Yeast pichia pastoris x-33/2albumin strain for secretion of human albumin

FIELD: gene engineering, in particular yeast strain modified by introducing of foreign genetic material.

SUBSTANCE: claimed strain is obtained by transforming of starting culture Pichia pastoris X-33 with two albumin structural genes with signals of yeast alpha-factor secretion, transcribed under control of 5'AOX1 promoter and transcription termination region of hepatitis G virus. Strain of present invention is useful in production of albumin-containing drugs.

EFFECT: strain for production of human recombinant albumin of increased yield.

3 ex

 

The present invention relates to genetic engineering, the method of recombinant DNA, and yeast, modified by introduction of foreign genetic material, and can be used in the production of aluminothermic medication.

Currently, the most common ways of obtaining albumin are chemical methods, in particular, the fractionation of blood plasma, the denaturation of ballast proteins, extraction of albumin aluminothermic precipitation. The disadvantages of chemical methods include raw materials shortage and the danger of contamination of the final product with pathogenic organisms. In addition, chemical methods are inefficient, with low yield of the final product.

The technology of human albumin, not depending on the amount of resources and the risk of infection from pathogenic organisms of the final product, is genetic engineering. One of the known methods of genetic engineering is the method of recombinant DNA, providing for the transfer of the structural gene for albumin using isolated from the cells of the donor DNA into the cell producer. As producers use various strains of microorganisms, in particular strains of yeast. Using yeast reduces the probability content of pathogenic organisms in al is amine and reduces the complexity of the manufacturing process. In addition, the absence of toxic components in yeast allows the use of albumin as a basis for medicines.

According to the patent EP 0361991, 1990, AT 37/02, C12N 1/19, C12N 15/14 producer in the process of synthesis of albumin are the yeasts Saccharomyces cerevisiae and Kluyveromyces marxianus var. Lactis, chromosome integrated structural gene albumin containing native secretion signal and transcribed under the control of the promoter region of the transcription termination of phosphoglycerate kinase. The disadvantage of this system is the low level of synthesis of albumin and significant costs on the selection and purification of the final product.

Using the methylotrophic yeast of the genus Pichia leads to a significant increase of albumin human. To obtain albumin as producers use different yeast strains of the genus Pichia: Pichia pastoris GS115 (NRRL Y-15851), Pichia pastoris GS190 (NRRL Y-18014), Pichia pastoris PPFI (NRRL Y-18017), Pichia pastoris (NRRL Y-11430), Pichia pastoris (NRRL Y-11431) [EP 0510693, 1992, C12N 1/15, C12N 15/14], Pichia pastoris GS115 [EP 0344459, 1989, C12N 15/00, C12P 21/02], Pichia pastoris Hsp150 [EP 0764209, 1997, C12N 15/14, C12 N1/19], Pichia pastoris MP-36 [EP 0438200, 1991, C12N 1/16, C12N 15/16, C12N 15/56, C12N 15/57, C12N 15/81], Pichia pastoris GTS11S [JP 8259599, 1996, SC 14/765, C07K 1/22]. Production of human albumin carried out by known recombinant DNA technology. The recombinant biosynthesis of extracellular albumin human strains-producers done which is due to the use of plasmids containing the structural gene of albumin, under the control of the promoter of the gene AOH containing region, providing activation and initiation of transcription in the presence of methanol in the culture medium. The set of essential characteristics as the prototype can be selected any of the above strains. They have a common drawback - low performance albumin.

As a prototype selected the most productive of the above strains of Pichia pastoris GS115/His+Mutsalbumin [EP 0510693, 1992, C12N 1/15, C12N 15/14], AH locus chromosome which integrated one structural gene albumin containing native secretion signal and transcribed under the control of 5 OH promoter and OH region termination of transcription.

The disadvantage of this strain is a low level secretion of human albumin to 1 g/l of culture medium.

The problem to which the present invention is directed, increasing productivity yeast producer albumin human.

The task is solved in that in accordance with the invention to increase the productivity of yeast producer albumin human use strain of the yeast Pichia pastoris X33/2albumin, AH locus of the chromosome which contains at least two structural gene albumin with signals secretion of the alpha factor for yeast, transcribed the x under the control of 5 OH promoter and the region of the termination of transcription of hepatitis G.

To obtain a strain of the yeast Pichia pastoris X33/2albumin as recipient uses a strain of the yeast Pichia pastoris X-33 (wild-type mut+), known, for example, [Burrowes O. et al., 2005, Journal of Biomedicine and Biotechnology, No. 4, p.374-384].

The strain of the yeast Pichia pastoris X33/2albumin characterized by the following distinctive features.

The DNA fragment encoding the structural gene for albumin, extracted from human liver by the method of reverse transcription - polymerase chain reaction (Lawn R. et al., Nucleic Acids Res, 1981, v.22, p.6103-6114). Thus obtained DNA fragment identical to the nucleotide sequence of the mRNA that encodes the structural portion of the albumin human (pick mRNA in the database EMBL/GenBank/DDBJ under registration number V00495).

AH locus chromosome Pichia pastoris X33 transformed, at least two genetic constructs containing the secretion signal of the alpha factor for yeast, merged with the structural part of the gene albumin, and transcribed under the control of 5 OH promoter and the region of the termination of transcription of hepatitis G. the transformation in the composition of the chromosomes of yeast cells contains at least two structural gene albumin for synthesis and secretion into the culture medium of human albumin. As a result of these changes transformed strain of the yeast Pichia pastoris identified as Pichia pastoris X33/2albumin.

Genetichesko the design, for synthesis and secretion of albumin human transformed by the yeast cells, consists of the following elements:

- Bgl II - Xho I DNA fragment size 2995 BP, including a fragment of the 5'-promoter region of the yeast gene AOH size 941 concentration, a signal secretion of the alpha factor for yeast size 266 concentration (Brake A.J., Merryweather J.P., Cuit D.G., et al., 1984, Proc. Natl. Acad. Sci. USA, V. 81, p.4682-4686), fused to the structural gene albumin size 1788 BP (deposited in the database EMBL/GenBank/DDBJ under registration number V00495).

- Kpn I DNA fragment size 120 concentration region termination of transcription of hepatitis G (D.V. Novikov abstract. Diss. Kida. Biol., M.: 2000, 24 S.).

- Bam HI DNA fragment size 2787 BP, including a fragment of the 5'-promoter region of the yeast gene AOH size 733 concentration, a signal secretion of the alpha factor for yeast size 266 concentration, fused to the structural gene albumin size 1788 BP

To obtain the genetic constructs and transformation of its yeast cells using methods described previously (D. Glover New in DNA cloning. Methods, M.: Mir, 1989, 368 S.).

Cells grow to full organic medium YEPD (also known as YPD) - 2% peptone, 1% yeast extract, 2% glucose or 1% glycerol.

Cells grow on mineral medium SC is 1.34% Yeast Nitrogen Base ("Difco, USA), 2% glucose (1% glycerol or 0.5% methanol), and the other is x synthetic environments for yeast.

Cells grow in the temperature range from 4 to 37°C.

As a carbon source for cell you can use many simple compounds, such as glucose, glycerol, methanol, ethanol.

As a nitrogen source for cell you can use mineral salts in the ammonium form, amino acids, urea.

During growth on a solid nutrient medium, the cells form a rounded, smooth colonies with a matte surface light cream color. With the growth in liquid media intensive form a smooth suspension. Culture has a characteristic smell methylotrophic yeast.

The implementation of the invention is illustrated by the following examples.

Example 1. Cultivation of a strain of the yeast Pichia pastoris X33/2albumin.

Cells of Pichia pastoris X33/2albumin grow at 20-30°With 100 ml of liquid BMGY medium (2% peptone, 1% yeast extract, 1% glycerol, 0.1 M potassium phosphate buffer, pH 6.0, 1.3% of Yeast Nitrogen Base ("Difco, USA)) to stationary phase of growth within 1-2 days.

Example 2. Using a strain of the yeast Pichia pastoris X33/2albumin for the preparation of recombinant human albumin and analysis of the culture medium in the presence of albumin.

Cells obtained from the previous example strain of yeast harvested by centrifugation, decant the supernatant and suspended sediment in 20 ml of BMMY medium (2% peptone, 1% yeast extract, 0.5 to 5% methanol, 0.1 M Kali is phosphate buffer, pH of 5.0-6.0 and 1.3% Yeast Nitrogen Base ("Difco, USA)for induction of expression of albumin. The induction is carried out at 20-30°C for 2-8 hours, then the culture medium is separated from the cellular biomass by centrifugation or filtering.

The presence of albumin in the culture medium determined by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate. Proteins are separated in a 10% polyacrylamide gel in the standard system buffers (electrode buffer was 25 mm Tris HCl, 200 mm glycine, 0.1% sodium dodecyl sulfate; buffer for preparation of top-gel - 350 mm Tris HCl pH 6.8; buffer for preparation of the bottom of the gel 375 mm Tris HCl pH 6.8). In parallel share the proteins secreted into the culture fluid control strain Pichia pastoris X33 grown in identical conditions. As standard drug use of human albumin. After electrophoresis the proteins stained in a solution containing 10% ethanol, 10% acetic acid and 0.01% Coomassie Briliant Blue R-250 (Serva, USA). Not bound peroxidase dye washed in a solution containing 10% ethanol and 10% acetic acid. When comparing the spectrum of proteins secreted into the culture fluid two strains, strain Pichia pastoris X33/2albumin detect the appearance of an additional protein band with an electrophoretic mobility identical to the standard drug is of Lumina person. The level of synthesis of albumin determined by comparing the intensity of staining bands recombinant protein with a strip of standard.

The resulting strain of the yeast Pichia pastoris X33/2albumin is a producer of recombinant human albumin. According to the data cells of a strain of the yeast Pichia pastoris X33/2albumin secrete at least 1.5 g of human albumin per liter of yeast culture.

Example 3. Authentication of the claimed strain of the yeast Pichia pastoris X33/2albumin.

When using a purified preparation of chromosomal DNA of Pichia pastoris X33/2albumin as template for polymerase chain reaction using primers 5'-TCTAGAAGGCGTTGAATTCTCGC-3' and 5'-ATAGCGTAATCCGTGACTAC-3' synthesized DNA fragment size 140 nucleotide bases, containing the following nucleotide sequence:

ATAGCGTAATCCGTGACTACGGGCTGCTCGCAGAGCCCTCCCCGGATGGGGCACAG

TGCACTGTGATCTGAAGGGGTGCACCCCGGTAAGAGCTCGGCCCAAAGGCCGGGTT

CTACTGCGAGAATTCAACGCCTTCTAGA,

the corresponding nucleotide sequence of the 3' terminal region of the genome of hepatitis G, and deposited in the database DDBJ/EMBL/GenBank under the registration number - AF249320.

The strain of the yeast Pichia pastoris X-33/2albumin for the secretion of albumin human, transformed into AH locus chromosome two structural genes albumin with signals secretion of the alpha factor for yeast, transcribed under the control of 5 OH the promoter region of terminate the transcription of hepatitis G.



 

Same patents:

FIELD: biotechnology, in particular plant gene engineering.

SUBSTANCE: recombinant plasmid DNA pBi101-IL18 is constructed having length of 15000 n.p. and containing DNA fragment of pBi101-IL18 vector plasmide having length of 13900 n.p.; -NdeI-BamHI/BgIII DNA fragment being cDNA site of human IL-18 gene; -Nol-NdeI fragment of pET15b plasmide; encoding N-terminal polypeptide from six hystidine amino acids and site of thrombin enzyme hydrolysis, -5'URT region from genome of tobacco etch virus; double 35S CaMV promoter from genome of cauliflower mosaic virus; -3'URT region from genome of cauliflower mosaic virus. Method of present invention makes it possible to transfer nucleotide sequence of human IL-18 in plant genomic DNA.

EFFECT: method for production of mature human IL-18 having biological activity.

2 dwg, 1 tbl, 3 ex

FIELD: agriculture, in particular determination of plant material genotype and sunflower breeding.

SUBSTANCE: claimed method includes isolation of DNA from each sprout in seed group of sunflower plant followed by amplification thereof using PCR. Amplification is carried out on HA 432, HA 514, HA 1442, and ORS 5 microsatellite locuses by using primers corresponding to flanking regions of such locuses. Amplification products are separated by electrophoresis in colored, e.g. agarose gel. Visual comparison of electrephoresis spectra, e.g., in ultraviolet beam makes in possible to evaluate inbred line uniformity and hybridism level in tested sample based on number of single-type spectra.

EFFECT: method of increased accuracy.

5 cl, 3 dwg, 2 ex

FIELD: biotechnology.

SUBSTANCE: method for production of purine nucleosides and purine nucleotides, in particular 5'-inosinic acid is disclosed. Claimed method includes using of bacterium belonging to genus Esherichia or genus Bacillus. Production of purine nucleosides and purine nucleotides by said bacterium is increased due to increased activity of YdhL pritein. Also disclosed is amino acid sequence of YdhL pritein from Bacillus amyloliquefaciens and gene encoding thereof.

EFFECT: method for industry scale production of nucleosides and nucleotides.

25 cl, 2 dwg, 6 tbl, 9 ex

FIELD: biotechnology, microbiology.

SUBSTANCE: invention relates to a method for producing methanol. Method involves culturing recombinant microorganism E. coli at temperature 20-30°C. Prepared culture and cells isolated from this culture, or treated product of these cells are remained in contact with methane for producing methanol. Indicated recombinant microorganism ahs ability to convert methane to alcohol as result of transformation of DNA encoding enzyme methane oxygenase of soluble type. Invention provides expression of all components of methane oxygenase that allows realization of method for producing methanol under milder conditions.

EFFECT: improved producing method.

3 cl, 1 dwg, 1 tbl

FIELD: biotechnology.

SUBSTANCE: DNA is constructed encoding protein, advancing fungus resistance to certain group of compounds. Alternatively DNA is constructed having defect in function and encoding protein, which advances lowering of GPI-anchored protein amount in fungus cell wall. Encoded protein is useful in production of antibody thereto which may by applied as active ingredient of antifungal agent.

EFFECT: new method for production of antifungal agent.

11 cl, 8 dwg, 1 tbl, 2 ex

FIELD: gene engineering, in particular production of transgenic potato with Colorado beetle resistance and biological and food safety.

SUBSTANCE: recombinant polynucleotide sequence of general formula X-A, wherein X is part of nucleotide sequence of introduced genetic construct representing in SEQ ID N 1; A is nucleotide sequence of flanking site of genomic DNA of genus Nevskiy potato, representing in SEQ ID N 2 is constructed; plant cell producing of cryIIIa protein and containing recombinant polynucleotide sequence, as well as potato transgenic plant and vegetative generation thereof with Colorado beetle resistance are obtained. Polynucleotide sequence is used in identification of plant cell producing of cryIIIa protein, plant and vegetative generation.

EFFECT: new potato genus with Colorado beetle resistance.

6 cl, 6 dwg, 7 tbl, 7 ex

FIELD: gene engineering, in particular production of transgenic potato with Colorado beetle resistance and biological and food safety.

SUBSTANCE: recombinant polynucleotide sequence of general formula X-A, wherein X is part of nucleotide sequence of introduced genetic construct representing in SEQ ID N 1; A is nucleotide sequence of flanking site of genomic DNA of genus Elizaveta potato, representing in SEQ ID N 2 is constructed; plant cell producing of cryIIIa protein and containing recombinant polynucleotide sequence, as well as potato transgenic plant and vegetative generation thereof with Colorado beetle resistance are obtained. Polynucleotide sequence is used in identification of plant cell producing of cryIIIa protein, plant and vegetative generation.

EFFECT: new potato genus with Colorado beetle resistance.

6 cl, 6 dwg, 7 tbl, 7 ex

FIELD: biotechnology, medicine.

SUBSTANCE: invention relates to new recombinant allergens that represent mutants of allergens of the natural origin and comprising at least four mutations. Examples of recombinant allergens are allergens Bet v1 and Ves v1. The primary mutations in recombinant allergen are separated of one another by interval for at least 15 Å and is location is characterized by that at least one circle region of surface of size 800 Å doesn't comprise mutations. Recombinant allergens are used as a pharmaceutical agent as a component of pharmaceutical composition that represents vaccine against allergic response reactions. Invention describes methods for using recombinant allergens in pharmaceutical composition for producing the immune response in subject. Invention represents DNA sequences given in the invention claim that encode recombinant allergens, expressing vector comprising DNA and cell-host for providing the recombinant allergen. Also, invention describes methods for preparing pharmaceutical composition and recombinant mutant allergen. Using recombinant allergen allows decreasing the specific IgE-binding capacity as compared with IgE-binding capacity of the natural allergen. Invention can be used in medicine for preparing vaccine against allergic response reactions.

EFFECT: valuable medicinal properties of allergens.

33 cl, 62 dwg, 10 ex

FIELD: selection and biotechnology of plants, agriculture.

SUBSTANCE: invention relates to highly effective system of genetic transformation of sugar beet plants. Method involves Agrobacterium-mediated transformation of sugar beet plant cotyledonous unit meristematic cells cultured in vitro that did not enter in the stage of callus-formation or regeneration of sprouts. Then sprouts are regenerated from transformed cells. Invention provides enhancing effectiveness and frequency of transformation of sugar beet plants.

EFFECT: improved preparing method of plants.

5 cl, 1 dwg, 2 tbl, 6 ex

FIELD: biotechnology, agriculture.

SUBSTANCE: one should carry out cell transformation of hard or soft wheat varieties with, at least, two product-coding genes and blocking the nutrition of Eurygaster integryceps Puton, where, at least, one of the genes mentioned is functionally connected with a promoter that provides constitutive expression of gene's product in a plant and, at least, the second of the mentioned genes is functionally connected with a promoter that provides tissue-specific expression of gene product in a plant. Wheat plant should be regenerated out of mentioned transformed cells. The innovation suggested enables to increase resistance of wheat varieties to harmful bugs (Eurygaster integryceps Puton) and, thus, obtain high-quality grain and keep the yields.

EFFECT: higher efficiency.

4 cl, 1 dwg, 7 ex, 3 tbl

FIELD: gene engineering, in particular preparation based on PDGF-BB, useful in therapy, veterinary, diagnosis, tissue culturing.

SUBSTANCE: invention relates to PDGF-BB production using Pichia pastoris 2-2 strain as producer of human platelet growth factor. Produced two-dimensional PDGF-BB form is characterized with purity of 95 %, specific activity of 3-5 ED50/ng, and expression level in yeast up to 0.1 g/l of culture.

EFFECT: two-dimensional PDGF-BB form with high purity, specific activity and expression level in yeast.

5 cl, 11 dwg, 5 ex

FIELD: biotechnology, microbiology, genetic engineering.

SUBSTANCE: invention relates to methods for preparing lactic acid. Lactic acid is prepared by culturing the recombinant strain of yeast of genus Schizosaccharomyces as a producer of lactic acid comprising at least one foreign lactate dehydrogenase gene. The recombinant strain of yeast Schizosaccharomyces pombe VKPM Y-3127 is prepared by using the strain Schizosaccharomyces pombe VKPM Y-285 as a recipient and transformation of the strain is carried out with plasmid DNA carrying IdhA gene from fungus Rhizopus oryzae. Invention provides carrying out synthesis of lactic acid at low pH values and show capacity for producing lactic acid at pH 4.0 up to the concentration of lactic acid in medium 80-100 g/l.

EFFECT: improved preparing method.

3 cl, 5 dwg, 2 tbl, 4 ex

The invention relates to biotechnology, namely genetic engineering

The invention relates to genetic engineering and can be used to create microbial yeast producer, providing a high yield of recombinant antigen of hepatitis b virus serotype adw

The invention relates to the field of genetic engineering and can be used in the biomedical industry

FIELD: veterinary, in particular large-scale albumin production.

SUBSTANCE: claimed method includes four-step deposition of blood plasma protein fractions with alcohol solution, wherein before deposition said albumin binding ability (ABA) is determined by fluorescence method using cation probes. ABA value is defined as ABA = EAC/TAC.100 %, wherein EAC is effective albumin concentration, and TAC is total albumin concentration. After albumin fraction providing blood plasma ABA is determined again by fluorescence method, obtained albumin fraction is purified on carbohydrate sorbents, blood plasma ABA is determined again by fluorescence method, purified albumin is stabilized with sodium chloride up to final concentration of 10-20 %, defecated by filtration, pasteurized and finally stabilized.

EFFECT: veterinary albumin with increased detoxification effect and enhanced sorption capacity; process with decreased energy and labor consumption.

2 dwg, 1 ex

Up!