Osteoprotegrin, its application for preparation of pharmaceutical composition (variants), production of food substance (variants) and fodder, food substance, fodder and pharmaceutical composition for prevention and treatment of disorders related to bone remodeling, and/or immune disorders

FIELD: technological processes.

SUBSTANCE: this invention is related to biotechnology, to be more precise, to preparation of proteins out of milk, and may be used for prevention or treatment disorders related to metabolism in bones and immune function. Osteoprotegrin is prepared out of human or cow milk and has glycolysis profile that produces polypeptide with molecular mass of approximately 80, 130 and 200 kilodaltons. Prepared protein is used in structure of food substance and pharmaceutical composition for prevention or treatment of disorders related with bone remodeling, and/or immune disorders. Also prepared protein is added to make fodder.

EFFECT: invention allows simple and efficient preparation of stable biologically active form of protein osteoprotegrin out of natural sources.

20 cl, 7 dwg, 1 ex

 

The technical field to which the invention relates.

The present invention relates to osteoprotegerin, which can be obtained from dairy sources, in particular from women's and cow's milk. The present invention also relates to its use to obtain the drug, taken orally, and/or pharmaceutical compositions, in particular to the use of such a preparation/composition for the prevention or treatment of disorders associated with metabolism in the bones and immune function.

The level of technology

In mammals, the bones support the body and are composed of mineral substances, matrix of collagen and Nikolayevich proteins and cellular components. Their growth and maintenance are regulated by many different factors, including the regulation and interaction of their constituent cell types, i.e. chondrocytes that form cartilage, osteoblasts, synthesizing and deposited bone matrix, and osteoclasts, responsible for the resorption of bone.

The chondrocytes originate from mesenchymal cells and generate the source of the cartilage matrix, required for endochondral of bone formation. Osteoblasts, promoting the formation of bone tissue, originate from the mesenchymal preosteoblast and localized on the surface of the bone, where they are synthesized, transported and placed protein matrix With d the natives hand, osteoclasts responsible for bone resorption, originate from precursors of granulocytes-monocytes present in the hematopoietic bone marrow. Actions osteoclasts and osteoblasts are closely related, for example, during the process of resorption mediated by osteoclasts generated by protein factors act as signaling molecules to initiate recovery of the bone by osteoblasts Osteoblasts, in turn, can affect the function of osteoclasts through the expression of soluble or membrane-associated regulators. Therefore, the normal bone remodeling depends on a certain balance between the opposing functions of bone formation and bone resorption carried out by each of the respective cell types.

Growth factors such as fibroblast growth factor (FGF) and transforming growth factor - β (TGF-β), are stored in the bone extracellular matrix and secretion stimulates the local release of bone precursor cells. Then factors such as bone morphogenic proteins (BMP) and parathyroid hormone (PTH), affect the development of these precursors in the bone forming osteoblasts, the final differentiation and function are regulated by the interaction of cells with the protein of the bone matrix.

During aging, the individual undergoes n is a power loss of bone mass the phenomenon, called separation, which is believed to be the result of the activity of osteoclasts, which exceeds that of osteoblasts. In cases where such separation is maintained for a longer time, more and more bone is destroyed/absorbed, and the result is a condition called osteoporosis.

In addition to the phenomena, depending on age, bone loss can also be caused by calcium or hormonal deficiency or conditions, which result in various diseases, such as osteoporosis, hypercalcemia, Paget's disease, bone loss due to osteoarthritis or rheumatoid arthritis or osteomyelitis, etc. Reduced bone density, as a rule, leads to reduced mechanical strength and an increased likelihood of fractures.

Modern approaches to the treatment of osteoporosis and/or related disorders in the bones include the use of calcium, administered to patients in need. In recent time the funds involved in the stimulation and/or inhibition of bone cells, such as hormones, calcitonin, insulin-like growth factor or osteoprotegerin (OPG), are also considered which can be used in the treatment of the above disease conditions. These funds typically receive recombinant what means, and they should be part of/be prepared in the form of herbal medicines, so that the corresponding substance could reach the target-bones in the active form.

In WO 00/24771 describes nucleic acid encoding osteoprotegerin proteins, and their use, for example, in the treatment of osteoporosis. The polypeptide synthesized by recombinant methods and then injected into the composition so that it was compatible with the intended method of administration. As such methods are offered intravenous, intradermal, subcutaneous, oral (e.g., by inhalation), transdermal (topical), through the mucosa and rectal administration.

In General, finding a suitable galenical form for this matter is time-consuming and cumbersome, as the ingredients used for this purpose must be compatible with the active substance and should also provide sufficient protection against various conditions in the body. However, as a means of stimulating bone growth, are synthesized locally in the bone - this substance is difficult to enter. Typically, you should develop a capsule which help to pass the substance through the gastrointestinal tract without failure under adverse environmental conditions existing in it. However, this route of administration also has some disadvantages, because ve is estvo must pass the liver and transported by body fluids, before it reaches the bone. In addition, it often leads to a reduced number of active biological substances reaching the target tissue.

The invention

Therefore, the aim of the present invention is to provide a means of introducing active substances to the individual, in which the substance acts in the body of an individual in a specific target tissue.

Accordingly, the above problem is solved by using osteoprotegerin, which you can get from milk.

List of figures

Figure 1 shows the concentration of osteoprotegerin milk during different stages of breast-feeding.

Figure 2 shows the results of analysis by the method of Western blotting of fractions of breast milk in reducing conditions using gel with 10% SDS. Strip OPG find using biotinylated polyclonal antibodies BAF805 against OPG from R&D Systems and conjugate streptavidin-alkaline phosphatase (SAPP).

Figure 3 shows the restriction map of the plasmid is integrated into the genomic DNA of transformed Yarrowia.

Figure 4 shows the results of the analysis of RT-PCR (RT-PCR) cells of the female breast milk and epithelial cells human breast MCF-7; lanes 1 and 2: β-actin (band of the expected size of 460 BP); lanes 3 and 4: OPG (band of the expected size of the 603 BP). 1. Cells of the female breast milk; 2. MCF-7; 3. Cells of the female breast milk; 4. MCF-7.

Figure 5 shows the results of an experiment in which OPG of the present invention inhibits apoptosis of cells Jurcat induced TRAIL.

Fig. 6 and 7 also explain the invention.

Information confirming the possibility of carrying out the invention

Osteoprotegerin (OPG), also known as factor suppressing osteoclastogenesis (OCIF), and similar to the TNF receptor molecule 1 (TR1)is a recently described member of the family of receptors of the tumor necrosis factor (TNFR). It inhibits the development of osteoclasts both in vitro and in vivo, and increases bone density (osteoporosis). In healthy murine embryos OPG is localized in cartilage rudiments of developing bone, as well as in the small intestine.

However, unlike other members of the TNF family receptor OPG has no transmembrane domain. Moreover, it can be shown that OPG is also the receptor for the cytotoxic ligand TRAIL (TNF related ligand, inducing apoptosis) and are identical to the receptor-1, originating from follicular dendritic cells. As such, it is assumed that regulates cell death and plays an important role in the formation of lymphoid tissues and the regulation of immune responses. Indeed, it is shown that in animals deprived of OPG are underdeveloped the e lymphoid tissue.

In the studies leading to the present invention now unexpectedly discovered that in addition to the availability of osteoprotegerin in, for example, bone tissues, it can also be found in women's breast milk. As a result, during the breast-feeding mother, obviously, provides the newborn specified biologically active substance in the form, able to survive in the gastrointestinal tract. From the specified follows that OPG produced by cells of the mammary gland, obviously differs from OPG allocated from other sources, in terms of its stability and/or resistance to decay.

Without intending to be bound by any theory, at the present time believe that a specific glycosylation profile reported protein in the cells of the breast, makes polypeptide is more resistant to acidic fluids of the stomach and/or alkaline environment found in the intestine, so that after absorption in the intestine and migrate to the bone active domain remains intact and is able to manifest their biological activity.

OPG of the present invention, i.e. in a form that can be obtained from dairy sources, has the polypeptide sequence defined by SEQ ID. NO.1, and detects a size of approximately 80, 130 and 200 kDa, respectively, which differs from the size OPG received recombinant method is mi (55 kDa).

OPG of the present invention can be included in the drug, taken orally, which may be a food product, such as, for example, milk, yogurt, curd, cheese, fermented milk products, fermented milk products, ice-creams, fermented cereal based products, powders based on milk, baby formula and pet food. Similarly, OPG of the present invention may also include enteral or pharmaceutical composition, for example, selected from the group consisting of solutions, dried oral supplements, liquid oral Supplement, dry food in tubes or liquid food in the box.

Indeed, as OPG of the present invention is stable, there is no need to translate the active compound in a specific herbal form to protect it from different and potentially adverse conditions prevailing in the gastrointestinal tract and body fluids.

According to another aspect of the present invention also relates to the application of osteoprotegerin of milk to obtain the drug, taken orally, such as food or enteral composition, or pharmaceutical composition.

Osteoprotegerin of the present invention and the drug, taken orally, described above, can be used for the treatment and/or prevention is IKI disorders of bone remodeling.

The most common bone disorder is osteopenia is a condition related to any decrease in bone mass to levels below normal. This condition may occur due to the speed reduction of the synthesis of the bones, or the increasing rate of destruction of the bone, or both. The most common form of osteopenia is primary osteoporosis, also known as postmenopausal and age-related osteoporosis. This form of osteoporosis is the consequence of the total loss in bone mass with age and, as a rule, the result of increasing the rate of bone resorption at the normal rate of formation of bones. Other forms of osteoporosis are endocrine osteoporosis (hyperthyroidism, hyperparathyroidism, Cushing's syndrome, and acromegaly), hereditary and congenital forms of osteoporosis (imperfect osteogenesis, homocystinuria syndrome Menkes syndrome Riley-Dey) and osteoporosis due to immobilization of extremities.

Recently recognized that osteoporosis in the human population is also associated with a higher incidence of arterial calcification is a component of many of atherosclerotic plaques.

Therefore, the food product described above can be used to prevent or relieve symptoms and/or structural changes in the bones, connected what's with osteopenia or osteoporosis, respectively. It should be borne in mind that the active substance will be included in the food product in an amount sufficient to induce a desired biological response. As discovered that OPG itself is a component of breast milk, milk products essentially are particularly suitable for delivery of a substance into the body of the individual.

On the other hand, for treatment of severe osteopenia or osteoporosis accordingly, the preferred medical scheme may be a pharmaceutical composition containing osteoprotegerin of the present invention in large quantities, i.e. in quantities sufficient to pause or even reverse disease process. Such compositions may contain OPG of the present invention in amounts of only one active substance. The advantage is that it does not envisage any major selection of the composition of a substance. Therefore, in the framework of the present invention is reasonably easy to extrude a pill consisting of "powder OPG", if necessary, with the addition of media or corrigentov. However, when OPG of the present invention should be introduced into the composition together with other active substances, should consider the nature and tendency to decomposition of such additional substances in the gastrointestinal tract. OPG this is subramania, included in the dosage form will enable the physician to more accurately control the daily or weekly dose of active connections.

Osteoprotegerin of the present invention can also be used to prevent and/or treat Paget's disease, osteomyelitis, infectious lesions of the bone, which leads to loss of bone, hypercalcemia, osteonecrosis, bone loss due to osteoarthritis or rheumatoid arthritis, periodontal bone loss and/or osteolytic metastasis.

Also found that OPG is a receptor for the ligand, related to the tumor necrosis factor (TRAIL), which induces apoptosis upon binding to its receptors containing the death domain. It is assumed that it regulates cell death and plays an important role in the formation of lymphoid tissues and the regulation of immune responses. In addition, OPG is a false receptor for RANKL (ligand for activator receptor NF-κ), which is described as a product of activated T-cells. The binding of receptor for RANKL on Mature dendritic cells increases survival of dendritic cells. In addition, the entry of RANKL in contact with its receptor enhances the growth of T cells and the function of dendritic cells.

Accordingly, the present invention relates to the use of osteop tigerina, which you can get from women and/or cow's milk for the production of the drug, taken orally, such as, for example, a food composition or enteral composition or for the manufacture of a medicinal product in accordance with the purpose of promoting the sound development of the immune tissues, to promote normal immune function and even for the prevention and/or treatment of disorders of the immune system.

Disorders of the immune system considered in this invention include allergies, autoimmune reactions, sepsis, cancer, inflammatory bowel disease, systemic autoimmune conditions, cardiovascular disease and immunopathological condition of the skin, oral cavity, gastrointestinal and urogenital tract and the respiratory tract.

In addition, osteoprotegerin of the present invention can also be used to regulate proliferation and apoptosis of cells, stimulation of oral tolerance, modulation of infectious processes and bacterial colonization of the newborn. In particular, newborns of the above disorders, in General, may be associated with preterm birth and/or low body weight at birth, so in such cases, osteoprotegerin of the present invention can simply enter the baby through the baby food.

SL is blowing to keep in mind that individual, which is treated may be a individual of any age, although young children and the elderly are the main subjects, which have to be considered because of their inherent need in exogenous osteoprotegerin. Some individuals, such as infants, osteoprotegerin required for the development of bone substance and/or the immune system, so in such cases, it may be advantageous introduction connections, and/or food and/or pharmaceutical compositions of the present invention.

However, it should be borne in mind that the present invention can also be applied to adults to prevent occurrence of any of the above disorders. It should also be borne in mind that, except for the people individuals who are treated may be animals, such as Pets, for which OPG of the present invention include in the feed.

OPG of the present invention can be obtained from milk source, obtained from a mammal, in particular of women's or cow's milk or colostrum. OPG breast milk has the amino acid sequence of 380 AK and detects molecular weight of approximately 80, 130 and 200 kDa when compared with protein markers that are used as molecular weight standards (BioRad). It shows 4 sites for N-gli is atilirovanie and may be present in Monomeric form and a dimeric form due to the formation of connection S-S through Cys 379.

OPG of the present invention can be isolated from dairy sources such as women's or cow's milk. However, it should be borne in mind that OPG of the present invention can be obtained by recombinant methods in the respective cells, giving a profile of glycosylation, which is observed in "OPG from milk". Preferred cells for expression are cells in the breast, as it can be expected that these cells will give identical or substantially identical to the profile of glycosylation.

Suitable cells for the expression of OPG of the present invention can be obtained by immortalization suitable means, such as the SV40 vector or the gene for telomerase, and transformation expressing the vector containing the nucleotide sequence encoding the polypeptide OPG. Of interest, the polypeptide can be obtained by selecting it from the supernatant in the case where the polypeptide is secreted, or collecting cells and separating the polypeptide from the cells themselves. In the case of continuous getting preferred will be the selection of the supernatant.

The following examples illustrate the invention without limiting it.

Examples

Samples of breast milk and human serum

Samples of breast milk (10-60 ml) collected from healthy mothers in the period up to 17 days after birth in sterile conditions by which zivania with a pump or sometimes manual pumping. The decant the milk into a sterile 50-ml centrifuge tubes and processed within 2 hours after taking. After centrifugation (200×g, 10 min) cellular precipitate immediately separated and processed for RNA extraction. The remaining milk is frozen at -20°C. the Samples human serum get from healthy donors and stored at -20°C.

Fractionation women breast milk

Separate the cream from the whole milk high-speed centrifugation. The top layer of cream extract, washed with water, and water from washing cream frozen at -20°C and stored until use. Separation of whey and casein reach the processing of rennet enzyme or chemical acidification (HCl) skim milk, causing coagulation of the casein. Then centrifugation processed milk isolate, sweet whey from insoluble rennet casein and acid whey from acid casein, respectively. Finally, using ultracentrifugation get soluble milk proteins (ultracentrifugation serum) and insoluble micellar casein. All fractions of casein and serum frozen at -20°C and stored until use.

Cell line human breast

Cell line breast cells MCF-7 (American Type Culture Center (ATCC), Manassas, VA., HTB-22), obtained from pleural the aqueous effusion breast cancer, retains some characteristics of a differentiated epithelium of the mammary gland. Cells were cultured in DMEM (Amimed Bioconcept, Allschwill, Switzerland) supplemented with 10% fetal calf serum (FCS, Amimed Bioconcept) and cultured at 37°C in a humid atmosphere containing 5% CO2. The culture medium replaced 2-3 times a week. Upon reaching confluently cells separated using trypsin/EDTA (GibcoBRL) at 37°C. the cells are Then prepared for RNA extraction.

Analysis by the method of Western blotting

Milk samples were diluted 1/25 regenerating buffer laemmli's method and boiled for 5 min Proteins share method SDS-PAGE (10%) and transferred onto nitrocellulose membranes (BioRad). The blots hybridized with biotinylating polyclonal antibody against human OPG (BAF805 at 0.2 μg/ml; R&D Systems) and streptavidin-alkaline phosphatase (Pierce). Immunoreactivity visualize using the alkaline phosphatase substrate BCIP/NBT (Zymed Laboratories). As molecular weight standards using pre-stained protein markers (BioRad). Recombinant human OPG (R&D Systems), serving as positive control, put in the amount of 25 ng per track.

The expression of OPG by cells of the female breast milk and epithelial cells of the human mammary gland

Reverse transcription with subsequent P Is P used for amplification of transcripts of OPG in a population of cells one-piece women's breast milk from a mother after 18 days after delivery and in the line of epithelial breast cells MCF-7. Total RNA extracted from cells using the method with Trizol (GibcoBRL). Briefly, Trizol (1 ml 5-10×106cells) are added to the cellular precipitate, the mixture several times sucked into the pipette and blow away and transferred to Eppendorff tube. Add chloroform (0.2 ml per 1 ml Trizol), and the tubes incubated for 5 min before centrifugation at 12000×g for 15 min, 4°C. the RNA is precipitated by an equal volume of isopropanol and centrifuged at 12000×g for 10 min Precipitation was washed with 70% ethanol and then resuspended in sterile deionized water. RNA stored at -20°s to use.

RNA samples treated with Dnazol I, not containing RNase to remove genomic DNA contamination. RNA define quantified by absorption at 260 nm and 280 nm on a spectrophotometer at the appropriate dilution (100-200 times). The RNA concentration (µg/ml) is calculated as follows: (absorption And260)×(dilution factor)×40 μg/ml Sample of total RNA, essentially, not containing proteins should have the relation of a260/A2801.8-to 2.2.

RNA is subjected to reverse transcription reverse transcriptase of the virus murine leukemia, Malone (Perkin-Elmer). Samples of RNA (0.5 μg total RNA), 0.5 units of RNase inhibitor, 1 mm each dNTP, 0.5 nmol/ml specific 3'-primer, 5 mm MgCl2and 1.25 units of reverse transcriptase inhibitors is incubated in a total volume of the reaction mixture 10 ál, containing buffer for enzyme supplied by the manufacturer. The reaction mixture was incubated for 30 min at 42°and then heated for 5 min at 95°C. Then the products of reverse transcription amplified with Gold DNA polymerase (Perkin-Elmer) in a thermocycler (Biolabo, Scientific Instruments, Chatel St Denis, Switzerland). Polymerase chain reaction (PCR) is carried out in a total volume of 50 μl using 10 µl of the products of reverse transcription buffer for PCR, 2 mm MgCl2, 5 μm of each dNTP, 0.2 nmol/ml of both OPG-specific primers - antisense ACTAGTTATAAGCAGCTTATTTTTACTG and semantic GGAGGCATTCTTCAGGTTTGCTG and 1.25 units of DNA polymerase. After initial denaturation for 10 min at 95°With samples amplified in 35 cycles of denaturation at 94°C for 45 s, annealing at 60°C for 1 min and extension at 72°C for 1 min 30 s, followed 7-min stage extension at 72°C. All samples subjected to RT-PCR using β-actin as a positive control. Product samples RT-PCR contribute 1.2% agarose gel (containing ethidium bromide) buffer 1×tai and separated by electrophoresis at 150 V for 1 hour. The products of RT-PCR visualize under UV light. The exact size of the strips is determined by comparison with size markers DNA (Boehringer Mannheim).

ELISA analysis of human OPG (enzyme-linked immunosorbent sandwich assay)

Concentration is the s OPG, present in breast milk and various milk fractions, measured using ELISA method. With this purpose, monoclonal antibodies against OPG (MAU, 1 μg/ml; R&D Systems, UK) applied to 96-well plates (Nunc) by incubation overnight at 4°C. Then tablets twice washed with 0.05% solution of tween-20 in PBS. Nonspecific binding blocked by incubation tablets with 2% solution of bovine serum albumin (BSA) in PBS for 2 hours at room temperature. Samples or recombinant OPG in standard concentrations (0,119-121,5 ng/ml; R&D Systems) and incubated in PBS-BSA for 3 h at room temperature. Then the tablets four times washed with PBS-tween before adding labeled with Biotin polyclonal antibodies against OPG (BAF805, 0.5 μg/ml; R&D Systems) for one hour at room temperature. After four additional washes add streptavidin-peroxidase (SAAP, 0.5 μg/ml, Kirkegaard % Perry KPL) and incubated for 1 hour at room temperature. Then the tablets washed four times and add the peroxidase substrate TMB (KPL). The tablets covered and incubated in the dark for five minutes. The enzymatic reaction is stopped by adding 1 N HCl. Determine the absorbance at 450 nm using a reader for ELISA (Dynex Technologies). The limit of sensitivity is approximately 30 PG/ml

Biological is aktivnosti OPG from breast milk

OPG is a receptor for the ligand, related to the tumor necrosis factor (TRAIL), which induces apoptosis upon binding to its containing domain of death receptors DR4 and DR5. Develop biological analysis, in which OPG breast milk can be tested on its ability to block called TRAIL apoptosis of these cells.

With this purpose, cells Jurkat, clone E6-1 (ATCS) were cultured in medium RPMI 1640 in the modification of the supplier ADS containing 10% FCS (37°C and 5% CO2). Cells were seeded at a density of 5×106cells/well in 96-well plates (Nunc). To each well add different concentrations of soluble recombinant human TRAIL (0-20 ng/ml) in the presence of 2 μg/ml protein-amplifier - antibodies that interact with soluble recombinant human TRAIL and thereby increasing its activity (Alexis, Läufelfingen, CH). Some wells also contain 50 ng/ml recombinant human OPG (R&D Systems), samples, women breast milk (NM; final dilution of 1/80; collected in the 1st or 9th day after birth) and/or 20 μg/ml of monoclonal antibodies against OPG (MAB805, R&D Systems). Tablets incubated at 37°C for 16 hours. Cell viability determined by adding3H-thymidine (1 µci/well) during the last 6 hours of cultivation.

In the test environment, the inhibition of proliferate the cells, called TRAIL, obviously at concentrations above 5 ng/ml, However, the samples NM prevent this inhibition. This effect is clearly due to the presence of OPG as monoclonal antibodies against OPG pay the specified effect.

The results are shown in figure 5.

Analysis by the method of Western blotting

OPG is synthesized in cells in the form of a monomer in the 55 kDa, but when extracellular secretion, it turns into linked by a disulfide bond dimer of approximately 100 kDa. Milk bands are detected in approximately 80, 130 and 200 kDa.

The concentration of OPG in women's breast milk

The content of OPG in samples of breast milk taken from 10 nursing mothers at different times in the first 17 days of lactation, check using ELISA method. Concentrations reach maximum values in the first 1-3 days of lactation and then decreased. Concentrations in milk range from 50 ng/ml to about 2 μg/ml (figure 1).

The cellular source of OPG milk

Analysis of RT-PCR shows that OPG of the present invention can be found in the cells of the female breast milk and epithelial cells of the mammary gland. Constitutive expression of mRNA for OPG is expressed in both types of untreated cells (figure 4).

Cloning OPG breast milk in yeast

Distinguish cells from female breast milk (18 days after birth) by centrifugation (200×g, 10 min).The cellular precipitate is extracted total RNA using Trizol® (Life Technologies, Basel, Switzerland), treated with Dnazol I and then purified by centrifugal RNeasy columns (Qiagen, Basel) according to the manufacturers ' recommendations. The PCR product encoding the Mature form of OPG, amplified from the total RNA using RT-PCR Titan™ One tube according to the Protocol provided by the manufacturer (Roche Diagnostics, Rotkreuz).

With OPG-specific antimuslim primer

CCGGCCTCTTCGGCCGCCAAGCGAGAAACGTTTCCTCCAAAGTACC

and conceptual primer

ACTAGTTATAAGCAGCTTATTTTTACTG

from this cDNA amplified fragment PCR 1174 BP PCR Product digested SfiI-SpeI, clear gel and the obtained fragment in 1156 BP are ligated with split SfiI-XbaI and SAP-treated pINA1267 getting pNFF270. Then, this plasmid is introduced into the yeast Yarrowia lipolytica by transformation. Figure 3 depicts the restriction map of the plasmid that integrates into the genomic DNA of transformed Yarrowia and SEQ ID. NO. 1-the protein encoded by this plasmid OPG.

The sequence of clone pGEM-T OPG is shown in figure 6. Mature OPG presented in black font and Dan in translated form. In the published sequence of OPG/OCIF amino acid residue 242 Mature OPG submitted by residue Ala (A), while all analyzed clones pGEM-T OPG at the specified position encode the residue is Asp (D). SfiI-SpeI fragment of OPG from this clone is transferred into pINA1267, split SfiI-XbaI. The obtained plasmid keyrestrictions map, depicted in figure 3. A single copy of such plasmids integrate into the genomic DNA of transformed Yarrowia. The protein encoded by such a plasmid, shown in figure 4. Mature OPG shown in bold. Plasmid pNFF270 introduced into Yarrowia lipolytica by transformation. The obtained transformants secrete a protein cross-reacting with OPG-specific antibodies into the culture medium, whereas transformants Y.lipolytica bearing containing no insert expression vector, not secrete this protein.

1. Osteoprotegerin, which is derived from women's or cow's milk or colostrum and that has a glycosylation profile, giving rise to a polypeptide with a molecular mass of approximately 80, 130 and 200 kDa, as measured by the method described in this invention.

2. A food product containing osteoprotegerin according to claim 1.

3. A food product according to claim 2, which is selected from the group consisting of milk, yogurt, curd, cheese, fermented milk products, fermented products based on milk, ice cream, fermented products based on cereals, powders on the basis of milk, and infant formula.

4. Pet food containing osteoprotegerin according to claim 1.

5. Pharmaceutical composition for prevention or treatment of disorders associated with bone remodeling, and/or immune disorders, containing an effective amount of osteoprotegerin according to claim 1, in combination with a pharmaceutically acceptable carrier.

6. The pharmaceutical composition according to claim 5 which is selected from the group consisting of solutions, dried oral supplements, liquid oral Supplement, dry food in tubes or liquid food in the box.

7. The use of osteoprotegerin according to claim 1 for the manufacture of a food product according to any one of claim 2 and 3.

8. The use of osteoprotegerin according to claim 1 for the manufacture of animal feed according to claim 4.

9. The use of osteoprotegerin according to claim 1 for the manufacture of a pharmaceutical composition according to any one of pp.5 and 6.

10. The use according to claim 9, where the disorder is a osteoporosis, Paget's disease, osteomyelitis, infectious damage to the bone, leading to bone loss, hypercalcemia, osteopenia, osteonecrosis, bone loss due to osteoarthritis or rheumatoid arthritis, periodontal bone loss and/or osteolytic metastasis.

11. The use according to claim 9, where the disorder is an Allergy, autoimmune disease, inflammatory bowel disease, systemic autoimmune comprising the Oia, dysregulation of proliferation and apoptosis and immunopathological condition of the skin, oral cavity, gastrointestinal and urogenital tract or the respiratory tract.

12. The use according to any one of p-11, where disorder associated with premature birth and/or low body weight at birth.

13. The use of osteoprotegerin according to claim 1 for receiving a food product for the prevention of disorders associated with bone remodeling.

14. Use item 13, where the disorder is a osteoporosis, Paget's disease, osteomyelitis, infectious damage to the bone, leading to bone loss, hypercalcemia, osteopenia, osteonecrosis, bone loss due to osteoarthritis or rheumatoid arthritis, periodontal bone loss and/or osteolytic metastasis.

15. The use according to any one of PP-13, where disorder associated with premature birth and/or low body weight at birth.

16. The use of osteoprotegerin according to claim 1 for receiving a food product for the prevention of immune disorders.

17. The application of article 16, where the disorder is an Allergy, autoimmune disease, inflammatory bowel disease, systemic autoimmune condition, dysregulation of proliferation and apoptosis and immunopathological condition of the skin, mouth Palast is, gastrointestinal and urinary tract or respiratory tract.

18. The use according to any one of p and 17, where disorder associated with premature birth and/or low body weight at birth.

19. The use of osteoprotegerin according to claim 1 for receiving a food product for the development of bone substance and/or the immune system.

20. The use of osteoprotegerin according to claim 1 to obtain a pharmaceutical composition for the development of bone substance and/or the immune system.



 

Same patents:

FIELD: medicine, biotechnology, pharmaceutical industry.

SUBSTANCE: method involves increasing part of the most active conformation of a glycosylated recombinant protein secreted by mammalian cell by its contact with a reagent for coupled oxidation-reduction. The proposed promotion method of the most active conformation of protein is used in a method for preparing a glycosylated recombinant protein in its the most active conformation. Configuration isomer of protein prepared by the indicated method for preparing a glycosylated recombinant protein in it's the most active conformation used in a method for preparing the protein composition for its administration to user and/or a patient or for consumption by user and/or patient. Using of the proposed invention provides enhancing activity of glycosylated protein prepared by a method of recombinant DNAs using a mammalian cell.

EFFECT: improved preparing method, valuable properties of protein.

27 cl, 9 dwg, 2 tbl, 3 ex

FIELD: biotechnology, immunology, biochemistry, medicine.

SUBSTANCE: invention proposes peptide concatemer inducing production of antibodies against apolipoprotein B-100 that inhibit lipase effect and inhibit binding LDL with LDL receptors. This concatemer consists of amino acid sequence of peptide repeating four times. Amino acid sequence is given in the invention description. Also, invention describes a concatemer-base vaccine used in treatment and prophylaxis of obesity and a method for preparing concatemer in E. coli cells using a vector. Invention discloses a polynucleotide encoding concatemer and expressing vector comprising the indicated polynucleotide. Using the invention provides inhibition of obesity.

EFFECT: valuable medicinal properties of concatemer and vaccine.

7 cl, 16 dwg, 1 tbl, 6 ex

FIELD: immunology, biotechnology.

SUBSTANCE: invention relates to variants of nucleic acid construct (NK-construct) encoding of MUC1 antigen based on seven full repeated VNTR-units. Variants include NK-constructs selected from group containing MUC1 based on seven full repeated VNTR-units, MUC1 based on seven full repeated VNTR-units without signal sequence, MUC1 based on seven full repeated VNTR-units without signal sequence, transmembrane and cytoplasm domains, full MUC1 based on seven full repeated VNTR-units without transmembrane and cytoplasm domains, as well as mutants of abovementioned variants, wherein at least one VNTR is mutated to reduce of glycosylation potential. Disclosed are NK-constructs additionally containing epitopes selected from group: FLSFHISNL, NLTISDVSV or NSSLEDPSTDYYQELQRDISE. Also described are variants of expressing plasmide carrying NK-construct represented as DNA, protein having anti-tumor activity, encoded with NK-construct and pharmaceutical composition with anti-tumor activity based on said protein, NK-construct or plasmide. Application of NK-construct and protein for producing of drug for treatment or prevention of MUC-1 expressing tumors; method for therapy by using NK-construct, protein, or plasmide also are disclosed.

EFFECT: NK-constructs with increased anti-tumor activity.

20 cl, 25 dwg, 5 ex

FIELD: medicine, biotechnology, pharmacy.

SUBSTANCE: invention relates to exchangers of ligand/receptor specificity delivering antibodies to receptors on pathogen. In particular, invention describes variants related to manufacturing and using exchangers of ligand/receptor specificity. Exchangers comprise at least one specificity domain containing ligand for receptor wherein ligand is not antibody or its part, and at least one antigenic domain combined with abovementioned specificity domain wherein antigenic domain comprises epitope of pathogen or toxin. Advantage of the invention involves enhanced specificity in delivery of drug.

EFFECT: improved and valuable properties of exchangers.

30 cl, 5 tbl, 6 ex

FIELD: medicine; biology.

SUBSTANCE: method involves introducing vector containing DNA-sequence into area under protection encoding T-cadgerin and being capable of providing its expression in target tissue or cells compatible with target tissue cells transected with said vector in advance and selected with respect to T-cadgerin expression level. The method has been tested on model system by implanting Matrigel to mice. Reliable implant mass-, implant hemoglobin contents- and capillary and medium-sized blood vessel number reduction has been observed in experimental animals, receiving cells L929 (clone TC3) expressing T-cadgerin, in two weeks after the injection.

EFFECT: enhanced effectiveness in treating pathological states with new blood vessel formation being suppressed.

7 cl, 8 dwg

FIELD: genetic engineering, biotechnology, biochemistry, medicine, pharmacy.

SUBSTANCE: invention relates to DNA encoding glycoprotein VI (GP VI) used as a base for synthesis of recombinant GP VI by method of recombinant DNAs followed by its using for the development of pharmaceutical compositions possessing with capacity for inhibiting or blocking interaction of platelets with collagen. Using the invention provides preparing GP VI in the recombinant form and using this agent for therapeutic aims.

EFFECT: valuable medicinal properties of glycoprotein VI.

6 cl, 4 dwg, 6 ex

FIELD: immunobiotechnology.

SUBSTANCE: invention relates to soluble CTLA4, which represents mutant variant of wild type CTLA4 and conserves binding ability to CD80 and/or CD86. Molecules of soluble CTLA4 have the first amino acid sequence containing extracellular CTLA4 region, which includes some mutant amino acid residues in S25-R33 region and M97-G107 region. According the present invention mutant molecules also may include second amino acid sequence, enhancing solubility of mutant molecule. Nucleic acid (NA) molecules encoding said CTLA4 and including NA-vectors also are described. Invention also relates to method for production of mutant CTLA4 and uses thereof in controlling of interaction between T-cell and CD80 and/or CD86-positive cell; suppression of graft-versus-host reaction; and treatment of immune system diseases. Soluble mutant CTLA4 according to present invention binds to CD80 and/or CD86 antigen with higher avidity than wild type CTLA4 or non-mutant CTLA41g.

EFFECT: new preparation for treatment of immune system diseases.

65 cl, 19 dwg, 2 tbl, 2 ex

FIELD: biotechnology, medicine.

SUBSTANCE: cells are contacted with protein containing fibronectin EDb-domen in presence of one or more chemical substances. As check experiment reaction between the same cells and abovementioned protein in absence of said substances. Expression of certain protein or presence of nucleic acid encoding the same makes it possible to select compounds bonding to fibronectin EDb-domen.

EFFECT: new biotechnological method.

1 tbl, 3 ex

FIELD: biotechnology, genetic engineering, immunology.

SUBSTANCE: invention proposes: isolated nucleic acid encoding feline ligand CD86; diagnostic oligonucleotide; cloning vector; vaccine for modulation of the immune response in cat; method for induction, enhancement and suppression of immune response in cats. Proposed group of inventions allows designing effective vaccines used in prophylaxis of immunodeficiency in felines and infectious peritonitis in domestic cats. Invention can be used in veterinary science.

EFFECT: valuable properties of nucleic acid.

27 cl, 13 dwg, 5 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention can be used for stimulation of the immune function in emotional-pain stress. For this purpose, the parenteral administration of amino acid L-lysine is used in rats with doses of 0.5, 1.5, 5, 15, 50, 150, 450 mcg/kg, once a day, with course of 4 days, 15 min before stressful exposure.

EFFECT: invention enables prevention of stress-induced immunosupression.

1 tbl

FIELD: medicine.

SUBSTANCE: composition containing the population of complexes of one or more heat-shock proteins (HSP) and antigenic peptides (AgP) are administered to the patient; in addition, at least one therapeutic agent, which doesn't contain the HSP is administered, to prevent or treat cancer. The population of complexes is received by use of the method, which provides the protein hydrolysis by one or more proteases and its decomposition by one or more non-enzyme methods, with obtaining the AgP population and formation of HSP with AgP complex. The protein agent is obtained from the cells with the same cancer antigenicity that should be treated or prevented in subject, and contains at least 50% or 50 different proteins of original antigen cells or cell fractions. The kit includes the containers with the described composition and treatment agent.

EFFECT: invention provides increased immune response in cancer and improved of therapeutic effect with reduced side action of treatment agent when used in combination with composition.

30 cl, 1 tbl

Antiallergic agent // 2324491

FIELD: medicine; pharmacology.

SUBSTANCE: antiallergic agent is produced by toluene extraction of the birch bark and contains the active components such as betulin, lupeol and O-caffeate taken in particular quantities.

EFFECT: agent is efficient against allergy and doesn't reveal side effects.

11 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: bioactive complex with anti-tumor, antidepressant and wound-healing activities is invented; it contains the secretion of renal tubules of spawning male of thornback - 640-690 mg of solid, and secretion of gills of Atlantic salmon of activated by symbiotic larvae of pearl oyster life cycle - 320-480 mg of solid per 1000 mL of finished product, and five-year-old brandy - the rest. The invented method for treatment of oncology diseases consists in oral administration of the bioactive complex 10-30 mL on an empty stomach 10-40 min before meal not less than twice a day for 2-8 weeks. The invented method for treatment of depressive disorders consists in oral administration of bioactive complex 10-30 mL on an empty stomach 10-40 min before meal not less than twice a day for 2-8 weeks.

EFFECT: invention provides multipurpose ichthyocomplex with powerful anti-inflammatory and antitumor activity and minimal side effects.

6 cl, 6 ex

Indanol derivatives // 2323937

FIELD: chemistry.

SUBSTANCE: invention relates to novel compounds of general formula (I): (where R1 and R2 may be identical or different, and each is a 1,3-substituted aryl with substituents from group α; R3 stands for any of the following groups: -CO-R4, -CO-O-R4, -CO-NH-R4, -CO-CH2-N(Ra)Rb, -(CH2)m-CO-R5, -(CH2)m-R5, -CO-NH-CO-N(Ra)Rb, -CO-NH-SO2-N(Ra)Rb, -CO-NH-CO-(CH2)m-N(Ra)Rb, or -CO-NH2; R4 stands for a lower alkyl, cycloalkyl, cycloalkyl substituted with 1-3 substituent from group α, lower alkenyl, lower alkynyl, halogen-substituted lower alkyl, hydroxyl-substituted lower alkyl, lower alkoxyalkyl, lower aliphatic acyloxyalkyl or lower alkoxycarbonylalkyl; R5 stands for hydroxyl, -OR4 or -N(Ra)Rb; Rа and Rb may be identical or different, each of them stands for hydrogen, hydroxyl, lower alkoxy group, hydroxyl-substituted lower alkoxyl, hydroxyl-substituted lower alkoxyalkyl, lower alkoxy lower alkoxyalkyl, cyano lower alkyl, cyano lower alkoxyalkyl, carboxy lower alkyl, carboxy lower alkoxyalkyl, aliphatic lower alkoxycarbonyl lower alkoxyalkyl, carbamoyl lower alkyl group, carbamoyl lower alkoxyalkyl, lower aliphatic acylamino lower alkyl, lower aliphatic acylamino lower alkoxyalkyl, lower alkylsulphonylamino lower alkyl, lower alkylsulphanylamino lower alkoxyalkyl, (N-hydroxy-N-methylcarbamoyl) lower alkyl, (N-hydroxy-N-methylcarbamoyl) lower alkoxyalkyl, (N-lower alkoxy-N-methylcarbamoyl) lower alkyl, (N-lower alkoxy-14-methylcarbamoyl) lower alkoxyalkyl or R4, or both, including associated nitrogen, stand for nitrogen-containing heterocyclic group or nitrogen-containing 1-3 substituted heterocyclic group with substituents from group α; m is an integer from 1 to 6; А stands for carbonyl; В stands for straight bond; D stands for oxygen atom; Е stands for С14 alkylene; n is an integer from 1 to 3; and α group is a group of substituents, which consist of halogen atoms, lower alkyls, hydroxy lower alkyls, halogen lower alkyls, carboxy lower alkyls, lower alkoxyls, hydroxy lower alkoxyls, hydroxy lower alkoxyalkyls, lower alkoxycarbonyls, carboxyls, hydroxyls, lower aliphatic acyls, lower aliphatic acylamines, (N-hydroxy-N-methylcarbamoyl) lower alkyls, (N-lower alkoxy-N-methylcarbamoyl) lower alkyls, hydroxy lower aliphatic acylamines, amines, carbamoyls and cyano groups), or pharmacologically suitable salt thereof. Invention also relates to pharmaceutical composition and method for disease prevention and treatment.

EFFECT: preparation of novel biologically active compounds.

18 cl, 117 ex

FIELD: chemistry.

SUBSTANCE: invention relates to novel compounds of formula I or pharmaceutically suitable salt or solvate thereof, where dashed line stands for additional bond, а is a number from 0 to 2, b is a number from 0 to 2, n is 2, p is 2, r is 1, М1 stands for nitrogen, М2 stands for С(R3), X stands for either a bond or alkylene group with number of carbon atoms from 1 to 6, Y stands for -С(О)- group, Z stands for a bond, or alkylene group with number of carbon atoms from 1 to 6, or alkenylene group with number of carbon atoms from 1 to 6, or -С(O)-, -CH(CN)-, -SO2- or СН2С(O)NR4- group, R1 stands for groups, R2 stands for six-membered heteroaryl ring with one or two heteroatoms chosen independently of each other from either nitrogen atom or N-O group, other atoms of the cycle being carbon, five-membered heteroaryl ring with one, two, three or four heteroatoms chosen independently of each other from nitrogen, oxygen or sulphur, other atoms of the cycle being carbon, R32 stands for substituded quinoline group, R32 stands for substituted aryl group, heterocycloalkyl group, cycloalkyl group with number of carbon atoms from 3 to 6, alkyl group with number of carbon atoms from 1 to 6, group, where the said six-membered heteroaryl ring or the said five-membered heteroaryl ring may be R6-substituted, R12 independently of others is chosen from an alkyl group with number of carbon atoms from 1 to 6, hydroxyl group or fluorine atom, provided in case R12 stands for hydroxyl or fluorine the rest of R12 cannot be bonded to a nitrogen-bonded carbon atom, or two R12 substituents form an alkyl bridge with number of carbon atoms from 1 to 2, which bonds two non-adjaicent carbon atoms of the ring, R13 independently of the others is chosen from an alkyl group with number of carbon atoms from 1 to 6, hydroxyl group, alcoxy group with number of carbon atoms from 1 to 6, or fluorine atom, provided in case R13 stands for hydroxyl or fluorine the rest of R13 cannot be bonded to a nitrogen-bonded carbon atom, or two R13 substituents form an alkyl bridge with number of carbon atoms from 1 to 2, which bonds two non-adjacent carbon atoms of the ring. See description for meaning of the other structural elements. Invention relates also to pharmaceutical compositions, as well as to application of compounds of formula I.

EFFECT: preparation of novel biologically active substances and pharmaceutical compositions.

20 cl, 659 ex

FIELD: medicine.

SUBSTANCE: method relates to approach of treatment chronic obstructive pulmonary disease (COPD), which includes basic therapy with additional administration of 250 mg oral mexidole BID for 30 days, as immunomodulator. The advantage of this method is recovering therapy in patients with COPD to normalize their immune status with use of effective and affordable medicine.

EFFECT: rate and length of exacerbation are decreased, while remission is extended.

6 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: it is necessary to prepare a patient to therapy due to local treatment of skin and available mucosa of organs subjected to chemo- and/or radiation impact, with butyric extracts of medicinal plants; and introduction of immunomodulating preparation (IMP) and an adsorbent in the course and after the course of radiation and/or chemotherapy. Additionally, one should perorally introduce protective species comprised out of compatible pharmacopoeic medicinal plants matched with possibility for their combined protector action upon tumor-unaffected tissues of sick organ and upon the tissue of all healthy organs being in area of chemo- and/or radiation impact. As IMP and adsorbent mentioned one should apply, correspondingly, a plant adaptogen and a plant adsorbent. Introduction of species, adaptogen and adsorbent should be started while preparing a patient to chemo- and/or radiation therapy to introduce them daily in the course of therapy conducted. Local treatment of skin and mucosa should be fulfilled after each seance of radiation and/or chemotherapy. Species, plant adaptogen and plant adsorbent should be introduced at certain intervals between each other. The innovation enables to decrease traumatism of chemo- and/or radiation therapy.

EFFECT: higher efficiency of prophylaxis and therapy.

14 cl, 7 ex

FIELD: medicine.

SUBSTANCE: the present innovation refers to medicinal preparations and treating immune diseases of skin being sensitive to corticosteroid therapy. Preparation for treating such immune diseases of skin as eczema (atopic, enfantile and eczema nummulare), contact dermatitis, neurodermitis, seborrheic dermatitis, psoriasis contains glucocorticosteroids 0.0005-0.1 g, heparin or heparinoid 3000-20000 U and klotrimazol 0.5-1 g, moreover, as the foundation one should apply solution, hydro-gel, cream, ointment and paste. The presparation suggested decreases the risk for the development of complications induced with application of steroids, and additional simultaneous application of klotrimazol excludes the development of skin candidiasis and further fungal sensitization.

EFFECT: higher efficiency of therapy.

1 cl, 1 dwg, 7 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: the present deals with compositions, kits and their usage for manufacturing medicinal preparations for treating immuno-inflammatory disorders out of the group consisting of rheumatoid arthritis, psoriasis, ulcerous colitis, Crohn's disease, ankylosing spondylitis, multiple sclerosis (MS), type I diabetes, systemic lupus erythematosus, Sjogren's syndrome, fibromyalgia and insult-induced lethality of cerebral cells and, also, for suppressing the production of one or more pro-inflammatory cytokines. The compositions suggested contain the combination of two active ingredients: (i) dipyridamol and (ii) corticosteroid. Such a combination provides the suppression of immune inflammation due to decreasing pro-inflammatory cytokines, such as TNFα by hundreds times.

EFFECT: higher efficiency.

54 cl, 4 ex, 3 tbl

FIELD: medicine.

SUBSTANCE: the present innovation deals with treating and preventing the loss of bony tissue and/or increased development of bony tissue. For this purpose it is necessary to apply 15-lipoxygenase inhibitors. These molecules could be introduced either individually or in combination with agents that inhibit the resorption of bony tissue or additional agents that regulate calcium resorption out of bony tissue or increase the accumulation of bony tissue. The innovation enables to widen the assortment of medicinal preparations for treating diseases associated with the loss of bony tissue, such as osteoporosis, osteoarthritis, Paget's disease and those of periodontium and, also, the fractures.

EFFECT: higher efficiency of therapy.

16 cl, 9 dwg, 7 ex, 5 tbl

Up!