Recombinant plasmid dna pfastbac-b9rz containing fragment of mankeypox virus genome, encoding interferon-gamma-binding protein and strain of baculovirus bvb9rz producing soluble interferon-gamma-binding protein of mankeypox virus

FIELD: biotechnology, in particular gene engineering.

SUBSTANCE: Gene of B9R protein having high homology with extracellular segment of interferon-gamma receptor is isolated by PCR method from Mankeypox virus genome of strain Zaire-96-1-16. Then said protein is cloned in donor plasmid pFastbAC and via site-specific transposition recombinant bacmid is constructed. Said bacmid is used for pest cell transfection to generate target strain.

EFFECT: new drugs for treatment of human diseases associated with hyperproduction of interferon-gamma.

2 cl, 3 dwg, 6 ex

 

The invention relates to biotechnology, in particular genetic engineering, and can find application as a drug of a new generation to fight with severe human diseases associated with overproduction of interferon gamma (IFNg).

Interferon - species-specific secreted glycoproteins, which are divided into two types (a/b and g). Interacting with corresponding cellular receptors, they induce the emergence of antiviral state [1]. Interferons are multifunctional cytokines, one of the most important regulators of inflammatory and immune reactions in response to viral infection. However, violations of the controlled products IFNg play a critical role in the etiology of the development of a number of human diseases, such as Crohn's disease [2], diabetes [3], rheumatoid arthritis [4], systemic lupus erythematosus [5], psoriasis [6]. Success in the treatment of these diseases will depend on how quickly and effectively able to reduce the level of IFNg in the body of the patient. Currently, there is a positive experience in the use of polyclonal [7, 8, 9, 10] and monoclonal antibodies [11] for the treatment of autoimmune diseases. Preparation of humanized monoclonal antibodies is currently in the second stage of clinical trials [11]. There are also drugs "Anather the h" and "Anaferon for children" (per. ID R N 000372/01-2001), prepared on the basis of affinity-purified antibodies containing the activated form of ultra-low doses of monoclonal, polyclonal, or natural antibodies to IFNg, obtained mainly by homeopathic technology, used for the treatment of influenza and ARVI [12].

Another method of treating diseases associated with high levels of IFNg in the body of the sick people, is the use of soluble IFNg-binding proteins - receptors of the cytokine. These proteins were isolated from urine [13, 14] or from human cells (WISH, HeLa, FS11...) [15]. However, the process of obtaining IFNg receptors from these sources is time-consuming and does not allow to obtain the drug in sufficient quantities.

Closest to the claimed approach is the use as a means of anti-IFNg therapy recombinant IFNg receptors. Recombinant soluble form of human IFNg receptor and several antibodies to these receptors are described in several U.S. patents [16, 17]. Received genetic engineering methods cDNA encoding IFNg-binding protein, clone and Express in E. coli cells, with the resulting product must be glycosylamine. These receptors and antibodies after further study, it is assumed to use as antagonists of IFNg, in particular for the treatment of autoimmunization.

Analysis of the nucleotide sequence of the genome of Monkeypox virus (SBI) has identified open frame broadcast B9R encoding a protein having a high degree of homology with the extracellular segment of the interferon gamma receptor [18]. This protein is one of the components of the system, allowing the Monkeypox virus effectively overcome the immune response of the human body.

An object of the invention is to expand the range of new-generation drugs for the treatment of human diseases associated with overproduction of interferon gamma.

The problem is solved by creating a recombinant baculovirus - producer soluble IFNg-binding protein. The first step in creating the producer strain is the construction of recombinant plasmid DNA pFastBac-B9RZ containing a fragment of the genome of Monkeypox virus that encodes the amino acid sequence of IFNg-binding protein.

The target plasmid pFastBac-B9RZ (figure 1) has a size 5628 standards P.N. and molecular weight 3.85 MDA and consists of

fragment of the genome of Monkeypox virus strain Zaire-96-I-16 length 868 BP encoding IFNg-binding protein;

- vector plasmid pFastBac [19] long 4760 P.N., providing site-specific transposition of the target DNA fragment into the genome of the baculovirus.

Recombinant baculovirus obtained is the result of site-specific transposition of the target DNA fragment from the donor plasmid pFastBac-B9RZ in baculovirus vector (bacmid), in E. coli [18], after infection of Sf21 insect cells produce soluble protein Monkeypox virus strain Zaire-96-I-16 - similar receptor IFNg person.

As a fragment of the genome of the virus Monkeypox use DNA fragment length 868 BP obtained using polymerase chain reaction. Matrix for the amplification of DNA is of Monkeypox virus strain Zaire-96-I-16. Oligonucleotide primers for amplification of IFNg-binding protein Monkeypox virus have the following structure:

1. 5′CGGGATCCATGAGATATATTATAATTCTCGCAGTTTTG 3′

2. 5′GGAATTCACCAGTGTATAATATGCAGTTTTATTTCAT 3′

In the structure of primers 1 and 2 laid the recognition sites of the restriction endonucleases BamHI and EcoRI, respectively (highlighted in the sequence of the primers in bold italics). As a plasmid vector, providing site-specific transposition of the target DNA fragment in bacmid pMON14272 [18], using plasmid pFastBac [18], containing baculovirus specific promoter pPolh for protein expression in insect cells, mini-Tn7-transposon, the resistance genes for ampicillin and gentamycin, polylinker for cloning the target gene and the signal for polyadenylation of the virus SV-40. Bacmid pMON14272 contains miscompiles mini-F replicon, a gene for resistance to kanamycin and the DNA fragment encoding α-donor peptide β-galactosidase of E. coli, and provides 1 the complementation during the reproduction of the strain E. coli DH10BacTMin the presence of a chromogenic substrate X-gal and the inducer IPTG.

Selected baculovirus expression system provides a high level of synthesis of the target product and its proper post-translational modification in comparison with other systems of expression.

The invention consists in that the DNA fragment containing the gene of interferon gamma-binding protein B9R of Monkeypox virus strain Zaire-96-I-16, is obtained by PCR from the viral genome, then the gene is cloned into the donor plasmid pFastBac and by site-specific transposition in bacterial cells produce recombinant bacmid used for transfection of insect cells, resulting generated recombinant virus BvB9RZ expressing the indicated gene. The nucleotide sequence of the embedded fragment is shown in figure 2.

The strain is characterized by the following features.

Morphological features. The strain has properties typical representative of baculoviruses, but unlike a virus vector has the phenotype Lac-.

Physiological and biochemical characteristics and cultural properties of the strain. DNA recombinant baculovirus has a length of about 140000 P.N. the Presence in its genome of the target insertion length 868 BP confirmed by OSU PCR method. When the reproduction of recombinant baculovirus for the culture of insect cells Spodoptera frugiperda (Sf21) his title is no different from the titer obtained by multiplication of the virus, not containing in its genome a foreign DNA fragments.

The main difference of the strain is its ability to synthesize IFNg-binding protein SBI during infection with them the culture of insect cells Sf21.

The resulting strain recombinant baculovirus BvB9RZ deposited in the collection of microorganisms of the State research center of Virology and biotechnology "Vector" for number V-356 from 15.08.05

The invention is illustrated by the following figures graphics:

Figure 1 Physical map of the plasmid pFastBac-B9RZ. For the first nucleotide plasmid is A nucleotide ministrone region phage f1; Tn7L, Tn7R - fragments of transposon Tn7; SV40polyA site of SV40 virus polyadenylation; B9R - gene interferon gamma-binding protein SBI strain Zaire-96-I-16; pPolh - polyhedrin promoter; Ori - the site of replication initiation; Apr, Gmrmarkers of resistance to ampicillin and gentamicin, respectively.

Figure 2. The nucleotide sequence of the gene B9R SBI (strain Zaire-96-I-16) and location specific primers (shown in bold) on the matrix. The sites of the restriction endonucleases BamHI and EcoRI, used in the construction of plasmid integration pFastBac-B9RZ shown a single the first underscore. Initiation and termination codons IFNg-binding protein SBI shown double underlined.

Figure 3. Electrophoretic analysis in 1% agarose, PCR fragments containing interferon gamma-binding protein SBI amplified using specific primers with DNA SBI (lane 3), the plasmid pFastBac-B9RZ (lane 4) and with bacmid bMON14272-B9RZ (track 5). Lane 1 - marker length "bp 100 (SibEnzyme", Russia), lane 2 - negative control.

For a better understanding of the invention the following are examples of its implementation.

Example 1. The method of amplification of a DNA fragment containing a gene IFNg-binding protein SBI.

Reaction amplification is carried out in Eppendorf tubes in a volume of 50 μl in amplifiers with a hot lid. The reaction mixture contains 10 mm Tris-HCl pH 8.8, 50 mm KCl, 2.5 mm MgCl2, 0.1% Tween 20, 0.2 mm dATP, 0.2 mm dCTP, 0.2 mm dGTP, 0.2 mm dTTP, oligonucleotide primers of 10 pmol each, 2 Ada. Tth polymerase, 2-10 ng DNA template.

Amplification was performed for 30 cycles according to the following scheme:

The presence of the amplified product is checked by electrophoresis in 1% agarose gel (figure 3).

Example 2. Construction of recombinant plasmid DNA pFastBac-B9RZ.

5-10 μg of plasmid pFastBac [18] and 1-5 μg of the amplified product corresponding gene B9R SBI, hydrolyzing endonucleases, R is stricly BamHI and EcoRI in standard conditions. The resulting fragments are electrophoresis in 1% agarose gel, followed by elution. 0.2 μg of the vector and 0.6 μg of the fragment are ligated under standard conditions and received ligase mixture transform competent cells of E. coli strain XL-blue. Cellular Apr-clones grown at 37aboutC in LB medium containing 100 μg/ml ampicillin, until the stationary phase. Recombinant plasmid DNA secrete according to standard methods and analyzed using restriction endonucleases BamHI and EcoRI. Clones containing an embedded fragment, isolated plasmid DNA, whose structure in the area of building-certify definition nuleotide sequence by the method of termination of the synthesized circuit for automatic sequencing machine ABM PRISMTM310 (Perkin Elmer, USA). Thus obtained target plasmid denote pFastBac-B9RZ.

Example 3. Getting backside pMON14272-B9RZ.

To 100 μl of competent cells of E. coli strain DH10BacTMadd 1 ng of plasmid pFastBac-B9RZ. The resulting mixture was incubated in ice for 30 min, then at 42aboutWithwithin 45 seconds and then cooled in ice for 2 minutes, the Reaction mixture was diluted 1:10 in LB-broth and pokasivaut on the rocking chair with intensive aeration at 37aboutWith over four hours. Next, cells are plated on selective medium LB-agar containing 100 μg/ml X-gal, 40 μg/ml IPTG, 50 μg/ml kanamycin 7 μg/ml gentamicin, 10 μg/ml tetracycline, and incubated in a thermostat at 37aboutWith during the day. Clones with the Lac phenotype-sow in a test tube with 5 ml LB-broth containing 50 μg/ml kanamycin, 7 ág/ml gentamicin, 10 μg/ml tetracycline and grown under intensive aeration at 37aboutWithto the stationary phase. The culture is transferred into 1.5 ml Eppendorf tubes, precipitated cells by centrifugation for 40 sec at 14000g, remove the environment. The process of adding the culture, deposition and removal environment, repeat two more times. Sediment resuspended in 0.3 ml of solution 1 (10 mm EDTA, 15 mm Tris-HCl pH 8.0, 100 μg/ml RNase), add 0.3 ml of solution 2 (0.2 M NaOH, 1% SDS) and incubated at room temperature for 5 minutes To the mixture slowly add 0.3 ml of solution 3 (3 M KAc pH 5.2). Incubated in ice for 10 min. and Centrifuged at 14000 g for 10 min. the Supernatant transferred to a clean tube, add 0.8 ml of isopropanol, stirred and cooled at -20about5 min, then precipitated at 14000 g for 15 minutes the Precipitate is washed two times with ethanol, dried, dissolved in 40 μl of TE buffer. The presence in the genome backside integrated DNA fragment confirmed by PCR. Received backmenu DNA pMON14272-B9RZ used for transfection of insect cells line Sf21.

Example 4. Transfection of Sf21 insect cells recombinant backmenu DNA pMON14272-B9RZ and receiving recombinant virus.

The Sf1 cells seeded in wells of a 6-hole tablet based, so the next day was the monolayer (2×106cells/well). The next day, prepare two solutions: 10 μl of viral DNA+100 ál of medium Grays and 6 μl of CellFECTIN reagent company LifeTechnologies (USA)+100 ál environment of Grace. The solutions are mixed, incubated at room temperature for 25 minutes At this time, wash the monolayer cells twice with medium Grays. To the cells was added 0.8 ml/well of medium Grays and 200 μl of the prepared solution. Incubate cells at 28aboutC for 5 hours After that, select the environment and add to the cells in 2 ml medium Grace with 10% fetal serum of cows (ESC) (OOO Biolot", Russia). Cells incubated at 28aboutWith in 2-5 days. The cells resuspended (intensive pipetting), centrifuged 5 min at 5000 g and the clear supernatant Packed in sterile tubes. The titer of the virus is determined as follows. The monolayer cells Sf21 add 200 ál of dilution of the virus and carry out adsorption for 60 min at room temperature. Next, prepare a 2% low-melting the agarose (Sigma, USA) and mix it in molten form with the environment, Grace c 10% ESK in the ratio of 1:1. The resulting medium is cooled in thermostat to the 37aboutWith and add 2 ml per well, and after hardening, add 2 ml per well of medium Grace with 10% ESK. Incubated in a thermostat at 28aboutWith 5 days. Next, add 2 ml per well is racial neutral red, dissolved in an environment of Grace with 10% of the ESK, in the ratio of 1:20. Incubated at 28aboutWith during the day. The titer is determined by counting stained plaques. The last is 107PFU/ml Suspension of recombinant virus stored at -20aboutC.

Example 5. Infection of Sf21 insect cells with the recombinant virus.

200 ál of thawed viral material with a titer of 107put on a monolayer of Sf21 insect cells in the mattress for the cultivation volume of 25 ml is Incubated for 30 min at room temperature. After incubation, add 2 ml of medium Grace with 10% ESK. Incubated at 28aboutWith in 2-3 days. The cells resuspended intensive pipetting and centrifuged 5 min at 5000 g. The clarified supernatant analyzed in the test for ability to inhibit the protective effect hIFNg virus encephalomyocarditis mice (WEBCM) on the culture of lung cells from a human embryo L68.

Example 6. Determination of biological activity of the expression product of the gene B9R.

The biological activity of the expression product of the gene B9R determined by its ability to inhibit the protective effect hIFNg from VAMK on the culture of lung cells from a human embryo L68. Cell line L68 cultured in 200 μl of DMEM medium with 10% fetal cow serum before the formation of the cell monolayer 75-85% of the surface of the wells of 96-well plate. PR is achieving the required density cell growth medium replaced with 200 μl of DMEM medium with 2% fetal cow serum, containing lysates of Sf21 cells infected with recombinant baculovirus (100 µl per well and serial twofold dilution) and the drug hIFNg (4 ng/ml, which according to preliminary determination of protective action hIFNg corresponds to three times the dose that provides 50% of the protective effect of VAMK). Tablets incubated at 37aboutWith CO2-incubator (concentration of CO2was 5%). As controls using wells containing cells L68; cells L68+VARV IFNgBP; cells L68+MPXV-IFNgBP; cells L68+WALKM giving background value (0%) optical density; cell L68+hIFNg, giving 100% optical density; cell L68+WALKM+hIFNg. The number of viable cells determined two days after infection WEBCM staining dye neutral red [20]. The density measurement is performed on the device Microplate Reader ELX808 (BIO-TEK INSTRUMENTS, INC, USA). The results are expressed as percentage of surviving cells relative to the number of cells in the control samples. Each sample was taken in three iterations, and the average survival rate is calculated by the formula:

(SoWEBCM+IFNg+IFNgBPOPWEBCM)/(OPIFNgOPWEBCM)×100%

According to the inhibition of protective action hIFNg from VAMK on the cell culture L68 at a concentration in the culture medium hIFNg 4 ng/ml 50% bend the b cells is achieved by adding 100 μl of culture medium of Sf21 cells, infected with recombinant virus BvB9RZ, with a multiplicity of infection of 0.01 PFU per cell on the seventh day of infection.

Thus, the resulting recombinant baculovirus BvB9RZ providing for the expression of interferon gamma-binding protein B9R of Monkeypox virus strain Zaire-96-I-16 in insect cells line Sf21. The resulting strain can be used to develop therapeutic drug of a new generation to fight human diseases associated with overproduction of interferon gamma.

1. Recombinant plasmid DNA pFastBac-B9RZ, bearing a fragment of the genome of Monkeypox virus strain Zaire-96-I-16 encoding soluble interferon-gamma binding protein, providing site-specific transposition of the target DNA fragment into the genome of the baculovirus, size 5628 standards P.N. and molecular weight of 3.85 hmm, containing

The PCR fragment of the genome of Monkeypox virus strain Zaire-96-I-16, containing the gene B9R obtained using primers

5′- CGGGATCCATGAGATATATTATAATTCTCGCAGTTTTG - 3′ and

5′- GGAATTCACCAGTGTATAATATGCAGTTTTATTTCAT - 3′,

encoding interferon-gamma binding protein, flanked by recognition sites of the restriction endonucleases BamHI and EcoRI, size 868 P.N.;

BamHI-EcoRI fragment of the vector plasmid pFastBac size 4760 P.N., including the surrounding baculovirus promoter pPolh, mini-Tn7-transposon and the signal for polyadenylation of the virus SV-40, providing site-specific transposition DNA gene B9R into the genome of the baculovirus;

genetic markers:

gene b-lactamase, which determines resistance to ampicillin;

gene aminoglycosides determining resistance to gentamicin;

unique restriction sites: BamHI (4033), EcoRI (4907).

2. The strain of recombinant baculovirus BvB9RZ obtained using the recombinant plasmid DNA pFastBac-B9RZ according to claim 1, deposited in the Institute of ECR number V-356, producing a soluble interferon-gamma binding protein encoded by the gene B9R of Monkeypox virus.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention relates to living attenuated recombinant influenza virus strains expressing earlier secretory antigen Mycobacteriun tuberculosis ESAT-6. Invention is useful in tuberculosis treatment and prophylaxis.

EFFECT: recombinant influenza virus vector with increased protective effect.

7 cl, 14 dwg, 11 tbl, 8 ex

FIELD: veterinary.

SUBSTANCE: claimed method includes application of chimera flavivirus, including capsid and non-structural proteins of yellow fever virus, prM protein, and envelope protein of West Nile encephalitis virus as drug for prophylaxis of infection caused by West Nile virus in horses.

EFFECT: prophylaxis of infection caused by West Nile virus in horses.

2 tbl

FIELD: gene engineering.

SUBSTANCE: recombinant fragmid DNA pHEN-TAB, containing unique human single-strand antibody gene is selected from constructed in vitro combinatorial phage library udder controlling of lactose operon promoter. Then Escherichia coli HB2151 cells are transformed with obtained fragmid DNA to produce recombinant bacterium strain Escherichia coli HB2151/pHEN-TAB as producer of human single-strand antibody capable of binding of human tumor necrosis factor alpha. Said antibody gas affinity constant of Kaf = 3.96±0.52x108 M-1.

EFFECT: new soluble human single-strand antibody scTAB against human tumor necrosis factor alpha with high affinity.

3 cl, 6 dwg, 6 ex

FIELD: genetic engineering, virology.

SUBSTANCE: invention proposes a method for preparing the attenuated recombinant strain of the influenza virus A.Method involves preparing the recombinant NS segment of influenza virus A comprising the functional RNA-binding domain and modification of its gene sequence below nucleotide 400 in the gene NS1. This modification prevents translation of the remaining moiety of the gene NS1. Also, invention proposes the genetic-engineering strain of influenza virus A, vaccine comprising thereof, and the recombinant segment of the gene NS of influenza virus A. The prepared genetic engineering strain of influenza virus A possesses the interferon-inducing effect and retains the interferon-nonsensitive natural phenotype and able to induce response as production of interferon in MDCK cells and in fertilized chicken eggs, and to grow in latter. Invention can be used in medicine and virology.

EFFECT: improved and valuable properties of recombinant virus.

17 cl, 20 dwg, 6 ex

FIELD: genetic engineering, virology, medicine.

SUBSTANCE: invention relates to method for production of modified Vaccinia virus Ankara (MVA). Claimed method includes contamination of mammalian continuous cell line with Vaccinia virus Ankara (MVA) of wild type, followed by viruses cultivation and collection. Further fresh cells of the same cell line are infected with newly formed viruses. Abovementioned steps optionally are repeated. Also disclosed are strains of modified Vaccinia virus Ankara (MVA) and utilization thereof. Said strains are capable to growth in continuous cell lines.

EFFECT: strains having decreased virulence in relates to mammalians.

20 cl, 5 tbl

FIELD: biotechnology, medicinal virology, medicine.

SUBSTANCE: invention describes isolated strain of human hepatitis B virus "S"-133 Ooh comprising genome of subtype adr that is deposited in the European collection of cellular cultures at № P 97121504 or P 97121505 or P 97121506 and encoding polypeptide of basic surface antigen of human hepatitis B virus. Abovementioned antigen comprises mutation in amino acid sequence (polypeptide), namely, methionine at 133 position is replaced with threonine. Invention discloses variants of isolated nucleic acids encoding the mutated polypeptide and variants of isolated nucleic acids encoding peptides showing properties of the indicated polypeptide. The description text gives nucleotide sequences of nucleic acid variants encoding abovementioned polypeptide and peptides. Also, invention describes variants of vectors used in cloning DNA fragments of mutant human hepatitis B virus comprising isolated nucleic acid and isolated nucleic acid bound functionally with RNA transcription promoter respectively and wherein each isolated nucleic acid encodes indicated polypeptide. Invention discloses methods for producing polypeptide and peptide and methods for preparing the purified polypeptide and peptide by using indicated vectors. Also, invention describes purified polypeptides and peptides of mutated antigen retaining antigenic properties of polypeptides of the natural human hepatitis B virus, and methods for preparing antibodies raised to them and anti-antibodies, among them, monoclonal antibodies. Also, invention discloses different methods for using abovementioned isolated nucleic acids, polypeptides and peptides for aim for diagnosis and treatment of diseases associated with human hepatitis B virus. Using the proposed invention provides the development of diagnosis schedules and treatment of diseases associated with the mutated human hepatitis B virus.

EFFECT: valuable medicinal properties of mutant virus.

66 cl, 2 dwg, 4 ex

FIELD: genetic engineering, virology, pharmacy.

SUBSTANCE: invention proposes the recombinant modified virus OF VACCINE Ankara able to express structural antigens of hepatitis C virus. Virus comprises DNA sequences encoding structural antigens of hepatitis C virus or their functional regions or epitopes of hepatitis C virus structural antigens. Also, invention proposes a pharmaceutical composition comprising such virus, eucaryotic cell infected with such virus, a method for preparing such virus and a method for preparing hepatitis C virus structural polypeptides. Invention can be used in virology and medicine for preparing hepatitis C virus antigen.

EFFECT: valuable properties of virus.

20 cl, 14 dwg, 1 tbl

FIELD: medicine, genetic engineering.

SUBSTANCE: invention proposes a method that involves construction of bacteriophage library of random peptides based on oligonuleotide fragments encoding their, selection of bacteriophages binding with target-cells but not binding with cells of other types that can be involves in pathological process or able to show effect on its diagnosis and therapy, and confirmation of specificity of selected bacteriophages by using combination of different tests. Oligonucleotide fragments encoding random peptides are prepared by reaction of reverse transcription by using random primers and total RNAs isolated from indicated target-cells and cells of other types. Applying this invention provides preparing bacteriophages binding with target-cells with high degree of selectivity. Invention can be used in diagnosis, therapy and pharmaceutical industry.

EFFECT: improved preparing method.

3 cl, 2 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: composition is used for producing vaccines for preventing infectious diseases to occur, treating allergy and malignant neoplasm cases. Various invention embodiments comprise virus, virus-like particle, viral capsid particle, fag or their recombinant forms covered with any desired antigen highly ordered and having repetitions that is achieved owing to specific interactions taking place. Multi-functional process based on cassette-type system (alpha-vaccine techniques) allows one to produce antigen-coated viral particles like hepatitis B virus or measles virus.

EFFECT: causing marked immune response.

44 cl, 7 dwg

The invention relates to medicine and relates to a vaccine containing mutant herpes virus

FIELD: gene engineering.

SUBSTANCE: the present innovation deals with the ways for obtaining transgenic poultry due to introducing retroviral vectors into blastodermal cells through the fissure in the shell of nonhatching egg from the side of its blunt end. With the help of insulin syringe one should introduce gene constructions for the depth of about 2-3 cm near a germinal disk. The innovation enables to simplify the procedure of introducing gene constructions into target cells at maintaining general efficiency of transgenesis that leads to the decrease of embryonic lethality.

EFFECT: higher efficiency.

FIELD: biotechnology, virology, medicine.

SUBSTANCE: invention relates to attenuated virus derived from modified Ankara vaccina virus. Said virus are not able for reproduction by replication in human cell lines. Also disclosed are application of virus or recombinant variants thereof as drug or vaccine, as well as method for inducing of immune response in patients with defected immunity, in patients having immunity to vaccine virus, or in patient during antiviral therapy.

EFFECT: variant of Ankara vaccina virus effective in medicine and veterinary.

86 cl, 15 dwg, 1 tbl, 2 ex

FIELD: biotechnology, medicine, in particular viral disease treatment.

SUBSTANCE: invention relates to recessive dividing retroviral vector useful in inhibition of wild-type retrovirus replication. Vector contains retroviral long terminal repeat sequences; retroviral packing signal; nucleotide sequence encoding (expressing) genetic antiviral agent; and optionally the second nucleotide sequence. Disclosed are method for production of said vector and reproduction thereof. Further isolated and purified nucleic acid (NA) molecule providing of selective advantage in regard to viral generation packing into virions is disclosed. Uses of retroviral vector in particular for specific antibody production are described.

EFFECT: new genetic antiviral agents generating prolonged and stable immunological responses in regard, for example, to AIDS and cancer viruses.

97 cl, 11 ex

FIELD: biotechnology, medicine, in particular viral disease treatment.

SUBSTANCE: invention relates to recessive dividing retroviral vector useful in inhibition of wild-type retrovirus replication. Vector contains retroviral long terminal repeat sequences; retroviral packing signal; nucleotide sequence encoding (expressing) genetic antiviral agent; and optionally the second nucleotide sequence. Disclosed are method for production of said vector and reproduction thereof. Further isolated and purified nucleic acid (NA) molecule providing of selective advantage in regard to viral generation packing into virions is disclosed. Uses of retroviral vector in particular for specific antibody production are described.

EFFECT: new genetic antiviral agents generating prolonged and stable immunological responses in regard, for example, to AIDS and cancer viruses.

97 cl, 11 ex

FIELD: genetic engineering, proteins, medicine, pharmacy.

SUBSTANCE: invention relates to a method for preparing a fused protein representing immunoglobulin Fc-fragment and interferon-alpha and can be used in treatment of hepatitis. Method involves construction of a fused protein comprising immunoglobulin Fc-fragment prepared from Ig G1 or Ig G3 in direction from N-end to C-end and the end protein comprising at least one interferon-alpha. Fc-fragment and the end protein are joined directly or by a polypeptide bridge. The fused protein is used for preparing a pharmaceutical composition used in treatment of liver diseases and in a method for targeting interferon-alpha into liver tissues. Invention provides preparing the fused protein eliciting with biological activity of interferon-alpha providing its concentrating in liver and showing enhanced solubility, prolonged half-time life in serum blood and enhanced binding with specific receptors.

EFFECT: improved targeting method, valuable biological properties of fused protein.

10 cl, 5 dwg, 9 ex

FIELD: genetic engineering, proteins, medicine, pharmacy.

SUBSTANCE: invention relates to a method for preparing a fused protein representing immunoglobulin Fc-fragment and interferon-alpha and can be used in treatment of hepatitis. Method involves construction of a fused protein comprising immunoglobulin Fc-fragment prepared from Ig G1 or Ig G3 in direction from N-end to C-end and the end protein comprising at least one interferon-alpha. Fc-fragment and the end protein are joined directly or by a polypeptide bridge. The fused protein is used for preparing a pharmaceutical composition used in treatment of liver diseases and in a method for targeting interferon-alpha into liver tissues. Invention provides preparing the fused protein eliciting with biological activity of interferon-alpha providing its concentrating in liver and showing enhanced solubility, prolonged half-time life in serum blood and enhanced binding with specific receptors.

EFFECT: improved targeting method, valuable biological properties of fused protein.

10 cl, 5 dwg, 9 ex

FIELD: gene engineering, in particular apoptosis inducing gene delivery vectors useful for cancer, hyperplasia, metaplasia and displasia diagnosis and treatment.

SUBSTANCE: recombinant adenovirus apoptin-containing vectors are obtained by cotransfection into 911 helper cell line of p.Amb-VP3 adaptor plasmids (in case of VP3 protein expression) or pMAb-VP2 plasmids (in case of VP2 protein expression) and JM17 DNA. p.Amb-VP3 plasmids carry apoptin gene in 5'-3'-orientation, expressing under control of adenoviral main late promoter. Plasmid JM17 DNA contains complete adenoviral DNA excepted E1 and E2 regions. pMAb-°VP2 plasmids carry apoptin gene with two point mutation in limits of coding region. Cotransfections are carried out by calcium phosphate method. Recombinant adenoviral DNA is formed by homologous recombination between homologous viral sequences representing in p.Amb-VP3 (or pMAb-VP2) plasmid and in adenoviral DNA from plasmid JM17 DNA. Cell infection of various human tumors with gene delivery vectors causes to tumor cell apoptosis induction and sufficiently reduced normal, diploid, non-transformed or non-pernicious cell apoptosis.

EFFECT: new gene delivery vector capable to induce cell apoptosis.

8cl, 7 dwg

FIELD: gene engineering, in particular apoptosis inducing gene delivery vectors useful for cancer, hyperplasia, metaplasia and displasia diagnosis and treatment.

SUBSTANCE: recombinant adenovirus apoptin-containing vectors are obtained by cotransfection into 911 helper cell line of p.Amb-VP3 adaptor plasmids (in case of VP3 protein expression) or pMAb-VP2 plasmids (in case of VP2 protein expression) and JM17 DNA. p.Amb-VP3 plasmids carry apoptin gene in 5'-3'-orientation, expressing under control of adenoviral main late promoter. Plasmid JM17 DNA contains complete adenoviral DNA excepted E1 and E2 regions. pMAb-°VP2 plasmids carry apoptin gene with two point mutation in limits of coding region. Cotransfections are carried out by calcium phosphate method. Recombinant adenoviral DNA is formed by homologous recombination between homologous viral sequences representing in p.Amb-VP3 (or pMAb-VP2) plasmid and in adenoviral DNA from plasmid JM17 DNA. Cell infection of various human tumors with gene delivery vectors causes to tumor cell apoptosis induction and sufficiently reduced normal, diploid, non-transformed or non-pernicious cell apoptosis.

EFFECT: new gene delivery vector capable to induce cell apoptosis.

8cl, 7 dwg

FIELD: gene engineering, in particular apoptosis inducing gene delivery vectors useful for cancer, hyperplasia, metaplasia and displasia diagnosis and treatment.

SUBSTANCE: recombinant adenovirus apoptin-containing vectors are obtained by cotransfection into 911 helper cell line of p.Amb-VP3 adaptor plasmids (in case of VP3 protein expression) or pMAb-VP2 plasmids (in case of VP2 protein expression) and JM17 DNA. p.Amb-VP3 plasmids carry apoptin gene in 5'-3'-orientation, expressing under control of adenoviral main late promoter. Plasmid JM17 DNA contains complete adenoviral DNA excepted E1 and E2 regions. pMAb-°VP2 plasmids carry apoptin gene with two point mutation in limits of coding region. Cotransfections are carried out by calcium phosphate method. Recombinant adenoviral DNA is formed by homologous recombination between homologous viral sequences representing in p.Amb-VP3 (or pMAb-VP2) plasmid and in adenoviral DNA from plasmid JM17 DNA. Cell infection of various human tumors with gene delivery vectors causes to tumor cell apoptosis induction and sufficiently reduced normal, diploid, non-transformed or non-pernicious cell apoptosis.

EFFECT: new gene delivery vector capable to induce cell apoptosis.

8cl, 7 dwg

FIELD: biotechnology, veterinary science.

SUBSTANCE: invention relates to therapeutic vector used in therapy of infectious diseases in cats that comprises at least one foreign nucleic acid each of that (a) encodes protein taken among the group consisting of feline protein CD28 represented in SEQ ID NO:8 or its immunogenic moiety; feline protein CD80 represented in SEQ ID NO:2 or 3, or its immunogenic moiety; feline protein CD86 represented in SEQ ID NO:6 or its immunogenic moiety, or feline protein CTLA-4 represented in SEQ ID NO:10 or its immunogenic moiety; and (b) nucleic acid that is able to be expressed in insertion of vector in the corresponding host. Indicated therapeutic vector is used in effective dose as component of vaccine against infectious diseases in cats for their immunization and in methods for enhancement or inhibition of immune response in cats and reducing or eradication of tumor in cats. Invention provides stimulating the activation and proliferation of T cells and to enhance effectiveness of control of infectious diseases in cats.

EFFECT: valuable biological properties of recombinant virus.

41 cl, 13 dwg

FIELD: biotechnology, protein engineering.

SUBSTANCE: claimed library represents E.coli TGI cells wherein each cell contains fragmid DNA providing biosynthesis of filamentous bacteriophages exposing unique human single-stranded antibody on surface thereof. Also disclosed is recombinant fragmid pHEN-2A8 DNA containing artificial gene of human single-stranded antibody under control of lactose operon promoter providing synthesis of human single-stranded antibody in composition of chimerical protein with membrane pIII protein of M13 bacteriophage in E.coli cells. Also disclosed is method for production of artificial human single-stranded 2A8 antibody by using such fragmid DNA.

EFFECT: fragmid library useful in medicine.

3 cl, 7 dwg, 10 ex

Up!