetrahydrofuran-3-yl represented by the formula:

(4-tetrahydropyranyl)methyl used in the present description, refers to the stands, substituted above tetrahydropyran-4-yl.

(2-tetrahydrofuranyl)methyl used in the present description, refers to the stands, substituted to the above tetrahydrofuran-2-yl.

(3-tetrahydrofuranyl)methyl used in the present description, refers to the stands, substituted to the above tetrahydrofuran-3-yl.

The term "halogen" in the present invention refers to fluorine, chlorine, bromine, iodine and the like, preferably fluorine, chlorine or bromine.

With1-6alkyl in the present invention refers to a linear or branched alkyl containing from 1 to 6 carbon atoms, and is preferably methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl, 1-ethylpropyl, 2-e is ylpropyl, n-hexyl, 1-methyl-2-ethylpropyl, 1-ethyl-2-methylpropyl, 1,1,2-trimethylpropyl, 1-properproper, 1-methylbutyl, 2-methylbutyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 2,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl, 2-ethylbutyl, 2-methylpentyl, 3-methylpentyl, or the like, more preferably methyl, ethyl, n-propyl, isopropyl or tert-butyl, more preferably methyl, ethyl or isopropyl.

C2-6alkenyl the present invention relates to a linear or branched alkenyl containing from 2 to 6 carbon atoms, and preferred examples are vinyl, allyl, 1-propenyl, 2-propenyl, Isopropenyl, 2-methyl-1-propenyl, 3-methyl-1-propenyl, 2-methyl-2-propenyl, 3-methyl-2-propenyl, 1-butenyl, 2-butenyl, 3-butenyl, 1-pentenyl, 1-hexenyl, 1,3-hexadienyl and 1,6-hexadienyl.

C2-6quinil the present invention relates to quinil containing from 2 to 6 carbon atoms, and preferred examples are ethinyl, 1-PROPYNYL, 2-PROPYNYL, 1-butynyl, 2-butynyl, 3-butynyl, 3-methyl-1-PROPYNYL, 1-ethinyl-2-PROPYNYL, 2-methyl-3-PROPYNYL, 1-pentenyl, 1-hexenyl, 1,3-hexadienyl and 1,6-hexadienyl.

The term "C1-6alkylene"used in the present description, refers to a divalent group obtained by removing two hydrogen atoms of the above "C1-6of alkyl", and as specific examples include methyl is h, ethylene, mutilation, propylene, ethylethylene, 1,1-dimethylethylene, 1,2-dimethylethylene, trimethylene, 1-metallisation, 1-ethyltryptamine, 2-metallisation, 1,1-dimethyltrimethylene, tetramethylene, pentamethylene and hexamethylene, preferably methylene, 1,2-ethylene, and more preferably methylene.

The term "C2-6albaniles"used in the present description, refers to a divalent group obtained by removing one hydrogen atom from the above "C2-6alkenyl", and as specific examples, you can specify vinile, propylen, butylen, penttinen and hexarelin, preferably vinile, propylen, butylen, penttinen, even more preferably vinile, propylen and Butenin, and even more preferably 1,2-vinile and 1,3-propylen.

The term "C2-6akinyan"used in the present description, refers to a monovalent group obtained by removing one hydrogen atom from the above "C2-6akinlana", and as specific examples include ethynylene, propylen, Butyrin, pentikinen and geksanalem, preferably ethynylene, propylen, Butyrin and pentikinen, more preferably ethynylene, propylen and Butyrin, even more preferably ethynylene and propylen, and most preferably ethynylene.

The term "C3-8the cycle is alkyl", used in the present description, refers to a cyclic aliphatic hydrocarbon group comprising 3-8 carbon atoms, and as examples, you can specify cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl, preferably cyclopropyl, cyclobutyl and cyclopentyl, and more preferably cyclopropyl.

The term "C1-6alkoxy"used in the present description, refers to the oxygen associated with the above "C1-6by alkyl", and examples include methoxy, ethoxy, n-propoxy, isopropoxy, sec-propoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, n-pentyloxy, isopentylamine, sec-pentyloxy, n-hexose, isohexane, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropylene, 2-ethylpropoxy, 1-methyl-2-ethylpropoxy, 1-ethyl-2-methylpropoxy, 1,1,2-trimethylpropane, 1,1-Dimethylbutane, 1,2-Dimethylbutane, 2,2-Dimethylbutane, 2,3-dimethylbutylamino, 1,3-dimethylbutylamino, 2-ethylbutane, 1,3-Dimethylbutane, 2-methylpentane, 3 methylpentane, hexyloxy, preferably methoxy, ethoxy, n-propoxy, isopropoxy, sec-propoxy, n-butoxy, isobutoxy, sec-butoxy and tert-butoxy, and more preferably methoxy.

The term "optionally substituted"used in the present description, refers to optionally substituted by 1-3 substituents selected from ukazannoi group Vice-Century

The term "connection..., its salt or hydrate used in the present description, refers to (i) the compound (I), (ii) salt of compound (I), (iii) hydrate of compound (I) or (iv) hydrate salt of compound (I), and preferably to (i) the compound (I) or (ii) salt of compound (I), and more preferably salts of compound (I).

The term "hydrate"as used in the present description, refers to gidratirovannom the connection status (solvated) or gidratirovannom state salt compounds (solvated).

Preferably, the hydrate was formed at a corresponding ratio of from 0.1 to 8 molecules of water per 1 molecule of the compound or salt of the compound, and more preferably, the hydrate was formed at a corresponding ratio of from 0.3 to 3 molecules of water per 1 molecule of the compound.

The salt of compound (I) of the present invention is not specifically limited, unless they are salts of the compounds of the present invention and, for example, you can specify inorganic salts, organic acid salts and salts with acidic amino acids, and among them the preferred pharmacologically acceptable salt. Acid may form a salt with the corresponding relations of 0.1-5 molecules 1 molecule of the compound.

As preferable examples of salts of inorganic acids, you can specify the salts of hydrochloric acid is, Hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and as preferred examples of salts of organic acids, you can specify a salt of acetic acid, succinic acid, fumaric acid, maleic acid, tartaric acid, citric acid, lactic acid, stearic acid, benzoic acid, benzosulfimide acid, econsultancy acid, methanesulfonic acid, paratoluenesulfonyl acid, etc.

As preferable examples of salts with acidic amino acids, you can specify a salt of aspartic acid, glutamic acid, etc.

As preferable examples of salts of compounds (I) of the present invention it is possible to specify a salt of hydrochloric acid, sulfuric acid, benzosulfimide acid, econsultancy acid, methanesulfonic acid, paratoluenesulfonyl acid or Hydrobromic acid, and as preferable examples include salts paratoluenesulfonyl acid.

Compounds (except (i) 4-(hydroxymethyl)-2,6-dimethoxyaniline acid and (ii) 4-(((tert - butyldiphenylsilyl)oxy)methyl)-2,6-dimethoxyaniline acid), represented by the following formula and their salts and hydrates, can be successfully used as intermediates in the synthesis of compounds (I) in compliance and with the present invention.

[where R48represents hydrogen, C1-6alkyl, optionally contains 1-3 substituent selected from the group of substituents In the below, benzyl, optionally contains 1-3 substituent selected from the group of substituents In the following 2-tetrahydropyranyl or a group represented by the formula:

(where R51, R52and R53each independently represents C1-6alkyl or phenyl); R46and R47each independently represents C1-6alkyl; V1Cis1-6alkylene; M represents a group represented by the formula:

(where R9aand R9beach independently represents hydrogen or C1-6alkyl, or R9aand R9btaken together, form 1,2-ethylene, 1,3-propylene or 2,3-Dimethylbutane-2,3-diyl), or a group represented by the formula:

(where R9c, R9dand R9eeach independently represents C1-6alkyl),

where a group of deputies represents the group consisting of fluorine atom, chlorine atom, bromine atom, cyano, C1-6alkoxy, pyrrolidinyl, piperazinil, piperidyl, morpholinyl, C3-8cycloalkyl, tetrahydropyranyl and tetrahydrofuranyl.

The following connection is recommended reading, their salts and hydrates are of significant value as intermediates in the synthesis of compound (I) in accordance with the present invention.

[1] the Compounds corresponding to the compound (I), where-NR5R6is

[2] the Compounds corresponding to the compound (I), where V2arepresents a group represented by the formula:

(where R51, R52and R53each independently represents C1-6alkyl or phenyl), methanesulfonate or p-toluensulfonate.

Next will be disclosed to a representative schematic of the receipt of the above compounds of formula (I) in accordance with the present invention. The following schemes R1, R5, R6, R9a, R9b, R9c, R9d, R9e, R43, R44, R45, R46, R47, R48and M have the above values, X represents a halogen (e.g. fluorine, chlorine, bromine or iodine), Ar represents phenyl, optionally substituted by 1-3 groups represented by the formula-V1a-V2a(where V1Aand V2ahave the above values), R1Cand R1deach is1-6alkyl, C2-6alkenyl,2-6quinil or C3-8cycloalkyl (each of the above groups may not be battelino substituted), Rcarepresents optionally substituted C1-6alkyl or optionally substituted benzyl, and X' is bromine, iodine or hydrogen, A represents A nitroso or nitro group, presents ProtNis aminosidine group, the group represented ProtAboutis protecting the hydroxyl group, B represents an Ar or X [where Ar and X have the above values], Lev is tsepliaeva group, such as X [where X has the above values] or sulfonate (e.g., pair-toluensulfonate or methansulfonate), R11a, R11b, R11cand R11deach are1-6alkyl, C3-8-cycloalkyl, C3-8cycloalkyl-C1-6alkyl, C2-6alkenyl or2-6quinil, and not necessarily R11band R11Staken together, form a 4-8-membered ring, and a 4-8 membered ring, as a Deputy, not necessarily contain several N, O or S atoms in the ring, and n is an integer from 1 to 6. The term "room temperature"used in the present description, refers to temperatures in the range from 10 to 40°C.

The scheme of obtaining 1

Stage 1-A:The derived 2-halogenopyrimidines represented by the formula (1), can be subjected to interaction with an acetylene derivative in the presence of palladium catalyst and yo the IDA copper(I), in the presence of a base and/or solvent, or without solvent, at a temperature of from 0°C to 250°C, receiving acetylene derivative (2). Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify toluene, xylene, anisole, N,N-dimethylformamide, 1,2-dimethoxyethane, tetrahydrofuran, dioxane, n-butanol, ethanol, methanol, 1-methyl-2-pyrrolidinone and water, which can be used separately or in a mixture of solvents. Used grounds will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably you can specify potassium carbonate, sodium carbonate, cesium fluoride, potassium fluoride, sodium bicarbonate, triethylamine and diethylamine. These grounds can also be used as solvents. The choice of a particular palladium or Nickel catalysts will depend on the starting materials, solvents, etc. and is not specifically limited, as long as they do not inhibit the reaction, and preferably you can specify tetrakis(triphenylphosphine)palladium(0), palladium(II)acetate/triphenylphosphine, palladium(II)chloride, Tris(dibenz licenceto)dipalladium(0)/three-tert-butylphosphine, dichloro[1,1'-bis(diphenylphosphino)ferrocene]palladium(0), [1,2-bis(diphenylphosphino)ethane]declomycin(II) and [1,3-bis(diphenylphosphino)propane]declomycin(II). It is preferable to use palladium catalyst in an amount of from 0.001 to 0.2 equivalent, acetylene derived from 1 to 20 equivalents, and the base number of from 1 to 20 equivalents or as a solvent.

Stage 1-B: Acetylene derivative represented by the formula (2), can be subjected to interaction with N-aminimum agent (for example, hydroxylamine-O-sulfonate or O-sulfonylhydrazide) at a temperature of from -50°C to 40°C, or in a solvent, or without solvent, and the resulting salt of N-aminopyridine can be selected by using a filter or the like, or used directly in the reaction system in the presence of a base or without, at a temperature of from 0°C to 250°C, receiving cyklinowanie compound represented by the formula (3). Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify toluene, xylene, anisole, N,N-dimethylformamide, 1,2-dimethoxyethane, tetrahydrofuran, dioxane, n-butanol, ethanol, methanol and 1-methyl-2-pyrrolidinone that which you can use separately or in a mixture of solvents. Used grounds will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably you can specify potassium carbonate, sodium carbonate, cesium fluoride, potassium fluoride, sodium bicarbonate, triethylamine, sodium methoxide, ethoxide sodium tert-piperonyl sodium tert-piperonyl potassium. In this case, N-miniraise agent is preferably used in an amount of from 1 to 3 equivalents, and the base number from 1 to 5 equivalents.

Scheme for 2

Stage 2-A:Ester 2-pyridyloxy acid represented by the formula (4), and hydroxylamine-O-sulfonate (5) can be put together in a solvent in the presence or in the absence of base, getting a 2-hydroxypyrazolo[1,5-a]pyridine represented by the formula (6). The temperature of the reaction mixture is usually in the range of 0°C to 100°C. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify acetone, acetic acid, methanol, ethanol and water, which can be used on the individual or in the form of a mixture of solvents. Hydroxylamine-O-sulfonate is preferably used in an amount of from 0.1 to 2 equivalents and the base is used in amounts of 1-3 equivalents.

Stage 2-B:2-Hydroxypyrazolo[1,5-a]pyridine represented by the formula (6), and an alkylating agent can be subjected to interaction in a solvent or without solvent, in the presence or in the absence of base, receiving derivative represented by the formula (7). The temperature of the reaction mixture is usually in the range from 0°C to 100°C. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify acetone, methanol, ethanol and water, which can be used separately or in a mixture of solvents. As alkylating agents, you can specify dimethylsiloxy acid, diethylmercury acid, alkylhalogenide, diazomethane and trimethylsilyldiazomethane. Used grounds will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably you can specify potassium carbonate, sodium carbonate, cesium fluoride, potassium fluoride, sodium bicarbonate, triethylamine, diethylamine, the methoxide is the atrium, ethoxide sodium tert-piperonyl potassium. The alkylating agent is preferably used in an amount of from 1 to 3 equivalents and the base is used in an amount of from 1 to 15 equivalents.

The scheme of obtaining 3

Stage 3-A:Derived pyrazolo[1,5-a]pyridine (compound (3) in the scheme of obtaining 1 or the compound (7) in the diagram get 2, and so on), and alkyllithium reagent (for example, n-utility, second-utility, tert-utility etc) can be subjected to interaction in an inert solvent and then subjected to interaction with a halogenation agent, getting derived pyrazolo[1,5-a]pyridine represented by the formula (9), and this is derived in the 7-position halogen. The temperature of the reaction mixture is usually in the range from -100°C to 40°C. Used halogenation agents will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably you can specify bromine, iodine, N-chlorosuccinimide, N-bromosuccinimide, N-jodatime, hexachloroethane, 1,2-dibromoethane, 1,2-dibromo-1,1,2,2-tetrachlorethane, 1,2-diodato or the like, Used solvents will be different depending on the source materials, reagents, etc. and they are not specifically limited to t is x then, until they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify hexane, pentane, tetrahydrofuran and diethyl ether, which can be used separately or in a mixture of solvents. Alkyllithium reagent is preferably used in an amount of from 1 to 2 equivalents, and halogenation agent is used in an amount of from 1 to 3 equivalents.

Stage 3-B: Derived pyrazolo[1,5-a]pyridine represented by the formula (9), and nitrouse agent can be subjected to interaction or in a solvent, or without solvent, receiving the derived 3-nitropyrazole[1,5-a]pyridine represented by the formula (10). The temperature of the reaction mixture is usually in the range from -70°C to 200°C. Used nitriloside agents will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably, you can specify the nitrate trihydrate copper, nitric acid, fuming nitric acid, sodium nitrate, detroitmetroairport, ammonium nitrate, etc. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited to, until they dissolve starting materials to some extent and does not inhibit the reaction, and predpochtite is), you can specify acetic anhydride, acetic acid, sulfuric acid, triperoxonane anhydride, triperoxonane acid, acetonitrile, 1,2-dimethoxyethane and tetrahydrofuran, which can be used separately or in a mixture of solvents. Nitrouse agent is preferably used in an amount of from 1 to 2 equivalents.

In another embodiment, the derived pyrazolo[1,5-a]pyridine (9) and nitrotyrosine agent, such as sodium nitrite, can be subjected to interaction or in a solvent, or without solvent, receiving the derived 3-nitrosophenol[1,5-a]pyridine represented by the formula (10). The temperature of the reaction mixture is usually in the range from -40°C to 100°C. Used nitrotyrosine agents will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably, you can specify the sodium nitrite, isoamyl nitrite and the like, Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably, you can specify acetic anhydride, acetic acid, hydrochloric acid, sulfuric acid, triperoxonane anhydride, triperoxonane acid, acetonitrile, 1,2-dimethoxyethane, water and ethanol, you can use separately or in a mixture of solvents. Nitrotyrosine agent is preferably used in an amount of from 1 to 2 equivalents.

Stage 3-C:Nitro-derivatives or nitrosopropane represented by the formula (10), and metal (powder) can be subjected to interaction in the presence or in the absence of acid or solvent, or without solvent, getting restored the connection, the derived 3-aminopyrazole[1,5-a]pyridine (11). The temperature of the reaction mixture is usually in the range from -10°C to 150°C. Used metals (powders) will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably you can specify zinc, iron, chloride of tin(II)chloride Nickel(II), etc. Used acid will be different depending on starting materials, solvents, etc. and they are not specifically limited to, until they do not inhibit the reaction, and preferably you can specify acetic acid, hydrochloric acid, sulfuric acid, etc. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferred is sustained fashion, you can specify methanol, ethanol, n-butanol, water, etc. that can be used separately or in a mixture of solvents. Metals (powders) are preferably used in an amount of from 1 to 10 equivalents.

In another embodiment, nitro-derivatives or nitrosopropane represented by the formula (10), can be subjected to the reactions of addition of hydrogen in an inert solvent in the atmosphere of hydrogen, in the presence or in the absence of acid, using a metallic catalyst, such as Pd-C, receiving the recovered compound derived 3-aminopyrazole[1,5-a]pyridine (11). Usually use a hydrogen pressure of 1 to 100 atmospheres, and the temperature of the reaction mixture is usually in the range from 0°C to 200°C. Used acid and metals will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify acetic acid, triperoxonane acid and hydrochloric acid, and the preferred catalysts can be specified Pd-C, PtO2, Pt-C and Raney-Nickel. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and will neighberhood reaction, and preferably, you can specify methanol, ethanol, propanol, butanol, tetrahydrofuran, 1,4-dioxane, ethyl acetate, acetone and N,N-dimethylformamide, which can be used separately or in a mixture of solvents. In this reaction the derived 3-aminopyrazole[1,5-a]pyridine (11) can also be obtained by using a reaction in which there is a formation of hydrogen gas due to heating ammonitrate, etc. in a solvent such as methanol, in the presence of a metal catalyst. The metal catalyst is preferably used in an amount of 5 to 100 weight%.

Stage 3-D:The derived 3-aminopyrazole[1,5-a]pyridine represented by the formula (11), and the reagent protecting the amino group (for example, di-tert-BUTYLCARBAMATE), can be subjected to interaction, receiving the derived 3-aminopyrazole[1,5-a]pyridine (12), in which the amino group in 3-position is protected by a carbamate (e.g., tert-butoxycarbonyl). The reaction can be conducted or in a solvent or without a solvent and in the presence or in the absence of base. The reaction temperature is usually in the range from -70°C to 150°C. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably can is about to specify tetrahydrofuran, diethyl ether, 1,4-dioxane, dichloromethane, 1,2-dichloroethane, chloroform, and N,N-dimethylformamide, which can be used separately or in a mixture of solvents. Used grounds will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably, you can specify triethylamine, pyridine, diisopropylethylamine, sodium hydride, potassium carbonate, sodium carbonate, cesium carbonate, sodium bicarbonate, 4-(dimethylamino)pyridine and sodium bis(trimethylsilyl)amide. As preferred examples of the protective groups that can be used ("ProtN" in this diagram), you can specify tert-butoxycarbonyl (Boc)and 9-fluorenylmethoxycarbonyl (Fmoc), 2,2,2-trichlorocyanuric (Troc) and the like, with which the amino group in 3-position is protected under reaction conditions using reagents and solvents suitable for the protective group. Reagents, protecting the amino group, preferably used in an amount of from 1 to 3 equivalents, and the base is used in an amount of from 1 to 5 equivalents.

Scheme 4

Stage 4-A:Derived 1-aminopyridinium salt represented by the formula (13) and a derivative of 1,1-bis(alkylthio)-2-nitroethylene, as the e formula (14), can be subjected to interaction in the presence or in the absence of a base, or solvent, or without solvent, receiving the derived 3-nitropyrazole[1,5-a]pyridine represented by the formula (15), (reference: Heterocycles, 1977, 6, 379). The temperature of the reaction mixture is usually in the range from 0°C to 200°C. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify ethanol, methanol, 1,2-dimethoxyethane and tetrahydrofuran, which can be used separately or in a mixture of solvents. Used grounds will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably, you can specify triethylamine, diisopropylethylamine, 4-(dimethylamino)pyridine, sodium bis(trimethylsilyl)amide, etc. Derived 1,1-bis(alkylthio)-2-nitroethylene preferably used in an amount of from 1 to 2 equivalents, and the base is usually used in an amount of from 1 to 5 equivalents.

Stage 4-At:The derived 3-nitropyrazole[1,5-a]pyridine represented by the formula (15), can be subjected to interaction by the method presented earlier in the article the Hai 3-C on the diagram for the preparation of 3, receiving the derived 3-aminopyrazole[1,5-a]pyridine (16).

Stage 4-C:The derived 3-aminopyrazole[1,5-a]pyridine represented by the formula (16), can be subjected to interaction by the method presented previously at the stage of 3-D in the diagram receiving 3 receiving aminosidine derived 3-aminopyrazole[1,5-a]pyridine (17).

Stage 4-D:Aminosidine derived 3-aminopyrazole[1,5-a]pyridine represented by the formula (17), can be subjected to interaction by the method described previously in stage 3 And the diagram for the preparation of 3, getting derived pyrazolo[1,5-a]pyridine (12'), whose 7-position halogen.

The scheme of obtaining 5

Stage 5-A:The derived 3-aminopyrazole[1,5-a]pyridine (12), whose amino group is protected ProtNthat can be subjected to interaction with an alkylating agent (e.g., optionally substituted by alkylhalogenide or the like), getting derived pyrazolo[1,5-a]pyridine represented by the formula (18), in which the amino group introduced by the Deputy. The reaction can be conducted in a solvent or without a solvent and in the presence or in the absence of base. The temperature of the reaction mixture is usually in the range from -70°C to 200°C. Used solvents will be different depending on starting materials, reagents, etc. and they specifically n is limited until until they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify dichloromethane, acetone, tetrahydrofuran, diethyl ether, N,N-dimethylformamide and dimethyl sulfoxide, which can be used separately or in a mixture of solvents. Used grounds will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably you can specify sodium hydride, potassium hydride, potassium carbonate, sodium carbonate, cesium carbonate, potassium hydroxide, sodium hydroxide, etc. Alkylating agent is preferably used in an amount of from 1 to 3 equivalents and the base in an amount of from 1 to 5 equivalents.

Stage 5-B:The derived 3-aminopyrazole[1,5-a]pyridine represented by the formula (18), it is possible to remove the protective group, getting derived pyrazolo[1,5-a]pyridine (19) without protective groups. The reaction can be conducted in the presence or in the absence of a reagent for removal of the protective groups. The temperature of the reaction mixture is usually in the range from -70°C to 200°C. reagents for removal of the protective groups will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and predpochtiteljno to specify hydrochloric acid, sulfuric acid, triperoxonane acid, methanesulfonate acid, attributively, aluminum(III)chloride, trimethylsilyltriflate etc. If the protective groups are used to group different from tert-butoxycarbonyl (Boc) (e.g., Fmoc, Troc, and so on), removing the protective groups is carried out using the reaction, which is used as a reagent suitable for the specified protective group. The reaction can be conducted or in a solvent or without solvent; if the reaction is carried out in the solvent used, the solvent will vary depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably, you can specify the ethyl acetate, tetrahydrofuran, diethyl ether, 1,4-dioxane, acetonitrile, dichloromethane, chloroform, nitromethane, phenol, anisole and thiophenol that can be used separately or in a mixture of solvents. Reagent for removal of the protective groups are preferably used in quantities of from 1 to 3 equivalents.

Stage 5-C:Derived pyrazolo[1,5-a]pyridine represented by the formula (19), can be subjected to interaction with the derived carbonyl (for example, diethylketone), derived aldehyde (for example, Propionaldehyde) or equivalent carbonyl (for example, ((1-amoxiciklin who drank)oxy)trimethylsilane or acetal-protected Deputy) in the presence of a reducing agent, getting derived pyrazolo[1,5-a]pyridine represented by the formula (20). The temperature of the reaction mixture is usually in the range from -10°C to 150°C. the Reaction can be conducted in the presence or in the absence of acid, in a solvent or without a solvent and in the presence or in the absence of inorganic salts. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify tetrahydrofuran, diethyl ether, 1,2-dichloroethane, dichloromethane, chloroform, acetonitrile, ethanol, methanol and water, which can be used separately or in a mixture of solvents. Used acid, inorganic salts and reducing agents will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably can be specified as acids, acetic acid, sulfuric acid, etc. as inorganic salts, sodium sulfate, etc. and as reducing agents triacetoxyborohydride sodium, sodium borohydride, centripetality sodium, etc. Derivatives of carbonyl and aldehyde (including equivalents) is preferably used to is the number from 1 to 20 equivalents, reducing agent in an amount of from 1 to 5 equivalents, of an inorganic salt in an amount of from 1 to 30 equivalents.

In another embodiment, the derived pyrazolo[1,5-a]pyridine (19) and allerease reagent can be subjected to interaction in the presence or in the absence of base, in a solvent or without solvent, getting derived pyrazolo[1,5-a]pyridine (20), in which the amino group allerban. The temperature of the reaction mixture is usually from -20°C to 150°C. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify tetrahydrofuran, diethyl ether, 1,2-dichloroethane, dichloromethane, acetonitrile, ethanol, methanol and water, which can be used separately or in a mixture of solvents. Used grounds will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably, you can specify triethylamine, pyridine, diisopropylethylamine, N,N-diisopropylethylamine, 4-(dimethylamino)pyridine, sodium carbonate, potassium carbonate, sodium hydroxide, potassium hydroxide, etc. Allerease agent is preferably used in a number is the number from 1 to 3 equivalents and the base in an amount of from 1 to 20 equivalents.

Stage 5-D:The derived 3-aminopyrazole[1,5-a]pyridine represented by the formula (11), can be subjected to the interaction with the carbonyl derivative (for example, diethylketone) or aldehyde derivative (for example, Propionaldehyde) in the presence of a reducing agent, such as triacetoxyborohydride sodium, getting derived pyrazolo[1,5-a]pyridine represented by the formula (19) or formula (20). Depending on the number of moles of the carbonyl derivative or aldehyde derivative and the reaction time can be obtained or monosubstituted derivative pyrazolo[1,5-a]pyridine represented by the formula (19), or disubstituted derivative pyrazolo[1,5-a]pyridine represented by the formula (20). The reaction can be conducted in the presence or in the absence of acid, in a solvent or without a solvent and in the presence or in the absence of inorganic salts. The reaction temperature is usually in the range from -10°C to 150°C. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify tetrahydrofuran, diethyl ether, 1,2-dichloroethane, dichloromethane, chloroform, acetonitrile and water, which can be used on the individual or in the form of a mixture of solvents. Used acid, inorganic salts and reducing agents will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably can be specified as acids, acetic acid, sulfuric acid, etc. as inorganic salts, you can specify the sodium sulfate, etc. and as reducing agents, you can specify triacetoxyborohydride sodium, sodium borohydride, cyanoborohydride sodium, etc. Carbonyl or aldehyde derivative is preferably used in an amount of from 1 to 20 equivalents, reducing agent in an amount of from 1 to 5 equivalents and inorganic salt in an amount of from 1 to 30 equivalents.

Stage 5-E:Derived pyrazolo[1,5-a]pyridine represented by the formula (20), can be subjected to reaction using metallurgy reagent or metalgearonline the reactant and the transition metal catalyst, in the presence or in the absence of a base and in a solvent or without solvent, getting derived pyrazolo[1,5-a]pyridine (I), substituted aryl group or heteroaryl group at 7-position. The temperature of the reaction mixture is usually in the range from 0°C to 200°C. Commonly used combinations of real new and catalysts include catalysts connection airborne acid/palladium (Suzuki reaction; N. Miyaura, A. Suzuki, Chemical Reviews 1995, 95, 2457), catalysts connection eritreanyellow/palladium (Stille reaction; T.N. Mitchell, Synthesis 1992, 803), catalysts connection arylzinc/palladium and catalysts arylphosphate Grignard reagent/Nickel. Specifically used palladium and Nickel catalysts will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify tetrakis(triphenylphosphine)palladium(0), palladium(II)acetate/triphenylphosphine, palladium(II)chloride, Tris(dibenzylideneacetone)dipalladium(0)/three-tert-butylphosphine, dichloro[1,1'-bis(diphenylphosphino)ferrocene]palladium(0), [1,2 bis(diphenylphosphino)ethane]declomycin(II), [1,3-bis(diphenylphosphino)propane]declomycin(II), etc. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify toluene, xylene, mesitylene, anisole, N,N-dimethylformamide, 1,2-dimethoxyethane, tetrahydrofuran, 1,4-dioxane, n-butanol, ethanol, methanol, 1-methyl-2-pyrrolidinone and water, which can be used separately or in a mixture of solvents. Used about the reasons will vary, depending on the starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably you can specify potassium carbonate, sodium carbonate, barium hydroxide, cesium fluoride, potassium fluoride, sodium bicarbonate, triethylamine, etc. Metallurgy reagent or metalgearonline reagent is preferably used in an amount of from 1 to 2 equivalents, the transition metal catalyst is used in quantities of from 0.001 to 0.2 equivalent, and a base in an amount of from 1 to 5 equivalents.

The scheme of obtaining 6

Stage 6-A:Derived pyrazolo[1,5-a]pyridine represented by the formula (12)containing a protected amino group at the 3-position, can be subjected to interaction by the method presented on stage 5-E in the above scheme receiving 5, getting derived pyrazolo[1,5-a]pyridine (21), 7-position which introduced the Ar group.

Stage 6-B:Derived pyrazolo[1,5-a]pyridine represented by the formula (21), can be subjected to interaction by the method presented on stage 5-a in the above scheme receiving 5, getting derived pyrazolo[1,5-a]pyridine represented by the formula (22).

Stage 6-C:Derived pyrazolo[1,5-a]pyridine represented by the formula (21) or (22), can be subjected to interaction by the method presented on stage 5 - in the above scheme receiving 5, getting derived pyrazolo[1,5-a]pyridine (23) or (24), which removed the protective group, respectively.

Stage 6-D:Derived pyrazolo[1,5-a]pyridine represented by the formula (23), can be subjected to interaction by the method presented on stage 5-D on the above scheme receiving 5, getting derived pyrazolo[1,5-a]pyridine represented by the formula (24) or (I), depending on the reaction conditions, etc.

Stage 6-E:Derived pyrazolo[1,5-a]pyridine represented by the formula (24), can be subjected to interaction by the method presented on stage 5 With the above scheme, receiving 5, getting derived pyrazolo[1,5-a]pyridine represented by the formula (I).

The scheme of obtaining 7

Stage 7-A:The derived 3-nitropyrazole[1,5-a]pyridine or a derivative of 3-nitrosophenol[1,5-a]pyridine represented by the formula (10'), can be subjected to interaction by the method presented on stage 5-E in the above scheme receiving 5, getting derived pyrazolo[1,5-a]pyridine (25), substituted Ar group in the 7-position.

Stage 7-B:The derived 3-nitropyrazole[1,5-a]pyridine or a derivative of 3-nitrosophenol[1,5-a]pyridine represented by the formula (25), can be subjected to interaction by the method presented on the Tadei 3-C on the above scheme for the preparation of 3, receiving the recovered compound derived pyrazolo[1,5-a]pyridine (26).

Stage 7-C:The derived 3-nitropyrazole[1,5-a]pyridine or a derivative of 3-nitrosophenol[1,5-a]pyridine represented by the formula (26), can be subjected to interaction by the method presented on stage in 3-D on the above scheme for the preparation of 3, getting derived pyrazolo[1,5-a]pyridine (21), in which the amino group in 3-position is protected.

The scheme of obtaining 8

Stage 8-A:Carboxylic acid derivative represented by the formula (27), and aidarous agent (for example, diphenylphosphoryl (DPPA) or sodium azide) can be subjected to interaction or in a solvent or without a solvent and in the presence or in the absence of a base at a temperature in the range from -70°C to 250°C, receiving azide derivative of the acid, and it is derived azide acid and then heated at a temperature in the range of from 40°C to 250°C for the implementation of the rearrangement reaction, such as rearrangement of Curtis (Curtius) to obtain the isocyanate in the system, and then the reaction of lead with tert-butanol or the like, receiving the derived 3-aminopyrazole[1,5-a]pyridine (12) or (21), protected urethane group, such as tert-butoxycarbonyl (Boc). Used solvents will be different depending on the source material, p the agents etc., and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify toluene, xylene, diphenyl ether, tert-butanol, tetrahydrofuran, dioxane, acetonitrile and N,N-dimethylformamide, which can be used separately or in a mixture of solvents. Used grounds will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably, you can specify triethylamine, diisopropylethylamine, 4-(dimethylamino)pyridine, pyridine, etc. in an Alternative way above derived azide acidit is possible to synthesize, transforming the carboxylic acid derivative (27) in the acid chloride or a mixed acid anhydride and then through its interaction with aidarous agent (for example, sodium azide, trimethylsilylacetamide, etc). With the help of another alternative method, the desired compound (12) or (21) can be obtained by using the rearrangement Hofmann (Hofmann), or rearrangement, Schmidt (Schmidt). Aidarous agent is preferably used in an amount of from 1 to 3 equivalents, the base is used in an amount of from 1 to 5 equivalents, and tert-butanol is used or in an amount of from 1 to 50 equivalents, or as a solvent.

Scheme for 9

Stage 9-A:Sulfide derivative represented by the formula (Iscan oxidize, using an oxidizing agent such as meta-chloroperbenzoic acid or solvent, or without solvent, getting sulfoxide derivative (Is1). The reaction temperature is usually in the range from -70°C to 150°C. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify acetone, acetic acid, triperoxonane acid, dichloromethane, chloroform, toluene, nitromethane, methanol, ethanol and water, which can be used separately or in a mixture of solvents. As used oxidizing agents, you can specify meta-chloroperbenzoic acid, cryptocercus acid, bis(trimethylsilyl)percolate, periodate sodium, cityregional nitrogen, a mixture of acid-nitric acid - sulfuric acid, chromic acid and other Oxidizing agent is preferably used in an amount of from 1 to 2 equivalents.

Stage 9-B:Sulfoxide derivative (Is1can oxidize, using an oxidizing agent such as meta-chloroperbenzoic acid or p is storytale, or without solvent, obtaining the sulfonic derivative (Is2). The temperature of the reaction mixture is usually in the range from -70°C to 150°C. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify acetone, acetic acid, triperoxonane acid, dichloromethane, chloroform, toluene, methanol, ethanol and water, which can be used separately or in a mixture of solvents. As used oxidizing agents, you can specify meta-chloroperbenzoic acid, chromic acid, cityregional osmium, potassium permanganate, etc. Oxidizing agent is preferably used in an amount of from 1 to 2 equivalents.

Scheme 10

Stage 10-A:A derivative of benzyl alcohol represented by formula (Med-1), and introducing Deputy agent, which can be used as a protective group for hydroxyl (for example, similarbuy agent or optionally substituted alkylating agent), can be subjected to interaction in a solvent or without a solvent and in the presence or in the absence of base, receiving the hydroxyl-protected derivative, provided the formula (Med-2). The temperature of the reaction mixture is usually in the range from -70°C to 200°C. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify tetrahydrofuran, diethyl ether, N,N-dimethylformamide and dimethyl sulfoxide, which can be used separately or in a mixture of solvents. As examples of the used grounds you can specify sodium hydride, potassium hydride, potassium carbonate, sodium carbonate, cesium carbonate, potassium hydroxide, sodium hydroxide, triethylamine, pyridine, imidazole, 2,6-lutidine etc. as similarbuy agents, you can specify trimethylsilyloxy, tert-butyldimethylsilyl and tert-butyldiphenylsilyl. As substituted alkylating agents, you can specify methoxymethane and benzylchloride. In this case, misleading or Deputy agent can be used in an amount of from 1 to 3 equivalents and the base can be used in an amount of from 1 to 5 equivalents.

Stage 10-B:The compound represented by formula (Med-2) or (Med-3), and alkyllithium reagent (for example, n-utility, second-utility, tert-utility etc) or a Grignard reagent (for example, methylacrylamide, isopropilic ibreed etc) can be subjected to interaction in an inert solvent and then subjected to interaction with a complex ester of boric acid or the like, receiving a derivative of boric acid represented by the formula (B-1). The temperature of the reaction mixture is usually in the range from -100°C to 80°C. Used esters of boric acid will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably, you can specify trimethylboron, triethylborane, triisopropylphenyl, 2-methoxy-4,4,5,5-tetramethyl-1,3,2-dioxaborolan etc. Used inert solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long until they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify hexane, pentane, tetrahydrofuran and diethyl ether, which can be used separately or in a mixture of solvents. If you use alkyllithium reagent, you can also add the agent forming a complex with a metal (for example, N,N,N',N'-tetramethylethylenediamine, hexamethylphosphoramide (HMPA), etc) to increase reactivity. Alkyllithium reagent or Grignard reagent is preferably used in an amount of from 1 to 2 equivalents, the ester of boric acid is used in an amount of from 1 to 3 equivalents and the agent that forms a complex with the metal, used in an amount of from 1 is about 2 equivalents.

Stage 10-C:The compound represented by formula (Med-2) or (Med-3), can be subjected to the reactions proceed with alkoxyimino or pinacolborane in a solvent or without a solvent and in the presence or in the absence of the substrate, using a transition metal catalyst, such as palladium, obtaining the compound (B-1). The temperature of the reaction mixture is usually in the range from 0°C to 250°C. Used inert solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify toluene, xylene, 1,4-dioxane, dichloroethane, acetonitrile, N,N-dimethylformamide and dimethyl sulfoxide, which can be used separately or in a mixture of solvents. Used grounds will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably, you can specify triethylamine, diisopropylethylamine, pyridine, potassium acetate, 1,8-diazabicyclo[5.4.0]-7-undecene (DBU), etc. Used alkoxycarbonyl will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferred is sustained fashion, you can specify bis(pinacolato)diboron, bis(neopentylglycol)diboron, bis(hexyleneglycol)diboron etc. Used palladium catalysts will also be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably you can specify tetrakis(triphenylphosphine)palladium(0), palladium(II)acetate/triphenylphosphine, palladium(II)chloride, Tris(dibenzylideneacetone)dipalladium(0)/three-tert-butylphosphine, dichloro[1,1'-bis(diphenylphosphino)ferrocene]palladium(0), [1,2-bis(diphenylphosphino)ethane]declomycin(II), [1,3-bis(diphenylphosphino)propane]declomycin(II) and other transition metal Catalyst is preferably used in quantities of from 0.001 to 0.2 equivalents, the base is used in an amount of from 1 to 20 equivalents, alkoxyaryl or pinacolborane used in an amount of from 1 to 3 equivalents.

Scheme for 11

Stage 11-A:Derivative represented by the formula (Med-4), and alkyllithium reagent (for example, n-utility, second-utility, tert-utility etc) or a Grignard reagent (for example, methylacrylamide, isopropylacrylamide etc) can be subjected to interaction in an inert solvent and then to carry out the reaction with a halide reagent triamcinolone, getting derived triamcinolone represented by the formula (S-1). T is mperature reaction is usually in the range from -100° C to 50°C. reagents of halide triamcinolone will be different depending on starting materials, solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably you can specify chloride trimethylamine, chloride teatralova, the presence of TBT chloride, bromide trimacinolone, bromide teatralova and bromide presence of TBT. Used inert solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify hexane, pentane, tetrahydrofuran and diethyl ether, which can be used separately or in a mixture of solvents. If you use alkyllithium reagent, you can also add the agent forming a complex with a metal (for example, N,N,N',N'-tetramethylethylenediamine, hexamethylphosphoramide (HMPA), etc) to increase reactivity. Alkyllithium reagent or Grignard reagent is preferably used in an amount of from 1 to 2 equivalents, agent forming a complex with the metal, used in quantities of from 1 to 2 equivalents and halide triamcinolona in an amount of from 1 to 2 equivalents.

Stage 11-B:The compound represented by formula (Med-4), can expose the ü reactions combination with hexamethyldisilane(IV), bis(tributiloltin(IV) or the like according to the method presented in stage C in figure 10, to obtain the derived triamcinolone represented by the formula (S-1).

Scheme 12

Stage 12-A:The compound represented by the formula (20), can be subjected to reaction combination with metallily reagent represented by formula (M-2) in the presence of transition metal catalyst according to the method presented on stage 5-E in the above scheme receiving 5, receiving derivative represented by the formula (Ial).

Stage 12-B:A derived pyrazolo[1,5-a]pyridine-protected hydroxyl group represented by the formula (Ial), you can remove the protective group using a suitable removal of this protective group, the reaction, and receiving the derived pyrazolo[1,5-a]pyridine represented by the formula (Ia2containing an alcohol group. The reaction of removing the protective group is carried out in the temperature range from -80°C to 200°C, in the presence or in the absence of removing the protective group reagent, in a solvent or without solvent. For example, if the protecting group is a silyl group, used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they R straut starting materials to some extent and does not inhibit the reaction, and preferably, you can specify the ethyl acetate, tetrahydrofuran, diethyl ether, dioxane, acetonitrile, methanol, ethanol, dichloromethane, chloroform, nitromethane, phenol, anisole and thiophenol that can be used separately or in a mixture of solvents. As examples of reagents used for the removal of the protective groups, you can specify the connection forming the anion of fluorine, such as tetrabutylammonium, hydrogen fluoride and cesium fluoride, acids such as hydrochloric acid, sulfuric acid, triperoxonane acid and methanesulfonamide acid, or bases such as potassium carbonate, sodium carbonate, sodium hydroxide and potassium hydroxide. In the case of a benzyl ether or the like, the protective group of the benzyl group can be removed using a hydrogenation reaction in a solvent such as ethanol, in the presence of a metal catalyst, such as Pd-C.

Scheme for 13

Stage 13-A:Derived pyrazolo[1,5-a]pyridine, containing a primary alcohol group represented by the formula (Ia3), can be subjected to oxidation reaction in a solvent or without solvent in the presence of an oxidizing agent, receiving aldehyde derivative represented by the formula (Ia4). The temperature of the reaction mixture is usually in the range of from -78°C to 150ଌ. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify tetrahydrofuran, diethyl ether, 1,2-dichloroethane, dichloromethane, chloroform, acetonitrile, toluene, and dimethyl sulfoxide, which can be used separately or in a mixture of solvents. As used oxidizing agents, you can specify oxalicacid, which is used as the activating agent for oxidation using dimethyl sulfoxide (oxidation Swarna (Swern)), as well as metal reagents such as activated manganese dioxide, a complex of a sulfur trioxide-pyridine, pyridineboronic (PCC), pyridinediamine (PDC), 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ) and the reagent dess-Martin (Dess-Martin). The oxidizing agent is preferably used in an amount of from 1 to 30 equivalents.

Stage 13-B:Derived pyrazolo[1,5-a]pyridine represented by the formula (Ia4containing aldehyde group, can be subjected to interaction with the reagent alkalimetallen, such as a Grignard reagent, alkylate, alkylzinc or alkylate, or in an inert solvent or without solvent, getting derived pyrazolo[1,5-a]pyridine, the notion is Noah formula (I a5). The temperature of the reaction mixture is usually in the range of from -80°C to 80°C. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify hexane, pentane, tetrahydrofuran and diethyl ether, which can be used separately or in a mixture of solvents. The reagent alkalimetal preferably used in an amount of from 1 to 2 equivalents.

Scheme for 14

Stage 14-A:Derived pyrazolo[1,5-a]pyridine represented by the formula (Ia3containing a hydroxyl group, can be subjected to interaction with an alkylating agent (alkylhalogenide, dialkylzinc acid, ether alkylsulfonic acid, etc. or the like, or in a solvent or without solvent, in the presence or in the absence of a base and in the presence or in the absence of a phase transfer catalyst, receiving hydroxyacetylamino derived pyrazolo[1,5-a]pyridine represented by the formula (Ia6). The reaction temperature is usually in the range from -10°C to 200°C. Used solvents will be different depending on starting materials, reagents, etc. and they were concr the IDT is not limited as long until they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify tetrahydrofuran, acetone, N,N-dimethylformamide, dimethylsulfoxide, ethanol, acetonitrile, toluene and water, which can be used separately or in a mixture of solvents. Used grounds will be different depending on the solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably, you can specify the potassium hydride, sodium hydride, tert-piperonyl potassium, potassium carbonate, sodium carbonate, calcium carbonate, potassium hydroxide, sodium hydroxide, barium hydroxide, silver oxide, barium oxide, etc. are Used interphase catalysts will be different depending on the solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably, you can specify tetrabutylammonium, tetrabutylammonium and tetrabutylammonium. The alkylating agent is preferably used in an amount of from 1 to 2 equivalents, based in an amount of from 1 to 2 equivalents and interfacial catalyst in an amount of from 1 to 2 equivalents.

The scheme receive 15

Stage 15-A:This scheme is a scheme for deriving pyrazolo[1,5-a]pyridine represented by f is rmulas (I a7), where the hydroxyl group derived pyrazolo[1,5-a]pyridine represented by the formula (Ia3containing a hydroxyl group, in turn tsepliaeva group.

The reaction of the sulfonic acid esterification:derived pyrazolo[1,5-a]pyridine represented by the formula (Ia3containing a hydroxyl group, can be subjected to interaction with the esterification reagent sulfonic acid at a temperature of from 0°C to 250°C, or in a solvent or without a solvent and in the presence or in the absence of base, getting derived ether sulfonic acid represented by the formula (Ia7). Reagents the esterification of the sulfonic acid will be different depending on the solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably, you can specify methansulfonate, tailhold, tailford, methanesulfonyl anhydride, tailby anhydride, triftormetilfullerenov anhydride, etc. Used grounds will be different based solvents, etc. and they are not specifically limited as long as they do not inhibit the reaction, and preferably, you can specify triethylamine, N-methylmorpholine, pyridine, etc. Used solvents will be different depending on the reagents, etc. and they not specifically restricted to t is x then, until they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify dichloromethane, diethyl ether, tetrahydrofuran, tert-butyl methyl ether, acetonitrile, N,N-dimethylformamide, dimethylsulfoxide and toluene, which can be used separately or in a mixture of solvents. The esterification reagent sulfonic acid is preferably used in an amount of from 1 to 2 equivalents, and the base is used in an amount of from 1 to 2 equivalents.

The reaction of halogenation (chlorination, synthesized, iodization):derived pyrazolo[1,5-a]pyridine represented by the formula (Ia3containing a hydroxyl group, can be subjected to interaction with a halogenation agent such as N-chlorosuccinimide, phosphorus oxychloride, thionyl chloride, chetyrehhloristy carbon, N-bromosuccinimide, bromine, trichromacy phosphorus, pathiramanal phosphorus, iodine or the like, or with triphenylphosphine and carbon tetrachloride or cetarehhloristam carbon at a temperature of from 0°C to 250°C or in a solvent, or without solvent, getting a halogenated compound (Ia7). To the reaction mixture may also be added a base, such as triethylamine, imidazole or 4-(dimethylamino)pyridine. Used solvents will be different depending on the reagents, etc. and they were concr the IDT is not limited as long until they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify dichloromethane, toluene and N,N-dimethylformamide, which can be used separately or in a mixture of solvents. The compound (Ia7) can also be obtained by direct reaction of the compound represented by formula (Ia3) with thionyl chloride, methanesulfonamido or the like at a temperature in the range from 0°C to 250°C or in a solvent or without solvent.

The fluorination reaction:Derived pyrazolo[1,5-a]pyridine represented by the formula (IA3containing a hydroxyl group, can be subjected to interaction with a fluorinating reagent at a temperature in the range from -78°C to 0°C, or in a solvent, or without solvent, getting a fluorinated derivative pyrazolo[1,5-a]pyridine represented by the formula (Ia7). Used solvents will be different depending on the reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify dichloromethane, diglyme, isooctane and monitorability that can be used separately or in a mixture of solvents. Used fluorinating reagents will be different depending on the solution of the residents and so on, and they are not specifically limited as long as they do not inhibit the reaction, and preferably, you can specify diethylaminoacetate (DAST), tetraploid sulfur, morpholinobutyrophenone (morph-DAST), etc. Fluorinating reagent is preferably used in an amount of from 1 to 5 equivalents.

Stage 15-B:Derived pyrazolo[1,5-a]pyridine represented by the formula (Ia7), can be subjected to interaction with the nucleophilic reagent, such as a salt of an alkali metal alkoxide at a temperature in the range from -78°C to 250°C, or in a solvent, or without solvent, getting derived pyrazolo[1,5-a]pyridine represented by the formula (Ia6). Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify tetrahydrofuran, diethyl ether, N,N-dimethylformamide, dimethyl sulfoxide, toluene and ethanol, which can be used separately or in a mixture of solvents. As a nucleophilic reagent, you can specify the alkali metal salts of alkoxides, and especially you can specify the sodium methoxide, ethoxide sodium, etc. Nucleophilic reagent is preferably used in an amount of from 1 to 2 equivalents.

Stadia-C: Derived pyrazolo[1,5-a]pyridine represented by the formula (Ia7containing tsepliaeva group, can be subjected to the interaction with the nucleophilic reagent at a temperature in the range from -78°C to 250°C, or in a solvent, or without solvent, getting derived pyrazolo[1,5-a]pyridine represented by the formula (Ia8). Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify tetrahydrofuran, diethyl ether, N,N-dimethylformamide, dimethyl sulfoxide, toluene and ethanol, which can be used separately or in a mixture of solvents. As a nucleophilic reagent can be specified amines, such as ammonia, methylamine, dimethylamine, morpholine and piperidine, or alkali metal salts of toolboxitem. The nucleophilic reagent is preferably used in an amount of from 1 to 2 equivalents.

In another embodiment, the compound (Ia8), containing the amino group, can be obtained by interacting with sodium azide, sodium di-tert-butylimidazolium, phthalimido sodium or the like as a nucleophilic reagent, followed by reaction of the recovery and removal of the protective groups, etc./p>

In addition, compound (Ia8containing Tilney group, can be obtained by reaction with thioacetate potassium, thiourea or the like as a nucleophilic reagent, with subsequent appropriate reactions.

Stage 15-D:Derived pyrazolo[1,5-a]pyridine represented by the formula (Ia3containing a hydroxyl group can be converted to a derivative pyrazolo[1,5-a]pyridine represented by the formula (Ia8), using the reaction of Mitsunobu (Mitsunobu)using vatsayana, such as diethylazodicarboxylate, and miniraise reagent or the like in the presence of organophosphorus compounds, in a solvent or without solvent. The temperature of the reaction mixture is usually in the range from -70°C to 80°C. as examples mineralsa reagents, you can specify phthalimide, etc. as examples of compounds of the phosphine you can specify triphenylphosphine, tributylphosphine and the like, and as examples azodicarboxylate connections you can specify the diethyl azodicarboxylate, aminobutiramida azodicarboxylate etc. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they dissolve starting materials to some extent and does not inhibit the reaction, and preferably you can specify tetrahydrofuran, Diatlov the th ether and toluene, you can use separately or in a mixture of solvents.

Scheme 16

Stage 16-A:Derived pyrazolo[1,5-a]pyridine represented by the formula (Ia4containing aldehyde group, can be subjected to interaction by the method presented on stages 5-C and 5-D on the above scheme receiving 5, getting derived pyrazolo[1,5-a]pyridine (Ia9containing optionally substituted by an amino group.

A representative scheme of obtaining the compound (I) according to the method of the present invention have been presented above, but the initial compounds and reagents used to produce compounds of the present invention, can also form salts or hydrates, which will differ depending on the starting materials and solvents, and they are not specifically limited as long as they do not inhibit the reaction. Used solvents will be different depending on starting materials, reagents, etc. and they are not specifically limited as long as they do not inhibit the reaction and dissolves starting materials to some extent. If the compound (I) of the present invention is manufactured in the form of free connection, a conventional method can be used to turn it into a salt which can form a compound (I). Once the ranks isomers (for example, geometric isomers, optical isomers based on the presence of asymmetric carbon atoms, isomers of rotation, stereoisomers and tautomers), obtained for the compound (I) of the present invention, it is possible to purify and isolate using conventional separation techniques, such as recrystallization, using diastereomeric salt, enzymatic methods of separation and chromatographic techniques (e.g., thin-layer chromatography, column chromatography, gas chromatography, and so on).

Compounds represented by formula (I) of the present invention, and their salts or hydrates can be used directly or mixed with well-known pharmaceutically acceptable carriers, and to formulate the usual ways. As the preferred dose forms, you can specify tablets, powders, fine particles, granules, coated tablets, capsules, syrups, lozenges, inhalers, suppositories, injections, ointments, eye ointment, eye drops, nasal drops, drops in ears, pulp, lotions, etc. For the preparation of dosage forms you can use any commonly used excipients, binders, disintegrating agents, lubricating agents, dyes, corrective coating and, if necessary, stabilizers, emulsifiers, binders, surface active agents, agents regulating the pH level, preservatives, antioxidants or the like, in combination with the various components that are usually used as starting materials in the preparation of pharmaceutical compositions.

As such components, you can specify animal and vegetable oils such as soybean oil, beef tallow and synthetic glycerides; hydrocarbons such as liquid paraffin, squalane and solid paraffin; essential oils, such as octyldodecanol and isopropylmyristate; higher alcohols, such as cetosteatil alcohol and beganovic alcohol; silicone resins; silicone oils; surface-active agents, such as polyoxyethylene esters of fatty acids, sorbitane esters of fatty acids, glycerol esters of fatty acids, polyoxyethylenesorbitan esters of fatty acids, polyoxylene gidrirovannoe castor oil and a block copolymer of polyoxyethylene polyoxypropylene; water-soluble polymers such as hydroxyethylcellulose, polyacrylic acid, carboxyvinyl polymer, polyethylene glycol, polyvinylpyrrolidone and methyl cellulose; lower alcohols such as ethanol and isopropanol; polynuclear alcohols, such as glycerin, propylene glycol, dipropyleneglycol and sorbitol; sugars such as glucose and sucrose; inorganic powders such as silicic anhydride, maggiacomo the Licata and aluminosilicate; purified water, etc. are Examples of excipients that can be used include lactose, corn starch, white sugar, glucose, mannitol, sorbitol, crystalline cellulose and silicon dioxide; examples of binders which can be used include polyvinyl alcohol, polyvinyl ether, methylcellulose, ethylcellulose, gum Arabic, tragakant, gelatin, shellac, hydroxypropylcellulose, hypromellose, polyvinylpyrrolidone, block-polymer polypropylenglycol/polyoxyethylene and meglumine, calcium citrate, dextrin, pectin and calcixerollic; examples of openers that can be used include starch, agar, gelatin powder, crystalline cellulose, calcium carbonate, sodium bicarbonate, calcium citrate, dextrin, pectin and calcixerollic; examples of lubricating agents which can be used include magnesium stearate, talc, polyethylene glycol, silica, hydrogenated vegetable oil; examples of dyes that can be used include any of those approved for addition to drugs; examples of corrective coatings that can be used include cocoa powder, menthol, aromatic powder, menthol oil, borneol and cinnamon powder; and examples of antioxidants that can be used include those, is the quiet allowed to add to medicines, such as ascorbic acid and alpha-tocopherol.

Compositions for oral administration can be prepared by combining the compound of the present invention or its salt with excipients, if necessary, adding a binder, a leavening agent, a lubricating agent, a coloring agent, a corrective coating or the like, and receiving the powder, fine particles, granules, tablets, coated tablets, capsules, etc. in the usual way.

Tablets or granules, of course, can be coated with a sugar coating, gelatin coating or other types of suitable coverings when necessary.

In the case of liquid compositions, such as syrup, injectables, eye drops or the like, the General method can be used for preparation of compositions with a pH regulator, an agent that promotes dissolution, giving isotonicity agent, or the like, as well as contributing to the dissolution medium, stabilizer, superyoshi agent, suspenders agent, an antioxidant, etc. if necessary. In the case of liquid compositions can also be liofilizirovanny and injection can be administered intravenously, subcutaneously or intramuscularly. As the preferred examples suspendida agents, you can specify methylcellulose, Polysorbate 80, hydroxyethyl cellulose, gum Arabic, powder tragakant, natrocarbonatite is, polyoxyethylenesorbitan and the like; preferable examples of promoting the solubility of funds, you can specify polyoxyethylene gidrirovannoe castor oil, Polysorbate 80, nicotinamide, polyoxyethylenesorbitan and the like; preferable examples of stabilizing agents, you can specify the sodium sulfite, metasulfite sodium, ether and the like; and as preferred examples of preservatives, you can specify methylparahydroxybenzoate, peroxybenzoate, metilparagidroksibenzoat, sorbic acid, phenol, cresol, chlorocresol etc.

There are no particular restrictions on the specific ways of getting agents for external use, and you can use any known methods. Materials used bases can be materials that are usually used for making medicines, quasilocal, cosmetic preparations and the like, and as examples include raw materials such as animal and vegetable oils, mineral oils, ester oils, waxes, higher alcohols, fatty acids, silicone oils, surface-active agents, phospholipids, alcohols, polynuclear alcohols, water-soluble polymers, clay minerals, purified water, etc., adding pH regulators, antioxidants, chelating agents, antiseptics and fungicides, CRAs is related agents aromatic agents, etc. if necessary. In addition, if necessary, they may include components that induce differentiation, or other components such as promoters circulation, microbicides, protivorahiticescoe agents, activators cells, vitamins, amino acids, humectants, keratolytic agents, etc.

Drugs, containing compound (I) of the present invention, and salts or hydrates as effective ingredients you can use to treat or prevent mammalian (e.g., humans, mice, rats, Guinea pigs, rabbits, dogs, horses, monkeys and so on), and especially for the prevention or treatment of human diseases. Although the dose of medication in accordance with the present invention will vary depending on the severity of the patient's symptoms, age, sex, body weight, dosage form, type of salt, the susceptibility to the drug and a specific type of disease and so on, they usually range from about 30 μg to 10 g, preferably from 100 μg to 500 mg, more preferably from 100 μg to 500 mg, more preferably from 100 μg to 100 mg per day for adults in the case of oral administration, or about 1-3000 μg/kg and preferably 3-1000 mg/kg per case injection, administered once or divided into several times a day.

EXAMPLES

The following examples of the preparation, use the s and test examples are only for illustrative purposes and are in no way intended to limit the compounds of the present invention. Professionals in this field should be clear that various modifications can be performed in addition to these examples, and the scope of the claims to achieve the maximum effect of the present invention, and such modifications are also included in the scope of the claims.

The phrase "purified using chromatographic processing on a column of silica gel and indicated in the title compound is obtained from... factions" in the present invention means obtaining specified in the connection header by concentrating the solution fractions containing the desired compound obtained by chromatographic processing on a column of silica gel and, if necessary, by subsequent recrystallization.

Example obtain 1

2-(1-butenyl)pyridine

To a solution of 2-bromopyridine (50 g)dissolved in diethylamine (500 ml), add dichlorobis(triphenylphosphine)palladium(II) (2.2 g) and copper iodide (0.3 g) and the reaction mixture is stirred for 4 hours at room temperature, introducing this gaseous 1-Butin (100 g). After the reaction mixture is bubbled nitrogen and then add ethyl acetate. After the reaction mixture was filtered through celite to remove insoluble residue, the filtrate is washed with water and brine. The obtained organic ex is ract dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic treatment on column c silica gel and indicated in the title compound (35 g) are obtained in the form of a brown oil from a fraction of a mixture of n-hexane:ethyl acetate (5:1).

1H NMR (400 MHz, CDCl3) δ of 1.26 (t, J=7,6 Hz, 3H), 2,45 (kV, J=7,6 Hz, 2H), 7,16-7,20 (m, 1H), 7,35-7,38 (m, 1H), to 7.59-7,63 (m, 1H), 8,53-8,54 (m, 1H).

Example of getting 2

2-ethylpyrazine[1,5-a]pyridine

To a solution of 2-(1-butenyl)pyridine (12.8 g) in dichloromethane (60 ml) add a solution of O-mesitylsulfonylhydroxylamine (reference, Synthesis, 1997, 1) (20 g) in dichloromethane (132 ml) under ice cooling and the reaction mixture is stirred for 30 minutes To the reaction mixture is added diethyl ether (2 l) to precipitate crystals, which are filtered off and then dried under reduced pressure to give crude product mesitylenesulfonic N-amino-2-(1-butynyl)pyridinium (12,6 g) in the form colorless crystals.

Part (6,1 g) obtained crude product of N-amino-2-(1-butynyl)pyridinemethanol dissolved in tetrahydrofuran (600 ml) and then to this add tert-piperonyl potassium (3.55 g) at room temperature and the reaction mixture is intensively stirred for 30 minutes After adding ice water to the obtained reaction mixture, extraction is carried out by this what lacerata. After re-extraction of the aqueous layer with ethyl acetate, the insoluble residue is removed using filtration through celite, the organic extracts are combined and washed with brine. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and specified in the header connection (0,63 g) are obtained in the form of oil is light yellow in color of the fraction of n-hexane:ethyl acetate (10:1).

1H NMR (400 MHz, CDCl3) δ of 1.36 (t, J=7,6 Hz, 3H), 2,86 (kV, J=7,6 Hz, 2H), 6.30-in (c, 1H), 6,65 (DDD, J=1,6, of 6.8, 6.8 Hz, 1H),? 7.04 baby mortality (DDD, J=1,2, 6,8, 8,8 Hz, 1H), 7,41 (DDD, J=1,2, 1,2, 8,8 Hz, 1H), of 8.37 (DDD, J=1,2, 1,2, 6,8 Hz, 1H).

Example of getting 3

7-bromo-2-ethylpyrazine[1,5-a]pyridine

To a solution of 2-ethylpyrazine[1,5-a]pyridine (80 mg) in tetrahydrofuran (1 ml) was added dropwise n-utility (1.6 M solution in hexane: 0,58 ml) at -78°in a stream of nitrogen and the reaction mixture was stirred further for 30 min at the same temperature. A solution of 1,2-dibromo-1,1,2,2-tetrachlorethane (196 mg) in tetrahydrofuran (0.5 ml) is added dropwise to the reaction mixture and stirring is continued for 30 minutes After increasing the temperature to room temperature and adding water to the reaction mixture extracted with her utilize the atom and the organic extract washed with water and brine. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (90 mg) are obtained in the form of butter a light brown colour of the fraction of n-hexane:ethyl acetate (20:1).

1H NMR (400 MHz, CDCl3) δ of 1.36 (t, J=7,6 Hz, 3H), 2,93 (kV, J=7,6 Hz, 2H), of 6.49 (c, 1H), 6,94 (DD, J=7,2, an 8.4 Hz, 1H), 6,99 (DD, J=1,6, 7.2 Hz, 1H), 7,44 (DD, J=1,6, and 8.4 Hz, 1H).

Example 4

7-bromo-2-ethyl-3-nitropyrazole[1,5-a]pyridine

To a solution of 7-bromo-2-ethylpyrazine[1,5-a]pyridine (1.1 g) in acetonitrile (20 ml) add detroitmetroairport (1.3 g) under ice cooling and the reaction mixture is stirred for 30 minutes and Then added to ice water, extracted with ethyl acetate and the organic extract washed with water and brine. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, and the solvent is evaporated under reduced pressure. The resulting residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (670 mg) obtained as yellow crystals from a fraction of n-hexane:ethyl acetate (10:1).

1H NMR (400 MHz, CDCl3) δ of 1.42 (t, J=7,6 Hz, 3H), 3.27 to (kV, J=7,6 Hz, 2), 7,39 (DD, J=1,2, 7,6 Hz, 1H), 7,50 (DD, J=7,6, 8,8 Hz, 1H), scored 8.38 (DD, J=1,2, 8,8 Hz, 1H).

Example of getting 5

7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-amine

To a suspension of 7-bromo-2-ethyl-3-nitropyrazole[1,5-a]pyridine (1.78 g) in a mixed solution of ethanol (100 ml), water (50 ml) and acetic acid (10 ml) is added powdered zinc (1.78 g) at room temperature and the reaction mixture is stirred for 1 hour at 65°C. the Reaction mixture was filtered through celite to remove the insoluble residue and the filtrate is evaporated under reduced pressure. To the obtained residue, add water and extracted with ethyl acetate, and after washing the organic extract with water, saturated aqueous sodium bicarbonate and brine the organic extract is dried over anhydrous magnesium sulfate and filtered, and the solvent is evaporated under reduced pressure. The resulting residue is purified by chromatographic processing on a column of silica gel (60 g) and specified in the header connection (1,16 g) are obtained in the form of oil dark green color of the faction acetate:n-hexane (4:1).

1H NMR (400 MHz, CDCl3) δ of 1.36 (t, J=7,6 Hz, 3H), 2,89 (kV, J=7,6 Hz, 2H), for 6.81 (DD, J=7,1, to 8.7 Hz, 1H), to 6.88 (DD, J=1,3, 7,0 Hz, 1H), 7,34 (DD, J=1,3, 8.6 Hz, 1H).

An example of obtaining 6

tert-Butyl N-(7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-yl)carbamate

To a solution of 7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-amine (1,16 g) in dichloromethane (50 ml), add triethylamine (1,01 ml) and di-tert-BUTYLCARBAMATE (1,34 ml) at room temperature and the reaction mixture is stirred for 15 hours. After completion of the reaction the solvent is evaporated under reduced pressure. Add ethyl acetate to the residue, the organic extract washed with water and brine, dried over anhydrous magnesium sulfate and filtered, then the solvent is evaporated under reduced pressure. The resulting residue is purified by chromatographic processing on a column of silica gel (60 g) and specified in the header connection (1,09 g) are obtained in the form of crystals of reddish-brown color of the faction ethyl acetate:n-hexane (1:3).

1H NMR (400 MHz, CDCl3) δ of 1.34 (t, J=7,6 Hz, 3H), 1,52 (users,9H), 2,87 (kV, J=7,6 Hz, 2H), 5,91 (users, 1H), 6,92? 7.04 baby mortality (m, 2H), 7,40 (d, J=9.0 Hz, 1H).

Example of getting 7

N-(7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-cyclopropylmethyl

To a solution of tert-butyl N-(7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-yl)carbamate (658 mg) in N,N-dimethylformamide (15 ml) is added sodium hydride (60% in oil; 116 mg) at room temperature in a stream of nitrogen and the reaction mixture is stirred for 30 minutes To this add (methyl bromide)cyclopropane (0,286 ml) at the same temperature the ur and the reaction mixture is stirred for 1 hour at 60° C. After completion of the reaction, the reaction mixture was gradually added to ice, add ethyl acetate and the organic extract washed with water and brine, after which it is dried over anhydrous magnesium sulfate and the solvent is evaporated under reduced pressure to give crude product of tert-butyl N-(7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-cyclopropanecarbonyl.

To a solution of crude tert-butyl N-(7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-cyclopropanecarbonyl dissolved in ethyl acetate (10 ml), add 4n. a mixture of hydrochloric acid/ethyl acetate (30 ml) and the reaction mixture is stirred for 2 hours at room temperature. After completion of the reaction, the reaction mixture is added 5N. an aqueous solution of sodium hydroxide under ice cooling for neutralization. The reaction mixture was extracted with ethyl acetate, and after washing the organic extract with water and saline solution it is dried over anhydrous magnesium sulfate and the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel (20 g) and indicated in the title compound (479 mg) are obtained in the form of a yellow oil from a fraction ethyl acetate:n-hexane (1:3)

1H NMR (400 MHz, CDCl3) δ 0,14-0,22 (m, 2H), 0,47-of 0.56 (m, 2H), 0,96-1,10 (m, 1H), 1,37 (t, J=7,6 Hz, 3H), 2,88 (d, J=6,8 Hz, 2H), 2,90 (kV, J=7,6 Hz, 2H), 6,83 (DD, J=7,0, 8.8 G is, 1H), 6.90 to (DD, J=1,3, and 7.1 Hz, 1H), 7,43 (DD, J=1,3, 8,8 Hz, 1H).

Example obtain 8

N-(7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-cyclopropylmethyl-N-tetrahydro-2H-4-paradimethylamino

To a solution of N-(7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-cyclopropanemethylamine (106 mg) in tetrahydrofuran (3 ml) is added tetrahydropyran-4-carbaldehyde (123 mg) at room temperature and then gradually add triacetoxyborohydride sodium (229 mg). After stirring the reaction mixture for 1 hour to this add saturated aqueous sodium bicarbonate solution. The resulting mixture was extracted with ethyl acetate and the organic extract washed with brine, then dried over anhydrous magnesium sulfate and evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel (10 g) and indicated in the title compound (120 mg) are obtained in the form of a yellow oil from a fraction ethyl acetate:n-hexane (1:6).

1H NMR (400 MHz, CDCl3) δ to-0.02 and 0.06 (m, 2H), 0,33-0,43 (m, 2H), 0.75 to 0,88 (m, 1H), 1,20-of 1.34 (m, 2H), 1,38 (t, J=7,6 Hz, 3H), 1,48-of 1.62 (m, 1H), 1,69-of 1.78 (m, 2H), 2,88 (d, J=6,8 Hz, 2H), 2.91 in (kV, J=7,6 Hz, 2H), 3.04 from (d, J=7,0 Hz, 2H), 3,30 (dt, J=2,1, 12.0 Hz, 2H), 3,90-4,00 (m, 2H), to 6.88 (DD, J=7,1, 8,8 Hz, 1H), of 6.96 (DD, J=1,3, and 7.1 Hz, 1H), 7,49 (DD, J=1,3, 8,8 Hz, 1H).

The same way as the examples get 7 and 8 receive the compound of example obtaining 9.

The example of Paul the treatment 9

N-(7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-butyl-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

Example 10

7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethyl-3-

nitropyrazole[1,5-a]pyridine

To a solution of 7-bromo-2-ethyl-3-nitropyrazole[1,5-a]pyridine (1.0 g) in a mixture of 1,2-dimethoxyethane (50 ml) and water (25 ml) is added 2,6-dimethoxy-4-(methoxymethyl)phenylboric acid (1.26 g), tetrakis(triphenylphosphine)palladium(0) (0.64 g) and octahedral of barium hydroxide (1.75 g) and the reaction mixture is heated and stirred for 2 hours at 80°C. To the resulting reaction mixture are added water and ethyl acetate and to remove the insoluble residue is filtered over celite. The filtrate is extracted with ethyl acetate, the organic extract washed with brine, dried over anhydrous magnesium sulfate and filtered, and the solvent is evaporated under reduced pressure. The resulting residue is purified by chromatographic processing on a column of silica gel and specified in the header connection (0,77 g) obtained as yellow crystals from a fraction of n-hexane:ethyl acetate (3:1).

1H NMR (400 MHz, CDCl3) δ of 1.28 (t, J=7.2 Hz, 3H), 3,12 (kV, J=7.2 Hz, 2H), 3,49 (c, 3H), 3,71 (c, 6H), 4.53-in (c, 2H), 6,67 (c, 2H), 7,03 (DD, J=1,6, 7.2 Hz, 1H), 7,65 (DD, J=7,2, 8,8 Hz, 1H), 8.34 per (DD, J=1,2, 8,8 Hz, 1H).

Example of getting 11

7-bromo-2-methylpyrazolo[1,5-a]pyridine

To a solution of 2-methylpyrazolo[1,5-a]pyridine (reference; Chem., Pharm. Bull., 1983, 31, 4568-5572) (1.0 g) in tetrahydrofuran (20 ml) dropwise at -78°in a stream of nitrogen was added n-utility (2.66 M solution in hexane; 3,7 ml) and the reaction mixture is stirred for 30 minutes To the reaction mixture is added dropwise a solution of 1,2-dibromo-1,1,2,2-tetrachlorethane (2.7 g) in tetrahydrofuran (5 ml) and stirring continued for 30 minutes After adding to the resulting reaction mixture, a saturated aqueous solution of ammoniaand the temperature was raised to room temperature, the reaction mixture add water and extracted with ethyl acetate. The organic extract is allocated, then washed with saline, dried over anhydrous magnesium sulfate and filtered. The solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and specified in the header connection (1,34 g) are obtained in the form of a yellow oil from a fraction of n-hexane:ethyl acetate (10:1).

1H NMR (400 MHz, CDCl3) δ 2,55 (c, 3H), 6,45 (c, 1H), 6,93 (DD, J=7,2, an 8.4 Hz, 1H), 6,97 (DD, J=1,6,7.2 Hz, 1H), 7,41 (DD, J=1,6, and 8.4 Hz, 1H).

Example 12

7-bromo-2-methyl-3-nitropyrazole[1,5-a]pyridine

It races the thief 7-bromo-2-methylpyrazolo[1,5-a]pyridine (1.3 g) in acetonitrile (25 ml) add detroitmetroairport (900 mg) under stirring on ice, and the reaction mixture is stirred for 10 minutes The resulting reaction mixture was added to ice water and the precipitated precipitated crystals are collected by filtration, washed with water and then dried under reduced pressure to give crude crystals. Their purified using chromatographic processing on a column of silica gel and indicated in the title compound (900 mg) obtained as yellow crystals from a fraction of n-hexane:ethyl acetate (5:1).

1H NMR (400 MHz, CDCl3) δ to 2.85 (s, 3H), 7,38 (DD, J=1,2, 7,6 Hz, 1H), 7,49 (DD, J=7,6, 8,8 Hz, 1H), 7,35 (DD, J=1,2, 8,8 Hz, 1H).

Example of getting 13

tert-Butyl N-(7-bromo-2-methylpyrazolo[1,5-a]pyridine-3-yl)carbamate

To a suspension of 7-bromo-2-methyl-3-nitropyrazole[1,5-a]pyridine (890 mg) in a mixed solution of ethanol (20 ml), water (10 ml) and acetic acid (2 ml) is added powdered zinc (890 mg) at room temperature and the reaction mixture is heated and stirred for 30 min at 60°C. After the insoluble precipitate is filtered off, the filtrate is extracted with ethyl acetate, washed with saturated aqueous sodium bicarbonate and saline. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and [7-bromo-2-methylpyrazolo[1,5-a]feast the DIN-3-yl]amine (371 mg) are obtained in the form of a brown oil from a fraction of n-hexane:ethyl acetate (1:1).

To the solution obtained [7-bromo-2-methylpyrazolo[1,5-a]pyridine-3-yl]amine and triethylamine (0,342 ml) in dichloromethane added di-tert-BUTYLCARBAMATE (429 mg) under ice cooling and the reaction mixture stirred for 15 h at room temperature. To the obtained reaction mixture, water is added, extracted with ethyl acetate and the organic extract washed with water and brine. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (420 mg) obtained as oil color, natural off-white canvas of the fraction of n-hexane:ethyl acetate (5:1).

1H NMR (400 MHz, CDCl3) δ 1,52 (users, 9H), 2,47 (c, 3H), 5,88-of 5.92 (m, 1H), 6,94-7,00 (m, 2H), 7,37-7,42 (m, 1H).

The same way as the examples get 7 and 8 receive the compound of example obtaining 14.

Example of getting 14

N-(7-bromo-2-methylpyrazolo[1,5-a]pyridine-3-yl)-N-cyclopropylmethyl-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,04 to 0.08 (m, 2H), 0,32-0,43 (m, 2H), 0.74 and-0,88 (m, 1H), 1,20-of 1.36 (m, 2H), 1,46-of 1.62 (m, 1H), 1,66-of 1.78 (m, 2H), 2,52, (c, 3H), 2,87 (d, J=6,8 Hz, 2H), 3,03 (d, J=6,8 Hz, 2H), 3,30 (dt, J=2.0 a, 12,0 Hz, 2H), 3,89-to 3.99 (m, 2H), to 6.88 (DD, J=1,4, 6,8 Hz, 1H), 6,95 (DD, J=6,8, 8,8 Hz, 1H), 7,47 (DD, J=1,4, 8,8 Hz, 1).

Example get 15

2-(3-Methoxy-1-PROPYNYL)pyridine

To a solution of 2-bromopyridine (20 g) in diethylamine (100 ml) is added 3-methoxy-1-propyne (11.8 g), dichlorobis(triphenylphosphine)palladium(II) (888 mg) and copper iodide (121 mg) and the reaction mixture is stirred for 1 hour at 40°in a stream of nitrogen. After the reaction mixture was filtered through celite to remove insoluble residue, the filtrate is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and specified in the header connection (16,8 g) are obtained in the form of oil light orange color of the fraction of n-hexane:ethyl acetate (5:1).

1H NMR (400 MHz, CDCl3) δ 3,48 (c, 3H), 4,36 (c, 2H), 7,22-7,26 (m, 1H), 7,44-7,47 (m, 1H), 7,66 (DDD, J=1,6, of 7.6 and 7.6 Hz, 1H), 8,57 at 8.60 (m, 1H).

Example 16

2-(methoxymethyl)pyrazolo[1,5-a]pyridine

To a solution of 2-(3-methoxy-1-PROPYNYL)pyridine (13,2 g) in dichloromethane (50 ml) added dropwise a solution of O-mesitylsulfonylhydroxylamine (reference, Synthesis, 1997, 1) (21 g) in dichloromethane (80 ml) under ice cooling and the reaction mixture is stirred for 30 minutes Diethyl ether (1 l) is added to the obtained reaction mixture to precipitate crystals, which are collected by filtration and dried under reduced pressure, getting wet is a product of 1-amino-2-(3-methoxy-1-PROPYNYL)pyridine 2,4,6-trimethyl-1-benzosulfimide in the form of crystals color, natural off-white canvas (27,1 g).

To a solution of the obtained crude product of 1-amino-2-(3-methoxy-1-PROPYNYL)pyridine 2,4,6-trimethyl-1-benzosulfimide (27,1 g) in methanol (100 ml) dropwise, while cooling with ice add sodium methoxide (28% methanol solution; and 14.3 ml) and the reaction mixture stirred for 20 min at room temperature. After adding to the resulting reaction mixture, ice water, the methanol is evaporated under reduced pressure, add to the residue water and extracted three times with ethyl acetate. The organic extracts are combined, washed with saline, dried over anhydrous magnesium sulfate, filtered and the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (3.54 in) get the oil light orange color of the fraction of n-hexane:ethyl acetate (5:1).

1H NMR (400 MHz, CDCl3) δ 3,47 (c, 3H), 4,68 (c, 2H) 6,50 (c, 1H), 6,70 to 6.75 (m, 1H), 7,06-7,11 (m, 1H), 7,47-to 7.50 (m, 1H), 8,40-8,43 (m, 1H).

Example of getting 17

Methyl ester (7-bromopyrazole[1,5-a]pyridine-2-yl)methyl

To a solution of 2-(methoxymethyl)pyrazolo[1,5-a]pyridine (3.5 g) in tetrahydrofuran (350 ml) dropwise at -78°in a stream of nitrogen was added n-utility (2.66 M solution in hexane; 10,5 ml) and the reaction mixture is stirred for 30 minutes To the obtained R is the promotional mix are added dropwise 1,2-dibromethane (2,05 ml) and stirring continued for 30 minutes After adding to the reaction mixture of a saturated aqueous solution of ammoniaand the temperature was raised to room temperature, add water and extracted with ethyl acetate. The organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered. The solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and specified in the header connection (2,75 g) are obtained in the form of oil is light yellow in color of the fraction of n-hexane:ethyl acetate (10:1).

1H NMR (400 MHz, CDCl3) δ 3,47 (c, 3H), 4.75 in (c, 2H), of 6.71 (c, 1H), 6,99 (DD, J=7,2, 8,8 Hz, 1H), 7,05 (DD, J=1,2, 7.2 Hz, 1H), 7,51 (DD, J=1,2, 8,8 Hz, 1H).

Example of getting 18

Methyl ester (7-bromo-3-nitropyrazole[1,5-a]pyridine-2-yl)methyl

To a solution of methyl ester (7-bromopyrazole[1,5-a]pyridine-2-yl)methyl (1.0 g) in acetonitrile (20 ml) add detroitmetroairport (606 mg) under stirring on ice. The resulting reaction mixture was added to ice water, extracted with ethyl acetate and then washed with water and brine. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and specified in the zag is lowke compound (546 mg) are obtained in the form of crystals of light-yellow color of the fraction of n-hexane:ethyl acetate (5:1).

1H NMR (400 MHz, CDCl3) δ 3,61 (c, 3H), 5,09 (c, 2H), 7,44 (DD, J=1,2, 7,6 Hz, 1H), 7,54 (DD, J=7,6, 8,8 Hz, 1H), 7,51 (DD, J=1,2, 8,8 Hz, 1H).

Example of getting 19

tert-Butyl N-[7-bromo-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-yl]carbamate

To a suspension of methyl ester (7-bromo-3-nitropyrazole[1,5-a]pyridine-2-yl)methyl (540 mg) in a mixed solution of ethanol (10 ml), water (5 ml) and acetic acid (1 ml) is added powdered zinc (540 mg) and the reaction mixture is heated and stirred for 30 min at 60°C. After insoluble residue is filtered off, the filtrate water is added, extracted with ethyl acetate and the organic extract washed with saturated aqueous sodium bicarbonate and saline. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and 7-bromo-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-amine (371 mg) are obtained in the form of a brown oil from a fraction of n-hexane:ethyl acetate (2:1).

To a solution of the obtained 7-bromo-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-amine in triethylamine (0,303 ml) and dichloromethane (5 ml) is added di-tert-BUTYLCARBAMATE (380 mg) under ice cooling and the reaction mixture was stirred further for but and at room temperature. To the reaction mixture, water is added, extracted with ethyl acetate and the organic extract washed with water and brine. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (360 mg) obtained as crystals pale yellow fraction of n-hexane:ethyl acetate (5:1).

1H NMR (400 MHz, CDCl3) δ 1,52 (users, 9H), 3,42 (c, 3H), 4,77 (c, 2H), 6,50-6,62 (m, 1H), 6,97 (DD, J=7,2, 8,8 Hz, 1H),? 7.04 baby mortality (DD, J=1,2,8,8 Hz, 1H), 7,58-to 7.68 (m, 1H).

The same way as the examples get 7 and 8 receive the compound of example obtaining 20.

Example of getting 20

N-[7-bromo-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-yl]-N-cyclopropylmethyl-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,04-0,04 (m, 2H), 0,30-0,40 (m, 2H), 0,72 is 0.86 (m, 1H), 1,18-of 1.33 (m, 2H), 1,46-of 1.62 (m, 1H), 1,64 is 1.75 (m, 2H), 2,87 (d, J=6,8 Hz, 2H), 3,03 (d, J=6,8 Hz, 2H), 3.27 to (dt, J=2,0, 11.2 Hz, 2H), 3,44 (c, 3H), 3,86-of 3.96 (m, 2H), 4,67 (c, 2H), 6.89 in (DD, J=1,4, 6,8 Hz, 1H), 7,02 (DD, J=6,8, 8,8 Hz, 1H), 7,54 (DD, J=1,4, 8,8 Hz, 1H).

Example of getting 21

7-bromo-2-methoxypyrazine[1,5-a]pyridine

A solution of 2-methoxypyrazine[1,5-a]pyridine (reference; Bull. Chem. Soc. Japan, vol.49(7), 1980-984 (1976)) (7,15 g) in tetrahydrofuran (140 ml) cooled to -78° With a stream of nitrogen, and after adding dropwise to this n-utility (1.6 M solution in hexane: 46 ml) the reaction mixture is stirred for 30 minutes To the reaction mixture dropwise at -78°add a solution of 1,2-dibromo-1,1,2,2-tetrachlorethane (18,9 g) in tetrahydrofuran (30 ml) and stirring is continued for 1 hour. The temperature of the reaction mixture was raised to room temperature, add water and then extracted with ethyl acetate. The organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and specified in the header connection (7,1 g) are obtained in the form of a yellow oil from a fraction of n-hexane:ethyl acetate (50:1).

1H NMR (400 MHz, CDCl3) δ a 4.03 (s, 3H), of 6.02 (s, 1H), 6,91-6,97 (m, 2H), 7,31 (DD, J=2,4, and 7.6 Hz, 1H).

Example of getting 22

7-bromo-2-methoxypyrazine[1,5-a]pyridine-3-amine

To a solution of 7-bromo-2-methoxypyrazine[1,5-a]pyridine (1 g) in acetic acid (10 ml) is added an aqueous solution (5 ml) of sodium nitrite (334 mg) and the reaction mixture stirred for 20 min at room temperature. After adding ethanol (60 ml) and water (30 ml) to the reaction mixture powder of zinc (1 g) and the reaction mixture is heated and re is eshivot for 30 min at 60° C. the Reaction mixture was filtered through celite to remove insoluble residue, add water and extracted with ethyl acetate. The organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (750 mg) are obtained as brown crystals from a fraction of n-hexane:ethyl acetate (3:1).

1H NMR (400 MHz, CDCl3) δ 4,13 (c, 3H), 6,78 (DD, J=1,6, 6,8 Hz, 1H), for 6.81 (DD, J=6,8, and 8.4 Hz, 1H), 7,24 (DD, J=1,6, and 8.4 Hz, 1H).

An example of retrieving 23

tert-Butyl N-(7-bromo-2-methoxypyrazine[1,5-a]pyridine-3-yl)carbamate

To a solution of 7-bromo-2-methoxypyrazine[1,5-a]pyridine-3-amine (810 mg) in dichloromethane (20 ml), add triethylamine (0.7 ml) and di-tert-BUTYLCARBAMATE (923 μl) under ice cooling and the reaction mixture was stirred over night at room temperature. To the obtained reaction mixture, water is added, extracted with ethyl acetate and the organic extract washed with brine. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on the column with silicagel the m and specified in the header of the connection (of 1.05 g) obtained as yellow crystals from a fraction of n-hexane:ethyl acetate (10:1).

1H NMR (400 MHz, CDCl3) δ 1,49 (c, 9H), 4,12 (c, 3H), 6.89 in (DD, J=1,2, 7,6 Hz, 1H), 6,94 (DD, J=7,6, 8,8 Hz, 1H), 7,30-7,39 (m, 1H).

Example of getting 24

N-(7-bromo-2-methoxypyrazine[1,5-a]pyridine-3-yl)-N-cyclopropylmethyl-N-tetrahydro-2H-4-paramillitaryn

Sodium hydride (60% in oil; to 24.6 mg) are added to a solution of tert-butyl N-(7-bromo-2-methoxypyrazine[1,5-a]pyridine-3-yl)carbamate (140 mg) in N,N-dimethylformamide (10 ml) at room temperature and the reaction mixture is stirred for 30 minutes (methyl bromide)cyclopropane (0.06 ml) to this, add at the same temperature and the reaction mixture is stirred for 1 hour at 60°C. After completion of the reaction, the reaction mixture was gradually add to ice, extracted with ethyl acetate, the organic extract washed with water and brine, dried over anhydrous magnesium sulfate, filtered and the solvent is evaporated under reduced pressure to give crude product, tert-butyl N-(7-bromo-2-methoxypyrazine[1,5-a]pyridine-3-yl)-N-cyclopropanecarbonyl.

The resulting crude product, tert-butyl N-(7-bromo-2-methoxypyrazine[1,5-a]pyridine-3-yl)-N-cyclopropanecarbonyl, dissolved in ethyl acetate (10 ml) without purification, and then add a mixture of 4h. hydrochloric acid/ethyl acetate (15 ml) and the reaction mixture is stirred for 2 hours at room temperature. After the arsenia reaction to the reaction mixture 5h. aqueous sodium hydroxide solution is added under ice cooling for neutralization. Add ethyl acetate and the organic extract washed with water and brine, dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure to give crude product, N-(7-bromo-2-methoxypyrazine[1,5-a]pyridine-3-yl)-N-cyclopropylmethyl.

The resulting crude product, N-(7-bromo-2-methoxypyrazine[1,5-a]pyridine-3-yl)-N-cyclopropylmethyl, dissolved in tetrahydrofuran (10 ml) without further purification, then to this add tetrahydropyran-4-carbaldehyde (233 mg) at room temperature and gradually add triacetoxyborohydride sodium (433 mg). After stirring the reaction mixture for 2 hours to the reaction mixture is added saturated aqueous sodium bicarbonate solution. After extraction with ethyl acetate the organic extract was washed with saline and dried over anhydrous magnesium sulfate and the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel (10 g) and indicated in the title compound (110 mg) are obtained in the form of a yellow oil from a fraction ethyl acetate:n-hexane (1:6).

1H NMR (400 MHz, CDCl3) δ -0,02 one-0.10 (m, 2H), 0,20-0,40 (m, 2H), 0.70 to about 0.90 (m, 1H), 1,10-of 1.39 (m, 2H), 1,40-1,60 (m, 1H), 1,62 and 1.80 (m, 2H), 2,81 (d, J=6,4 Hz, 2H), 295 (d, J=7.2 Hz, 2H), 3.27 to (dt, J=2,0, 12.0 Hz, 2H), 3,80-4,00 (m, 2H), 4,11 (c, 3H), 6,80-to 6.95 (m, 2H), 7,33 (DD, J=1,6, and 8.4 Hz, 1H).

Example get 25

tert-Butyl N-[2-methylthiotetrazole[1,5-a]pyridine-3-yl]carbamate

To a suspension of 2-methylthio-3-nitropyrazole[1,5-a]pyridine (reference; tr1s, 1977, 6, 379) (400 mg) in ethanol (20 ml), water (10 ml), acetic acid (2 ml) is added powdered zinc (800 mg) and the reaction mixture is heated and stirred for 5 min at 80°C. the Insoluble residue is filtered off, the filtrate add water and extracted with ethyl acetate and then the organic extract was washed with saturated aqueous sodium bicarbonate and saline. The organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, obtaining (2-methylthiotetrazole[1,5-a]pyridine-3-yl)amine as a crude product.

To a solution of the obtained crude (2-methylthiotetrazole[1,5-a]pyridine-3-yl)amine in dichloromethane (5 ml) was added triethylamine (0.4 ml) and then di-tert-BUTYLCARBAMATE (625 mg) under ice cooling and the reaction mixture was stirred over night at room temperature. To the reaction mixture, water is added, extracted twice with ethyl acetate and the organic extract washed with water and brine. The resulting organic extract is dried over anhydrous sulfate magnify filter, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (230 mg) are obtained in the form of a yellow oil from a fraction of n-hexane:ethyl acetate (5:1).

1H NMR (400 MHz, CDCl3) δ 1,53 (users, 9H), 2,60 (c, 3H), 6,00-x 6.15 (m, 1H), 6,69 (t, J=6,8 Hz, 1H), 7,11 (t, J=8.0 Hz, 1H), 7,40-to 7.50 (m, 1H), 8,83 (d, J=6,8 Hz, 1H).

Example get26

tert-Butyl N-[7-iodine-2-methylthiotetrazole[1,5-a]pyridine-3-yl] carbamate

To a solution of tert-butyl N-[2-methylthiotetrazole[1,5-a]pyridine-3-yl]carbamate (21,6 g) in tetrahydrofuran (1 l) dropwise at -78°in a stream of nitrogen was added n-utility (1.6 M solution in hexane; 130 ml), the reaction mixture is stirred for 30 minutes To the resulting reaction mixture is added a solution of 1,2-diodata (24 g) in tetrahydrofuran (50 ml) and stirring is continued for 1 hour. After adding to the reaction mixture of a saturated aqueous solution of ammoniaand the temperature was raised to room temperature, extracted with ethyl acetate and the organic extract washed with water and brine. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing column is silica gel and specified in the header connection (21,5 g) obtained as yellow crystals from a fraction of n-hexane:ethyl acetate (5:1).

1H NMR (400 MHz, CDCl3) δ of 1.52 (s, N), of 2.64 (s, 3H), 6,02-6,10 (m, 1H), for 6.81 (DD, J=7,2, 8,8 Hz, 1H), 7,22 (DD, J=1,2, 7.2 Hz, 1H), 7,42-to 7.50 (m, 1H).

Example of getting 27

N-cyclopropylmethyl-N-[7-iodine-2-(methylsulfanyl)pyrazolo[1,5-a]pyridine-3-yl]amine

To a solution of tert-butyl N-[7-iodine-2-methylthiotetrazole[1,5-a]pyridine-3-yl]carbamate (600 mg) in N,N-dimethylformamide (6 ml) is added sodium hydride (60% in oil; 80 mg) in a bath with ice and the reaction mixture was stirred for 30 min at room temperature. (Methyl bromide)cyclopropane (0,22 ml) to the reaction mixture at the same temperature and stirring is continued for 1 hour at 40°C. After completion of the reaction, the reaction mixture was gradually added to ice, extracted with ethyl acetate and the organic extract washed with water and brine. The organic extract is dried over anhydrous magnesium sulfate and the solvent is evaporated under reduced pressure to give crude product, tert-butyl N-cyclopropylmethyl-N-[7-iodine-2-(methylsulfanyl)pyrazolo[1,5-a]pyridine-3-yl]carbamate.

To a solution of crude tert-butyl N-cyclopropylmethyl-N-[7-iodine-2-(methylsulfanyl)pyrazolo[1,5-a]pyridine-3-yl]carbamate in ethyl acetate (1 ml) is added a mixture of 4h. hydrochloric acid/ethyl acetate (10 ml) and the reaction mixture is stirred for 2 hours at room temperature. After C is the conclusion of the reaction, a saturated aqueous solution of sodium bicarbonate to the reaction mixture under ice cooling for neutralization. The reaction mixture was extracted with ethyl acetate, and after washing the organic extract with water and saline solution it is dried over anhydrous magnesium sulfate and the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel (20 g) and indicated in the title compound (506 mg) are obtained in the form of a yellow oil from a fraction ethyl acetate:hexane (1:3).

1H NMR (400 MHz, CDCl3) δ 0,16-0,24 (m, 2H), 0,48-of 0.56 (m, 2H), 1,00-1,10 (m, 1H), 2,60 (c, 3H), 2,96 (d, J=6.0 Hz, 2H), 3.00 and-3,24 (m, 1H), of 6.68 (DDD, J=1,2, 6,8, 8,8 Hz, 1H), 7,17 (DD, J=1,2, 6,8 Hz, 1H), 7,43 (DD, J=1,2, 8,8 Hz, 1H).

Example of getting 28

N-cyclopropylmethyl-N-[7-iodine-2-(methylsulfanyl)pyrazolo[1,5-a]pyridine-3-yl]-N-tetrahydro-2H-4-paradimethylamino

To a solution of N-cyclopropylmethyl-N-[7-iodine-2-(methylsulfanyl)pyrazolo[1,5-a]pyridine-3-yl]amine (70 mg) in tetrahydrofuran (2.5 ml) is added tetrahydropyran-4-carbaldehyde (56 mg) at room temperature and then gradually add triacetoxyborohydride sodium (103 mg). After 1 hour, add saturated aqueous sodium bicarbonate solution, extracted with ethyl acetate, the extract washed with brine and dried over anhydrous magnesium sulfate, the solvent is evaporated under reduced pressure to give crude product indicated in the title compound (50 mg) as a yellow oil is th color.

1H NMR (400 MHz, CDCl3) δ -0,06-0,04 (m, 2H), between 0.30 to 0.38 (m, 2H), 0.74 and is 0.86 (m, 1H), 1,20-of 1.32 (m, 2H), 1,40-1,60 (m, 1H), 1,66 and 1.80 (m, 2H), 2,69 (c, 3H), 2,85 (d, J=6,8 Hz, 2H), to 3.02 (d, J=7.2 Hz, 2H), 3,22-of 3.32 (m, 2H), 3,86-of 3.94 (m, 2H), 6,72 (DD, J=7,2, 8,8 Hz, 1H), 7,15 (DD, J=1,2, 7.2 Hz, 1H), 7,40 (DD, J=1,2, 8,8 Hz, 1H).

An example of obtaining 29

2,6-dimethoxy-4-(methoxymethyl)phenylboric acid

To a solution of 3,5-dimethoxy(methoxymethyl)benzene (23.7 g) in tetrahydrofuran (500 ml) is added n-utility (1,56 M solution in hexane; 100 ml) at -78°and the reaction mixture is stirred for 30 minutes under ice cooling. After cooling the reaction mixture to an internal temperature of -78°to the reaction mixture add triisopropoxide (39 ml) and the internal temperature was raised to room temperature with stirring. After completion of the reaction, to the reaction mixture while cooling with ice, add saturated aqueous ammoniacal and then to the reaction mixture are added ethyl acetate, the organic extract washed with brine, dried over anhydrous magnesium sulfate and the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (7.5 g) are obtained in the form of a yellow oil from an ethyl acetate fraction.

1H NMR (400 MHz, CDCl3) δ 3,43 (c, 3 is), 3,92 (c, 6H), 4,47 (c, 2H), 6,61 (c, 2H), 7,18 (c, 2H).

Example 30

4-(hydroxymethyl)-2,6-dimethoxyaniline acid

To a solution of 3,5-dimethoxybenzyl alcohol (2,71 g) in tetrahydrofuran (50 ml) is added n-utility (1,56 M solution in hexane; and 36.2 ml) under cooling with ice bath with ice, the internal temperature was raised to room temperature, and stirred for 1 hour. The internal temperature is then lowered to -78°With, to the mixture of triethoxysilane (9.6 ml) and the temperature was raised to room temperature with stirring. After completion of the reaction, to the reaction mixture while cooling with ice, add saturated aqueous solution of ameriglide and the reaction mixture is extracted with ethyl acetate, and then after washing the organic extract salt solution is dried over anhydrous magnesium sulfate and the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel (50 g), and specified in the header connection (1,72 g) obtained as an amorphous solid white color of an ethyl acetate fraction.

1H NMR (400 MHz, CDCl3) δ 3,92 (c, 6H), to 4.73 (s, 2H), 6,65 (s, 2H), 7,18 (c, 2H).

Similar to the method of example 30 synthesize compounds of examples 31 and 32 receive.

An example of retrieving 31

4-(2-hydroxyethyl)-2,6-dimethoxyaniline acid

Butter yellow

1H NMR (400 MHz, CDCl3) δ 1,56-of 1.62 (m, 1H), 2,88 (t, J=6.4 Hz, 2H), 3,88-to 3.92 (m, 2H), 3,90 (c, 6H), 6,51 (c, 2H), 7,14 (c, 2H).

Example of getting 32

4-(3-hydroxypropyl)-2,6-dimethoxyaniline acid

1H NMR (400 MHz, CDCl3) δ 1,84-of 1.94 (m, 2H), 2,68 was 2.76 (m, 2H), 3,64-3,74 (m, 2H), 3,90 (C, 6N), 6.48 in (s, 2H), 7,16 (s, 2H).

Similar to the method of example obtaining 29 synthesize compounds of examples getting 33-35.

An example of obtaining 33

4-(ethoxymethyl)-2,6-dimethoxyaniline acid

1H NMR (400 MHz, CDCl3) δ of 1.28 (t, J=7,1 Hz, 3H), to 3.58 (q, J=7,1 Hz, 2H), 3,92 (c, 6H), 4,51 (c, 2H), 6,63 (c, 2H), 7,19 (c, 2H).

An example of retrieving 34

4-[1-[1-(tert-butyl)-1,1-dimethylsilane]oxyethyl]-2,6-dimethoxyaniline acid

Colorless oil

1H NMR (400 MHz, CDCl3) δ 0,01 (c, 3H), 0,08 (c, 3H), 0,92 (c, 9H), of 1.41 (d, J=6.4 Hz, 3H), 3,90 (c, 6H), 4,84 (kV, J=6,4 Hz, 1H), 6,61 (c, 2H), 7,17 (c, 2H).

Example of getting 35

2,4-dimethoxy-6-(methoxymethyl)phenylboric acid

Crystals white

1H NMR (400 MHz, CDCl3) δ 3,41 (c, 3H), 3,85 (c, 3H), 3,88 (c, 3H), 4.53-in (c, 2H), 6.48 in (d, J=2.4 Hz, 1H), 6,55 (d, J=2.4 Hz, 1H), 7,09 (users, 2H).

<> Example 1

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

To a solution of N-(7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-cyclopropylmethyl-N-tetrahydro-2H-4-paradimethylamino (60 mg) in 1,2-dimethoxyethane (2 ml) and water (1 ml) is added 2,6-dimethoxy-4-(methoxymethyl)phenylboric acid (45 mg), tetrakis(triphenylphosphine)palladium(0) (35 mg) and octahedral of barium hydroxide (72 mg) and the reaction mixture is heated and stirred for 4 h at 90°C. the Reaction mixture was then cooled to room temperature, add water and ethyl acetate, the reaction mixture was filtered through celite to remove insoluble residue, and the filtrate is extracted with ethyl acetate. The combined organic extract was washed with brine, dried over anhydrous magnesium sulfate, filtered and the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (40 mg) are obtained in the form of crystals of light-yellow color of the fraction of n-hexane:ethyl acetate (1:1).

1H NMR (400 MHz, CDCl3) δ to-0.02 to 0.04 (m, 2H), 0,34 is 0.38 (m, 2H), 0,80-0,90 (m, 1H), 1,22 (t, J=7,6 Hz, 3H), of 1.24 to 1.34 (m, 2H), 1,54-of 1.64 (m, 1H), 1,74 and 1.80 (m, 2H), 2,77 (kV, J=7,6 Hz, 2H), 2,88 (d, J=6,8 Hz, 2H), 3,05 (d, J=7.2 Hz, 2H), and 3.31 (t, J=11,6 Hz, 2H), 3,49 (c, 3H), to 3.73 (c, 6H), 3,90-4,00 (m, 2H), 4.53-in (c, 2H), 6,59 (DD, J=1,2, 6,8 Hz, 1H), 6,67 (c, 2H), 7,00 (DD, J=6,8, 8,8 Hz, 1H), 7,44 (DD, J=1,2, 8,8 Hz, 1H).

Example 1-2

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

Specified in the title compound (29 g) is recrystallized from ethanol (80 ml)to give crystals of pale yellow (27.5 g).

1H NMR (600 MHz, DMSO-d6) δ -0,02-0,00 (m, 2H), 0,32-0,35 (m, 2H), 0,73-of 0.79 (m, 1H), 1,11-1,19 (m, 5H), 1,51-of 1.57 (m, 1H), 1,69-1,72 (userid, J=2,0, a 12.7 Hz, 2H), 2,65 (kV, J=7,6 Hz, 2H), 2,84 (d, J=6,8 Hz, 2H), 3,01 (d, J=7,1 Hz, 2H,), 3,21 (DDD, J=1,7, to 11.7, 11.7 Hz, 2H), 3,39 (c, 3H), 3,63 (c, 6H), 3,82 (userid, J=2,4, and 11.5 Hz, 2H), 4,49 (c, 2H), 6,55 (DD, J=1,2, 6,8 Hz, 1H), 6,74 (c, 2H), 7,06 (DD, J=6,6, 8,8 Hz, 1H), 7,51 (DD, J=1,2, 8,8 Hz, 1H).

Similar to the method of example 1 to synthesize the compounds of examples 2-9.

Example 2

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(1-methoxyethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

The crystals are light yellow

1H NMR (400 MHz, CDCl3) δ to-0.02 to 0.04 (m, 2H), 0,32 is 0.38 (m, 2H), over 0.80 to 0.92 (m, 1H), 1,23 (t, J=7,6 Hz, 3H), 1,22-of 1.34 (m, 2H), of 1.52 (d, J=6.4 Hz, 3H), 1,52-of 1.64 (m, 1H), 1,72-to 1.82 (m, 2H), 2,79 (kV, J=7,6 Hz, 2H), 2,89 (d, J=6,4 Hz, 2H), 3,05 (d, J=7.2 Hz, 2H), 3,26-to 3.34 (m, 2H), 3,36 (c, 3H), of 3.73 (c, 6H), 3,90-3,98 (m, 2H), 4,34 (kV, J=6,8 Hz, 1H), is 6.61 (DD, J=1,2, 6,8 Hz, 1H), only 6.64 (d, J=2,8 Hz, 2H), 7,01 (DD, J=6,8, 8,8 Hz, 1H), 7,44 (DD, J=1,2, 8,8 Hz, 1H).

P the emer 3

N-cyclopropylmethyl-N-7-[4-(ethoxymethyl)-2,6-acid]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

Crystals yellow

1H NMR (400 MHz, CDCl3) δ to-0.02 and 0.06 (m, 2H), 0,34-0,43 (m, 2H), 0,80-0,94 (m, 1H), 1,24 (t, J=7.5 Hz, 3H), of 1.33 (t, J=7,0 Hz, 3H), 1,20-to 1.38 (m, 2H), 1,54 by 1.68 (m, 1H), 1,74-of 1.84 (m, 2H), 2,78 (kV, J=7.5 Hz, 2H), 2,90 (d, J=6.6 Hz, 2H), of 3.07 (d, J=7,0 Hz, 2H), 3.33 and (dt, J=1,6, 12.0 Hz, 2H), 3,66 (kV, J=7,0 Hz, 2H), 3.75 to (c, 6H), 3,92-was 4.02 (m, 2H), 4,59 (c, 2H), 6,61 (userd, J=6,8 Hz, 1H), of 6.71 (c, 2H), 7,03 (DD, J=7,0, 8,8 Hz, 1H), 7,46 (userd, J=8,8 Hz, 1H).

Example 4

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-3-furylmethyln

Butter yellow

1H NMR (400 MHz, CDCl3) δ to-0.02 to 0.04 (m, 2H), 0,32 at 0.42 (m, 2H), 0,80-of 0.82 (m, 1H), 1,21 (t, J=7,6 Hz, 3H), 1,58-of 1.66 (m, 1H), 1,84-of 1.94 (m, 1H), 2,20 of-2.32 (m, 1H), 2,74 (kV, J=7,6 Hz, 2H), 2,90 (d, J=6,4 Hz, 2H), 3,40-3,50 m, 1H), 3,18-3,26 (m, 1H), 3,47 (c, 3H), to 3.58-3,70 (m, 2H), 3,71 (c, 6H), 3.72 points-is 3.82 (m, 2H), 4,51 (c, 2H), return of 6.58 (DD, J=0,8, 6,8 Hz, 1H), 6,66 (c, 2H), 7,00 (DDD, J=0,2, 6,8, 8,8 Hz, 1H), 7,42 (DD, J=0,6, 8,8 Hz, 1H).

Example 5

(4-3-[(cyclopropylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-acid)methanol

Amorphous solid light yellow

1H NMR (400 MHz, CDCl3) δ -0,03-0,05 (m, 2H), 0,32-0,40 (m, 2H), 0,80-0,90 (m, 1H), 1,22 (t, J=75 Hz, 3H), 1,22-of 1.35 (m, 2H), 1,53-of 1.66 (m, 1H), 1,72-of 1.81 (m, 2H), 1,96 (t, J=5.6 Hz, 1H), 2,78 (kV, J=7.5 Hz, 2H), 2,86 of 2.92 (m, 2H), 3,02-to 3.09 (m, 2H), 3,28-to 3.38 (m, 2H), 3,74 (C, 6N), 3,90-4,00 (m, 2H), 4,76 (d, J=5.6 Hz, 2H), is 6.61 (DD, J=1,3, 6,8 Hz, 1H), 6,72 (s, 2H), 7,02 (DD, J=6,8, 8,8 Hz, 1H), 7,46 (DD, J=1,3, 8,8 Hz, 1H).

Example 6

(4-3-[(cyclobutylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-acid)methanol

Amorphous solid light yellow

1H NMR (400 MHz, CDCl3) δ 1,19-of 1.32 (m, 2H), 1,21 (t, J=7.5 Hz, 3H), 1,51-of 1.64 (m, 3H), 1.70 to 1,95 (m, 6H), for 2.01 (t, J=5.6 Hz, 1H), 2.26 and-2,39 (m, 1H), 2,73 (kV, J=7.5 Hz, 2H), 2,90-of 2.97 (m, 2H), 3,02-is 3.08 (m, 2H), 3,26-3,37 (m, 2H), of 3.73 (c, 6H), 3,89-to 3.99 (m, 2H), 4,74 (d, J=5.6 Hz, 2H), 6,60 (DD, J=1,3, 6,8 Hz, 1H), of 6.71 (c, 2H), 7,02 (DD, J=6,8, 8,8 Hz, 1H), 7,41 (DD, J=1,3, 8,8 Hz, 1H).

Example 7

2-(4-3-[(cyclopropylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-acid)-1-ethanol

Oil light green

1H NMR (400 MHz, CDCl3) δ -0,04-0,02 (m, 2H), 0,32 is 0.38 (m, 2H), 0,78-0,88 (m, 1H), 1,21 (t, J=7,6 Hz, 3H), 1,22-of 1.32 (m, 2H), 1,52-of 1.65 (m, 2H), 1,72 and 1.80 (m, 2H), 2,75 (kV, J=7,6 Hz, 2H), 2,87 (d, J=6,8 Hz, 2H), 2,92 (t, J=6,4 Hz, 2H), 3.04 from (d, J=7.2 Hz, 2H), 3,26-to 3.34 (m, 2H), 3,70 (c, 6H), 3,90-3,98 (m, 4H), 6,55 (c, 2H), return of 6.58 (DD, J=1,6, 6,8 Hz, 1H), 7,00 (DD, J=6,8, 8,8 Hz, 1H), 7,43 (DD, J=1,6, 8,8 Hz, 1H).

Example 8

(4-3-[(cyclopropylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-dimethoxyphenyl the l)-1-propanol

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,03 of 0.01 (m, 2H), 0,33-0,37 (m, 2H), 0,81-0,85 (m, 1H), between 1.19 to 1.31 (m, 5H), 1,50-of 1.57 (m, 1H), 1,72-to 1.77 (m, 2H), 1,95-2,04 (m, 2H), 2,73 is 2.80 (m, 4H), 2,87 (d, J=6,8 Hz, 2H), 3.04 from (d, J=6,8 Hz, 2H), 3,30 (dt, J=2,0, 12.0 Hz, 2H), 3,70 (c, 6H), 3,76 (t, J=6.4 Hz, 2H), 3,91-3,95 (m, 2H), 6,54 (c, 2H), 6,59 (DD, J=1,2, 6,8 Hz, 1H), 7,00 (DD, J=6,8, 8,8 Hz, 1H), 7,43 (DD, J=1,6, 8,8 Hz, 1H).

Example 9

N-cyclopropylmethyl-N-7-[2,4-dimethoxy-6-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

The crystals are light yellow

1H NMR (400 MHz, CDCl3) δ -0,04-0,02 (m, 2H), between 0.30 to 0.36 (m, 2H), 0,78-0,88 (m, 1H), 1,20 (t, J=7,6 Hz, 3H), 1,20-of 1.32 (m, 2H), 1,52-of 1.64 (m, 1H), 1,72 and 1.80 (m, 2H), 2.70 height is 2.80 (m, 2H), 2,87 (d, J=6,8 Hz, 2H), 3.04 from (d, J=6,8 Hz, 2H), 3,19 (c, 3H), 3,28-to 3.34 (m, 2H), 3,68 (c, 3H), 3,88 (c, 3H), 3,90-3,98 (m, 2H), 3,98 (d, J=12,8 Hz, 1H), 4,21 (d, J=12,8 Hz, 1H), 6,51 (d, J=2.4 Hz, 1H), is 6.54 (DD, J=1,6, 6,8 Hz, 1H), 6,76 (d, J=2,4 Hz, 1H), 6,99 (DD, J=6,8, 8,8 Hz, 1H), 7,44 (DD, J=1,2, 8,8 Hz, 1H).

Example 10

tert-Butyl N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-

aripirazole[1,5-a]pyridine-3-ylcarbamate

To a solution of tert-butyl N-(7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-yl)carbamate (100 mg)dissolved in 1,2-dimethoxyethane (6 ml) and water (3 ml), added 2,6-dimethoxy-4-(methoxymethyl)phenylboric acid (100 mg), tetrakis(triphenylphosphine)palladium(0) (51 mg) and octahedral hydroxide barium (139 mg) and the reaction mixture is heated and stirred for 3 hours at 80° With a stream of nitrogen. To the obtained reaction mixture are added water and extracted with ethyl acetate. The organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, then the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (87 mg) was obtained as amorphous solid of light yellow color of the fraction of n-hexane:ethyl acetate (2:1).

1H NMR (400 MHz, CDCl3) δ to 1.21 (t, J=7,6 Hz, 3H),and 1.54 (users, 9H), 2,72 (kV, J=7,6 Hz, 2H), 3,47 (c, 3H), 3,69 (c, 6H), 4,51 (c, 2H), of 5.82-5,90 (m, 1H), 6,58-of 6.65 (m, 1H), 6,65 (c, 2H), 7,08-7,14 (m, 1H), 7,32-7,38 (m, 1H).

Example 11

N-cyclobutylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

To a solution of tert-butyl N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-ylcarbamate (43 mg) in N,N-dimethylformamide (1 ml) is added sodium hydride (60% in oil; 6 mg) and (methyl bromide)CYCLOBUTANE (0,013 ml) and the mixture is stirred for 1 hour at room temperature. To the obtained reaction mixture, water is added, then the mixture is extracted with ethyl acetate and washed with brine. The resulting organic extract is dried over anhydrous magnesium sulfate, filtered and the solvent viparis the Ute under reduced pressure, give crude product, tert-butyl N-cyclobutylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-ylcarbamate.

The resulting crude product, tert-butyl N-cyclobutylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-ylcarbamate, dissolved in ethyl acetate (1 ml) without further purification, then add 4n. hydrochloric acid (an ethyl acetate solution; 2 ml) and the resulting mixture is stirred for 1 hour at 40°C. After neutralization of the reaction mixture is treated with 5N. aqueous sodium hydroxide under ice cooling, extracted with ethyl acetate and the organic extract washed with brine. Then the reaction mixture was dried over anhydrous magnesium sulfate and filtered, and the solvent is evaporated under reduced pressure to give crude product, N-cyclobutylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-ylamine.

To a solution of the obtained residue in tetrahydrofuran (1 ml) without purification, add tetrahydropyran-4-carbaldehyde (33 mg) and triacetoxyborohydride sodium (62 mg) and the mixture is stirred for 1 hour at room temperature. To the obtained reaction mixture are added water and then a saturated aqueous solution of sodium bicarbonate, the mixture is extracted with ethyl acetate and the organic extract was washed with saline is Astrom. The mixture is then dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (24 mg) are obtained in the form of a yellow oil from a fraction of n-hexane:ethyl acetate (5:1).

1H NMR (400 MHz, CDCl3) δ to 1.21 (t, J=7,6 Hz, 3H), 1,22-of 1.30 (m, 2H), 1,55-of 1.62 (m, 3H), 1,71 and 1.80 (m, 4H), 1,81-of 1.93 (m, 2H), 2,28-of 2.36 (m, 1H), 2,72 (kV, J=7,6 Hz, 2H), 2,93 (d, J=6,8 Hz, 2H), 3.04 from (d, J=7.2 Hz, 2H), 3.27 to the 3.35 (m, 2H), 3,48 (c, 3H), 3.72 points (c, 6H), 3,91-of 3.96 (m, 2H), to 4.52 (c, 2H), 6,59 (userd, J=6,8 Hz, 1H), 6,67 (c, 2H), 7,01 (DD, J=6,8, 8,8 Hz, 1H), 7,40 (userd, J=8,8 Hz, 1H).

Similar to the method of example 11 synthesize compounds of examples 12-14.

Example 12

N-butyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ 0,86 (t, J=6.8 Hz, 3H), 1,22 (t, J=7,6 Hz, 3H), 1,24-of 1.40 (m, 6H), 1,50-1,60 (m, 1H), 1.70 to of 1.78 (m, 2H), 2,73 (kV, J=7,6 Hz, 2H), 2,96 (d, J=7.2 Hz, 2H), 3,01 (t, J=7.2 Hz, 2H), 3,26-to 3.35 (m, 2H), 3,49 (c, 3H), of 3.73 (c, 6H), 3,90-of 3.97 (m, 2H), 4.53-in (c, 2H), 6,60 (DD, J=1,2, 6,8 Hz, 1H), 6,68 (c, 2H), 7,01 (DD, J=6,8, 8,8 Hz, 1H), 7,42 (DD, J=1,2, 8,8 Hz, 1H).

Example 13

N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-propyl-N-tetrahydro-2H-4-paradimethylamino

Amorphous solid light is yellow

1H NMR (400 MHz, CDCl3) δ of 0.87 (t, J=7,6 Hz, 3H), of 1.20 (t, J=7.2 Hz, 3H), 1,23-of 1.32 (m, 2H), 1,36-of 1.45 (m, 2H), 1,52-of 1.62 (m, 1H), 1,72-of 1.78 (m, 2H), 2,73 (kV, J=7.2 Hz, 2H), 2,96-3,00 (m, 4H), 3.27 to the 3.35 (m, 2H), 3,49 (c, 3H), to 3.73 (c, 6H), 3,90-of 3.97 (m, 2H), 4.53-in (c, 2H), 6,60 (DD, J=1,6, 6,8 Hz, 1H), 6,68 (c, 2H), 7,01 (DD, J=6,8, 8,8 Hz, 1H), 7,42 (DD, J=1,6, 8,8 Hz, 1H).

Example 14

N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-isobutyl-N-tetrahydro-2H-4-paradimethylamino

Amorphous solid light yellow

1H NMR (400 MHz, CDCl3) δ of 0.91 (d, J=6.8 Hz, 6H), of 1.20 (t, J=7,6 Hz, 3H), 1,22 to 1.31 (m, 2H), 1,50-of 1.62 (m, 2H), 1,72 and 1.80 (m, 2H), 2,74 (kV, J=7,6 Hz, 2H), 2,82 (d, J=7.2 Hz, 2H), 2.91 in (d, J=6,8 Hz, 2H), 3,26-to 3.34 (m, 2H), 3,47 (c, 3H), 3.72 points (c, 6H), 3,90-of 3.96 (m, 2H), to 4.52 (c, 2H), return of 6.58 (DD, J=of 1.6, 6.8 Hz, 1H), 6,66 (c, 2H), 7,00 (DD, J=6,8, 8,8 Hz, 1H), 7,43 (DD, J=1,6, 8,8 Hz, 1H).

Example 15

7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-amine

A suspension of 7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethyl-3-nitropyrazole[1,5-a]pyridine (0.7 g) in a mixed solvent consisting of ethanol (35 ml), water (18 ml) and acetic acid (3.5 ml), add powdered zinc (0.7 g) at room temperature and the reaction mixture is heated and stirred for 30 min at 60°C. the Reaction mixture was filtered through celite to remove insoluble residue, is added to the filtrate water and extracted ethylacetate is. The resulting organic extract was washed with brine, saturated aqueous sodium bicarbonate and then brine, dried over anhydrous magnesium sulfate and filtered, after which the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel and specified in the header connection (0,48 g) are obtained in the form of a yellow oil from a fraction of n-hexane:ethyl acetate (4:1).

1H NMR (400 MHz, CDCl3) δ of 1.23 (t, J=7,6 Hz, 3H), 2,60 are 2.98 (m, 2H), 3,47 (c, 3H), 3,70 (c, 6H), 4,51 (c, 2H), 6,40-6,60 (m, 1H), 6,65 (c, 2H), 6.90 to-was 7.08 (m, 1H), 7.24 to 7,38 (m, 1H).

Mass spectrum (ESI) m/z 342 MN+

Example 16

tert-Butyl N-1-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-

aripirazole[1,5-a]pyridine-3-ylcarbamate

To a solution of 7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-amine (0,48 g) in dichloromethane (4.8 ml) is added triethylamine (0.3 ml) and di-tert-BUTYLCARBAMATE (0,39 ml) at room temperature and the reaction mixture was stirred over night at room temperature. To the obtained reaction mixture are added water and extracted with ethyl acetate. The organic extract was washed with brine, dried over anhydrous magnesium sulfate, filtered and the solvent is evaporated under reduced pressure. The residue is purified using chromatog epicheskoi processing on a column of silica gel and indicated in the title compound (0.54 g) are obtained as white crystals from a fraction of n-hexane:ethyl acetate (1:1).

1H NMR (400 MHz, CDCl3) δ to 1.21 (t, J=7,6 Hz, 3H), and 1.54 (users, 9H), 2,72 (kV, J=7,6 Hz, 2H), 3,47 (c, 3H), 3,69 (c, 6H), 4,51 (c, 2H), 5,86 (users, 1H), is 6.61 (d, J=6,8 Hz, 1H), 6,65 (c, 2H), 7,10 (DD, J=6,8, 8,8 Hz, 1H), 7,35 (d, J=8,8 Hz, 1H).

Example 17

N-1-[4-(1-[1-(tert-butyl)-1,1-dimethylsilane]oxyethyl)-2,6-acid]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-cyclopropylmethyl-N-tetrahydro-2H-4-paradimethylamino

To a solution of N-(7-bromo-2-methoxypyrazine[1,5-a]pyridine-3-yl)-N-cyclopropanemethylamine (70 mg)dissolved in 1,2-dimethoxyethane (4 ml) and water (2 ml), add 4-[1-[1-(tert-butyl)-1,1-dimethylsilane]oxyethyl]-2,6-dimethoxyaniline acid (92 mg), tetrakis(triphenylphosphine)palladium(0) (31 mg) and octahedral of barium hydroxide (85 mg) and the reaction mixture heated and stirred for 1 hour at 80°in a stream of nitrogen. To the reaction mixture are added ethyl acetate and after filtered off the insoluble residue, the mixture is extracted with ethyl acetate and the organic extract washed with brine. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (112 mg) are obtained in the form of a yellow oil from a fraction of n-hexane:ethyl acetate (4:1).

1H NMR 400 MHz, CDCl3) δ -0,07-0,03 (m, 2H), 0,07 (c, 3H), 0,12 (c, 3H), 0,32 is 0.38 (m, 2H), 0.79, which is to 0.88 (m, 1H), 0,96 (c, 9H), to 1.21 and 1.33 (m, 2H), 1.26 in (t, J=7.2 Hz, 3H), 1,49 (d, J=6.4 Hz, 3H), 1,51-to 1.63 (m, 1H), 1,70-1,80 m, 2H), 2,77 (kV, J=7.2 Hz, 2H), 2,84-only 2.91 (m, 2H), 3.00 and-of 3.07 (m, 2H), of 3.25 to 3.35 (m, 2H), 3,70 (c, 6H), 3,89-of 3.97 (m, 2H), 4.92 in (kV, J=6,4 Hz, 1H), is 6.61 (DD, J=1,3, 6,8 Hz, 1H), 6,67 (c, 1H), 6,68 (c, 1H), 7,00 (DD, J=6,8, 8,8 Hz, 1H), 7,43 (DD, J=1,3, 8,8 Hz, 1H).

Example 18

1-(4-3-[(cyclopropylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-acid)-1-ethanol

To a solution of N-[7-[4-[1-[1-(tert-butyl)-1,1-dimethylsilane]oxyethyl]-2,6-acid]-2-ethylpyrazine[1,5-a]pyridine-3-yl]-N-cyclopropylmethyl-N-tetrahydro-2H-4-paradimethylamino (112 mg) in tetrahydrofuran (1 ml) add tetrabutylammonium (1M solution in tetrahydrofuran; 0,27 ml) at room temperature and the reaction mixture is stirred for 3 hours at the same temperature. Once added to the obtained reaction mixture, a saturated aqueous solution of ameriglide this mixture is extracted with ethyl acetate, the organic extract washed with brine, dried over anhydrous magnesium sulfate and filtered, and the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (66 mg) was obtained as amorphous solid light yellow is the light of the fraction of n-hexane:ethyl acetate (1:2).

1H NMR (400 MHz, CDCl3) δ -0,04-0,12 (m, 2H), 0,32 is 0.38 (m, 2H), 0,78-0,88 (m, 1H), 1,21 (t, J=7.5 Hz, 3H), of 1.21 and 1.33 (m, 2H), 1,50-of 1.65 (m, 4H), 1,70-1,80 (m, 2H), was 2.76 (q, J=7.5 Hz, 2H), 2,84-only 2.91 (m, 2H), 3,01-is 3.08 (m, 2H), 3,26-3,37 (m, 2H), of 3.73 (c, 6H), 3,88-3,98 (m, 2H), 4,91-4,99 (m, 1H), 6,59 (DD, J=1,3, 6,8 Hz, 1H), 6,70 (c, 1H), 6,74 (c, 1H), 7,01 (DD, J=6,8, 8,8 Hz, 1H), 7,45 (DD, J=1,3, 8,8 Hz, 1H).

Example 19

4-3-[(cyclopropylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-dimethoxybenzaldehyde

To a solution of (4-3-[(cyclopropylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-acid)methanol (50 mg) in acetone (2 ml) was added activated manganese oxide(IV) (250 mg) at room temperature and the reaction mixture is stirred for 12 hours. Manganese oxide is filtered off from the reaction mixture and the filtrate is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (41 mg) are obtained in the form of hard yellow substance from the fraction ethyl acetate:n-hexane (1:2).

1H NMR (400 MHz, CDCl3) δ -0,02 of 0.01 (m, 2H), 0,30-0,40 (m, 2H), 0,80-0,88 (m, 1H), 1.18 to 1.32 to (m, 5H), 1,54-of 1.62 (m, 1H), 1,72 and 1.80 (m, 2H), 2,75 (kV, J=7,6 Hz, 2H), 2,88 (d, J=6,8 Hz, 2H), 3,05 (d, J=6,8 Hz, 2H), 3.25 to 3,34 (m, 2H), 3,79 (c, 6H), 3,93-3,98 (m, 2H), is 6.61 (DD, J=1,2, 6,8 Hz, 1H), 7,03 (DD, J=6,8, 8,8 Hz, 1H), 7,21 (c, 2H), 7,49 (DD, J=1,2, 8,8 Hz, 1H), 10,02 (c, 1H).

Example 20

N-BU the Il-N-7-[4-(ethoxymethyl)-2,6-acid]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

Interact N-(7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-butyl-N-tetrahydro-2H-4-paradimethylamino (150 mg) and 4-(hydroxymethyl)-2,6-dimethoxyphenylacetic acid (250 mg) by the method of example 1, obtaining (4-3-[butyl(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-acid)methanol (189 mg in the form of a yellow oil.

To the solution obtained (4-3-[butyl(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-acid)methanol (189 mg) in N,N-dimethylformamide (15 ml) is added sodium hydride (60% oil; 24 mg) at room temperature and the reaction mixture is stirred for 30 minutes Then to the reaction mixture add Iodate (0,047 ml) and the mixture is stirred for 1 hour at 60°C. After completion of the reaction to the reaction mixture with ice added with ice cooling, the mixture is extracted with ethyl acetate and the organic extract washed with brine and dried over anhydrous magnesium sulfate, then the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel (10 g) and indicated in the title compound (111 mg) was obtained as yellow crystals from a fraction ethyl acetate:n-hexane (1:2).

1H NMR (400 MHz, CDCl3) δ 0,86 (t, J=7.0 Hz, 3H), of 1.20 (t, J=7.5 Hz, 3H), of 1.31 (t, J=7.0 G is, 3H), 1,17-of 1.42 (m, 6H), 1,50-of 1.64 (m, 1H), 1.70 to to 1.79 (m, 2H), 2,73 (kV, J=7.5 Hz, 2H), 2,96 (d, J=7,0 Hz, 2H), 3,01 (t, J=7,0 Hz, 2H), 3.33 and (dt, J=1,6, 12.0 Hz, 2H), 3,64 (kV, J=7,0 Hz, 2H), 3.72 points (c, 6H), 3,90-4,00 (m, 2H), 4,57 (c, 2H), 6,59 (DD, J=1,1, 6,8 Hz, 1H), 6,69 (c, 2H), 7,01 (DD, J=6,9, and 8.9 Hz, 1H), 7,42 (DD, J=1,3, 8,8 Hz, 1H).

Similar to the method of example 20 synthesize compounds of examples 21-27.

Example 21

N-cyclopropylmethyl-N-(7-2,6-dimethoxy-4-[(2-piperidinoethyl)methyl]phenyl-2-ethylpyrazine{1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ be-0.05 to 0.02 (m, 2H), 0,32 is 0.38 (m, 2H), 0,80-0,88 (m, 1H), 1.18 to 1.32 to (m, 5H), of 1.40 to 1.48 (m, 2H), 1,52 by 1.68 (m, 5H), 1.70 to of 1.78 (m, 2H), 2.40 a is 2.55 (m, 4H), of 2.64 (t, J=6.0 Hz, 2H), was 2.76 (q, J=7.2 Hz, 2H), 2,87 (d, J=6,8 Hz, 2H), 3.04 from (d, J=6,8 Hz, 2H), and 3.31 (t, J=11.2 Hz, 2H), 3,68 (t, J=6.4 Hz, 2H), 3,71 (c, 6H), 3,90-of 3.97 (m, 2H), 4,59 (c, 2H), return of 6.58 (DD, J=0,8, 6,8 Hz, 1H), 6,68 (c, 2H), 7,00 (DD, J=6,8, and 8.4 Hz, 1H), 7,44 (userd, J=8,8 Hz, 1H).

Example 22

N-cyclopropylmethyl-N-(7-2,6-dimethoxy-4-[(2-methoxyethoxy)methyl]phenyl-2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,02 of 0.01 (m, 2H), between 0.30 to 0.38 (m, 2H), 0,80-0,90 (m, 1H), 1,19-of 1.30 (m, 5H), 1,50-of 1.62 (m, 1H), 1,72 and 1.80 (m, 2H), 2,75 (kV, J=7,6 Hz, 2H), 2,87 (d, J=6,8 Hz, 2H), 3.04 from (d, J=6,8 Hz, 2H), of 3.25 to 3.35 (m, 2H), 3.43 points (c, 3H), 3,62-the 3.65 (m, 2H), 3,71-to 3.73 (m, 8H), 3,90-3,98 (m, 2H), with 4.64 (c, 2H), to 6.57 (DD, J=1,6, 6,8 Hz, 1H), 6,70 (c, 2H), 7,00 (DD, J=6,8, and 9.2 Hz, 1H), 7,44 (DD, J=1,2, 8,8 Hz, 1H).

Example 3

N-7-[4-(ethoxymethyl)-2,6-acid]-2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-propyl-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ of 0.87 (t, J=7.4 Hz, 3H), of 1.20 (t, J=7.5 Hz, 3H), of 1.31 (t, J=7.0 Hz, 3H), of 1.18 and 1.33 (m, 2H), of 1.34 to 1.47 (m, 2H), 1,50-of 1.65 (m, 1H), 1,70-1,80 (m, 2H), 2,74 (kV, J=7.5 Hz, 2H), 2,96 (d, J=7,1 Hz, 2H), 2,93-to 3.02 (m, 2H), and 3.31 (dt, J=1,8, 12.0 Hz, 2H), 3,64 (kV, J=7,0 Hz, 2H), 3.72 points (c, 6H), 3,90-to 4.98 (m, 2H), 4,57 (c, 2H), 6,59 (DD, J=1,4, 7,0 Hz, 1H), 6,69 (c, 2H), 7,01 (DD, J=7,0, 8,8 Hz, 1H), 7,42 (DD, J=1,3, and 8.8 Hz, 1H).

Example 24

N-cyclopropylmethyl-N-(7-[2,6-dimethoxy-4-(2-methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

Oil light green

1H NMR (400 MHz, CDCl3) δ -0,04-0,02 (m, 2H), 0,32 is 0.38 (m, 2H), 0,78-0,88 (m, 1H), 1,21 (t, J=7,6 Hz, 3H), 1,22-of 1.32 (m, 2H), 1,52-of 1.65 (m, 1H), 1,70-1,80 (m, 2H), 2,75 (kV, J=7,6 Hz, 2H), 2,87 (d, J=6,8 Hz, 2H), equal to 2.94 (t, J=6,8 Hz, 2H), 3,03 (d, J=6,8 Hz, 2H), 3,26-to 3.34 (m, 2H), 3,41 (s, 3H), 3,68 (C, 6N), 3,66-of 3.78 (m, 2H), 3,90-of 3.96 (m, 2H), 6,55 (s, 2H), return of 6.58 (DD, J=1,2, 6,8 Hz, 1H), 6,99 (DD, J=6,8, 8,8 Hz, 1H), 7,42 (DD, J=1,2, 8,8 Hz, 1H).

Example 25

N-cyclopropylmethyl-N-(7-2,6-dimethoxy-4-[(2-morpholinoethoxy)methyl]phenyl-2-ethylpyrazine{1,5-a]pyridine-3-yl)-

N-tetrahydro-2H-4-paradimethylamino

Crystals yellow

1H NMR (400 MHz, CDCl3) δ -0,02 of 0.01 (m, 2H), 0,33-of 0.36 (m, 2H), 0,80-0,84 (m, 1H), 1,19 of 1.28 (m, 5H), 1,50-1,60 (m, 1H), 1,70-1,80 (m, 2H), 2,52-of 2.58 (m, 4H), to 2.67 (t, J=5.6 Hz, 2H), 2,75 (kV, J=7,6 Hz, 2H), 2,87 (d, J=6,8 Hz, 2H), 3.04 from (d, J=7.2 Hz, 2H), 3,30 (dt, J=2,0, 12.0 Hz, 2H), 3,68 (t, J=5.6 Hz, 2H), 3,71 (c, 6H), of 3.75 (t, J=4.8 Hz, 4H), 3,91-3,95 (m, 2H), 4,60 (c, 2H), return of 6.58 (DD, J=1,6, 6,8 Hz, 1H), 6,67 (c, 2H), 7,00 (DD, J=6,8, 8,8 Hz, 1H), 7,44 (DD, J=1,6, 6,8 Hz, 1H).

Example 26

N-cyclopropylmethyl-N-(7-2,6-dimethoxy-4-[3-(2-

morpholinoethoxy)propyl]phenyl-2-ethylpyrazine{1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,03 of 0.01 (m, 2H), 0,33-0,37 (m, 2H), 0,78-0,88 (m, 1H), 1,17-of 1.35 (m, 5H), 1,50-1,60 (m, 1H), 1.70 to of 1.78 (m, 2H), 1,95-2,02 (m, 2H), 2,45-of 2.58 (m, 6H), 2.63 in (d, J=6.0 Hz, 2H), 2,72-and 2.79 (m, 4H), 2,87 (d, J=6,8 Hz, 2H), 3.04 from (d, J=6,8 Hz, 2H), 3,30 (dt, J=2,0, 12.0 Hz, 2H), 3,54 (t, J=6.4 Hz, 2H), 3,62 (t, J=6.0 Hz, 2H), 3,69 of 3.75 (m, 8H), 3,92-3,95 (m, 2H), 6,52 (c, 2H), 6,59 (DD, J=1,2, 6.4 Hz, 1H), 7,00 (d, J=6,8, 8,8 Hz, 1H), 7,43 (DD, J=1,6, 7,8 Hz, 1H).

Example 27

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(3-methoxypropyl)phenyl]-2-ethylpyrazine{1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,03 of 0.01 (m, 2H), 0,33-0,37 (m, 2H), 0,81-0,85 (m, 1H), between 1.19 to 1.31 (m, 5H), 1,50-1,60 (m, 1H), 1,72 and 1.80 (m, 2H), 1,94 is 2.01 (m, 2H), 2,73-and 2.79 (m, 4H), 2,87 (d, J=6,4 Hz, 2H), 3.04 from (d, J=6,8 Hz, 2H), 3,30 (dt, J=2.0 a, and 11.6 Hz, 2H), 3.33 and (s, 3H), of 3.48 (t, J=6.4 Hz, 2H), 3,70 (c, 6H), 3,92-3,95 (m, 2H), 6,53 (c, 2H), 6,59 (DD, J=1,2, 6,8 Hz, 1H), 7,00 (DD, J=6,4, 8,8 Hz, 1H), 7,43 (DD, J=1,2, and 8.4 Hz, 1H).

Example 28

N-7-[4-(charmet the l)-2,6-acid]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-cyclopropylmethyl-N-tetrahydro-2H-4-paradimethylamino

To a solution of (4-3-[(cyclopropylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-acid)methanol (122 mg) in dichloromethane (5 ml), add triethylamine (0,076 ml), methanesulfonamide (0,023 ml) and 4-(dimethylamino)pyridine (0.5 mg) at room temperature and the reaction mixture is stirred for 2 hours. After completion of the reaction, to the reaction mixture, water is added, extracted with ethyl acetate, the organic extract washed with brine and dried over anhydrous magnesium sulfate, then the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel (15 g) and indicated in the title compound (45 mg) obtained as an amorphous solid yellow color of the faction ethyl acetate:n-hexane (1:2).

1H NMR (400 MHz, CDCl3) δ to-0.02 to 0.04 (m, 2H), 0,33-0,41 (m, 2H), of 0.79 to 0.92 (m, 1H), 1,23 (t, J=7,6 Hz, 3H), 1,20-of 1.36 (m, 2H), 1,53-to 1.67 (m, 1H), 1,72-to 1.82 (m, 2H), 2,77 (kV, J=7,6 Hz, 2H), 2,89 (d, J=6,8 Hz, 2H), 3,06 (d, J=7,0 Hz, 2H), 3,32 (dt, J=2,0, 12.0 Hz, 2H), 3.75 to (c, 6H), 3,90-4,00 (m, 2H), 4,66 (c, 2H), 6,60 (DD, J=1,4, 6,8 Hz, 1H), 6,74 (c, 2H), 7,02 (DD, J=6,8, 8,8 Hz, 1H), 7,47 (DD, J=1,5, 8,8 Hz, 1H).

Example 29

N-cyclopropylmethyl-N-2-ethyl-7-[4-(isopropoxyphenyl)-2,6-acid]pyrazolo[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

To a solution of 2-propane the La (8 μl) in N,N-dimethylformamide (1.5 ml) is added sodium hydride (60% in oil; 4.3 mg) at room temperature and the reaction mixture is stirred for 15 minutes To the resulting reaction mixture is added a solution of N-7-[4-(chloromethyl)-2,6-acid]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-cyclopropylmethyl-N-tetrahydro-2H-4-paradimethylamino (45 mg) in N,N-dimethylformamide (3.5 ml) and sodium iodide (0.5 mg), then the reaction mixture was stirred for 20 min at 40°and further stirred for 20 min at 80°C. To the resulting reaction mixture is added ice, extracted with ethyl acetate and the organic extract washed with brine and dried over anhydrous magnesium sulfate, then the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel (10 g) and indicated in the title compound (9 mg) are obtained in the form of a yellow oil from a fraction ethyl acetate:n-hexane (1:2).

1H NMR (400 MHz, CDCl3) δ -0,03-0,04 (m, 2H), 0,32-0,41 (m, 2H), of 0.79 to 0.92 (m, 1H), 1,22 (t, J=7,6 Hz, 3H), of 1.29 (d, J=6.0 Hz, 6H), 1,20-of 1.36 (m, 2H), 1,53-to 1.67 (m, 1H), 1,72-to 1.82 (m, 2H), 2,77 (kV, J=7.5 Hz, 2H), 2,89 (d, J=6,6 Hz, 2H), 3,06 (d, J=7,0 Hz, 2H), 3,32 (dt, J=2,0, 12.0 Hz, 2H), of 3.73 (c, 6H), 3,70-a-3.84 (m, 1H), 3,90-4,00 (m, 2H), 4,59 (c, 2H), 6,59 (DD, J=1,3, 6,8 Hz, 1H), 6,70 (c, 2H), 7,01 (DD, J=6,8, 8,8 Hz, 1H), was 7.45 (DD, J=1,5, 8,8 Hz, 1H).

Example 30

3-(4-3-[(cyclopropylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-acid)propyl methanesulfonate

To a solution of 3-(4-3-[(cyclopropylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-acid)-1-propanol (190 mg) in dichloromethane (20 ml), add triethylamine (0,062 ml), methanesulfonyl chloride (51 mg) and 4-(dimethylamino)pyridine (0.5 mg) at room temperature and the reaction mixture is stirred for 2 hours.

After completion of the reaction, to the reaction mixture, water is added, extracted with ethyl acetate and the organic extract washed with brine and dried over anhydrous magnesium sulfate, then the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel (15 g) and indicated in the title compound (179 mg) are obtained in the form of a yellow oil from a fraction ethyl acetate:n-hexane (1:2).

1H NMR (400 MHz, CDCl3) δ -0,03 of 0.01 (m, 2H), 0,33-0,37 (m, 2H), 0,81-0,85 (m, 1H), 1,19-of 1.35 (m, 5H), 1,50-of 1.57 (m, 1H), 1,72-to 1.77 (m, 2H), 1.85 to 2,00 (m, 2H), 2,70-2,90 (m, 6H), 3.04 from-3,10 (m, 5H), of 3.25 to 3.35 (m, 2H), 3,70 (c, 6H), to 4.33 (t, J=6.4 Hz, 2H), 3,91-to 3.99 (m, 2H), 6,53 (c, 2H), 6,59-6,62 (m, 1H), 6,95-7,05 (m, 1H), 7,43-of 7.48 (m, 1H).

Example 31

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(3-morpholinopropan)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

To a solution of 3-(4-3[(cyclopropylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-dimethoxyphenyl the l)propyl of methansulfonate (50 g) in dichloromethane (10 ml) is added morpholine (60 mg) at room temperature and the reaction mixture stirred for 12 h at the same temperature. After completion of the reaction, to the reaction mixture, water is added, extracted with ethyl acetate, the organic extract washed with brine and dried over anhydrous magnesium sulfate, then the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel (10 g) and indicated in the title compound (16 mg) are obtained in the form of a yellow oil from a fraction of ethyl acetate.

1H NMR (400 MHz, CDCl3) δ to-0.02 to 0.02 (m, 2H), of 0.35-0.40 (m, 2H), 0,80-0,90 (m, 1H), 1,20-of 1.35 (m, 5H), 1,55-1,60 (m, 1H), 1,73 and 1.80 (m, 2H), 1,90-to 1.98 (m, 2H), 2,45-of 1.52 (m, 6H), 2,70-of 2.81 (m, 4H), 2,89 (d, J=7,2Hz, 2H), 3,06 (d, J=7.2 Hz, 2H), 3,32 (ushort, J=9.6 Hz, 2H), 3,70-with 3.79 (m, 10H), 3,93-of 3.97 (m, 2H), 6,54 (c, 2H), is 6.61 (DD, J=0,8, 6,8 Hz, 1H), 7,06 (DD, J=6,8, 8,8 Hz, 1H), 7,45 (DD, J=1,2, 8,8 Hz, 1H).

Example 32

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(morpholinomethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

To a solution of 4-3-[(cyclopropylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-ethylpyrazine[1,5-a]pyridin-7-yl-3,5-dimethoxybenzaldehyde (15 mg) in acetic acid (0.5 ml) and tetrahydrofuran (0.5 ml) is added morpholine (3.2 mg) under stirring at room temperature, then add triacetoxyborohydride sodium (8 mg) and the reaction mixture is stirred for 2 hours. To the obtained reaction mixture, water is added and extragere the t with ethyl acetate. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure. The resulting residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (8.5 mg) are obtained in the form of a yellow oil from a fraction ethyl acetate:n-hexane (2:1).

1H NMR (400 MHz, CDCl3) δ -0,04 of 0.01 (m, 2H), 0,32 is 0.38 (m, 2H), 0,78-0,88 (m, 1H), 1.18 to 1.32 to (m, 5H), 1,50-of 1.62 (m, 1H), 1,72-of 1.78 (m, 2H), 2,48-of 2.58 (m, 4H), was 2.76 (q, J=8.0 Hz, 2H), 2,87 (d, J=6,8 Hz, 2H), 3.04 from (d, J=7,2 Hz, 2H), 3,26-to 3.34 (m, 2H), 3,54 (c, 2H), 3,71 (c, 6H), 3.75 to of 3.78 (m, 4H), 3,91-3,95 (m, 2H), 6,59 (userd, J=6,8 Hz, 1H), 6,69 (c, 2H), 7,00 (DD, J=6,8, 8,8 Hz, 1H), 7,44 (userd, J=8,8 Hz, 1H).

Similar to the method of example 32 synthesize compounds of examples 33 and 34.

Example 33

N3-cyclopropylmethyl-N3-tetrahydro-2H-4-pyranometer-7-4-[(dimethylamino)methyl]-2,6-acid-2-ethylpyrazine[1,5-a]pyridine-3-amine

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,03 of 0.01 (m, 2H), 0,32 is 0.37 (m, 2H), 0,78-of 0.90 (m, 1H), 1.18 to 1.32 to (m, 5H), 1,50-of 1.62 (m, 1H), 1.70 to of 1.78 (m, 2H), 2,34 (users, 6H), was 2.76 (q, J=7,6 Hz, 2H), 2,87 (d, J=6,8 Hz, 2H),3.04 from (d, J=6,8 Hz, 2H), of 3.25 to 3.35 (m, 2H), 3.45 points-to 3.52 (m, 2H), 3,71 (c, 6H), 3,90-3,95 (m, 2H), 6,60 (DD, J=1,2, 6,8 Hz, 1H), 6,67 (c, 2H), 7,00 (DD, J=7,2, an 8.4 Hz, 1H), 7,44 (DD, J=1,2, 8,8 Hz, 1H).

Example 34

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(tetrahydro-1H-1-pyrrolidinyl)phenyl]-2-ethylpyrazine[1,5-a]pyridi the-3-yl-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,02-0,00 (m, 2H), 0,30-0,40 (m, 2H), 0,80-0,88 (m, 1H), 1,19-1,32 (m, 5H), 1,50-of 1.64 (m, 1H), 1,72-of 1.78 (m, 2H), 1,80-1,90 (m, 4H), 2,56 of 2.68 (m, 4H), was 2.76 (q, J=7,6 Hz, 2H), 2,87 (d, J=6,8 Hz, 2H), totaling 3.04 (d, J=6,8 Hz, 2H), 3,26-to 3.34 (m, 2H), 3,67 (users,2H), 3,71 (c, 6H), 3,92-3,95 (m, 2H), 6,59 (DD, J=0,8, 6,8 Hz, 1H), 6,69 (c, 2H), 6,98-7,02 (m, 1H), 7,44 (userd, J=8,8 Hz, 1H).

Example 35

tert-Butyl N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methylpyrazolo[1,5-a]pyridine-3-ylcarbamate

To a solution of tert-butyl N-(7-bromo-2-methylpyrazolo[1,5-a]pyridine-3-yl)carbamate (300 mg) in a mixture of 1,2-dimethoxyethane (10 ml) and water (5 ml) is added 2,6-dimethoxy-4-ethoxymethyleneamino acid (353 mg), tetrakis(triphenylphosphine)palladium(0) (159 mg) and octahedral hydroxide barium (435 mg) and the reaction mixture is heated and stirred for 6 hours at 80°in a stream of nitrogen. To the obtained reaction mixture, water is added, the mixture extracted with ethyl acetate, the organic extract washed with brine, dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (176 mg) are obtained in the form of butter a light brown colour of the fraction of n-hexane:ethyl acetate (1:1).

1H NMR (400 MHz, CDClsub> 3) δ 1,54 (users,9H), 3,32 (c, 3H), 3,47 (c, 3H), 3,69 (c, 6H), 4,51 (c, 2H), 5,86-of 5.92 (m, 1H), 6,56-of 6.61 (m, 1H), 6,65 (c, 2H), 7,11 (DD, J=6,8, 8,8 Hz, 1H), 7,34 (DD, J=1,2, 8,8 Hz, 1H).

Example 36

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methylpyrazolo[1,5-a]pyridine-3-ylamine

To a solution of tert-butyl N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methylpyrazolo[1,5-a]pyridine-3-ylcarbamate (175 mg) in N,N-dimethylformamide (4 ml) is added sodium hydride (60% in oil; 25 mg) and (methyl bromide)cyclopropane (0,047 ml) and the reaction mixture is stirred for 1 hour at 40°C. To the resulting reaction mixture is added water, extracted with ethyl acetate and the organic extract was washed with saline solution. The resulting organic extract is dried over anhydrous magnesium sulfate, filtered and the solvent is evaporated under reduced pressure to give crude product, tert-butyl N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methylpyrazolo[1,5-a]pyridine-3-ylcarbamate.

The resulting crude product, tert-butyl N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methylpyrazolo[1,5-a]pyridine-3-ylcarbamate, dissolved in ethyl acetate (5 ml) without purification, they add to it at room temperature for 4h. hydrochloric acid (an ethyl acetate solution; 10 ml) and the reaction mixture is stirred for 1 hour at 40°C. After neutralise the tion of the reaction mixture through 5h. an aqueous solution of sodium hydroxide under ice cooling, the mixture is extracted with ethyl acetate, the organic extract washed with brine, dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (100 mg) are obtained in the form of a yellow oil from a fraction of n-hexane:ethyl acetate (1:2).

1H NMR (400 MHz, CDCl3) δ to 0.15-0.20 (m, 2H), 0,48-of 0.54 (m, 2H), 1,02-1,10 (m, 1H), 2,35 (c, 3H), 2,88 (d, J=6,8 Hz, 2H), 3,47 (c, 3H), 3,70 (c, 6H), 4,51 (c, 2H), 6,63 (DD, J=1,2, 6,8 Hz, 1H), 6,65 (c, 2H), 6,99 (DD, J=6,8, 8,8 Hz, 1H), was 7.36-7,40 (m, 1H).

Example 37

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methylpyrazolo[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

To a solution of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methylpyrazolo[1,5-a]pyridine-3-ylamine (60 mg) in tetrahydrofuran (3 ml) is added tetrahydropyran-4-carbaldehyde (36 mg) and triacetoxyborohydride sodium (67 mg) and the reaction mixture is stirred for 1 hour at room temperature. To the obtained reaction mixture are added water and then saturated aqueous sodium bicarbonate solution, extracted with ethyl acetate, the organic extract washed with brine, dried over anhydrous sulfate mA the deposits and filtered and the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel and the crystals obtained from the fraction of n-hexane:ethyl acetate (1:1), filtered, washed with n-hexane and then dried, obtaining mentioned in the title compound (63 mg) as crystals of pale yellow color.

1H NMR (400 MHz, CDCl3) δ be-0.05 to 0.02 (m, 2H), 0,31-0,36 (m, 2H), 0,78-0,88 (m, 1H), 1,20-of 1.32 (m, 2H), 1,54-of 1.64 (m, 1H), 1,72-of 1.78 (m, 2H), 2,34 (c, 3H), 2,85 (d, J=7.2 Hz, 2H), 3,03 (d, J=7.2 Hz, 2H), 3,26-to 3.34 (m, 2H), 3,47 (c, 3H), 3,71 (c, 6H), 3,90-of 3.96 (m, 2H), 4,51 (c, 2H), 6,53 (DD, J=1,2, 6,8 Hz, 1H), 6,66 (c, 2H), 7,00 (DD, J=6,8, 8,8 Hz, 1H), 7,42 (DD, J=1,2, 8,8 Hz, 1H).

Example 38

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methylpyrazolo[1,5-a]pyridine-3-yl-N-tetrahydro-3-furylmethyl

To a solution of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methylpyrazolo[1,5-a]pyridine-3-ylamine (40 mg) in tetrahydrofuran (3 ml) was added tetrahydrofuran-3-carbaldehyde (50% aqueous solution; 0,064 ml), 3 M aqueous sulfuric acid (0,105 ml) and sodium borohydride (8 mg) under ice cooling and the reaction mixture is stirred for 1 hour. To the obtained reaction mixture are added water and then a saturated aqueous solution of sodium bicarbonate, the mixture is extracted with ethyl acetate and the organic extract washed with brine. The resulting organic extract is dried over anhydrous magnesium sulfate and filtration is comfort, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (30 mg) are obtained in the form of crystals of light-yellow color of the fraction of n-hexane:ethyl acetate (1:1).

1H NMR (400 MHz, CDCl3) δ -0,03-0,03 (m, 2H), 0,33-0,38 (m, 2H), 0,80-0,90 (m, 1H), 1,54 by 1.68 (m, 1H), 1.85 to 1,95 (m, 1H), 2,20-to 2.29 (m, 1H), 2,33 (c, 3H), 2,87-2,90 (m, 2H), 3,06 (DD, J=8,8, 12.0 Hz, 1H), up 3.22 (DD, J=6,4, 12.0 Hz, 1H), 3,47 (c, 3H), 3,59-3,70 (m, 2H), 3,71 (c, 6H), 3.72 points-3,88 (m, 2H), 4,51 (c, 2H), is 6.54 (DD, J=1,2, 6,8 Hz, 1H), 6,66 (c, 2H), 7,01 (DD, J=6,8, 8,8 Hz, 1H), 7,41 (DD, J=1,2, 8,8 Hz, 1H).

Similar to the method of example 20 to obtain the compounds of examples 39 and 40.

Example 39

(4-3-[(cyclopropylamino) (tetrahydro-2H-4-pyranometer)amino]-2-methylpyrazolo[1,5-a]pyridin-7-yl-3,5-acid)methanol

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,04-0,06 (m, 2H), 0,34 at 0.42 (m, 2H), 0,80-0,94 (m, 1H), 1,23-to 1.38 (m, 2H), 1,54-1,72 (m, 1H), 1,74-of 1.84 (m, 2H), 2,38 (c, 3H), 2,47 (users, 1H), 2,89 (d, J=6,8 Hz, 2H), of 3.07 (d, J=7,0 Hz, 2H), 3,34 (dt, J=2,0, 12.0 Hz, 2H), 3,74 (c, 6H), 3,90-was 4.02 (m, 2H), 4,71 (c, 2H), to 6.57 (DD, J=1,4, 6,8 Hz, 1H), of 6.71 (c, 2H), 7,05 (DD, J=6,8, 8,8 Hz, 1H), 7,52-of 7.60 (m, 1H).

Example 40

N-cyclopropylamino-N-7-[4-(ethoxymethyl)-2,6-acid]-2-methylpyrazolo[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,03-0,05(m, 2H), 0,32 at 0.42 (m, 2H), 0,80-0,94 (m, 1H), of 1.34 (t, J=7.2 Hz, 3H), 1,22-to 1.38 (m, 2H), 1,54 is 1.70 (m, 1H), 1,74-of 1.84 (m, 2H), 2,38 (c, 3H), 2,89 (d, J=6,8 Hz, 2H), of 3.07 (d, J=7.2 Hz, 2H), 3,34 (dt, J=1,6, 12,0 Hz, 2H), 3,66 (kV, J=7.2 Hz, 2H), 3.75 to (c, 6H), 3,92-was 4.02 (m, 2H), 4,59 (c, 2H), to 6.57 (DD, J=1,4, 6,8 Hz, 1H), 6,72 (c, 2H),? 7.04 baby mortality (DD, J=6,8, 8,8 Hz, 1H), 7,45 (DD, J=1,4, 8,8 Hz, 1H).

Example 41

tert-Butyl N-[7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-yl]carbamate

To a solution of tert-butyl N-[7-bromo-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-yl]carbamate (300 mg) in 1,2-dimethoxyethane (10 ml) and water (5 ml) is added 2,6-dimethoxy-4-ethoxymethyleneamino acid (323 mg), tetrakis(triphenylphosphine)palladium(0) (146 mg) and octahedral hydroxide barium (398 mg) and the reaction mixture is heated and stirred for 2 hours at 80°in the flow of nitrogen. To the obtained reaction mixture, water is added, the reaction mixture was extracted with ethyl acetate and the organic extract washed with brine. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (245 mg) obtained as an amorphous solid light yellow color of the fraction of n-hexane:ethyl acetate (1:1).

1H NMR (400 MHz, CDCl3) δ 1.55V (users, 9H, 3,32 (c, 3H), 3,76 (c, 3H), 3,68 (c, 6H), 4,51 (c, 2H), 4,62 (c, 2H), 6,37-6,46 (m, 1H), 6,65 (c, 2H), 7,13 (DD, J=6,8, 8,8 Hz, 1H), 7,50-7,58 (m, 1H).

Example 42

N-cyclopropylmethyl-N-[7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-yl]amine

To a solution of tert-butyl N-[7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-yl]carbamate (170 mg) in N,N-dimethylformamide (4 ml) is added sodium hydride (60% in oil; 22 mg) and (methyl bromide)cyclopropane (0,043 ml) and the reaction mixture was stirred for 30 min at 40°C. To the resulting reaction mixture is added water, extracted with ethyl acetate and the organic extract washed with brine. The resulting organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure to give crude product, tert-butyl N-cyclopropylmethyl-N-[7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-yl]carbamate.

The obtained tert-butyl N-cyclopropylmethyl-N-[7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-yl]carbamate was dissolved in ethyl acetate (5 ml) without purification, then this type 4h. hydrochloric acid (an ethyl acetate solution; 10 ml) and the reaction mixture was stirred for 30 min at 40°C. the Reaction mixture is neutralized 5h. water rastvoromeshalkami sodium under ice cooling, then the reaction mixture was extracted with ethyl acetate, and the organic extract washed with water and brine. The organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (95 mg) are obtained in the form of a yellow oil from a fraction of n-hexane:ethyl acetate (2:3).

1H NMR (400 MHz, CDCl3) δ to 0.15-0.20 (m, 2H), 0,48-of 0.54 (m, 2H), 1,02-1,10 (m, 1H), 1,20-of 1.32 (m, 2H), 2,35 (c, 3H), 2,88 (d, J=6,8 Hz, 2H), 3,47 (c, 3H), 3,70 (c, 6H), 4,51 (c, 2H), 6,63 (DD, J=1,2, 6,8 Hz, 1H), 6,65 (c, 2H), of 6.99 (DD, J=6,8, 8,8 Hz, 1H), was 7.36-7,40 (m, 1H).

Example 43

N-cyclopropylmethyl-N-[7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-yl]-N-tetrahydro-2H-4-paradimethylamino

To a solution of N-cyclopropylmethyl-N-[7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-yl]amine (80 mg) in tetrahydrofuran (2 ml) is added tetrahydropyran-4-carbaldehyde (44 mg) and triacetoxyborohydride sodium (82 mg) and the reaction mixture was stirred for 30 min at room temperature. To the reaction mixture are added water and saturated aqueous sodium bicarbonate solution, the mixture is extracted with ethyl acetate and the organic extract washed with brine. Organic extras the CT dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (63 mg) are obtained in the form of a yellow oil from a fraction of n-hexane:ethyl acetate (1:2).

1H NMR (400 MHz, CDCl3) δ -0,01 of 0.01 (m, 2H), 0,33-0,37 (m, 2H), 0,78-0,88 (m, 1H), 1,20-of 1.32 (m, 2H), 1,52-of 1.65 (m, 1H), 1,72-of 1.78 (m, 2H), 2,87 (d, J=6,8 Hz, 2H), 3,05 (d, J=6,8 Hz, 2H), 3,26-to 3.33 (m, 2H), 3,29 (c, 3H), 3,48 (c, 3H), 3,70 (c, 6H), 3,89-3,95 (m, 2H), 4,51 (c, 2H), 4,56 (c, 2H), 6,63 (DD, J=1,2, 6,8 Hz, 1H), 6,65 (c, 2H), 7,03 (DD, J=6,8, 8,8 Hz, 1H), 7,51 (DD, J=1,2, 8,8 Hz, 1H).

Example 44

N-cyclopropylmethyl-N-[7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-yl]-N-tetrahydro-3-furylmethyl

To a solution of N-cyclopropylmethyl-N-[7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-yl]amine (15 mg) in tetrahydrofuran (1 ml) was added tetrahydrofuran-3-carbaldehyde (50% aqueous solution of 0.022 ml), 3 M aqueous solution of sulfuric acid (0.036 ml) and sodium borohydride (2.8 mg) under ice cooling and the reaction mixture is stirred for 1 hour at the same temperature. To the obtained reaction mixture are added water and then a saturated aqueous solution of sodium bicarbonate, the mixture is extracted with ethyl acetate, the organic extract washed with brine, dried over anhydrous magnesium sulfate and filtered, R is storytell is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (4.8 mg) are obtained in the form of crystals of light-yellow color of the fraction of n-hexane:ethyl acetate (1:2).

1H NMR (400 MHz, CDCl3) δ 0,00-0,06 (m, 2H), 0,32-0,40 (m, 2H), 0,80-0,90 (m, 1H), 1,55 by 1.68 (m, 1H), 1,86-of 1.95 (m, 1H), 2,21 of-2.32 (m, 1H), 2,88 of 2.92 (m, 2H), is 3.08 (DD, J=8,8, 12.0 Hz, 1H), 3,23 (DD, J=6,8, 12.0 Hz, 1H), 3,30 (c, 3H), 3,48 (c, 3H), 3,60-3,68 (m, 2H), 3,69 (c, 6H), 3.72 points-a-3.84 (m, 2H), 4,51 (c, 2H), 4,55 (c, 2H), is 6.54 (DD, J=1,2, 6,8 Hz, 1H), 6,66 (c, 2H), 7,01 (DD, J=6,8, 8,8 Hz, 1H), 7,41 (DD, J=1,2, 8,8 Hz, 1H).

Similar to the method of example 20 to obtain the compounds of examples 45 and 46.

Example 45

4-[3-[(cyclopropylamino)(tetrahydro-2H-4-pyranometer)amino]-2-(methoxymethyl)pyrazolo[1,5-a]pyridin-7-yl] - for 3,5-dimethoxyphenethyl

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,04-0,04 (m, 2H), 0,30-0,40 (m, 2H), 0,78 to 0.92 (m, 1H), 1,20-of 1.34 (m, 2H),1,53 is 1.70 (m, 1H), 1,71 and 1.80 (m, 2H), 2,20 (users, 1H), 2,88 (d, J=6,8 Hz, 2H), 3,05 (d, J=7.2 Hz, 2H), 3,29 (c, 3H), 3,24-to 3.38 (m, 2H), 3,70 (c, 6H), 3,88-3,98 (m, 2H), 4,57 (c, 2H), 4,71 (c, 2H), 6,63 (DD, J=1,4, 6,8 Hz, 1H), 6,68 (c, 2H), 7,05 (DD, J=6,8, 8,8 Hz, 1H), 7,49-EUR 7.57 (m, 1H).

Example 46

N-cyclopropylamino-N-[7-[4-(ethoxymethyl)-2,6-acid]-2-(methoxymethyl)pyrazolo[1,5-a]pyridine-3-yl]-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,04-0,04 (m, 2H), 0,30-0,40 (m, 2H), 0,78 to 0.92(m, 1H), 1,31 (t, J=6.8 Hz, 3H), 1,20-of 1.36 (m, 2H), 1,54 by 1.68 (m, 1H), 1.70 to is 1.81 (m, 2H), 2,89 (d, J=6,8 Hz, 2H), 3,06 (d, J=6,8 Hz, 2H), 3,30 (c, 3H), 3,26-to 3.36 (m, 2H), 3,64 (kV, J=6,8 Hz, 2H), 3,71 (c, 6H), 3,89-3,98 (m, 2H), 4,56 (c, 2H), 4,57 (c, 2H), only 6.64 (DD, J=1,6, 6,8 Hz, 1H), 6,68 (c, 2H), 7,05 (DD, J=6,8, 8,8 Hz, 1H), 7,52 (DD, J=1,6, 8,8 Hz, 1H).

Example 47

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methoxypyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

To a solution of N-(7-bromo-2-methoxypyrazine[1,5-a]pyridine-3-yl)-N-cyclopropylmethyl-N-tetrahydro-2H-4-paradimethylamino (48 mg), dissolved in a mixture of 1,2-dimethoxyethane (2 ml) and water (1 ml), added 2,6-dimethoxy-4-(methoxymethyl)phenylboric acid (36 mg), tetrakis(triphenylphosphine)palladium(0) (28 mg) and octahedral of barium hydroxide (58 mg), the reaction mixture is heated and stirred for 2 hours at 85°C. To the resulting reaction mixture are added water and ethyl acetate, the reaction mixture was filtered through celite to remove insoluble residue, and then the filtrate is extracted with ethyl acetate. The resulting organic extract was washed with brine, dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure. The resulting residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (40 mg) obtained as crystals, light yellow is the first color of the fraction of n-hexane:ethyl acetate (2:1).

1H NMR (400 MHz, CDCl3) δ to-0.02 to 0.04 (m, 2H), between 0.30 to 0.36 (m, 2H), over 0.80 to 0.92 (m, 1H), 1,24-of 1.36 (m, 2H), 1,52-of 1.64 (m, 1H), 1,74-to 1.82 (m, 2H), 2,84 (d, J=6,8 Hz, 2H), 2,97 (d, J=6,8 Hz, 2H), 3,32 (TD, J=2,0, to 11.6 Hz, 2H), 3,51 (c, 3H), 3,76 (c, 6H), a 3.87 (c, 3H), 3,90-3,98 (m, 2H), 4,55 (c, 2H), 6,51 (DD, J=1,6, 6,8 Hz, 1H), 6,69 (c, 2H),? 7.04 baby mortality (DD, J=7,2, 8,8 Hz, 1H), 7,33 (DD, J=1,6, 8,8 Hz, 1H).

Similar to the method of example 47 synthesize compounds of examples 48-51.

Example 48

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(1-methoxyethyl)phenyl]-2-methoxypyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

The crystals are light yellow

1H NMR (400 MHz, CDCl3) δ to-0.02 to 0.04 (m, 2H), between 0.30 to 0.38 (m, 2H), over 0.80 to 0.92 (m, 1H), 1,22-of 1.34 (m, 2H), 1.55V (d, J=1.6 Hz, 3H), 1.56 to its 1.68 (m, 1H), 1,72-to 1.82 (m, 2H), 2,84 (d, J=6,8 Hz, 2H), 2,97 (d, J=7.2 Hz, 2H), 3,26-3,34 (m, 2H), 3,37 (c, 3H), of 3.77 (c, 6H), 3,89 (c, 3H), 3,90-3,98 (m, 2H), 4,37 (kV, J=6,4 Hz, 1H), 6,53 (DD, J=1,2, 7.2 Hz, 1H), 6,66 (d, J=3.2 Hz, 2H),? 7.04 baby mortality (DD, J=7,2, 8,8 Hz, 1H), 7,33 (DD, J=1,6, 8,8 Hz, 1H).

Example 49

(4-3-[(cyclopropylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-methoxypyrazine[1,5-a]pyridin-7-yl-3,5-acid)methanol

Amorphous solid yellow

1H NMR (400 MHz, CDCl3) δ to-0.02 and 0.06 (m, 2H), between 0.30 to 0.38 (m, 2H), 0,80-0,93 (m, 1H), 1,23-to 1.38 (m, 2H), 1,53-to 1.67 (m, 1H), 1,74-of 1.88 (m, 2H), 2,84 (d, J=6.6 Hz, 2H), 2,98 (d, J=1.0 Hz, 2H), 3.33 and (dt, J=1,7, 12.0 Hz, 2H), of 3.77 (c, 6H), 3,88 (c, 3H), 3,91-4,00 (m, 2H), 4,81 (userd, J=4,6 Hz, 2H), 6,50-6,55 (m, 1H), 6,74 (c, 2H), 7,02-to 7.09 (m, 1H), 7,32-7,38 (m, 1H).

Por the measures 50

N-cyclopropylmethyl-N-7-[4-(ethoxymethyl)-2,6-acid]-2-methoxypyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,02 of 0.07 (m, 2H), between 0.30 to 0.39 (m, 2H), 0,82-of 0.95 (m, 1H), 1,36 (t, J=7.0 Hz, 3H), 1.25 and 1.39 in (m, 2H), 1,55 by 1.68 (m, 1H), 1,75-of 1.84 (m, 2H), 2,85 (d, J=6,8 Hz, 2H), 2,99 (d, J=7,0 Hz, 2H), 3,34 (dt, J=1.8V, 12.0 Hz, 2H), 3,69 (kV, J=7,0 Hz, 2H), 3,78 (c, 6H), 3,89 (c, 3H), 3,92-4,00 (m, 2H), 4,62 (c, 2H), of 6.52 (DD, J=1,4, 6.9 Hz, 1H), 6,72 (c, 2H), 7,06 (DD, J=6,9, and 8.9 Hz, 1H), 7,35 (DD, J=1,4, and 8.9 Hz, 1H).

Example 51

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methoxypyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-3-furylmethyl

The crystals are light yellow

1H NMR (400 MHz, CDCl3) δ to-0.02 to 0.04 (m, 2H), 0,28-0,34 (m, 2H), 0,78 is 0.86 (m, 1H), 1,60 by 1.68 (m, 1H), 1,84-of 1.94 (m, 1H), 2,20-of 2.30 (m, 1H), and 2.83 (d, J=6,8 Hz, 2H), 2,92-3,00 (m, 1H), 3,10-3,14 (m, 1H), 3,48 (c, 3H), 3,52-3,68 (m, 2H), of 3.73 (c, 6H), 3,74-3,82 (m, 2H), 3,84 (c, 3H), to 4.52 (c, 2H), 6.48 in (DD, J=1,2, 7.2 Hz, 1H), 6,65 (c, 2H), 7,02 (DD, J=7,2, 8,8 Hz, 1H), 7,29 (DD, J=1,2, 8,8 Hz, 1H).

Example 52

tert-Butyl N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methoxypyrazine[1,5-a]pyridine-3-ylcarbamate

To a solution of tert-butyl N-(7-bromo-2-methoxypyrazine[1,5-a]pyridine-3-yl)carbamate (200 mg)dissolved in 1,2-dimethoxyethane (12 ml) and water (6 ml), added 2,6-dimethoxy-4-(methoxymethyl)phenylboric acid (197 mg, tetrakis(triphenylphosphine)palladium(0) (101 mg) and octahedral hydroxide barium (274 mg), the reaction mixture is heated and stirred for 4 h at 80°in a stream of nitrogen. To the resulting reaction mixture is added ethyl acetate, and after filtered off the insoluble residue, the reaction mixture was extracted with ethyl acetate, the organic extract washed with brine, dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (150 mg) obtained as oil is light yellow in color of the fraction of n-hexane:ethyl acetate (1:1).

1H NMR (400 MHz, CDCl3) δ 1,52 (users, 9H), 3,48 (c, 3H), 3,70 (c, 6H), a 3.87 (c, 3H), 4,51 (c, 2H), of 5.82 (users, 1H), 6,53 (d, J=6,8 Hz, 1H), 6,64 (c, 2H), 7,10 (DD, J=6,8, 8,8 Hz, 1H), 7,27 (d, J=8,8 Hz, 1H).

Example 53

N-cyclobutylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methoxypyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

To a solution of tert-butyl N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methoxypyrazine[1,5-a]pyridine-3-ylcarbamate (75 mg) in N,N-dimethylformamide (0.6 ml) is added sodium hydride (60% in oil; 10 mg) and (methyl bromide)CYCLOBUTANE (0,022 ml) and the reaction mixture is stirred for 1 hour at room temperature. To receive the Noah of the reaction mixture, water is added, extracted with ethyl acetate and the organic extract washed with brine. The organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure to give crude product, tert-butyl N-cyclobutylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methoxypyrazine[1,5-a]pyridine-3-ylcarbamate.

To the obtained crude product, tert-butyl N-cyclobutylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methoxypyrazine[ 1,5-a]pyridine-3-ylcarbamate, without additional purification type 4h. hydrochloric acid (an ethyl acetate solution; 1 ml) and the reaction mixture is stirred for 1 hour at 40°C. the reaction mixture is neutralized using 2n. an aqueous solution of sodium hydroxide under ice cooling, then the mixture is extracted with ethyl acetate and the organic extract washed with brine. The organic extract is dried over anhydrous magnesium sulfate and filtered, the residue is purified by chromatographic processing on a column of silica gel and N-cyclobutylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methoxypyrazine[1,5-a]pyridine-3-ylamine (51 mg) are obtained in the form of a yellow oil from a fraction of n-hexane:ethyl acetate (1:1).

To a solution of the N-cyclobutylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methoxypyrazine[1,5-a]pyridine-3-ylamine in tetrahydrof the wound (0.6 ml) is added tetrahydropyran-4-carbaldehyde (34 mg) and triacetoxyborohydride sodium (38 mg) and the reaction mixture is stirred for 2 hours at room temperature. To the resulting reaction mixture is added saturated aqueous sodium bicarbonate solution, the mixture is extracted with ethyl acetate and the organic extract washed with brine. The organic extract is dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure, the residue is purified by chromatographic processing on a column of silica gel and indicated in the title compound (52 mg) are obtained in the form of a yellow oil from a fraction of n-hexane:ethyl acetate (3:2).

1H NMR (400 MHz, CDCl3) δ 1,17-of 1.30 (m, 2H), 1,48-to 1.63 (m, 3H), 1,69-1,89 (m, 6H), 2.26 and-2,39 (m, 1H), 2,82-2,87 (m, 2H), 2.93 which are 2.98 (m, 2H), 3,24-to 3.34 (m, 2H), 3,49 (c, 3H), of 3.73 (c, 6H), 3,85 (c, 3H), 3,88-of 3.96 (m, 2H), 4.53-in (c, 2H), 6.48 in (DD, J=1,3, 6,8 Hz, 1H), 6,66 (c, 2H), 7,02 (DD, J=6,8, 8,8 Hz, 1H), 7,24 (DD, J=1,3, 8,8 Hz, 1H).

Similar to the method of example 53 synthesize compounds of examples 54-56.

Example 54

N-butyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-

methoxypyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-

paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ 0,81-to 0.89 (m, 3H), 1.18 to of 1.40 (m, 6N), 1,48 is 1.60 (m, 1H), 1.70 to of 1.78 (m, 2H), 2,83 are 2.98 (m, 4H), 3,24-to 3.34 (m, 2H), 3,49 (c, 3H), 3,74 (c, 6H), 3,85 (c, 3H), 3,88-of 3.97 (m, 2H), 4.53-in (c, 2H), of 6.49 (DD, J=1,3, 6,8 Hz, 1H), 6,67 (c, 2H), 7,02 (DD, J=6,8, 8,8 Hz, 1H), 7,26 (DD, J=1,3, 8,8 Hz, 1H).

Example 55

N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methoxypyrazine[1,5-a]pyridine-Il-N-propyl-N-tetrahydro-2H-4-paradimethylamino

Amorphous solid light yellow

1H NMR (400 MHz, CDCl3) δ of 0.87 (t, J=7,6 Hz, 3H), of 1.20 to 1.31 (m, 2H), 1,33-of 1.42 (m, 2H), 1,48-of 1.62 (m, 1H), 1,71-of 1.78 (m, 2H), 2,87 (d, J=7.2 Hz, 2H), 2,90 (d, J=7.2 Hz, 2H), 3.25 to to 3.34 (m, 2H), 3,48 (c, 3H), of 3.73 (c, 6H), 3,84 (c, 3H), 3,88-3,95 (m, 2H), to 4.52 (c, 2H), 6,47 (DD, J=1,2, 6,8 Hz, 1H), 6,66 (c, 2H), 7,00 (DD, J=6,8, 8,8 Hz, 1H), 7,25 (DD, J=1,2, 8,8 Hz, 1H).

Example 56

N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-methoxypyrazine[1,5-a]pyridine-3-yl-N-isobutyl-N-tetrahydro-2H-4-paradimethylamino

Amorphous solid light yellow

1H NMR (400 MHz, CDCl3) δ of 0.90 (d, J=6.4 Hz, 6H), 1,19-of 1.30 (m, 2H), 1,48 is 1.60 (m, 2H), 1,74-of 1.81 (m, 2H), 2,72 (d, J=7.2 Hz, 2H), 2,82 (d, J=7.2 Hz, 2H), 3,26-to 3.34 (m, 2H), 3,48 (c, 3H), of 3.73 (c, 6H), 3,84 (c, 3H), 3,89-3,95 (m, 2H), to 4.52 (c, 2H), 6,47 (DD, J=1,2, 6,8 Hz, 1H), 6,66 (c, 2H), 7,00 (DD, J=6,8, 8,8 Hz, 1H), 7,26 (DD, J=1,2, 8,8 Hz, 1H).

Similar to the method of example 18 synthesize the compound of example 57.

Example 57

1-(4-3-[(cyclopropylmethyl)(tetrahydro-2H-4-pyranometer)amino]-2-methoxypyrazine[1,5-a]pyridin-7-yl-3,5-acid)-1-ethanol

Amorphous solid light yellow

1H NMR (400 MHz, CDCl3) δ -0,06 of 0.01 (m, 2H), is 0.27-0.34 (m, 2H), 0,78-0,89 (m, 1H), 1,20-of 1.34 (m, 2H), 1,49-to 1.63 (m, 4H), 1,71 and 1.80 (m, 2H), 2,78-2,84 (m, 2H), 2.91 in-2,99 (m, 2H), 3,24-to 3.35 (m, 2H), 3,74 (c, 3H), 3.75 to (c, 3H), 3,86 (c, 3H), 3,88-of 3.97 (m, 2H), 4,93-free 5.01 (m, 1H), of 6.49 (DD, J=1,3, 6,8 Hz, 1H), 6,68 (c, 1H), 674 (c, 1H), 7,02 (DD, J=6,8, 8,8 Hz, 1H), 7,31 (DD, J=1,3, 8,8 Hz, 1H).

Similar to the method of example 47 synthesize the compound of example 58.

Example 58

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethoxypyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

Butter yellow

1H NMR (400 MHz, CDCl3) δ -0,04-0,02 (m, 2H), and 0.28-0.31 in (m, 2H), 0,78-0,88 (m, 1H), 1,20-1,32 (m, 5H), 1,50-1,60 (m, 1H), 1.70 to of 1.78 (m, 2H), 2,1 (d, J=6,4 Hz, 2H), 2,95 (d, J=6,8 Hz, 2H), 3,29 (dt, J=2.0 a, and 11.6 Hz, 2H), 3,48 (c, 3H), 3.72 points (c, 6H), 3,89-3,93 (m, 2H), 4,21 (kV, J=7.2 Hz, 2H), to 4.52 (c, 2H), 6,47 (DD, J=1,2, 6,8 Hz, 1H), 6,66 (c, 2H), 7,00 (DD, J=7,2, 8,8 Hz, 1H), 7,30 (DD, J=1,2, 8,8 Hz, 1H).

Example 59

N-cyclopropylmethyl-N-[7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-(methylsulfanyl)pyrazolo[1,5-a]pyridine-3-yl]-N-tetrahydro-2H-4-paradimethylamino

To a solution of N-cyclopropylmethyl-N-[7-iodine-2-(methylsulfanyl)pyrazolo[1,5-a]pyridine-3-yl]-N-tetrahydro-2H-4-paradimethylamino (50 mg)dissolved in a mixture of 1,2-dimethoxyethane (2 ml) and water (1 ml), added 2,6-dimethoxy-4-(methoxymethyl)phenylboric acid (50 mg), tetrakis(triphenylphosphine)palladium(0) (40 mg) and octahedral of barium hydroxide (56 mg) and the reaction mixture is heated and stirred for 3 hours at 80°C. To the resulting reaction mixture are added water and ethyl acetate, the insoluble residue is filtered over celite and the filtrate extra is irout with ethyl acetate. The organic extracts are combined and washed with brine, dried over anhydrous magnesium sulfate and filtered, the solvent is evaporated under reduced pressure. The resulting residue is purified by chromatographic processing on a column of silica gel and then using chromatographic processing column, using NH silica (NH Silica (Fiji Silysia)), getting mentioned in the title compound (36 mg) as a yellow oil.

1H NMR (400 MHz, CDCl3) δ to-0.02 to 0.04 (m, 2H), between 0.30 to 0.38 (m, 2H), of 0.82 to 0.92 (m, 1H), 1,22-of 1.34 (m, 2H), 1,52-of 1.64 (m, 1H), 1,76-to 1.82 (m, 2H), 2,44 (c, 3H), 2,90 (d, J=6,8 Hz, 2H), 3,06 (d, J=7.2 Hz, 2H), 3,32 (TD, J=2,0, 12.0 Hz, 2H), 3,50 (c, 3H), 3,74 (c, 6H), 3,90-3,98 (m, 2H), 4,54 (c, 2H), 6,59 (DD, J=1,6, 7.2 Hz, 1H), 6,67 (c, 2H), 7,05 (DD, J=7,2, 8,8 Hz, 1H), 7,41 (DD, J=1,6, 8,8 Hz, 1H).

Similar to the method of example 59 to receive the compound of example 60.

Example 60

N-cyclopropylmethyl-N-[7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-(methylsulfanyl)pyrazolo[1,5-a]pyridine-3-yl]-N-tetrahydro-3-furylmethyl

Butter yellow

1H NMR (400 MHz, CDCl3) δ to-0.02 to 0.04 (m, 2H), 0,28 is 0.38 (m, 2H), 0,80-0,90 (m, 1H), 1,58 by 1.68 (m, 1H), 1,88 is 1.96 (m, 1H), 2,20-of 2.30 (m, 1H), 2,42 (c, 3H), 2,88 of 2.92 (m, 2H), 3,02-3,10 (m, 1H), 3,20-3,24 (m, 1H), 3,47 (c, 3H), to 3.58-3,82 (m, 4H), 3,71 (c, 6H), to 4.52 (c, 2N), to 6.57 (DD, J=1,6, 7.2 Hz, 1H), 6,64 (c, 2H), 7,03 (DD, J=6,8, 8,8 Hz, 1H), 7,38 (DD, J=1,6, 8,8 Hz, 1H).

Example of getting 1X

2-ethyl-3-iteratio[1,5-a]pyridine

N-chlorosuccinimide (411 g, is 3.08 mol) is slowly added to a mixture of 2-ethylpyrazine[1,5-a]pyridine (360 g, 2,46 mol), ethyl acetate (3600 ml), water (1800 ml) and sodium iodide (480 g, 3,20 mol, 1.3 equivalents) for 30 min under ice cooling and then the reaction mixture was stirred for 2 h and 20 min at room temperature. After completion of the reaction, to the reaction mixture are added water and ethyl acetate and the mixture is extracted with ethyl acetate. The organic extract is washed twice with 10% aqueous sodium thiosulfate and then concentrated. Hexane added to the residue, the mixture is heated to obtain a solution and the resulting solution is filtered to remove the insoluble residue. Then after washing the hexane solution with water, the hexane layer is concentrated and the residue is dissolved in ethyl acetate and the solvent is evaporated, getting 663 g specified in the connection header (98,9% yield).

1H NMR (400 MHz, CDCl3) δ to 1.35 (t, J=7.7 Hz, 3H), 2,84 (kV, J=7.7 Hz, 2H), 6,72 (DDD, J=6,8, to 6.8, 1.3 Hz, 1H), 7,15 (DDD, J=9,0, to 6.8, 1.1 Hz, 1H), 7,37 (DDD, J=9,0, of 1.3, 1.3 Hz, 1H), at 8.36 (DDD, J=6,8, 1,1, 1,1 Hz, 1H).

Example of getting 2

Tetrahydro-2H-4-pyrocarbonate

Concentrated aqueous ammonia solution (50 ml) is added to methyl tetrahydro-2H-Piran-4-carboxylate (50 g, 347 mmol) and the reaction mixture stirred for 43,5 hours at room temperature is. Then the reaction mixture is cooled in a bath of ice water, after which the precipitate is filtered off and dried under reduced pressure at 40°receiving of 33.4 g specified in the connection header (74,6% yield).

1H NMR (400 MHz, CDCl3) δ 1,45-of 1.62 (m, 4H), 2,28 (TT, J=11,1, 4,4 Hz, 1H), 3,26 (DDD, J=11,4, 11,4, 2.7 Hz, 2H), 3,82 (userd, J=11,4 Hz, 2H), 6,74 (users, 1H), 7,21 (users, 1H).

Example of getting 3

N4-(2-ethylpyrazine[1,5-a]pyridine-3-yl)tetrahydro-2H-4-pyrocarbonate

A mixture of 2-ethyl-3-iteratio[1,5-a]pyridine (350 grams of 1.29 mol), tetrahydro-2H-4-pyrocarbonate (249 g of 1.93 mol), copper iodide (49,0 g, 258 mmol), tribalista (hydrate) (546 g, 2.57 mol), 1,2-cyclohexanediamine (mixture of CIS - and TRANS-forms) (58,7 g, 514 mmol) and xylene (3500 ml) is stirred under heating, while keeping the external temperature of 120° (oil bath). The reaction mixture is heated and stirred for 6 hours, then heating stopped and after reaching an internal temperature of 61.5°to the reaction mixture add hot water (58°With 3500 ml) and stirring is continued over night. After adding to the reaction mixture of 28% aqueous ammonia (1050 ml) and stirring for 1 hour the precipitation is filtered and washed with water (1750 ml) and ethyl acetate (1050 ml), then dried under aeration at 60°during the night, getting 280g specified in the agolove connection (main conformer:minor conformer - 6:1) (79.6% of the output).

The main conformer

1H NMR (400 MHz, CDCl3) δ of 1.33 (t, J=7.7 Hz, 3H), 1,88-2,05 (m, 4H), 2.57 m-to 2.67 (m, 1H), 2,75 (kV, J=7.7 Hz, 2H), 3,50 (DDD, J=11,4, 11,4, 2,9 Hz, 2H), 4.09 to (DDD, J=11,4, 4,0, 2,6 Hz, 2H), of 6.68 (DDD, J=6,8, to 6.8, 1.3 Hz, 1H), 6,82 (users, 1H), 7,07 (DDD, J=9,0, to 6.8, 1.3 Hz, 1H), 7,29 (userd, J=9.0 Hz, 1H), 8,30 (d, J=6,8 Hz, 1H).

Minor conformer

1H NMR (400 MHz, CDCl3) δ of 1.34 (t, J=7.7 Hz, 3H), of 1.40-1.50 (m, 2H), 1,88-2,05 (m, 2H), 2,37-2,48 (m, 1H), 2,78 (kV, J=7.7 Hz, 2H), 3,14 (DDD, J=11,9, 11,9, 1.8 Hz, 2H), 3,84-to 3.92 (m, 2H), 6,56 (users,1H), 6,80 (DDD, J=6,8, to 6.8, 1.3 Hz, 1H), 7,20 (userid, J=9,0, 6,8 Hz, 1H), 7,34 (userd, J=9.0 Hz, 1H), 8,39 (d, J=6,8 Hz, 1H).

An example of retrieving 4

N4-cyclopropylmethyl-N4-(2-ethylpyrazine[1,5-a]pyridine-3-yl)tetrahydro-2H-4-pyrocarbonate

A mixture of N4-(2-ethylpyrazine[1,5-a]pyridine-3-yl)tetrahydro-2H-4-pyrocarbonate (272 g, 915 mmol), tert-butoxide potassium (144 g, 1.28 mol) and 1,2-dimethoxyethane (1750 ml) was heated and stirred at an external temperature of 40°C. Then the reaction mixture is added dropwise (methyl bromide)cyclopropane (161 g, 1,19 mol), keeping the temperature inside the reactor below 50°C. After heating and stirring continue for 4 hours to the reaction mixture are added water (1250 ml) and toluene (3750 ml). The aqueous layer was removed and then the organic extract was washed with 10% brine (1250 ml) and water (1250 ml × 2 times) in that order and conc is the shape under reduced pressure, getting 277 g specified in the title compound as brown oil (yield of 92.6%).

1H NMR (400 MHz, CDCl3) δ 0,03-0,11 (m, 1H), 0,14-0,22 (m, 1H), 0,32-0,46 (m, 2H), 0,85-0,98 (m, 1H), 1,36 (t, J=7,6 Hz, 3H), 1,29-of 1.40 (m, 1H), of 1.40-1.50 (m, 1H), of 1.85 (DDD, J=16,3, 11,9, and 4.4 Hz, 1H), 1,97 (DDD, J=16.5, and 11,9, 4.6 Hz, 1H), 2,41 (TT, J=11,5, 3.8 Hz, 1H), 2,66-2,84 (m, 2H), 3,03 (DDD, J=11,9, 11,9, 2.2 Hz, 1H), 3.15 in (DDD, J=11,9, 11,9, 2.2 Hz, 1H), and 3.31 (DD, J=13,7, 7,3 Hz, 1H), 3,79 (DD, J=13,7, 7,3 Hz, 1H), 3,76-3,86 (m, 1H), 3,91 (DDD, J=11,9, 4,4, 2.0 Hz, 1H), 6,79 (DDD, J=6,8, to 6.8, 1.4 Hz, 1H), 7,17 (userid, J=8,8, 6,8 Hz, 1H), 7,33 (userd, J=8,8 Hz, 1H), 8,40 (d, J=6,8 Hz, 1H).

Example get 5X

N-cyclopropylmethyl-N-(2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paradimethylamino

A solution of N4-cyclopropylmethyl-N4-(2-ethylpyrazine[1,5-a]pyridine-3-yl)tetrahydro-2H-4-pyrocarbonate (220 g, 672 mmol) in tetrahydrofuran (1100 ml) was stirred at an external temperature of 55°With (bath with hot water). The complex of borane-tetrahydrofuran (1M solution, 1748 ml) is added dropwise to the reaction mixture and after heating and stirring for 2 hours the reaction mixture is cooled in a bath with ice, and add 2n. hydrochloric acid (437 ml). Then the reaction mixture is stirred for 1 hour at an external temperature of 50°With (bath with hot water). After completion of the reaction, to the reaction mixture are added dropwise 5h. an aqueous solution of sodium hydroxide (299 ml) for the maintenance of the pH to 8 and the aqueous layer was removed. Then the organic extract was added toluene (2200 ml) and then the organic extract is washed twice with water, concentrated under reduced pressure, getting 209 g specified in the title compound (yield of 99.2%).

1H NMR (400 MHz, CDCl3) δ -0,04-0,06 (m, 2H), 0,30-0,40 (m, 2H), 0,73 is 0.86 (m, 1H), 1.18 to about 1.36 (m, 2H), 1,33 (t, J=7,6 Hz, 3H), 1,46 is 1.60 (m, 1H), 1,72 (userd, J=12,8 Hz, 2H), 2,82 (kV, J=7,6 Hz, 2H), 2,84 (d, J=7.2 Hz, 2H), 3,01 (d, J=7.2 Hz, 2H), or 3.28 (DDD, J=12,0, to 12.0, 2.0 Hz, 2H), 3,92 (userid, J=12,0, 4,4 Hz, 2H), 6,59 (DDD, J=6,8, to 6.8, 1.2 Hz, 1H), 6,95 (DDD, J=8,8, to 6.8, 1.2 Hz, 1H), 7,44 (DDD, J=8,8, 1,2, 1.2 Hz, 1H), 8,29 (DDD, J=6,8, 1,2, 1,2 Hz, 1H).

Example of getting 6X

N-cyclopropylmethyl-N-(2-ethyl-7-iteratio[1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paradimethylamino

A solution of N-cyclopropylmethyl-N-(2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paradimethylamino (180 g, 574 mmol) in tetrahydrofuran (1620 ml) is cooled using bath with a mixture of dry ice-ethanol. To the resulting solution was added dropwise a 1.6 M solution of n-utility in hexane (538 ml, 854 mmol) while the temperature inside the reactor in the range from -73°to -64,5°C. After stirring the reaction mixture for 1 hour at the same temperature is added dropwise pentafluorides (115 ml, 861 mmol). The reaction mixture is additionally stirred for 1 hour and 20 min and then added to the mixture the mixture of water/THF (1/1, vol/about., 360 ml). Ohlazhdeniya, then to the reaction mixture are added water (3600 ml) and heptane (3600 ml), the aqueous layer was removed and the organic extract washed with water (3600 ml). Then to the organic layer, add 5N. an aqueous solution of hydrochloric acid (1800 ml) and the aqueous layer was isolated. After cooling, the aqueous layer in a bath with ice and add 5N. an aqueous solution of sodium hydroxide (1620 ml) to the reaction mixture further toluene (3600 ml) and the organic layer isolated. The aqueous layer was extracted with toluene (3600 ml) and both organic extracts are combined and concentrated, getting 220 g specified in the connection header in the form of oil, dark-green (87.3%).

1H NMR (400 MHz, CDCl3) δ to-0.02 to 0.05 (m, 2H), 0,33-0,40 (m, 2H), 0.74 and is 0.86 (m, 1H), 1,19-of 1.32 (m, 2H), 1,36 (t, J=7,6 Hz, 3H), 1,46 is 1.60 (m, 1H), 1,71 (userd, J=13,2 Hz, 2H), 2,86 (d, J=6,8 Hz, 2H), 2,88 (kV, J=7,6 Hz, 2H), 3,02 (d, J=6,8 Hz, 2H), or 3.28 (DDD, J=11,6, 11,6, 2.0 Hz, 2H), 3,92 (userid, J=11,6, 2,6 Hz, 2H), of 6.71 (DD, J=8,8, 6,8 Hz, 1H), 7,20 (DD, J=6,8, 1.2 Hz, 1H, 7,47 (DD, J=8,8, 1.2 Hz, 1H).

Example of getting 7

Hydrochloride N-cyclopropylmethyl-N-(2-ethyl-7-iteratio[1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paradimethylamino

A solution of concentrated hydrochloric acid (48,5 ml, 575 mmol) in isopropanol (270 ml) is added dropwise to a solution of N-cyclopropylmethyl-N-(2-ethyl-7-iteratio[1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paradimethylamino (220 g, 501 IMO the ü) in dimethylcarbonate (3600 ml) for 20 min at room temperature and the reaction mixture stirred for 15 h at room temperature. Then the reaction mixture is cooled in a bath of ice water, and to this add dimethylcarbonate (900 ml). After stirring the reaction mixture for about 5 hours precipitated solid precipitate is collected by filtration and washed with dimethylcarbonate (900 ml). Then it is dried under reduced pressure at 50°receiving 250 g specified in the connection header (output 93,7%) in the form of MES with dimethylcarbonate and isopropanol.

1H NMR (400 MHz, CD3OD) δ 0.08 to 0.40 in (m, 2H), 0,42-of 0.56 (m, 2H), 0,81-0,94 (m, 1H), 1,30-1,60 (m, 4H), 1,50 (t, J=7.5 Hz, 3H), 1,67-of 1.81 (m, 1H), 3,06 (kV, J=7.5 Hz, 2H), 3,24 (DDD, J=11,7, 11,7, 2.4 Hz, 2H), 3,56 is 3.76 (m, 4H), 3,82-3,90 (m, 2H), 7,20 (DD, J=8,8,7,1 Hz, 1H), 7,66 (d, J=7,1 Hz, 1H), 7,98 (d, J=8,8 Hz, 1H).

Example of getting 8X

2-bromo-1,3-dimethoxy-5-(methoxymethyl)benzene

Methylchloride (34,5 ml, 446 mmol) are added to a solution of (4-bromo-3,5-acid)methanol (100 g, 405 mmol) and triethylamine (67,5 ml, 484 mmol) in 1,2-dimethoxyethane (1000 ml) under ice cooling and the reaction mixture is stirred for 30 minutes After adding to the reaction mixture of 28% sodium methoxide in methanol (350 ml, 1,72 mol) the mixture is further stirred for 3 hours at room temperature. After completion of the reaction, to the reaction mixture are added toluene (1000 ml) and water (1000 ml), the aqueous layer was removed and the organic extract washed with water (1000 ml), 1N. hydrochloric sour the Oh (500 ml) and water (500 ml) in that order, and concentrate under reduced pressure, getting 105 g specified in the title compounds as colorless oil (yield of 99.5%).

Example of getting 9ץ

2,6-dimethoxy-4-(methoxymethyl)phenylboric acid

To a solution of 2-bromo-1,3-dimethoxy-5-(methoxymethyl)benzene (20,0 g, to 76.6 mmol) in tetrahydrofuran (200 ml)which was cooled in a bath with a mixture of ice-acetone, add 1,58 M n-utility in hexane (50,9 ml, 80,4 mmol) in a stream of nitrogen and the reaction mixture is stirred for 30 minutes Then to the reaction mixture add a solution of trimethoxysilane (8,75 g, 84,2 mmol) in tetrahydrofuran (20 ml) and the temperature of the reaction mixture was raised to 0°when the mixing. After adding to the reaction mixture 1H. hydrochloric acid (200 ml) the mixture is stirred for 30 min at room temperature. After the reaction, to the reaction mixture are added toluene (200 ml) and the organic layer emit, after which the aqueous layer was extracted with toluene (100 ml). The combined organic extracts washed with water (100 ml) and then concentrated under reduced pressure. The residue is dissolved in tert-butylmethylether ether (75 ml) and the reaction mixture was stirred for 30 min, then added to the mixture heptane (223 ml) and the reaction mixture is stirred further for 2 hours. The precipitation is filtered off and washed with a mixed solution of Tr is t-butyl methyl ether and heptane (1:3, 3,75 ml) and then dried at 40°within 24 hours, receiving 12.4 g specified in the connection header (output 71,8%).

Example of getting 10X

Methyl 4-bromo-3,5-dimethoxybenzoate

Potassium carbonate (359 g) are added to a solution of 4-bromo-3,5-dihydroxybenzoic acid (127,5 g) in N,N-dimethylformamide (1020 ml) under cooling in a bath with ice and then add logmean (143 ml). After removal of the bath with ice and stirring at room temperature for 17 h, the reaction mixture was poured into ice water. Precipitated solid precipitate is collected by filtration and washed with water, and then the residue is dissolved in ethyl acetate and dried over anhydrous magnesium sulfate and the solvent is evaporated under reduced pressure, obtaining specified in the header connection (133,2 g) as a solid white color.

Example get 11X

(4-bromo-3,5-acid)methanol

Borohydride lithium (20,8 g) is added slowly to a solution of methyl 4-bromo-3,5-dimethoxybenzoate (133,2 g) in tetrahydrofuran (500 ml) at room temperature and the mixture is stirred for 3 hours under heating at boiling under reflux. The reaction mixture is cooled to room temperature, add ice water (1.5 l) and then add ethyl acetate (1.2 l) for extraction. Received about the organic extract was washed with brine, dried over anhydrous magnesium sulfate and the solvent is evaporated under reduced pressure, obtaining specified in the header of the connection (of 118.8 g) as a solid white color.

Example get 12X

2-bromo-1,3-dimethoxy-5-(methoxymethyl)benzene

Sodium hydride (60% in oil; 24,7 g) are added to a solution of (4-bromo-3,5-acid)methanol (118,8 g) in N,N-dimethylformamide (960 ml) under cooling with ice, and after stirring for 10 min added dropwise logmean (41.7 ml), the temperature was raised to room temperature and stirring is continued for 1 hour. The reaction mixture is poured into ice water (2.5 l), extracted with ethyl acetate, the extract washed with brine and dried over anhydrous magnesium sulfate and the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel and specified in the header connection (121,3 g) obtained as colorless oil from a fraction of n-hexane:ethyl acetate (4:1).

Example of getting H

2,6-dimethoxy-4-(methoxymethyl)phenylboric acid

n-Utility (2,64 M solution in hexane; 182 ml) was added dropwise to a solution of 2-bromo-1,3-dimethoxy-5-(methoxymethyl)benzene (121,3 g) in tetrahydrofuran (730 ml) at -78°and a mixture of AC who're asked for 20 minutes Then to the reaction mixture add a solution of trimethoxysilane (61,7 ml) in tetrahydrofuran (20 ml) at -78°C. When the temperature inside the reactor rises to -10°C, the reaction mixture is added saturated aqueous ammoniacal (730 ml) and stirring is continued for 15 minutes the reaction mixture is extracted with ethyl acetate, the extract washed with brine and dried over anhydrous magnesium sulfate and the solvent is evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel and specified in the header connection (90,4 g) are obtained in the form of a solid white color of the fraction of n-hexane:ethyl acetate (2:3).

1H NMR (400 MHz, CDCl3) δ 3,44 (c, 3H), 3,93 (c, 6H), 4,47 (c, 2H), 6,62 (c, 2H), 7,19 (c, 2H).

Example of getting 14

2,6-dimethoxy-4-(methoxymethyl)phenylboric acid

To a suspension of magnesium shavings (97,5 mg, 4,01 mmol) in tetrahydrofuran (0.5 ml)containing a small amount of added iodine, add approximately a tenth of a solution of 2-bromo-1,3-dimethoxy-5-(methoxymethyl)benzene (1.0 g, 3,82 mmol) in tetrahydrofuran (1 ml) under nitrogen atmosphere and the mixture is heated on an oil bath at 70°C. the Heating is stopped after the low boiling the reaction mixture under reflux and the disappearance of the iodine okra is key. To continue boiling under reflux, the remaining solution of 2-bromo-1,3-dimethoxy-5-(methoxymethyl)benzene in tetrahydrofuran is added dropwise to the reaction mixture. After completion of adding dropwise, the reaction mixture was then heated and refluxed for 1 hour, then cooled to room temperature. Then the reaction mixture is added dropwise to a cooled on ice to a solution of triethylborane (or 0.57 ml, equal to 4.97 mmol) in tetrahydrofuran (0.5 ml). After completion of adding dropwise, and stirring for 40 minutes under ice cooling, the mixture is stirred over night at room temperature. To the reaction mixture then add an aqueous solution of ameriglide and methanol. Quantitative measurements using liquid chromatography confirm the receipt specified in the connection header with the release of 89%.

Example of getting 1Y

tert-Butyl N-(2-ethylpyrazine[1,5-a]pyridine-3-yl)carbamate

To a solution of 2-ethyl-3-nitropyrazole[1,5-a]pyridine (of 7.65 g, 40 mmol)dissolved in a mixture of isopropyl alcohol (153 ml) and acetic acid (11.5 ml), add di-tert-BUTYLCARBAMATE (14 g, 64 mmol) and 5% palladium-on-coal (1,53 g, 50 wt.%) and reaction are for 3 hour at room temperature in hydrogen atmosphere (0.3 MPa). After completion of the reaction, reactio the ing the mixture is filtered and the resulting filtrate is evaporated. The residue is dissolved in ethyl acetate and an ethyl acetate solution is washed with aqueous sodium bicarbonate solution and saline. The organic extract is dried over magnesium sulfate and evaporated to dryness. To this add isopropyl alcohol (7.7 ml) and heptane (38,3 ml) and the mixture heated to 60°to obtain a solution. As a result of slow cooling, a precipitate and then to this add heptane (15.3 ml). After maturation of the mixture during the night and subsequent stirring for 30 min in a bath with ice, the precipitate is collected by filtration and washed with heptane. The precipitate is dried under reduced pressure, getting 7,58 g specified in the title compound (71%yield).

Example obtain 2Y

tert-Butyl N-(2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paramillitary

To a solution of tert-butyl N-(2-ethylpyrazine[1,5-a]pyridine-3-yl)carbamate (12 g, 46 mmol) and tert-butoxide potassium (6.2 g, 55 mmol) in N,N-dimethylformamide (120 ml) is added methanesulfonate tetrahydropyran-4-ylmethyl (10.7 g, 55 mmol) under ice cooling, the reaction mixture is stirred for 1 hour, then add tetrahydrofuran (200 ml) and the reaction mixture is additionally stirred for 18 hours. Then to the reaction mixture are added water (200 ml) and ethyl acetate (500 ml) and the aqueous layer was isolated and extracted with ethyl acetate, the m (300 ml). The combined organic extracts washed with water (300 ml, 3 times) and brine, dried over magnesium sulfate and evaporated under reduced pressure, obtaining 18 g specified in the title compound as yellow oil (yield ≥99%).

1H NMR (400 MHz, CDCl3) δ 1,33 (c, 9H), to 1.37 (d, J=7,6 Hz, 3H), 1,10-of 1.80 (m, 5H), 2,73 (kV, J=7,6 Hz, 2H), 3,30-of 3.42 (m, 3H), 3,57-a-3.84 (m, 1H), 3,90-was 4.02 (m, 2H), 6,70 (DD, J=6,8, 6,8 Hz, 1H), 7,10 (DD, J=7,1, 6,8 Hz, 1H), of 7.23 (d, J=7,1 Hz, 1H), with 8.33 (d, J=6,8 Hz, 1H).

Example obtain 3Y

The hydrochloride of N-(2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paradimethylamino

To a solution of tert-butyl N-(2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paramillitary (17.5 g, 50 mmol) in 1,2-dimethoxyethane (175 ml) is added 4n. a solution of a mixture of hydrochloric acid - ethyl acetate (175 ml) and the reaction mixture is stirred for 3 hours at 45°C. the Solvent is then evaporated under reduced pressure, to the residue add 1,2-dimethoxyethan (175 ml) and hexane (175 ml), the mixture is cooled on ice and the precipitate is collected by filtration, getting to 11.8 g specified in the title compound (yield 87%).

1H NMR (400 MHz, CDCl3) δ of 1.26 and 1.35 (m, 2H), 1,40 (t, J=8.0 Hz, 3H), of 1.88 (d, J=a 12.7 Hz, 2H), 2,12-of 2.20 (m, 1H), 3,03 (kV, J=8.0 Hz, 2H), of 3.10-3.20 (m, 4H), 3,81 (DD, J=11,5, 2.4 Hz, 2H), 6,80 (DD, J=6,8, 6,8 Hz, 1H), 7,18 (DD, J=9,0, 6,8 Hz, 1H), of 8.09 (d, J=9.0 Hz, 1H), 8,32 (d, J=6,8 Hz, 1H), 11,70 (users, 1H).

the example of obtaining 4Y

N-cyclopropylmethyl-N-(2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paradimethylamino

A mixture of the hydrochloride of N-(2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paradimethylamino (10.3 g, 35 mmol) and potassium carbonate (5.8 g) in ethyl acetate (150 ml) and water (30 ml) is stirred for 8 min at room temperature. The organic extract is allocated, then washed with saline, dried over magnesium sulfate and evaporated under reduced pressure, obtaining N-(2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-tetrahydro-2H-4-paradimethylamino (9,1 g). This compound is dissolved in tetrahydrofuran (180 ml), then add cyclopropanecarboxaldehyde (7,4 g, 106 mmol) and triacetoxyborohydride sodium (10.5 g, 49.7 mmol) and the reaction mixture is stirred for 10 minutes After completion of the reaction, to the reaction mixture are added ethyl acetate (400 ml) and water (200 ml) and the organic extract emit. After extracting the aqueous layer with ethyl acetate (200 ml) the organic extracts are combined and washed with water (100 ml) and brine (100 ml). The organic extract is dried over magnesium sulfate and evaporated under reduced pressure. The residue is purified by chromatographic processing on a column of silica gel (hexane:ethyl acetate = 6:1)to give 11.9 g specified in the title compound as yellow oil (≥99% yield)./p>

Example of getting 5Y

tert-Butyl N-cyclopropylmethyl-N-(2-ethylpyrazine[1,5-a]pyridine-3-yl)carbamate

To a solution of tert-butyl N-(2-ethylpyrazine[1,5-a]pyridine-3-yl)carbamate (4,93 g, 18.0 mmol) and tert-butoxide potassium (2,54 g, and 22.6 mmol) in N,N-dimethylformamide (49 ml) was added dropwise (methyl bromide)cyclopropane (2,02 ml of 20.8 mmol). The reaction mixture was stirred at room temperature for 15 min, then add ethyl acetate (50 ml), heptane (50 ml) and water (50 ml) and the organic layer isolated. The aqueous layer was then extracted with heptane (30 ml). The combined organic extracts washed with water (25 ml × 2 times) and 10% brine (10 ml). The organic extract is dried over magnesium sulfate and evaporated under reduced pressure, getting 6.5 g specified in the connection header (≥99% yield).

1H NMR (400 MHz, CDCl3) δ 0,00 to 0.19 (m, 2H), 0,30-0,50 (m, 2H), 0,95 (users, 1H), 1,20-1,60 (m, 9H), of 1.34 (t, J=7,6 Hz, 3H), 2,75 (kV, J=7,6 Hz, 2H), 3.25 to 3.40 in (m, 1H), 3,44-3,62 (m, 1H), 6,67 (t, J=6,8gts, 1H), 7,07 (t, J=7.2 Hz, 1H), 7,32 (d, J=8,8 Hz, 1H), 8,31 (d, J=7.2 Hz, 1H).

Example of getting 6Y

tert-Butyl N-(7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-cyclopropanecarbonyl

A solution of n-utility in hexane (1.6 M, 3,88 ml, 6,18 mmol) is added dropwise to a solution of tert-butyl N-cyclopropylmethyl-N-(2-ethylpyrazine[1,5-a]pyridine--yl)carbamate (1.5 g, 4.76 mmol) in tetrahydrofuran (15 ml) at -70°C. After stirring the reaction mixture for 50 min at the same temperature to the reaction mixture are added dropwise 1,2-dibromotetrafluoroethane (1.0 ml, of 8.33 mmol). The temperature of the reaction mixture is slowly increased and added an aqueous solution of sodium bicarbonate at 0°C. the Reaction mixture was extracted with ethyl acetate and the organic extract washed with brine, dried over magnesium sulfate and evaporated. The residue is purified by chromatographic processing on a column of silica gel (hexane:ethyl acetate = 8:1)to give 1.65 g specified in the title compound as yellow oil (yield of 87.8%).

1H NMR (400 MHz, CDCl3) δ 0,00-0,20 (m, 2H), 0,39 (m, 2H), 0,95 (m, 1H), 1,25-to 1.60 (m, 9H), of 1.35 (t, J=8.0 Hz, 3H), 2,56 (kV, J=8.0 Hz, 2H), 3,20-to 3.35 (m, 1H), 3,50-the 3.65 (m, 1H), 6,93? 7.04 baby mortality (m, 2H), 7,35 (DD, J=1.6,theand 8.4 Hz, 1H).

Example of getting 7Y

tert-Butyl N-cyclopropylmethyl-N-7-(2,6-dimethoxy-4-(methoxymethyl)phenyl)-2-ethylpyrazine[1,5-a]pyridine-3-ylcarbamate

After adding 1,2-dimethoxyethane (26,7 ml) and water (13.4 ml) to a mixture of tert-butyl N-(7-bromo-2-ethylpyrazine[1,5-a]pyridine-3-yl)-N-cyclopropanecarbonyl (422 mg, of 1.34 mmol), 2,6-dimethoxy-4-(methoxymethyl)phenylboric acid (399 mg, of 1.74 mmol), tetrakis(triphenylphosphine)palladium(0) (231 mg, 0.20 mmol) and octahydrate hydroxide barium (634 mg, 2.0 mmol who) mixture Tegaserod under reduced pressure at 0° With under stirring. The reaction mixture is heated to 90°and then stirred for 90 minutes After completion of the reaction, to the reaction mixture are added water and extracted with ethyl acetate. The organic extract was washed with brine, dried over magnesium sulfate and evaporated. The residue is purified by chromatographic processing on a column of silica gel (n-hexane:ethyl acetate = 4:1-2:1) and then suspended and purified heptane, getting 487 mg specified in the title compound (73% yield).

1H NMR (400 MHz, CDCl3) δ 0,10-0,22 (m, 2H), 0,35-0,50 (m, 2H)and 1.15 (m, 1H), 1,24 (t, J=7,6 Hz, 3H), 1,20 by 1.68 (m, 9H), 1,62 (c, 2H), 2,70 (kV, J=7,6 Hz, 2H), 3,49 (c, 3H), 3,68-of 3.78 (m, 6H), 4.53-in (c, 2H), 6,64-of 6.73 (m, 3H), 7,11 (t, J=8.0 Hz, 1H), 7,31 (d, J=8,8 Hz, 1H).

Example of getting 8Y

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-ylamine

A mixture of tert-butyl N-cyclopropylmethyl-N-7-(2,6-dimethoxy-4-(methoxymethyl)phenyl)-2-ethylpyrazine[1,5-a]pyridine-3-ylcarbamate (20 mg, 0.04 mmol) in triperoxonane acid (1.0 ml) is stirred for 30 min at room temperature. To the reaction mixture add 5N. an aqueous solution of sodium hydroxide for neutralization, and then extracted with ethyl acetate. The organic extract was washed with aqueous sodium bicarbonate solution and brine in that order and dried over Sul is an atom of magnesium. It is evaporated under reduced pressure, obtaining 13 mg specified in the title compound (81% yield).

1H NMR (400 MHz, CDCl3) δ 0,18 (kV, J=4.4 Hz, 2H), 0,45-0,55 (m, 2H), 1,10-1,30 (m, 1H), 1,23 (t, J=7.2 Hz, 3H), 2,10 (users, 1H), 2,75 (kV, J=7.2 Hz, 2H), 2,89 (d, J=6,8 Hz, 2H), 3,47 (c, 3H), 3,70 (c, 6H), 4,51 (c, 2H), 6,54 (DD, J=0,8, 6,8 Hz, 1H), 6,66 (c, 2H), 7,00 (DD, J=6,8, and 9.2 Hz, 1H), 7,40 (DD, J=0,8, and 8.4 Hz, 1H).

Example of getting 9Y

7-bromo-2-ethylpyrazine[1,5-a]pyridine

A solution of 2-ethylpyrazine[1,5-a]pyridine (5.0 g, 34,2 mmol) in tetrahydrofuran (50 ml) is cooled to a temperature below -70°in a stream of nitrogen and then added dropwise a solution of n-utility in hexane (32,5 ml, 1,58 M solution, 51,4 mmol) at a temperature below -60°C. After stirring for 1 hour the reaction mixture is added dropwise bromopentafluorobenzene (9.3 g, of 37.7 mmol) at a temperature below -60°C. the Reaction mixture is stirred for 2 hour at a temperature below -70°Since, then, to the reaction mixture are added water (50 ml) and the temperature was raised to room temperature. To this add ethyl acetate (50 ml) and water (50 ml) and extracted with ethyl acetate. The organic extract is washed twice with 5% brine (50 ml) and dried over anhydrous magnesium sulfate and then the solvent is evaporated under reduced pressure, getting 6,9 g specified in the connection header.

Example of getting 10Y

p> 7-bromo-2-ethyl-3-nitropyrazole[1,5-a]pyridine

Fuming nitric acid (1.7 ml) is added dropwise to a solution of 7-bromo-2-ethylpyrazine[1,5-a]pyridine (6.9 g, 34,2 mmol) in concentrated sulfuric acid (13,8 ml) at the temperature of the reaction mixture below 30°With cooling with ice. After stirring the reaction mixture for 30 min it is added to ice water (138 ml) and precipitated precipitate is filtered off. To the resulting precipitate add ethyl acetate (226 ml) and methanol (38 ml), the mixture is heated to 70°and then the precipitate is collected by filtration under ice cooling. The solvent from the resulting filtrate is evaporated under reduced pressure and the concentrated residue is recrystallized from a mixture of heptane-ethyl acetate (1:1)to give 2.4 g specified in the connection header in the form of crystals light brown (31% yield).

Example of getting 11Y

7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethyl-3-nitropyrazole[1,5-a]pyridine

A mixture of 7-bromo-2-ethyl-3-nitropyrazole[1,5-a]pyridine (3.0 g, 11.1 mmol), 2,6-dimethoxy-4-(methoxymethyl)phenylboric acid (5.0 g, of 22.2 mmol), palladium acetate (125 mg, 0.55 mmol), triphenylphosphine (578 mg, 2.22 mmol), hydrate tribalista (5.3g, of 22.2 mmol) and 1,2-dimethoxyethane (30 ml) heated to boiling under reflux for 14 h the C in nitrogen atmosphere. The reaction mixture is cooled to room temperature, add ethyl acetate (100 ml) and water (50 ml) and the organic layer isolated. The organic extract is then washed with 10% brine (50 ml), 1N. hydrochloric acid (50 ml) and 10% aqueous ammonia (50 ml) in that order. The organic extract is dried over anhydrous magnesium sulfate and the solvent is evaporated under reduced pressure. The concentrated residue is purified by chromatographic processing on a column of silica gel, receiving of 3.45 g specified in the title compound (84% yield).

1H NMR (400 MHz, CDCl3) δ 1,25 (t, J=7.4 Hz, 3H), 3.15 in (kV, J=7,4 Hz, 2H), 3,50 (c, 3H), 3,78 (c, 6H), 4,57 (c, 2H), 6,65 (c, 2H), 7,05 (DD, J=7,0, 1.0 Hz, 1H), 7,66 (DD, J=9,0, 7,0 Hz, 1H), at 8.36 (DD, J=9,0, 1.0 Hz, 1H).

Example of getting 12Y

7-[2,6-Dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-amine

A mixture of 7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethyl-3-nitropyrazole[1,5-a]pyridine (850 mg, 2.3 mmol), 10% palladium-on-coal (50%by weight, 330 mg) and methanol (19 ml) is stirred for 13 hours at 50°C in an atmosphere of hydrogen at atmospheric pressure. After cooling the reaction mixture to room temperature, the reaction mixture was filtered through celite to remove the catalyst. The solvent from the resulting filtrate is evaporated under reduced pressure, obtaining of 3.45 g u is asanoha the title compound (84% yield).

1H NMR (400 MHz, CDCl3) δ to 1.24 (t, J=7.4 Hz, 3H), 1,46 is 1.96 (users,2H), was 2.76 (q, J=7,4 Hz, 2H), 3,48 (c, 3H), 3,70 (c, 6H), to 4.52 (c, 2H), of 6.52 (d, J=6.3 Hz, 1H), 6,66 (c, 2H), 6,99 (DD, J=8,6, and 6.3 Hz, 1H), 7,32 (d, J=8.6 Hz, 1H).

Example of getting 13Y

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-ylamine

A mixture of 7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-amine (400 mg, at 1.17 mmol), cyclopropanecarboxaldehyde (0,122 ml of 1.64 mmol) and tetrahydrofuran (2 ml) is heated for 1 hour at 50°C. Then the reaction mixture is added dropwise to ice diisobutylaluminium (1M toluene solution, 3,51 ml, 3,51 mmol). The reaction mixture was stirred for 20 min, then the reaction mixture is added 1N. hydrochloric acid (2 ml) and ethyl acetate (20 ml) and extracted with ethyl acetate. The organic extract is washed twice with water (10 ml) and dried over anhydrous magnesium sulfate and then the solvent is evaporated under reduced pressure. The concentrated residue is recrystallized from a mixture of heptane:ethyl acetate (10:1)to give 290 mg specified in the title compound as white crystals (63% yield).

1H NMR (400 MHz, CDCl3) δ 0,18 (kV, J=4.4 Hz, 2H), 0,45-0,55 (m, 2H), 1,10-1,30 (m, 1H), 1,23 (t, J=7.2 Hz, 3H), 2,10 (users, 1H), 2,75 (kV, J=7.2 Hz, 2H), 2,89 (d, J=6,8 Hz, 2H), 3,47 (c, 3H),3,70 (c, 6H), 4,51 (c, 2H), is 6.54 (DD, J=6,8, 0.8 Hz, 1H), 6,66 (c, 2H), 7,00 (DD, J=9,2, 6,8 Hz, 1H), 7,40 (DD, J=8,4, 0.8 Hz, 1H).

Example 1X

Toilet N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

A mixture of N-cyclopropylmethyl-N-(2-ethyl-7-iterator[1,5-a]pyridine-3-yl)-N-(tetrahydro-2H-4-pyranometer)americanled (193 g, 405 mmol), 2,6-dimethoxy-4-(methoxymethyl)phenylboric acid (143 g, 105 mmol, 1.56 equivalents), palladium acetate (4.7 g, 21 mmol, 5 mol%), triphenylphosphine (27,6 g, 105 mmol, 26 mol.%), potassium carbonate (203 g of 1.47 mmol, 3.63 equivalent), 1,2-dimethoxyethane (6667 ml) and water (3333 ml) is heated in a flask at 100°With oil bath through the reaction system bubbled nitrogen gas. Approximately 6 hours after the beginning of the boil under reflux, the reaction mixture was cooled to room temperature.

Then added to the mixture of toluene (2000 ml) and the separated aqueous layer was removed. Toluene layer is extracted twice 5h. hydrochloric acid (first time: 3000 ml, for the second time: 1000 ml). To the aqueous layer add isopropylacetate (2000 ml), while cooling in a bath with ice add 5N. an aqueous solution of sodium hydroxide (4200 ml) to bring the pH to 14 and allocate isopropylacetate layer. Isopropylacetate layer is then washed with 10% aqueous solution of the ethyl the diamine (2000 ml, 3 times) and water (2000 ml, 2 times), after concentration of added ethanol (400 ml) for azeotropic distillation and the reaction mixture is concentrated, getting 207 g solid green color.

The residue is dissolved in ethanol (1720 ml) when heated, is added dropwise a solution of the monohydrate p-toluensulfonate acid (65,5 g, 344 mmol) in ethanol (170 ml) for 3 min at the temperature of the reaction mixture to 60°C. After providing a mixture of opportunities to cool with stirring, add the seed crystals (100 mg)when the internal temperature reaches 35°C. After 30 min the mixture is cooled in a temperature-controlled bath at 7°C and stirred for 15 hours and 45 minutes Fell into the sediment the crystals are then filtered off and washed with isopropanol (400 ml). The crystals are dried under reduced pressure at 60°C for 3.5 hours, receiving 214 g specified in the title compound as white crystals (79.5% of the output).

Example 2

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

A mixture of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-ylamine (20 mg, 0.05 mmol), sodium iodide (75 mg, 0.50 mmol), tetrahydro-2H-4-paradimethylaminobenzaldehyde (49 mg, 0.25 mmol) and carbonate soda which I (10 mg), dissolved in dimethylformamide (0.5 ml) is stirred for 90 min at room temperature. Then to the reaction mixture are added water and ethyl acetate and extracted with ethyl acetate. The organic extract is dried over magnesium sulfate and then evaporated. The residue is purified using a chromatographic column filled with silica gel, receiving 21 mg specified in the title compound (84% yield).

Example 3

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylaminobenzaldehyde

To a solution of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino (2.2 g) in ethyl acetate (30 ml) is added a mixture of 4h. hydrochloric acid - ethyl acetate (1,17 ml) at room temperature, the reaction mixture was stirred under cooling with ice and the precipitate is collected by filtration, obtaining the crude product indicated in the title compound (2.2 g) as white powder.

The resulting crude product (2.2 g) is recrystallized from a mixed solvent consisting of tert-butyl methyl ether (500 ml) and ethyl acetate (700 ml), getting mentioned in the title compound (1.5 g).

1H NMR (400 MHz, DMSO-d6at 100° δ -0,04 one-0.10 (m, 2H), between 0.30 to 0.38 (m, 2H), of 0.77-0.87 (m, 1H), 1,14-1,25 (m, 5H, 1,55-1,70 (m, 3H), 2,73 (kV, J=8 Hz, 2H), 2,99 (users, 2H), 3,14 (users,2H), 3,21 (userid, J=11, 11, 1 Hz, 2H), 3,41 (c, 3H), 3,64 (c, 6H), 3,80 (DDD, J=11, 6, 4 Hz, 2H), 4,50 (c, 2H), 6,59 (userd, J=7 Hz, 1H), 6,74 (c, 2H), 7,11 (ushort, J=1 Hz, 1H), to 7.59 (users,1H).

Example 4

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

To a solution of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino (2,01 g) in 2-propanol (50 ml) is added 3 M sulfuric acid (0.68 ml) under ice cooling and the reaction mixture is stirred. Then the reaction mixture is evaporated under reduced pressure to give crude product specified in the connection header.

The resulting crude product is recrystallized from a mixed solvent consisting of 2-propanol (40 ml) and ethanol (20 ml), getting mentioned in the title compound (1.04 g).

1H NMR (400 MHz, DMSO-d6at 100° δ -0,02 of 0.07 (m, 2H), 0,32 is 0.38 (m, 2H), 0.75 to 0.87 (m, 1H), 1,14-1,25 (m, 5H), 1,55-1,70 (m, 3H), 2,70 (kV, J=8 Hz, 2H), 2,97 (users, 2H), 3,12 (users,2H), 3,22 (userid, J=11, 11, 2 Hz, 2H), 3,41 (c, 3H), 3,64 (c, 6H), 3,80 (userd, J=11 Hz, 2H), 4,50 (c, 2H), 6,58 (userd, J=7 Hz, 1H), 6,74 (c, 2H), 7,10 (userid, J=8, 7 Hz, 1H), 7,54 (userd, J=8 Hz, 1H).

Example 5X

Methanesulfonate N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)Fe is Il]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

To a solution of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino (1.78 g) in ethyl acetate (40 ml) add methansulfonate acid (234 μl), the reaction mixture was stirred at room temperature and evaporated under reduced pressure. The obtained residue was washed with a mixed solvent consisting of a mixture of n-hexane:ethyl acetate (10:1)to give the crude product indicated in the title compound (2.1 g).

The resulting crude product (2.1 g) is recrystallized from a mixed solvent consisting of tert-butyl methyl ether (400 ml) and ethyl acetate (150 ml), getting mentioned in the title compound (1.6 g).

1H NMR (400 MHz, DMSO-d6at 100° δ -0,03 of 0.07 (m, 2H), 0,32-0,40 (m, 2H), 0.75 to 0.87 (m, 1H), 1,12-1,25 (m, 5H), 1,53 is 1.70 (m, 3H), 2,41 (c, 3H), 2,70 (kV, J=8 Hz, 2H), 2,97 (users,2H), 3,11 (users, 2H), 3,22 (userid, J=11, 11, 1 Hz, 2H), 3,41 (c, 3H), 3,64 (c, 6H), 3,80 (userd, J=11 Hz, 2H), 4,50 (c, 2H), 6,57 (userd, J=6 Hz, 1H), 6,74 (c, 2H), 7,09 (userid, J=7, 6 Hz, 1H), 7,53 (userd, J=7 Hz, 1H).

Example 6

Toilet N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

To a solution of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2 is-4-paradimethylamino (1.6 g) in ethyl acetate (25 ml) add monohydrate p-toluensulfonate acid (617 mg) and the reaction mixture was stirred at room temperature. The precipitate is filtered off, give crude product specified in the connection header (2,18 g).

The resulting crude product (2,18 g) is recrystallized from a mixed solvent consisting of tert-butyl methyl ether (640 ml) and ethyl acetate (770 ml), getting mentioned in the title compound (1.9 g).

1H NMR (400 MHz, DMSO-d6at 100° δ -0,03 of 0.07 (m, 2H), 0,32-0,40 (m, 2H), 0.75 to 0.87 (m, 1H), 1,12-1,25 (m, 5H), 1,53 is 1.70 (m, 3H), 2,29 (c, 3H), 2,70 (kV, J=8 Hz, 2H), 2,97 (users,2H), 3,11 (users, 2H), 3,22 (userid, J=11, 11 Hz, 2H), 3,41 (c, 3H), 3,64 (c, 6H), 3,80 (userd, J=11 Hz, 2H), 4,50 (c, 2H), 6,58 (userd, J=6 Hz, 1H), 6,74 (c, 2H), 7,06-7,14 (m, 3H), 7,49-7,58 (m, 3H).

Example 7

Toilet N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

To a solution of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino (500 mg) in ethanol (5 ml) add a solution of the monohydrate p-toluensulfonate acid (172 mg) in ethanol (1 ml), heating up to boiling under reflux, and the reaction mixture is stirred, letting it cool to room temperature. After further cooling the reaction mixture to a temperature of -20°skipped precipitated crystals are filtered off, getting mentioned in the title compound (629 mg).

Note the R 8X

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylaminobenzaldehyde

After addition of 48% aqueous Hydrobromic acid (0,69 ml) to a solution of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino (2.0 g) in ethyl acetate (20 ml) the reaction mixture is intensively stirred at room temperature. The precipitate is filtered off, give crude product specified in the connection header (2,34 g).

The resulting crude product (2,34 g) is recrystallized from ethanol (60 ml), getting mentioned in the title compound (2.14 g).

1H NMR (400 MHz, DMSO-d6at 100° δ -0,03 of 0.07 (m, 2H), 0,30-0,40 (m, 2H), 0.75 to 0.87 (m, 1H), 1,14-1,24 (m, 5H), 1,55-1,70 (m, 3H), 2,71 (kV, J=8 Hz, 2H), 2,98 (users, 2H), 3,13 (users, 2H), 3,21 (userid, J=11, 11, 1 Hz, 2H), 3,41 (c, 3H), 3,64 (c, 6H), 3,80 (userd, J=11 Hz, 2H), 4,50 (c, 2H), 6,59 (userd, J=6 Hz, 1H), 6,74 (c, 2H), 7,10 (users, 1H), 7,56 (users, 1H).

Example 9ץ

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylaminobenzaldehyde

To a solution of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-pyranometer the ina (320 mg) in ethyl acetate (10 ml) add monohydrate benzosulfimide acid (108 mg) and the reaction mixture was stirred at room temperature. The precipitate is filtered off, give crude product indicated in the title compound (330 mg).

The resulting crude product (330 mg) is recrystallized from a mixed solvent consisting of tert-butyl methyl ether (70 ml) and ethyl acetate (80 ml), getting mentioned in the title compound (106 mg).

1H NMR (400 MHz, DMSO-d6at 100° δ -0,03 of 0.07 (m, 2H), 0,30-0,40 (m, 2H), 0.75 to 0.87 (m, 1H), 1,14-1,25 (m, 5H), 1,55-1,70 (m, 3H), 2,70 (kV, J=8 Hz, 2H), 2,97 (users, 2H), 3,12 (users, 2H), 3,22 (userid, J=11, 11 Hz, 2H), 3,41 (c, 3H), 3,64 (c, 6H), 3,80 (userd, J=11 Hz, 2H), 4,50 (c, 2H), 6,57 (userd, J=8 Hz, 1H), 6,74 (c, 2H), 7,10 (userid, J=8, 8 Hz, 1H), 7.23 percent-to 7.32 (m, 3H), 7,54 (userd, J=8 Hz, 1H), to 7.64 (DD, J=8, 2 Hz, 2H).

Example 10

Econsultant N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

To a solution of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino (350 mg) in a mixture of ethyl acetate (5 ml) and tert-butyl methyl ether (5 ml) is added econsultancy acid (83 mg) and the reaction mixture was stirred at room temperature. The precipitate is filtered off, give crude product indicated in the title compound (355 mg).

The resulting crude product (355 mg) is recrystallized from mixed solvent, SOS is Vashego of tert-butyl methyl ether (40 ml) and ethyl acetate (40 ml), getting listed in the title compound (250 mg).

1H NMR (400 MHz, DMSO-d6at 100° δ -0,03 of 0.07 (m, 2H), 0,30-0,40 (m, 2H), 0.75 to 0.87 (m, 1H), 1,10-1,25 (m, 8H), 1,55-1,70 (m, 3H), 2,52 (kV, J=7 Hz, 2H), 2,70 (kV, J=8 Hz, 2H), 2.95 and (users, 2H), 3,11 (users, 2H), 3,22 (userid, J=12, 12 Hz, 2H), 3,41 (c, 3H), 3,64 (c, 6H), 3,80 (userd, J=12 Hz, 2H), 4,50 (c, 2H), 6,57 (userd, J=7 Hz, 1H), 6,74 (c, 2H), 7,09 (userid, J=8, 7 Hz, 1H), 7,53 (userd, J=8 Hz, 1H).

[Examples retrieve]

The following are examples of pharmaceutical compositions comprising compounds of the present invention.

The method of obtaining songs

After mixing the compounds of the present invention, (tosilata N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino), mannitol, crosspovidone and hydroxypropylcellulose use an appropriate amount of purified water to the implementation of wet granulation. The granulated product is dried and then fractionary in size. Crosspovidone and magnesium stearate is added to the granules prior to mixing and tableting. Received the tablets covered with a film using an aqueous solution of a coating agent (a mixture of hydroxypropylmethylcellulose, talc, Macrogol 6000, titanium oxide and a half of iron oxide). The used amount of material to obtain the tablets are presented in table 1.

Table 1< / br>
Examples: the Number of materials per 1 tablet

(mg)
MaterialPurposeTablet 0.5 mgTablet 5 mgTablet 25 mg
The compound of the present invention *1Main ingredient0,6756,7533,75
MannitolExcipient170,925164,85137,85
CrosspovidoneBaking powder101010
HydroxypropylcelluloseBinder666
Purified waterSolventq.s.q.s.q.s.
Only-187,6187,6187,6
CrosspovidoneBaking powder101010
Magnesium stearateLubricating agent2,42,42,4
Only-200200200
Top agent *2Covering agent 888
Purified waterSolventq.s.q.s.q.s.
Only-208208208
*1: Toilet N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino.

*2: a Mixture of hydroxypropylmethylcellulose, talc, Macrogol 600, titanium oxide and a half of iron oxide.

[Test cases]

Evaluation of binding activity of the receptor corticotropin-releasing hormone (CRFR), inhibiting the production of camp, sedative effects and the ability to induce metabolizing enzyme compounds of the present invention. Test methods and results are presented next.

Test example 1

<Experiment CRFR binding>

(1) Obtaining CRFR1-expressing cells:

As the material for the experiment on CRFR binding using the membrane fraction of human cells, intensely expressing CRFR1. CRFR-expressing cells prepared as follows. Full length CRFR1 gene obtained by PCR using the cDNA library of the human brain (QuickCloneTMClontech). The resulting DNA fragment inserted into the vector klonirovana and are ligated nucleotide sequence. cDNA containing the nucleotide sequence, again associated with the expression vector (pcDNA.3.1TM, Invitrogen). CRFR1 the expression vector is introduced into NECK cell and resistant cells, which proliferate in culture medium containing G418 (1 mg/ml), clone by the method of limiting dilutions. In addition to the cloned cells select cells with high binding ability between the membrane fraction per unit of protein and membrane in accordance with the following experiment on binding, and the selected cells used in the experiments.

(2) Obtain the membrane fraction:

Cloned cells obtained in (1), collected and suspended in cold membrane buffer (50 mm Tris-HCl, 5 mm MgCl2, 2 mm EGTA, 1 mm DTT and a cocktail of protease inhibitor (COMPLETETMRoche Diagnostics), pH 7.4) and after cell disruption using a transmitter station (KINEMATICA) (level 5, 10 seconds, 4 times, while cooling with ice) cells centrifuged (13000 rpm (18000g), 30 min, 4° (C) for the deposition of cell membranes. Dropped into the sediment cell membranes suspended in membrane buffer and destroy using a transmitter station (level 4, 20-30 seconds while cooling with ice) for the preparation of a dispersed suspension. Quantify the protein content in the dispersion of the suspension and the suspension is diluted with membrane buffer containing 0.1% BSA to a concentration of protein 200 mgml, for use as a cell membrane fraction.

(3) Experiment bind:

The experiment on the binding of CRF carried out by way SPATM(Amersham Pharmacia), using a 96-well plate. The experiment is carried out in accordance with the instructions to SPA beads. Leave to stand at room temperature for 2 hours or more 5 μg protein in the cell membrane fraction, 1 mg SPA beads and 100 PM125I-CRF (Perkin Elmer) in the presence of test compounds, and then centrifuged (1200 rpm (260g), 5 min, at room temperature, then measure the radioactivity in each well using a TopCountTM(Packard).

(4) Calculation of funds bind

The amount of radioactivity with the addition of 2000-fold excess of nonradioactive shell as nonspecific binding is subtracted from each value and each value is presented as a percentage (% of control), where 100% is defined as the radioactivity without the addition of test compounds (control). The concentration showing 50% (% of control), determine from the graph constructed for the concentration of the test compounds on the horizontal axis and percent (% of control) on the vertical axis as values.

Test example 2

<Experiment on inhibition of the production of camp using AtT-20 cells>

(1) Test procedure:

Cell AtT-20 are a cell line derived from a tumor of the pituitary gland of the mouse, which is known to respond to corticotropin-releasing hormone (CRF) for the camp through activation of intracellular adenylyl cyclase system and to release adrenocorticotropin hormone (ACTH) (Biochem. Biophys. Res. Com., 106, 1364-1371, 1982). In this experiment, AtT-20 cells (1×105) suspended in D-MEM with 0.1% FBS) and seeded in 96-well plate, then add 1 mm (final concentration) of a phosphodiesterase inhibitor (IBMX, Calbiochem) prior to incubation for 30 min at 37°C. Then add a diluted solution of the test compound to incubation for 30 min at 37°and CRF (final concentration: 30 nm) is added to the next incubation for 30 min at 37°C. Cells are harvested by centrifugation (1800 rpm (630g) 5 min), then perform the lysis using litany buffer (0.2% dodecyltrimethylammonium) and the intracellular production of camp assess using HTRF method. camp HTRF kit (Nihon Schering) is used for the analysis of camp.

(2) calculation of the inhibitory activity of camp production:

The results obtained are treated in the following way.

camp production for each sample is presented as a percentage (% of control), and cells with the addition of CRF (final concentration: 30 nm) prinimayutsa 100% (control). The concentration showing 50% (% of control), determine from the graph constructed for the test compounds on the horizontal axis and percent (% of control) on the vertical axis, as the value of the IC50.

<test Results>

In test example 1, all of the compounds of the present invention (examples 1-9, 11-14, 18, 20-27, 29, 31-34, 37, 38, 40, 43, 44, 46-51, 53-60) demonstrate excellent activity binding in respect of CRFR1. In test example 2, all the compounds of the present invention (examples 1-9, 11-14, 18, 20-24, 26, 27, 29, 32-34, 37, 38, 40, 43, 44, 46-51, 53-60) demonstrate excellent effects of inhibition of CRF-induced camp production. Some of the results presented in table 2.

Table 2
Connection # < / br>
(Example#)
Activity binding CRF1 receptor IC50(nm)Activity production of camp< / br>
IC50(nm)
Example 1714
Example 3495,1
Example 139011
Example 23506
Example 475050
Example 59523,5
Example 60303,5

Test example 3

Evaluation of sedative action on mice in the light/dark chamber

(1) Test procedure:

Test on mice, placed in a light/dark chamber, is carried out according to the modified method Belzung C., Misslin R, Vogel E. et al. (reference; Behavioural effects of the benzodiazepine receptor partial agonist RO16-6028 in mice, Psychopharmacology, 97, 388-391, 1989). As a test device using the light/dark chamber, includes covered with black acrylic chamber (dark chamber; 15×10×20 cm), UN-shaded white acrylic chamber (light Luggage; 15×20×20 cm) and black acrylic tunnel (10×7×4.5 cm), which connects a dark cell with a light camera and allows the mouse to move freely back and forth between the dark camera and light camera. However, in this device for the study of transparent acrylic polymer used for the front wall (20×20 cm) and rear wall (20×20 cm) light camera that provides the possibility to observe the behavior. After installing lighting on the floor light camera to light 150 Lux 5-week-old male mice of the strain Balb/C (purchased from Nihon Charles River) placed in a dark chamber at the beginning of the experiment. For this test, the test compound suspended in 0.5% aqueous solution of methylcellulose and administered orally to subjects the animals one hour prior to the start of the test.

(2) calculation of the sedative effect:

The behavior of mice observed within 5 minutes after the start of the experiment. The time spent in the light chamber is measured as an indicator of sedation, and "stay in the light" is defined as a condition in which the legs of the mice are on the floor light camera. The minimum dose, which significantly lengthens the time spent in the light compared with a group of animals who were injected carrier, defined as the minimum effective dose (MED). Statistical significance between the group which introduced the media, and the group that was administered the test compound analyzed using multiple comparison by type Donetta after one-way analysis of variance, when one experiences use a variety of doses, and using U test Mann-Whitney in those cases, when using only one dose.

<test Results>

N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino demonstrates an excellent effect on the basis of the evaluation of the sedative in the test on mice in the light/dark chamber, and the amount of MED is 10 mg/kg

Test example 4

Evaluation of indutsiruemoi drug metabolizing enzyme (CYP3A4) using kriokhraneniya human hepatocytes.

(1) Test procedure:

Kriokhraneniya hepatocytes (In Vitro Techology) quickly thawed under stirring at 37°and then to the cells slowly add chilled on ice environment William's Medium E with 10% FBS, +PSG) before centrifugation at 500 rpm for 5 minutes. After removal of the supernatant liquid obtained hepatocytes diluted with chilled on ice environment William's Medium E to a concentration of 5×105cells/ml, plated in 48-hole covered with collagen tablets (BD Biosciences) in an amount of 1×105cells/cm3and incubated for approximately 24 hours at 37°C in an atmosphere of 5% CO2,then the medium is replaced by Hepato-STIMTM(BD Biosciences) (+EGF, PSG, -FBS) and culture support for 24 hours under conditions of 37°C, 5% CO2. Approximately 48 hours after seeding cells add a test compound or rifampicin (SIGMA, positive control) in the form of a dilute solution (using Hepato-STIMTM(+EGF, PSG, -FBS)), hepatocytes incubated for about 24 hours under conditions of 37°C, 5% CO2and the culture medium replaced by medium containing freshly prepared dilution of the test compounds or rifampicin before further incubation for 24 hours under the same conditions. After incubation the cells are washed once with PBS and total RNA extracted using the kit Qiagen RNeasy Mini kit (Qiagen). cDNA is synthesized using reverse transcription extrage vannoy RNA, using reagents TaqMan Reverse reduced Reagents (Applied Biosystems). The reaction of reverse transcription carried out using oligo dT as a primer to the processing at 25°C for 10 min, after which use the treatment at 48°C for 60 min, after which inactivate reverse transcriptase treatment at 95°C for 10 min. cDNA Obtained is introduced into PCR using the Gene Amp PCR system 9700. The obtained cDNA quantify, using a set of reagents SYBR Green PCR Core Reagents kit (Applied Biosystems), and the content of human CYP3A4 and GAPDH mRNA quantitatively determined using AV (Applied Biosystems). Primernye sequence and used in PCR are presented in tables 3 and 4. Used in test example abbreviations are explained below.

FBS: Fetal calf serum

PSG: penicillin (100 U/ml, streptomycin (100 μg/ml), glutamine (2 mm)

EGF: Epidermal growth factor

GAPDH: glyceraldehyde-3-phosphatedehydrogenase

Table 3< / br>
Primernye sequence
IsocamGenBank#PrimerNameSequence
CYP3A4NM017460FHCYP3A4_F3TAGCTGAGGATGAAGAATGG
RHCYP3A4 R3GTGGATTGTTGAGAGAGTCG
GAPDHM_33197FhGAPDH_FGAAGGTGAAGGTCGGAGTC
RhGAPDH RGAAGATGGTGATGGGATTTC

Table 4< / br>
Conditions for PCR
TemperatureTime
9510 min
9415 secDenaturation
5615 secAnnealing
7230 secExtension
40 cycles

(2) Calculation of indutsiruemoi CYP3A4:

The results obtained were processed as follows. Calculate the magnitude of the amount of CYP3A4 mRNA obtained in PCR, divided by the amount of GAPDH mRNA ratio ("ratio") of the value obtained by adding the test compound relative to the value for the negative control (0.1% DMSO), and the ratio of the magnitude for a positive control (10 μm rifampicin) in relation to the value for the negative control, expect both. Then to compare each cycle of the test difference between the value of the number CYP3A4 MRR is, divided by the amount of GAPDH mRNA with the addition of test compounds at various concentrations and with the addition of negative control, calculated as a percentage, with 100% take the dierence between the number of CYP3A4 mRNA divided by the amount of GAPDH mRNA for positive control and negative control to determine indutsiruemoi for each test compound.

<test Results>

In test example 4, the compounds of the present invention (examples 1, 3, 59) were evaluated in relation to induce drug metabolizing enzyme using kriokhraneniya of human hepatocytes for the evaluation of CYP induction in the liver to predict drug interactions what are the side effects for taking their people as drugs. Test results for concentrations of 1 μm exhibit poor indutsiruemoi, not exceeding 40%, where the value of "multiplicity" for positive control was defined as 100%. Some of the obtained test results obtained using the test compounds shown in table 5.

Table 5
Test concentration< / br>
Examples
% of positive control
0.03 µm 0.1 ám0,3 ám1 mcm3 mcm10 mcm
Example 592311254959
Example 16712203665
Example 3337252334
Rifampicin

(positive control)
-----100

In addition to the above test example 4 were also used various other tests to assess indutsiruemoi drug metabolizing enzyme, and it was confirmed that the compounds of the present invention have low inducing ability in relation to these various drug metabolizing enzymes.

Industrial applicability

The present invention is to provide new pharmaceutical compositions containing the new compounds pyrazolo[1,5-a]pyridine with antagonism against CRF receptors, and their salts or hydrates of the foregoing. The compound of the present invention, its salts or hydrates of the above have excellent the m antagonism against CRF receptors, especially in relation to CRF1 receptors, they have low toxicity, and safety of their high, so high their benefits when used as a drug. Compounds of the present invention, and containing pharmaceutical compositions can be used for treatment or prevention of diseases associated with CRF and/or CRF receptor, particularly for the treatment or prevention of depression, depressive symptoms (depression, episodic depression, recurrent depression, depression caused by bad attitudes towards children, post-traumatic depression and so on), mania, anxiety, States General anxiety disorders by type of panic, phobias, obsessive-compulsive disorders, disorders associated with post-traumatic stress syndrome Tourette, autism, affective disorders, mental depression, manic-depressive psychosis, cyclothymic personality, schizophrenia, peptic ulcer, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative ileus, stress-related disorders of the gastrointestinal tract, nervous vomiting, or the like.

1. N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-pyranyl is tillin or its salt.

2. The salt of the compound according to claim 1, where the salt is an inorganic salt of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino.

3. Salt according to claim 2, where the inorganic salt is a salt chloroethanol acid, pomodorini acid or sulphuric acid.

4. The salt of the compound according to claim 1, where the salt is an N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino hydrochloride.

5. The salt of the compound according to claim 1, where the salt is an N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino hydrobromide.

6. The salt of the compound according to claim 1, where the salt is a sulfate N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino.

7. The salt of the compound according to claim 1, where the salt is an organic salt of N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino.

8. Salt according to claim 7, where the organic acid is a sulfonic acid.

9. Salt according to claim 7, where the organic acid is benzosulfimide, econsultation, methanesulphonate or p-toluensulfonate.

10. Sol the compound according to claim 1, where salt is an N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino bansilalpet.

11. The salt of the compound according to claim 1, where the salt is an N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino econsultant.

12. The salt of the compound according to claim 1, where the salt is an N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino methanesulfonate.

13. N-cyclopropylmethyl-N-7-[2,6-dimethoxy-4-(methoxymethyl)phenyl]-2-ethylpyrazine[1,5-a]pyridine-3-yl-N-tetrahydro-2H-4-paradimethylamino

p-toluensulfonate.

14. Receptor antagonist of the corticotropin-releasing factor (CRF), including a connection according to claim 1 or its salt.

15. Receptor antagonist of the corticotropin-releasing factor (CRF) 14, which represents a receptor antagonist of the corticotropin-releasing factor (CRF)1.

16. Receptor antagonist of the corticotropin-releasing factor (CRF) 14, where the antagonist is a therapeutic or prophylactic agent for depression, depressive symptom, mania, anxiety, fears, violations by type panic, phobias, obsessive-compulsive disorders, disorders related to the post traumatic stress disorder, syndrome Tourette, autism, affective disorders, mental depression, manic-depressive psychosis, cyclothymic personality or schizophrenia, comprising the compound according to claim 1 or its salt.

17. Receptor antagonist of the corticotropin-releasing factor (CRF) 14, where the antagonist is a therapeutic or preventive agent for the treatment of peptic ulcers, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative ileus, stress-induced gastro-intestinal disorders or nervous vomiting, comprising the compound according to claim 1 or its salt.

18. A method of treating or preventing depression, depressive symptom, mania, anxiety, fears, panic, phobias, obsessive-compulsive disorders, disorders associated with post-traumatic stress syndrome Tourette, autism, affective disorders, mental depression, manic-depressive psychosis, cyclothymic personality or schizophrenia, comprising introducing the compound according to claim 1 or its salt.

19. The method of treatment or prophylaxis of peptic ulcer, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative ileus, stress-related disorders of the gastrointestinal tract or nervous vomiting, include the rd introducing the compound according to claim 1 or its salt.

20. The use of compounds according to claim 1 or its salt to obtain a therapeutic or prophylactic agent for depression, depressive symptom, mania, anxiety, fears, panic, phobias, obsessive-compulsive disorders, disorders associated with post-traumatic stress syndrome Tourette, autism, affective disorders, mental depression, manic-depressive psychosis, cyclothymic personality or schizophrenia.

21. The use of compounds according to claim 1 or its salt to obtain a therapeutic or prophylactic agent for the treatment of peptic ulcers, irritable bowel syndrome, ulcerative colitis, Crohn's disease, diarrhea, constipation, postoperative ileus, stress-related disorders of the gastrointestinal tract or nervous vomiting.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: invention pertains to new derivatives of indole with general formula 1: where R is unsubstituted or substituted quinolyl, pyridopyrazinyl, indazolyl or pyridyl and which is directly bonded to nitrogen of the amide group; R1 is unsubstituted or substituted alkly-aryl; R2 represents hydrogen; R3-R6 represent hydrogen, R7 represents (C1-C6)-alkylcarbonyl or (C1-C6)- alkoxycarbonyl, and X, Y represent oxygen or sulphur, under the condition that, when R is an unsubstituted or substituted 2-, 3-, 4-, 5- and 6-pyridyl group and R1-R6 have the above mentioned values, R7 is not an acetyl radical or tert-butyloxycarbonyl group. The invention also relates to physiologically tolerant salts of the indole derivatives, as well as to pharmaceutical compositions based on them and their use in obtaining medicinal preparations.

EFFECT: obtaining of medicinal preparations, used as medicines for curing tumorous diseases, especially in case of resistance to other drugs and metastasising carcinomas.

14 cl, 7 tbl, 6 dwg, 25 ex

Asaindoles // 2326880

FIELD: medicine; pharmacology.

SUBSTANCE: invention refers to pharmaceutical formulation inhibiting protein kinase, containing inhibiting selective kinase compound amount of general formula (I): , where: R means aryl or indolyl, and the latter is optionally substituted with one or more groups selected from R4, -C(=O)-R, -C(=O)-OR5, -C(=O)-NY1Y2 and -Z2R; R2 means H; R3 means H; R4 means C1-C6 alkyl, optionally substituted with one substitute -C(=O)-NY1Y2; R5 means H; R7 means C1-C6 alkyl; R means C1-C6 alkyl; X1 means C-aryl, C-heteroaryl, such as pyridile or isoxasolyl, and the latter is optionally substituted with one or two C1-C6 alkyls, C-heterocycloalkyl, such as morpholinile or peperidynil, C-halogen, C-CN, C-OH, C-Z2R, C-C(=O)-OR5, C-NYlY2, C-C(=O)-NY1Y2; Y1 and Y2 means redardless H, aryl, C3-C6 cycloaryl, C1-C6 alkyl, optionally substituted with one group selected from phenyl, halogen, heterocyclil, such as morpholinile, phurile, hydroxyl, -C(=O)-OR5, OR7; or group-NY1Y2 can form morpholinile, peperidynil, optionally substituted with one or two substitutes selected from OH, C1-C6 alkyl; Z means O; where aryl as group or part of group means optionally substituted with one or two substitutes monocyclic aromatic C6carbocyclic fragment, where substitute is selected from halogen or C1-C6 alkoxy, C(=O)-OR5; except compounds: 4-chlorine-2-(4-tert-butylphenyl)-1H-pyrrole[2,3-b]pyridine, 2-(5-methoxy-1 -methyl-1 H-indole-3-il)-4-phenyl-1H- pyrrole[2,3-b]pyridine, 2-(5- methoxy-1 -methyl-1 H-indole-3-il)-1H- pyrrole[2,3-b] pyridine-4-carbonitrile, 4-chlorine-2-(5- methoxy-1 -methyl-1H-indole-3-il)-1H- pyrrole[2,3-b]pyridine, or 2-(5- methoxy-1H-indole-3-il)-1H- pyrrole[2,3-b]pyridine -4- carbonitrile.

EFFECT: application of compound for production of medicinal agent for inflammatory disease.

51 cl, 9 tbl, 148 ex

FIELD: medicine; pharmacology.

SUBSTANCE: invention refers to new compounds of and formula: I II those developing antiviral activity allowing application in pharmaceutical formulations and for antiviral medicines production.

EFFECT: new compounds have useful biological properties.

5 cl, 3 dwg, 6 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to the formula I compounds or its pharmaceutically acceptable salt or hydrate where Z means N; X1 means O or S, R1 means alkyl containing one to six carbon atoms; R2 designates hydrogen or alkyl containing one to six carbon atoms; and R3 designates hydrogen or alkyl containing one to six carbon atoms substituted with the -ORa group where Ra means alkyl containing one to six carbon atoms; saturated nonaromatic cyclic radical containing 3 to 8 atoms in a cycle where one atom in a cycle is a heteroatom selected from N or O, whereas the rest of the atoms in the cycle are carbon atoms, one or two of these carbon atoms being not necessarily substituted by nitrogen atom with the groups -C(O)(C1-C6alcoxy) or -SO2-C1C6alkyl. Invention also relates to pharmaceutical composition.

EFFECT: compounds possess inhibiting activity.

13 cl, 1 tbl, 8 ex

FIELD: CHEMISTRY.

SUBSTANCE: invention relates to novel method for preparation of compounds of formula IX or IXа, which implies reaction of compound of formula Va, in solvent, with compound of formula VII or formula VIIa, in the presence of palladium catalyst and phospho ligand, in the presence of amine base, resulting in compound of formula VIII or VIIIa. The method also implies reaction of compound of formula VIII or VIIIa, in solvent, with cyclopropylamine, not necessarily in the presence of catalyst. Also, invention relates to method for purification of compound of formula IX or IXa.

Va - R1 may be either С1-8alkyl, aryl or heteroaryl, not necessarily aryl- and/or С1-8alkyl-substituted; and

.

EFFECT: method for preparation of biologically useful compounds is described.

17 cl, 3 tbl, 77 ex

FIELD: chemistry.

SUBSTANCE: invention relates to novel compounds of formula I or pharmaceutically suitable salt or solvate thereof, where dashed line stands for additional bond, а is a number from 0 to 2, b is a number from 0 to 2, n is 2, p is 2, r is 1, М1 stands for nitrogen, М2 stands for С(R3), X stands for either a bond or alkylene group with number of carbon atoms from 1 to 6, Y stands for -С(О)- group, Z stands for a bond, or alkylene group with number of carbon atoms from 1 to 6, or alkenylene group with number of carbon atoms from 1 to 6, or -С(O)-, -CH(CN)-, -SO2- or СН2С(O)NR4- group, R1 stands for groups, R2 stands for six-membered heteroaryl ring with one or two heteroatoms chosen independently of each other from either nitrogen atom or N-O group, other atoms of the cycle being carbon, five-membered heteroaryl ring with one, two, three or four heteroatoms chosen independently of each other from nitrogen, oxygen or sulphur, other atoms of the cycle being carbon, R32 stands for substituded quinoline group, R32 stands for substituted aryl group, heterocycloalkyl group, cycloalkyl group with number of carbon atoms from 3 to 6, alkyl group with number of carbon atoms from 1 to 6, group, where the said six-membered heteroaryl ring or the said five-membered heteroaryl ring may be R6-substituted, R12 independently of others is chosen from an alkyl group with number of carbon atoms from 1 to 6, hydroxyl group or fluorine atom, provided in case R12 stands for hydroxyl or fluorine the rest of R12 cannot be bonded to a nitrogen-bonded carbon atom, or two R12 substituents form an alkyl bridge with number of carbon atoms from 1 to 2, which bonds two non-adjaicent carbon atoms of the ring, R13 independently of the others is chosen from an alkyl group with number of carbon atoms from 1 to 6, hydroxyl group, alcoxy group with number of carbon atoms from 1 to 6, or fluorine atom, provided in case R13 stands for hydroxyl or fluorine the rest of R13 cannot be bonded to a nitrogen-bonded carbon atom, or two R13 substituents form an alkyl bridge with number of carbon atoms from 1 to 2, which bonds two non-adjacent carbon atoms of the ring. See description for meaning of the other structural elements. Invention relates also to pharmaceutical compositions, as well as to application of compounds of formula I.

EFFECT: preparation of novel biologically active substances and pharmaceutical compositions.

20 cl, 659 ex

FIELD: medicine, pharmacology.

SUBSTANCE: compound formula I is described, including the pharmaceutically acceptable salts, , where: Z presents ; Q is taken from the group that consists of: -W - presents , and the pharmaceutical composition, application of compound formula (I) for preparation of antiviral medicine.

EFFECT: proposed compounds can be helpful in treatment of HIV and AIDS.

70 cl, 2 tbl, 129 ex

FIELD: organic chemistry, chemical technology.

SUBSTANCE: invention relates to a method (variants) for synthesis of racemic 2-(7-chloro-1,8-naphthyridine-2-yl)-3-(5-methyl-2-oxohexyl)-1-isoindolinone and its (+)-enantiomer. The first variant of method for synthesis of racemic 2-(7-chloro-1,8-naphthyridine-2-yl)-3-(5-methyl-2-oxohexyl)-1-isoindolinone involves step (e) and another variant involves steps (b)-(e). Method for synthesis of (+)-enantiomer involves the following steps (a)-(f): (a) interaction of 2,6-diaminopyridine with malic and sulfuric acids to form 2-amino-7-hydroxy-1,8-naphthyridine hydrosulfate that (b) is treated with phthalyl reagent in a solvent medium to form phthalimidylnaphthyridine of the formula (2): that (c) is chlorinated to form chloride of the formula (3): that (d) is reduced to hydroxyindolinone of the formula (4): that (e) is treated with 5-methyl-2-oxohexyltriphenylphosphonium halide to yield racemic 2-(7-chloro-1,8-naphthyridine-2-yl)-3-(5-methyl-2-oxohexyl)-1-isoindolinone that (f) is separated and final (+)-2-(7-chloro-1,8-naphthyridine-2-yl)-3-(5-methyl-2-oxohexyl)-1-isoindolinone is prepared. Invention provides improving method for synthesis of 2-(7-chloro-1,8-naphthyridine-2-yl)-3-(5-methyl-2-oxohexyl)-1-isoindolinone from 2-(7-chloro-1,8-naphthyridine-2-yl)-3-hydroxyisoindolinone-1-one based on using 5-methyl-2-oxohexyltriphenylphosphonium halide.

EFFECT: improved methods of synthesis.

13 cl, 1 ex

FIELD: organic chemistry, medicine, pharmacy.

SUBSTANCE: invention relates to compounds of the formula (I): that are antagonists of CRF receptors and wherein Ar means optionally substituted phenyl or monocyclic 6-membered heteroaryl comprising one heteroatom chosen from nitrogen, oxygen or sulfur atoms; R1-R4 have values given in the invention claim, or to their pharmaceutically acceptable salts. Also, invention relates to methods for synthesis of indicated compounds and to pharmaceutical compositions containing these compounds that are useful for administration to a patient suffering from diseases that are relived in therapy using antagonists of CRF receptors.

EFFECT: valuable medicinal properties of compounds and pharmaceutical composition.

26 cl, 10 tbl, 17 ex

FIELD: organic chemistry, biochemistry.

SUBSTANCE: invention describes novel substituted pyrazoles of the general formula (I): wherein values of radicals Ar, Ar2, W, G, R5-R8, RZ and n are given in the invention claim. Also, invention relates to a pharmaceutical composition based on these compounds, using this pharmaceutical composition for manufacturing agent designated for treatment of asthma, and a method for inhibition of activity of cathepsin S. Compounds indicated above can be used in medicine.

EFFECT: valuable medicinal and biochemical properties of compounds and pharmaceutical composition.

27 cl, 3 tbl, 352 ex

FIELD: medicine; veterinary science.

SUBSTANCE: invention refers to application of compounds with common structural formula

R1=-H, -NH2, -Br, -Cl, -ОН, -СООН,

B=-N=, -CH=, Z=-CH=, -N=,

A=-CH- at B=-N=, Z=-CH-,

A=-CH- at В=-СН=, Z=-CH=,

A=-N= at B=-N=, Z=-CH-,

A=-CH- at B=-N=, Z=-N=,

A=-CH= at В=-СН=, Z=-N=.

Structures of specified formula are active for nitrergic and dopaminergic systems of mammal body including human body. These compounds can be applied as neuroprotectors, to improve cognitive function and to normalise psychophysiologic state, to treat consequences of substance abuse, as well as to treat wide range of diseases including neuropsychic, cardiovascular, immune, inflammatory and gastro-intestinal disorders.

EFFECT: application of new and well-known compound to effect nitrergic and dopaminergic systems for treatment purposes.

4 ex, 3 tbl, 8 dwg

FIELD: chemistry.

SUBSTANCE: here, described are new derivatives of 1H-1,2,4-triazole-3-carbozamide of the general formula (I) , wherein R is phenyl, possibly replaced by 1-2 halogen atoms, R1 is phenyl possibly replaced by 1-2 halogen atoms or trifluotomethyl group, or pyridile radical; R2 represents a hydrogen atom; R3 - C1-6-alkyl, C2-8-alcoxy, C3-8-cycloalkyl, possibly replaced with C1-3-zalkyl or ethynil, C2-8-bicycloalkyl, C4-8-alkenil, C3-8-trifluoroalkyl or C2-8-fluoroalkyl group or C3-8-cycloalkyl, group NR4R5, where R4 and R5 together with nitrogen atom to which they are coupled, form a monocyclic or bicyclic heterocyclic fragment with 5-8 ring atoms, the heterocyclic group of the above fragment contains one or two heteroatoms, selected from the group N and O, possibly replaced with C1-3-alkyl or R2 and R3 together with nitrogen atom to which they are coupled form 1,4'-bipyperidine radical, their pharmaceutically acceptable salts.

EFFECT: pharmaceutical composition is used for treatment of disturbances involving neurotransmission of cannabinoids.

5 cl, 43 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: invention involves compositions of lamotrigine and its pharmaceutically acceptable derivative of prolonged release. Composition includes: 1) nucleus with lamotrigine or its pharmaceutically acceptable derivative; 2) outer coating of nucleus thickness of which is selected so that it is actually resistant for ambient liquids and actually resistant for release of lamotrigine or its pharmaceutically acceptable derivative, and 3) mentioned outer coating has one or more pores from outer face of coating through essentially all the coating without penetration to mentioned nucleus enabling release of lamotrigine or its pharmaceutically acceptable derivative from nucleus into ambient liquid. Mentioned pores have area or integrated area from approximately 10 to approximately 60% of front-face area of mention composition. And release of lamotrigine or its pharmaceutically acceptable derivative is performed essentially trough mentioned pores. Outer surface at that dissolves in the event ambient pH exceeds 5. Composition provides prolonged release of lamotrigine by two procedures: slower release due to initial release of lamotrigine through the pore, and faster release in further step due to dissolving of outer coating.

EFFECT: elimination of side effects accompanying lamotrigine-based or its pharmaceutically acceptable derivatives therapy.

5 cl, 7 dwg, 9 tbl, 6 ex

FIELD: medicine; psychiatry.

SUBSTANCE: method is implemented as follows: for 30 days pharmacotherapy is administered: 20-25 mg a day intramuscularly of 0.5% solution of benzodiazepine anxyolitic of diazepam, 300-400 mg of antioxidant mexidol intravenously by drop infusion during the first 10-15 days and 125-150 mg in tabloid form during the next 15-20 days, 15 intramuscular injections of 1 - 1.2 ml of 0.1% solution of immunocorrector timogene. Hyperbaric oxygenation is administered at the same time with excessive pressure 0.8 - 1.0 atm at compression and decompression speed of 0.1 atm per minute by isopressure method for 40 minutes 2 times a day during the first 15 days and once a day during the next 15 days.

EFFECT: combination of pathogenic means for efficient and safe treatment of subacute reactive psychosis by complex impact of neuro-homeostasis.

1 ex

FIELD: medicine, pharmacy.

SUBSTANCE: invention describes medicinal formulations and methods for providing the increasing rate of release of paliperidone. The medicinal formulations of sustained release provide the therapeutically effective mean and stable state of the paliperidone concentrations in plasma in a single administration per a day. This dosing regimen as a single dose per a day results to a single plasma paliperidone concentration peak for each 24 h period. Except for, the paliperidone plasma concentration occurs at later period after administration of dose and shows less value as compared the paliperidone plasma concentration that is achieved after administration of paliperidone in medicinal formulation with immediate release.

EFFECT: improved and valuable properties of formulations.

20 cl, 9 dwg, 2 ex

FIELD: organic chemistry, medicine.

SUBSTANCE: invention relates to using compounds of the general formula (I) for preparing a drug used in treatment of obesity.

EFFECT: valuable medicinal property of compounds.

4 cl, 1 tbl, 9 ex

FIELD: organic chemistry, medicine.

SUBSTANCE: invention relates to using compounds of the general formula (I): and their pharmaceutically acceptable acid-additive salts. Compounds are used for preparing medicinal agents used in treatment diseases and state associated with system of adenosine receptors A2A, such as Alzheimer's disease, Parkinson's diseases, Huntington's syndrome, schizophrenia, anxiety state, pain, depression, narcomania to such substances as amphetamine, cocaine, opioides, ethyl alcohol, nicotine, cannabinoids, or in treatment of hypoxia, ischemia, epileptic attack. Also, proposed compounds exert neuroprotective effect and can be used as sedative, antipsychotic or anti-epileptic agents.

EFFECT: valuable medicinal properties of compounds.

18 cl, 1 tbl, 49 ex

FIELD: medicine, pharmacy.

SUBSTANCE: invention relates to injection depot-preparations containing ziprasidon or its pharmaceutically acceptable salts that solubilized with cyclodextrin and containing a viscosity modifying agent and comprising a cellulose derivative, polyvinylpyrrolidone, alginates, chitosan, dextran, gelatin, polyethylene glycols, polyoxyethylene ethers, polyoxypropylene ethers, polyactides, polyglycolides, polycaprolactones, polyanhydrides, polyamines, polyurethanes, polyetheramides, poly-ortho-esters, polydioxanones, polyacetals, polycarbonates, poly-ortho-carbonates, polyphosphazenes, succinates, polycarbonates, poly-(maleic acid), poly-(amino acids), polyhydroxycellulose, chitin, copolymers or terpolymers of abovementioned substances, sucrose butyrate acetate, PLGA, stearic acid/NMP or their combinations. Also, the claimed invention relates to depot-preparations containing ziprasidon mesylate and solubilized SBECD. Also, the claimed invention relates to a method for treatment of psychotic disease, for example, schizophrenia that involves using the claimed preparations. The claimed preparations provides prolonged administration of ziprasidon and its content from 70 to about 280 mgA/ml that provides possibility for a single administration and providing the therapeutic effect for prolonged period.

EFFECT: improved and valuable medicinal and pharmaceutical properties of preparations.

16 cl, 2 tbl, 2 ex

FIELD: organic chemistry, pharmaceuticals.

SUBSTANCE: invention relates to new compounds of formula I , or stereoisomers, or pharmaceutically acceptable salts thereof, wherein Q is SO2; n = 2 or 3; each R1 and R2 is independently H, halogen, OR22 or C1-C6-alkyl; each R3 and R4 is H; each R5 and R6 is independently H or C1-C6-alkyl optionally substituted with phenyl or R5 and R6 together with together with atom to which they are attached may form 5-7-membered ring optionally containing N as the second heteroatom optionally substituted with COOH or C1-C6-alkyl; R7 is H; R7 is optionally substituted 8013-membered bicyclic or tricyclic ring system, containing N in bridge bond and optionally 1, 2 additional heteroatoms selected from N, S wherein substituent represent 1 or 2 halogen atoms; R22 is H or C1-C6-phenyl optionally substituted with C1-C6-alkyl. Compounds of present invention specifically bond to 5-HT6 receptor and are useful in pharmaceutical compositions.

EFFECT: compounds with specific bonding to 5-HT6 receptor.

10 cl, 3 tbl, 45 ex

FIELD: organic chemistry, pharmaceuticals.

SUBSTANCE: invention relates to new chemical compound of general formula I , or salts, or hydrates thereof. In formula I R1 represents group of formula -G1-R1a (wherein G1 represents single bond, oxygen, sulfur; R1a represents C1-C10-alkyl optionally substituted with halogen or C3-C8-cycloalkyl); R2, R3 and R4 are independently hydrogen or -G20-R20 (wherein G20 represents single bond, oxygen, sulfur, sulfinyl or sulfonyl; R20 represents C1-C6-alkyl optionally substituted with 1-3 halogen atoms or C3-C8-cycloalkyl); R5 and R6 are independently -X5-X6-X7 group (meanings of X5, X6 and X7 are as defined in specification) or R3 and R4 may together form pyrrol ring optionally substituted with C1-C6-alkyl; Ar represents phenyl, 1,3-benzodioxolyl, naphthyl, pyridyl, optionally substituted with 1-3 substituents (as defined in specification) Compounds of formula I has antagonistic activity in relates to receptors of corticotrophin releasing factor (CRF). Also disclosed are compounds, characterized by preferable structures, pharmaceutical compositions, using such compounds, intermediates for production thereof and method for treatment of various diseases mediated by CRF.

EFFECT: new compounds as antagonists of CRF receptors.

33 cl, 1 tbl, 316 ex

FIELD: chemistry.

SUBSTANCE: invention refers to new pyridazine -3 (2H) derivatives, the chemical formula of which corresponds to the general formula , in which R1, R2, R3, R4 and R5 have values indicated in the formula of the invention. The compounds of the formula (I) are effective and selective inhibitors of phosphodiesterase 4. The invention also refers to the method of their preparation, pharmaceutical composition which includes these compounds, and to the application for medicine preparation for treatment of disease state or disease which medicable by meance of phosphodiesterase 4 inhibition. Besides, the object of the invention is the method of disease state and disease treatment by means of phosphodiesterase 4 inhibition.

EFFECT: new compounds have effective biological properties.

19 cl, 25 tbl, 278 ex

Up!