Barley with varied activity of branching enzyme and starch and starch-containing products with increased amylose content

FIELD: agriculture.

SUBSTANCE: barley plant including mutation in gene SBE11a, or transgene which codes activity inhibitor of SBE11a, has low level of activity of enzyme SBE11a. Starch produced from grain of such plant may have amylase content of at least 40% (weight/weight). Also, barley of such kind may have lowered levels of activity of SBE11b. Barley grain may have non-rugose phenotype despite damaged amylopectin synthesis path.

EFFECT: lower levels of activity of branching enzyme and increased amylase content of starch-containing products.

46 cl, 19 dwg, 7 tbl, 11 ex

 

The SCOPE of the INVENTION

This invention relates to plant barley with low activity vatadage starch enzyme (SBE, starch branching enzyme), IIa (SBEIIa) in the endosperm, resulting in increased relative amylose content in grain starch. The invention also relates to grain and starch, as well as food and non-food products derived from them.

BACKGROUND of the INVENTION

In cereals, the starch is approximately 45-65% of the mass of the Mature grain. Starch consists of two types of molecules, amylose and amylopectin. Amylose is an essentially linear molecule consisting of α-1,4-linked glycosidic chains, whereas amylopectin is a highly branched molecule with α-1,6-glycosidic bonds, cross-linking of the linear chain.

The synthesis of starch in the endosperm of higher plants is carried out by a group of enzymes catalyzing the four key stages. First, ADP-glucosephosphate activates the Monomeric precursor of starch through the synthesis of ADP-glucose from G-1-P glucose-1-phosphate and ATP. Secondly, the activated donor glycosyl, ADP-glucose, tolerated by starch synthase to not regenerating the end of an existing connection α-1-4. Third, enzymes, wetvasca starch, enter the branch point by splitting the area α-1,4-linked glucan with subsequent PE the Enos split chain acceptor chain with the formation of a new α -1,6-linkages. Enzymes, wetvasca starch, are the only enzymes that can enter α-1,6-linkage in α-polyglycine and, therefore, play a significant role in the formation of amylopectin. Finally, the enzyme that removes the starch branching, remove some razvitsya connection, although the mechanism by which they act, not found (Myers et al., 2000).

Although it is clear that at least these four activity is necessary for normal synthesis of starch granules in higher plants, the endosperm of higher plants has multiple isoforms of each of these four activities, and for individual isoforms suggested specific roles on the basis of mutational analysis (Wang et al., 1998, Buleon et al., 1998) or by modifying the levels of gene expression using transgenic approaches (Abel et al., 1996, Jobling et al., 1999, Scwall et al., 2000). However, the exact contribution of each isoform of each activity in the biosynthesis of starch is still unknown, and it is not known whether there are significant differences in these contributions between species. In the endosperm of grain present two forms of ADP-glucosephosphate, one form inside amyloplast and one form in the cytoplasm (Denyer et al., 1996, Thorbjomsen et al., 1996). Each form consists of two types of subunits. Wrinkled (sh2) and brittle (bt2) mutants in maize represent damage in the large and the scarlet subunits, respectively (Girouz and Hannah, 1994). In the endosperm of cereals found four class synthase starch, one isoform, which is localized exclusively within starch granules, granulomatosa starch synthase (GBSS), two forms, which are distributed between the pellet and the soluble fraction (SSI, Li et al., 1999a, SSII, Li et al., 1999b), and the fourth form, which is completely localized in the soluble fraction (SSIII, Cao et al., 2000, Li et al., 1999b; Li et al., 2000). It is shown that GBSS is essential for the synthesis of amylose (Shure et al., 1983), and it was shown that mutations in SSII and SSIII change the structure of amylopectin (Gao et al., 1998, Craig et al., 1998). Mutations that define the role of activity SSI, are not described.

In the endosperm of the grain is expressed three forms vatadage enzyme: Watashi enzyme I (SBEI), Watashi enzyme IIa (SBEIIa) and Watashi enzyme IIb (SBEIIb) (Hedman and Boyer, 1982, Boyerand Preiss, 1978, Mizuno et al., 1992, Sun et al., 1997). It is shown that in maize and rice vysokomolochnye phenotypes are the result of damage in the SBEIIb gene, also known as gene amylose extender (ae) (Boyer and Preiss, 1981, Mizuno et al., 1993, Nishi et al., 2001). These mutants SBEIIb starch granules of the endosperm showed abnormal morphology, the amylose content was significantly increased, the frequency of branching residual amylopectin has been reduced, and the proportion of short chains (<DP17, especially DP8-12) was low. In addition, the temperature of gelatinization of starch was increased. The stage is the implementation for this was attended by a significant amount of substances, which is defined as "intermediate" between aminosol and amylopectin (Boyer et al., 1980, Takeda et al., 1993b). In contrast, mutants of maize plants SBEIIa gene due to the mutator (Mu) insertional element and, therefore, insufficient expression of SBEIIa protein were indistinguishable from the wild type by the branching of the starch of the endosperm (Blauth et al., 2001), although they have been modified starch leaves. This way the rice plants with a deficit of SBEIIa activity did not show a significant change in the profile of chains of amylopectin in the endosperm (Nakamura, 2002).

In maize mutation dull1 causes reduced starch content and increased levels of amylose in the endosperm with the degree of change depending on the genetic background, as well as a higher degree of branching of the residual amylopectin (Shannon and Garwood, 1984). The gene corresponding to this mutation, was identified and selected by strategy labeling of the transposon using transposon-mutator (Mu), and shown that it encodes an enzyme labeled starch synthase II (SSII) (Gao et al., 1998). Currently, this enzyme recognizes a member of the family SSIII grains. Mutant endosperm has lower levels of SBEIIa activity associated with a mutation dull1. Other cereals corresponding mutation has not been described. It is unknown whether the relation of these findings to other grains, such as ball is any.

In WO 94/09144 proposed the use of semantic and antisense genes for changes in the natural proportions of the starch synthase (SS) and SBE in maize. However, the presented data confirming the proposed molecular strategies, and there is no proposal for a specific reduction in the activity of SBEIIa.

Potato negative regulation of one SBEI has minimal impact on the structure of starch (Filpse et al., 1996), although in the following identified qualitative changes (Safford et al., 1998).

However, the potato negative regulation of SBEI and SBEII in combination increased the relative content of amylose is significantly greater than the negative regulation of one SBEII (Schwall et al., 2000).

In higher plants there are two types of enzymes that remove the fork, and they are defined on the basis of their substrate specificity as enzymes that remove the fork, type isoamylase, and enzymes that remove the fork, type pullulanase (Myers et al., 2000). Mutations Sugary-1 in maize and rice are associated with failure of both enzymes that remove the fork (James et al., 1995, Kubo et al., 1999), but the causal mutation mapped in the same location, and that the gene of the enzyme that removes the branching type isoamylase. The mutant sta-7 Chlamydomonas (Mouille, 1996), analogue mutations sugary-1 corn, negatively regulated only isoamylase activity. Genes biosi the importance of starch, who cloned from grain are listed in table 1.

Starch is widely used in food, paper and chemical industries. The physical structure of starch can have a significant impact on the nutritional and technological properties of starch for food or non-food industrial products. As an indicator of the structure of starch can be considered several characteristics, including the distribution chains of amylopectin in length, degree of crystallinity and the presence of forms of crystallinity, such as the V-complex form of the crystallinity of the starch. Chain length of amylopectin can be an indicator of altered crystallinity and altered gelatinization, and also believe that it correlates with reduced retrogradely of amylopectin. Also, consider that the altered distribution chains of amylopectin in length reflects the organoleptic properties of food products, in which the starch is included in significant amounts. The reduced crystallinity of the starch may also be an indicator of low temperature of starch gelatinization, and believe that it is associated with improved organoleptic properties.

The relatively high temperature of gelatinization of the most vysokomolochnyh starch is a disadvantage for some food applications. Temperature Klasterec and reflects the energy of grinding, necessary for the processing of such food products. For processing of grain or flour for food production of these grains or starches usually need a higher temperature. Therefore, products containing vysokomolochnye starches are generally more expensive. In addition, for the preparation of these produced food or for cooking from flour containing vysokomolochnye starches, the consumer may need to spend more time and use a higher temperature. Vysokomolochnye starches with low or normal temperature of gelatinization, would have the advantage in many food applications.

The composition of starch, in particular, in the form called resistant starch, is very important for gut health, in particular for the health of the large intestine. Accordingly, some cereals, such as maize, developed vysokomolochnye starches for use in food products as a means of contributing to the health of the intestine. The beneficial effects of resistant starch are the result of supply of the large intestine, where the intestinal microflora receives the energy source that undergoes fermentation with the formation of inter alia fatty acids with short chain. These fatty acids with short the second circuit provide nutrients for colonocytes, reinforce the grip of some nutrients through the colon and contribute to the physiological activity of the colon. As a rule, if you don't provide a stable starches or other dietary fiber, the colon is relatively inactive in metabolism.

Another nutritional component of cereals and, in particular, barley is β-glucan. β-Glucan is composed of glucose units connected β (1-4) and/or β (1-3) glycosidic cross, and is not destroyed by human digestive enzymes, making it suitable as a source of dietary fiber. β-Glucan may be partially subjected to enzymatic hydrolysis by endogenous bacteria of the colon, in the fermentation process which the formation of fatty acids with short-chain (mainly acetate, propionate and butyrate), which are useful for mucosal cells lining the small intestine and the colon (Sakata and Engelhard, 1983). Absorption β-glucan also has the effect of increasing the excretion of bile acids, resulting in lower total serum cholesterol and low-density lipoprotein (LDL), which reduces the risk of coronary heart disease. In a similar way β-glucans act by weakening shifts in the concentration of glucose in the blood after a meal. Consider, Thu, these effects can also be based on increasing the viscosity of the contents of the stomach and small intestine.

Although modified starches or β-glucan, for example, can be used in food products, which provide functioning normally do not provide non-modified sources, such processing tends either to modify other important components, or is undesirable because of the processes involved in the modification. Therefore, it is preferable to provide the sources of components that can be used in food products in unmodified form.

Barley (Hordeum vulgare) is the fourth most common crops cultivated worldwide and relatively underutilized in terms of human consumption, except for use in the production of alcohol-free beer. The average grain barley contains about 64% starch, 11% protein and 5% β-glucan (usually 3-6%). The remaining 20% include moisture, fiber, and other minor components.

Known variations in the structure of starch barley relatively limited variations available in maize. Mutants in SBEIIb corresponding to phenotypes amylose extender in maize or rice, barley is not characterized. Phenotype attributed to mutations SBEIIa or SBEIIb, barley is unknown. The most well characterized mutations are waxy mutation and vysokopilska mutation, identified as S. High Amylose Glacier (AC38) has a relatively moderate increase in amylose content up to a maximum of about 45% of total starch. Double mutants with the waxy phenotype also constructed and characterized (Schondelmaier et al., 1992; Fujita et al., 1999).

Identified other barley mutants with a high content of amylose in the starch. Chemically induced mutants for SSIIa gene had higher levels of amylose in grain starch, up to about 65-70% (WO 02/37955 A1). Mutants M and M also showed significantly reduced the average weight of grain as a result of reduced synthesis of starch from the average weight of approximately 51 mg for parent lines Himalaya to 32 and 35 mg for M and M respectively. Although these mutants retained the length and thickness of seeds of wild type, they were aligned from 2.8 mm average thickness for Himalaya up to 1.6-1.8 mm and had a Central essentially unfilled region that has resulted in the worst performance of grinding. Found that the ratio of the length of the grain (L) to thickness (T) is a useful diagnostic parameter for mutant alleles and mutant seeds and seeds of wild-type relate LT more than 3.5 and less than 3.5, respectively. The starch content of the mutant lines was reduced from 49,0% for Himalaya to 17.7 and 21.9% for M and M respectively. It was shown that although there has been a decrease in amylose content in grain from 6.2 mgna the weevil to 4.0 and 4.8 mg in M and M respectively, but there was a sharp decrease in the content of amylopectin in the caryopsis from 18,7 the Himalaya to 1.6 and 2.9 mg of mutant. This indicates that relatively high levels of amylose was the result of reduced production of amylopectin. Levels of grain β-glucans were elevated in mutants more than 10%. Starch showed lower the gelatinization temperature. Mutant SBEIIa had altered the distribution of activities SBEIIa and SBEIIb between starch granules and soluble fractions of endosperm, but they were essentially not altered by the level of activity in the endosperm as a whole (WO 02/37955; Morell et al., 2003).

Although starches with high amylose content these types of useful, starch barley with higher content of amylose preferred, particularly if this is associated with enhanced synthesis of starch and other characteristics, such as less need for modification after collection. These starch products are also relatively resistant to digestion and a great benefit to health.

GENERAL PROVISIONS

Specialists in the art it should be clear that the invention described herein is subject to variations and modifications other than those specifically described. It should be clear that the invention described herein includes all such variations and modifications. The invention also includes the CE such stages, features, compositions and compounds related to this description or referenced therein, individually or collectively, and any and all combinations of any two or more than two of these stages or signs.

Throughout the description, unless the context requires otherwise, the word "contain" and variations such as "contains" and "contain"should be understood to imply the inclusion of a specific integer or stage or certain group of integers or steps, but not the exclusion of any other integer or stage or any other group of integers or steps. The present invention should not be limited in scope by the specific embodiments described herein, which are intended only to bring examples. Functionally equivalent products, compositions and methods are clearly within the scope of the invention as described here.

Bibliographic details of the publications to which the author refers in this description, presented in the end of the description. References mentioned herein is incorporated herein by reference in their full amounts. Made here are links to the prior art, including any one or more than one document of the prior art, should not be construed as a confirmation or assumption that the prior art is well known in Australia or forms part of a well-known ABC is the Australia.

As used here, the term "obtained (derived) from" should be understood as indicating that a particular integer or group of integers are derived from these types, but they don't necessarily have been obtained directly from the specified source.

The designation of nucleotide residues, relevant here, is the same as the recommended Biochemical Nomenclature Commission of the IUPAC-IUB, where a represents adenine, represents cytosine, G represents guanine, T represents thymidine.

SUMMARY of the INVENTION

The first aspect of the invention relates to grain, obtained from plants of barley, which has reduced the level of activity of SBEIIa enzyme in the endosperm, the starch of the specified grain has a relative amylose content of at least 40% (wt./wt.). The relative content of amylose may be preferably higher than 50%, or 75%, and preferably grain is nenormiruemym.

The second aspect of the invention relates to the barley grains contain starch, which has a relative amylose content of at least 75% (wt./wt.).

In the third aspect of the invention relates to a flour or whole-wheat flour obtained from the grain of the first or second aspects of the invention, or to the food products incorporating such flour or flour from whole grains.

Vchetverom aspect of the invention relates to starch, obtained from grain barley plants, which has reduced the level of activity of SBEIIa enzyme in the endosperm, and specified the starch is unmodified and has a relative amylose content of at least 40% (wt./wt.). In the specific form of the fourth aspect of the plant barley additionally has a reduced level of SBEIIb enzyme in the endosperm.

In the fifth aspect of the invention relates to compositions containing starch according to a fourth aspect of the invention and other food ingredient or water.

In the sixth aspect of the invention relates to compositions containing starch granules of the endosperm of barley and other food ingredient or water, where the starch of these starch granules contains at least 75% (wt./wt.) amylose.

In the seventh aspect of the invention relates to plant barley with lower level of activity of SBEIIa enzyme, where the starch in the grain of this plant barley has a relative amylose content of at least 40% (wt./wt.) or preferably at least 50% or at least 75%.

In the eighth aspect of the invention relates to a method for barley plants with a reduced activity level of SBEIIa enzyme in the endosperm, the starch grains of this plant barley has an amylose content of at least 40% (wt./wt.), includes stage (a) introduction the Oia genetic variation in the parental plant barley and (b) the identification of the plants or seeds-the descendants of the parent plants of barley, which have a reduced SBEIIa activity.

In the ninth aspect of the invention relates to a method for barley plants with a reduced activity of the enzymatic activities of both SBEIIa and SBEIIb in the endosperm, comprising: (a) mutagenesis of seeds from plants with a reduced activity of SBEIIa enzyme activity; or (b) mutagenesis of seeds from plants with a reduced activity of SBEIIb enzyme activity; or (C) crossing a plant having reduced SBEIIa enzyme activity, with the plant having reduced SBEIIb enzyme activity; and identification of barley plants with a reduced activity and SBEIIa and SBEIIb.

A BRIEF DESCRIPTION of GRAPHIC MATERIALS

Figure 1. The nucleotide sequence of cDNA barley SBEIIa (SEQ ID No. 1).

Figure 2. The nucleotide sequence of cDNA SBEIIb barley (SEQ ID No. 2).

Figure 3. The sequence of the gene razorblades starch enzyme IIa (SEQID No. 3) (wSBEII-D1) from A. tauschii accessions, which corresponding to the SBEIIa gene D genome of hexaploid wheat (T. aestivum).

Figure 4. Partial sequence of a gene wheat SBEIIb (SEQ ID No. 4) (wbe2b genome).

Figure 5. Schematic design of the duplex RNA. A. Used the order of the elements of the gene: promoter sequence of a gene SBEIIa or SBEIIb (exons 1, 2 and 3) in the sense orientation, the intron (intron 3), the sequence of a gene SBEIIa or SBEIIb (exons 1, 2, 3 and 4) in antimi the business orientation and sequence of the transcription terminator/polyadenylation. B. gene Transcript ds-SBEIIa and ds-SBEIIb form a "hairpin" structure of the RNA with donativum area formed by hybridization between the sense and antisense sequences. Intron sequence, bounded by the nucleotides G and AG, subject to splicing.

6. PCR analysis of barley lines, transgenic for ds-SBEIIa and ds-SBEIIb. To identify positive transgenic lines used pairs of primers BX17F/AR2bkpnR for SBEIIb and BX17F/AR2akpnR for SBEIIa, which amplified first and second fragments of the relevant structures, which include exons 1, 2, 3 and intron 3 (semantic orientation). GP means of the untransformed Golden Promise. Central lane shows the molecular size markers.

7. Southern blot analysis of barley lines, transgenic for ds-SBEIIa and ds-SBEIIb. A. Positive transgenic barley ds-SBEIIa, as shown by blot-hybridization on Southern. The expected band size is 1836 P.O. B. Positive transgenic barley ds-SBEIIb, as shown by the method of Southern. The expected size band - 1907 BP GP means Golden Promise (negative control).

Fig. Western blot analysis of barley lines, transgenic for ds-SBEIIa and ds-SBEIIb. Ten T1 seeds (seeds from plants) lines IIb 4.3 and IIb 4.4 analyzed for the expression of SBEIIb by Western blot analysis using electrophoresis in SDS page in adenocarinoma conditions and pacificnet antibody to SBEIIb. Track 1 (+) represents a positive control, a variety Glacier.

Fig.9. Western blot analysis of barley lines, transgenic for ds-SBEIIa and ds-SBEIIb. Ten T1 seeds (seeds from t0 plants) line IIa 4.1 analyzed for the expression of A. SBEIIa or B. SBEIIb by Western blot analysis using electrophoresis in SDS page in adenocarinoma conditions and specific antibodies to SBEIIa or SBEIIb. Tracks on both gels are the same seeds. Track 1 (+) in each panel represents the positive control, grade Glacier.

Figure 10. Western blot analysis of transgenic barley lines ds-SBEIIa and ds-SBEIIb. Ten T1 seeds (seeds from plants THAT line IIb 4.1 analyzed for the expression of A. SBEIIb or B. SBEIIa by Western blot analysis using electrophoresis in SDS page in adenocarinoma conditions and specific antibodies to SBEIIb or SBEIIa. Tracks on both gels are the same seeds. Track 1 (+) in each panel represents the positive control, grade Glacier.

11. The morphology of starch granules of transgenic barley ds-SBEIIa. Starch granules from individual seeds were visualized by light microscopy of both transgenic seeds, ds-SBEIIa and ds-SBEIIb. Figa, the seed with the expression of SBEIIa wild-type (lane IIa 4.2.3). Figb, the seed with the lack of expression of SBEIIa (track IIa 4.2.5). Observed significant morphological changes in the starch from the mJy with the lack of SBEIIa, but not SBEIIb.

Fig. Scanning electron microscopy (SEM) of starch granules. A. starch granules of wild-type (lane IIa 4.2.3), B. and C. from transgenic endosperm ds-SBEIIa (track IIa 4.2.5). Starch granules from the seed ds-SBEIIb (SBEIIb inactivated) does not seem to be morphologically altered compared to wild type.

DETAILED description of the INVENTION

The change in barley SBEIIa

The invention is based on the discovery that reduced SBEIIa activity in the endosperm of barley results in modified production of starch, in particular to high accumulation of amylose in barley grain. This unexpected result is contrary to the discoveries in maize and rice, where the mutation in the SBEIIa does not change the profile of amylopectin (Blauth et al., 2001, Nakamura, 2000). Preferably there is a change in one or more than one additional enzymatic activity of the biosynthesis of starch, and more preferably the reduction in SBEIIb, and SBEIIa. Also preferably, the grain of this plant barley is nenormiruemym.

The method of obtaining plants of barley

In one aspect of the invention, a method for reducing the activity of vatadage starch enzyme IIa (SBEIIa) in the endosperm of barley. The decrease in activity may be at least 40%, or possibly preferably at least 50% compared with the level of activity in endo is the EPM unmodified (control) barley, more preferably at least 75%, and even more preferably at least 90% or 95%. This method may include changes in the expression of SBEIIa gene of barley or it may include a gene mutation barley SBEIIa, where the SBEIIa activity in the endosperm is reduced.

This method may include the stage of determining the activity of SBEIIa in the endosperm of barley preferably by measuring the protein level, for example by immunological detection, or level of the corresponding mRNA by methods well known in the art, such as blot-hybridization analysis Northern or polymerase chain reaction with reverse transcription (RT-PCR). This method may optionally include the stage of selection or screening plant barley or grain having reduced SBEIIa activity in the endosperm. Stage selection can be based on the reduced level of SBEIIa activity or protein, or it can be based on the phenotype grain barley plants, such as the high content of amylose or low content of amylopectin or on the visual phenotype, such as wrinkled grain.

The SBE activity can be measured using an enzymatic analysis, for example by analyzing phosphorylase stimulation (Boyer and Preiss, 1978). This analysis measures the stimulation by SBE include glucose-1-phosphate insoluble in the th in methanol polymer (α -D-glucan) phosphorylate and. The SBE activity can be measured by analyzing iodine staining, which measures the decrease in the absorption of the complex glucan-Polyot, the resulting branching glucan polymers. The SBE activity can also be assessed with analysis of the relationship of the branches, which measures the formation of regenerating all of the recovered amylose as substrate after enzymatic hydrolysis by isoamylase (Takeda et al., 1993a). Preferably, the activity measured in the absence of SBEI activity or SBEIIb. The SBE isoforms show different substrate specificity, for example SBEI shows higher activity in the branching of amylose, whereas SBEIIa and SBEIIb shows higher speed fanout amylopectinosis substrate. These isoforms may also be distinguished on the basis of the length of glutinosae chain that is transferred.

The following aspect of the invention, a method for reducing the activity of multiple enzymatic activities of the biosynthesis of starch in the endosperm of barley, where one of the activities is SBEIIa. Preferably lowered activity of both SBEIIa and SBEIIb, and even more preferably SBEI activity is also reduced. Other enzymatic activities of the biosynthesis of starch, which can be reduced in combination with SBEIIa are: SSI, SSII, SSIII. Also could the t to be modified enzymes removes the branching of the starch, for example, the activity of isoamylase or pullulanase. In the following embodiment the activity of enzymatic activity of the biosynthesis of starch can be modified at a plant in tissues other than endosperm, for example SBEI activity or SBEII can be increased in the leaves to compensate for some loss of activity caused by transgene coding for SBEIIa-inhibitory molecule, designed primarily for expression in endosperm. Alternative synthesis of starch can be further improved by overexpression of one or more than one enzyme of the biosynthesis of starch in combination with a decrease SBEIIa. Genes encoding such enzymes may originate from any source, such as a bacterial or other sources, other than barley, and they can be modified in the direction of the change in catalytic properties, such as changes of temperature dependence of enzymes (WO 94/09144).

The following aspect of the invention, a method for increasing the level of amylose (% of starch) in barley grain, including the stage of the lowering of the SBEIIa activity in the endosperm of barley. The amylose content is preferably at least 50%, more preferably at least 60% and even more preferably at least 65, 75% or 70%. In the following preferred GP is ameneh the invention of this method, the example shown here, provides an amylose content of at least 80% or 90%.

Vysokopilsky phenotype can be achieved by using a partial or full termination of SBEIIa gene or genes SBEIIa and SBEIIb. The extent to which this gene Engibarov, will to some extent determine the characteristics of the starch grains of barley. Any number of techniques gel electrophoresis carried out on proteins extracted from the modified endosperm of barley, will identify the nature and extent of modification in respect of the activity of SBEIIa and/or SBEIIb. The modification may be manifested as a decrease in the activity of SBEIIa and/or SBEIIb, the complete cessation of the enzymatic activity or changes in the distribution of SBEIIb or other enzymes within the endosperm. To conduct these tests, the starch can be extracted from the endosperm of barley and analyze proteins, for example, as described in Rahman et al., 1995. Techniques well known in the art, such as LTO-PAG electrophoresis (polyacrylamide gel electrophoresis with sodium dodecyl sulfate) and Western blot turns, carried out on the soluble fraction and the fraction of starch granules and identify barley plants where there has been a modification in respect of enzymes SBEIIa and/or SBEIIb.

Barley plants

The following aspect of the invention the proposed plant barley (Hordeum vulgare with a reduced level of SBEIIa activity in the endosperm during at least some grain development, moreover, this plant is barley able to give a corn starch which has a relatively high content of amylose. Preferably the level of SBEIIa reduced in the endosperm at least 50%, more preferably at least 75% and most preferably at least 90% or 95% compared with wild type. The term "wild type" has its ordinary meaning in the field of genetics and includes varieties or genotypes of barley, which is not modified as described here.

The invention also suggested plants and grain progeny that possess the desired characteristics of the parents.

The invention also encompasses plants of barley, which have an altered activity of SBEIIb or other enzymatic activity of the biosynthesis of starch in addition to reduced SBEIIa activity. Plants with reduced activity of SBEIIa and SBEIIb, can be obtained by crossing plants, low on SBEIIa, plants, reduced by SBEIIb or by introducing a transgene encoding a molecule that inhibits the expression of genes both SBEIIa and SBEIIb. The invention also encompasses the mutation(s) in other genetic backgrounds. Original modified (mutant) plants could be crossed with plants containing more desirable genetic background. After the initial crossing is possible to conduct an appropriate number reverse TFR is shivani to remove less desirable genetic background. The desired genetic background may include any appropriate combination of genes, providing commercial output and other characteristics, such as agriculture, resistance to abiotic stress or grain without film. This genetic background may also include other modified genes of the biosynthesis or modification of starch, such as phenotype amylose extender or the amo1 mutation in barley High Amylose Glacier (gene unknown), the waxy mutation (found, for example, in sort Waxiro), the mutant gene in vysokopilska grade MC (available from the USDA ARS National Small Grain Germplasm Research Facility, Aberdeen, Idaho 831290 USA) or vysokomolochnyh varieties M and M (mutation in the SSIIa gene), genes or modifier. Also desirable is to unite other double and triple mutations with combinations of the above lines in crosses with other lines of barley, which have wrinkled the endosperm, where the causative gene is unknown.

Grain

The invention also suggested that the barley grain containing starch, modified compared to the wild type. This modified starch is at least partly a consequence of reduced SBEIIa activity during the development of the endosperm of barley grain. This grain contains high levels of amylose as a percentage of total starch and low content of amylopectin in comparison with the wild type, which has about 25% amylose is 75% amylopectin. Preferably both activity, SBEIIa and SBEIIb, reduced during the development of the endosperm. Even more preferably the SBEI activity is also reduced. Levels of amylose, measured by methods well known in the art, preferably comprise at least 50% of the total starch, more preferably at least 60% and even more preferably at least 65%, 70%, 75%, 80% or 90%. Higher levels of amylose may be indicative of abnormal morphology of starch granules, or loss of the double refraction of the granules when observed in the light microscope, or in other ways. Preferably the level of amylose measured by iodometric method, which can be a spectrophotometric method (e.g., Morrison and Laignelet, 1983) or high performance liquid chromatography (HPLC, for example, Batey and Curtin, 1996).

Grain barley plants may have an increased level β-glucan, which may be associated with an increased inflow of carbon in the synthesis of this polymer and not in the synthesis of amylopectin. Alternative this grain may have normal levels β-glucan, for example in the range of 3.0 to 6.0% by weight of the Mature grain. More preferably, the grain contains elevated levels of amylose, and normal levels β-glucan. This combination is unexpected, based on the composition to the making a movie in the grain of barley, mutant for SSIIa (WO 02/37955). Grain may contain starch, which has changed the temperature of gelatinization and/or modified characteristics of swelling during and after gelatinization. This grain is also preferably has remorselessly phenotype.

The invention also suggested flour or meal derived from these grains. It can be raw or processed, for example, by fractionation or bleaching. The invention further suggested that the barley grain, suitable for the production of food products derived from barley plants having a modified level of SBEIIa activity in the endosperm, the starch of the specified grain has a high amylose content and low content of amylopectin. In addition, the invention covers the grain that has been processed in other ways, so that the grain can be ground, crushed, collapsed, flattened or crushed.

Starch

In another aspect, the invention proposed a starch obtained from corn barley plants, as described above, having a reduced level of SBEIIa activity in the endosperm, the starch has a high amylose content and low content of amylopectin. Preferably lowered activity of both SBEIIa and SBEIIb, and more preferably SBEI activity is also reduced. In another aspect izaberete the AI offered starch, obtained from grain barley plants containing at least 50% amylose, preferably at least 60% of amylose and even more preferably at least 65%, 70%, 75%, 80% or 90% of amylose. Purified starch can be produced from corn by way of grinding, such as wet milling, which involves separating the starch from the protein, fat and fiber. The initial product of the milling process is a mixture or composition of starch granules, and the invention, therefore, includes such granules. The starch of these granules contain at least 50% amylose, preferably 70%, 75% or 80% amylose.

The starch may contain elevated levels of resistant starch with an altered structure, characterized by specific physical characteristics, including one or more than one of the group consisting of physical inaccessible to digestive enzymes, which can be a high content of β-glucan, a modified morphology of starch granules, the presence of significant associated with starch lipid modified crystallinity and the modified distribution chains of amylopectin in length. High amylose content also contributes to the level of resistant starch.

The invention also offered the starch of the grain shown in example barley plants, steriade what about the increased amounts of dietary fiber, preferably in combination with a high level of resistant starch. This increase also, at least in part, a result of the high relative level of amylose.

Ways to reduce the activity of a gene: the Transgenes

The activity of SBEIIa and possibly other genes of the biosynthesis or modification of starch preferably change by introducing genetic variation into the plant, which can be accomplished by injection of the transgene into the plant barley. "Genetic variation" means any change in the genome, which in this context influences the activity of SBEIIa, and include mutations such as point mutations, substitutions, inversions, translocations and preferably deletions, as well as the integration of transgenes. "Transgene"as it is referred to here has its usual biotechnology value and includes a genetic sequence, which is obtained or modified using recombinant DNA technology or RNA, and which was introduced in the organism or cell. The transgene may include genetic sequence derived from this organism or cells, for example, the antisense sequence. The transgene typically includes an exogenous nucleic acid that is not derived from the specified organism or cell. "Transgenic" refers to the organism or the cell containing the transgene. "Nereshennye" refers to the absence of any transgene in the genome. The transgene preferably integrated into the genome of the organism or cells for stable inheritance.

Method of reducing the activity of SBEIIa may include the stage of incorporation of the transgene in the recovered cell barley and regeneration of transgenic barley plants from transformed cells. Wetvasca enzymes involved in the synthesis of amylopectin include SBEI, SBEIIa and SBEIIb, and the invention encompasses the reduced expression of one SBEIIa or in combination with changes in the expression of SBEIIb or SBEI. Therefore, the transgene(s) may(gut) to inactivate more than one of these genes. In addition, inactivation of SBEIIb and/or SBEI may be direct, in which the target transgene (e.g., encoding a duplex RNA, antisense or ribosomnuyu RNA, see below) is an expression of SBEIIb or SSEI, or it may indirectly result in changes in the expression of SBEIIb or SBEI. For example, transgenic target RNA can only be SBEIIa gene/PHK in the sense of identity, sequence or mating grounds, but it also results in reduced SBEIIb or SBEI by altering the stability or protein distribution. Additional forms of the present invention relate to the combination of altered activity of SBEIIa and change one or more chemodrug of other enzymes of the synthesis of amylopectin, which may include SSI, SSII, SSIII and enzymes that remove the fork, such as isoamylase or pullulanase. Expression of any of them or all of them may be modified by the incorporation of the transgene.

For genes for the synthesis of amylopectin in barley there are several known DNA sequences, any of which can be the basis for the development of transgenes for inactivation of these genes in barley. They include SBEIIa (GenBank, catalog numbers AF064562 and AF064560), SBEIIb (GenBank, catalog numbers AF064563 and AF064561). The SBEI gene homologues of barley can be distinguished using sequence based on the DNA sequences of other cereals, for example, using methods described in WO 99/14314, Li et al., for Triticum. The sequence for SBEI Trincum p, which is highly homologous gene SBEI D genome of wheat and has a high degree of similarity to the gene of barley, can be found in the published patent application WO 99/14314 or references, cited here, and this document is incorporated herein by reference. The sequence SBEI wheat may be available in the GenBank database, catalog number AF076679. Homologues of other genes for the synthesis of amylopectin from wheat or other closely related species can also be used to modify the levels of gene expression in barley. Such genes or fragments thereof can be obtained by methods well known in the art, including PCR ampli is icatio or hybridization with labeled probes.

The term "stringent hybridization conditions"as used here, means hybridization will generally take place if at least 90%and preferably at least 95%sequence identity between the probe and the sequence of the target. An example of stringent hybridization conditions is incubation overnight in a solution containing 50% formamide, 5×SSC (1×SSC=150 mm NaCl, 15 mm trinatriytsitrat), 50 mm sodium phosphate (pH 7,6), 5× denhardt's solution, 10% textresult and 20 μg/ml denatured fragmented DNA carrier, such as DNA, salmon sperm, followed by washing the substrate for hybridization in 0.1×SSC at about 65°C. Other conditions hybridization and washing are well known, and examples are provided in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, NY (1989), particularly Chapter 11.

Area(s) of homology used in obtaining transgenic constructs must have at least 85%identity to the corresponding gene of barley, preferably at least 90%and even more preferably at least 95-100%identity in the relevant area. Also preferably, the specific target of the transgene were genes for the synthesis of amylopectin, expressed in the endosperm of barley, and to its influence on the synthesis of amylopectin in the village of the natives parts of the plant was less or minimal. This can be achieved by the use of suitable regulatory sequences, such as endosperm-specific promoters transgene.

Antisense

Genetically engineered or transgenic approaches to change, in particular to the specific reduction of gene activity in plants are well known in the art. These methods of introducing genetic variation into the plant barley include the expression of a corresponding antisense molecule which is complementary to RNA of the target genes and can gibridizatsiya with it. Believe that antisense molecules inhibit translation or processing, or stability of the mRNA of the target genes, inactivating through his expression. Methods of obtaining antisense sequences are well known in the art, and examples can be found in U.S. patent No. 5190131, in the description of the European patent 0467349-A1, in the description of the European patent 0223399-A1 and in the description of the European patent 0240208, which is incorporated herein by reference. An overview of the use of antisense techniques in plants made Bourque (1995) and Senior (1998). Bourque enumerates a large number of examples of antisense sequences were used in plant systems as a way of inactivation of the gene. She also found that the achievement of 100% inhibition of any farm is ntatives activity can be optional since partial inhibition is likely to result in measurable changes in the system. Senior (1998) found that antisense methods are now well developed technique for the manipulation of gene expression.

Antisense molecules to genes SBEIIa, SBEIIb, SBEI or other genes of the biosynthesis of amylopectin barley can be based on the mRNA sequences of barley or based on homology with the sequences of DNA or mRNA obtained from other species, such as wheat. These antisense sequences may correspond to structural genes or sequences that carry out the regulation of gene expression or splicing event. For example, the antisense sequence may correspond to target the coding region SBEIIa gene or another gene of barley, or 5'-untranslated region (UTR)or the 3'-UTR, or combinations thereof. It can be partially complementary intron sequences, which can be subjected to splicing during or after transcription, but preferably only exon sequences of the target genes. Considering usually greater divergence UTR selection of these areas as a target provides a higher specificity of inhibition of the gene. The length of the antisense sequence should be for men is our least 19 adjacent nucleotides, preferably at least 50 nucleotides, and more preferably at least 100, 200, 500, or 1000 nucleotides. You can use the full sequence complementary to the full transcript of the gene. Length most preferably is 100-2000 nucleotides. The degree of homology antisense sequence with transcript-target must be at least 85%, preferably at least 90% and more preferably 95-100%. Molecule antisense RNA may of course contain extraneous sequences that can function as a stabilizing molecule.

Compresse

Other molecular-biological approach, which can be used is compresse. The mechanism of compressie not well understood, but consider that it involved posttranslational silence gene (PTGS, post-transcriptional gene silencing), and in this respect he can be very similar to many examples of antisense suppression. It includes an introduction to plant additional copies of the gene or its fragment in sense orientation relative to the promoter for its expression. The size of this semantic fragment, the regions of the target genes and the degree of homology with the gene target are the same as described above for antisense sequences. In some cases this on the additional copy of the gene sequence inhibits expression of the target genes of plants. In terms of means of implementation approaches of compressie reference is made to patent application WO 97/20936 and description of the European patent 0465572.

Silence gene, double-mediated RNA

The next method that can be used to introduce genetic variation into the plant barley, is silence gene-mediated duplex or double-RNA. In this way also involved in PTGS. With this method introduce DNA that directs the synthesis of at least partially donateware(s) RNA product(s). DNA, therefore, contains both sense and antisense sequence that, when transcribed into RNA can gibridizatsiya education Dantewada district of RNA. In the preferred embodiment of the sense and antisense sequences are separated by spacer elements of the area that contains the intron, which when transcribed into RNA undergoes splicing. It is shown that this procedure results in a higher efficiency of silence gene. Double area may contain one or two RNA molecules transcribed from either one or from two regions of DNA. The presence of this double-molecule triggers a response from the endogenous system of plants, which destroys as Dunaeva RNA and homologous RNA transcript of the target genes of plants, effectively reducing or eliminating the asset is ity of the gene target. In terms of ways to use this technique, reference is made to the description to the Australian patent 99/292514 and to the description of patent application WO 99/53050. The length of the sense and antisense sequences which hybridize, shall in each case be at least 19 of adjacent nucleotides, preferably at least 50 nucleotides, and more preferably at least 100, 200, 500, or 1000 nucleotides. You can use the full sequence corresponding to the full transcript of the gene. Length is most preferable amount of 100-2000 nucleotides. The degree of homology of sense and antisense sequences from the transcriptome-the target must be at least 85%, preferably at least 90% and more preferably 95-100%. The RNA molecule may of course contain extraneous sequences that can function as a stabilizing molecule.

Ribozymes

Ribozymes can be used to introduce genetic variation responsible for the inactivation of expression of the desired gene in barley. Ribozymes are RNA molecules with enzymatic or catalytic function, which can cleave other RNA molecules at specific sites, specific to one or two more hybridization sequences. The cleavage of RNA enact viruet the expression of the target genes. Ribozymes can also function as antisense molecule that may contribute to the inactivation of the gene. Ribozymes contain one or more than one catalytic domain preferably of the type head of a hammer or studs, hybridization between sequences. You can use other ribozyme motives, including RNase P, introns group I or II and type of hepatitis Delta. Reference is made to the description of European patent 0321201 and U.S. patent No. 6221661. The use of ribozymes for inactivating genes in transgenic plants demonstrated, for example Wegener et al. (1994).

The genetic constructs/vectors

The invention also suggested that the selected molecules of nucleic acid, including RNA, preferably DNA that encode inhibitory gene molecule. Preferably, these nucleic acid molecules encode antisense molecules, semantic (compressie), double strand RNA or ribozymes to target is the sequence of SBEIIa gene of barley, and effective in inactivation of its expression in the endosperm of barley plants. The invention also suggested that the genetic constructs containing an isolated nucleic acid molecule containing one or more than one regulatory element, such as promoters, enhancers and sequence termination of transcription or polyadenylic the Finance. Such elements are well known in the art. These genetic constructs may also contain intron sequences that promote expression of the transgene in plants, particularly in monocotyledonous plants, such as barley. The term "intron" is used in its usual sense as meaning a genetic segment that is transcribed but does not encode a protein, which undergoes splicing of RNA before translation. Introns can be included in the 5'-UTR or coding region, if the transgene encodes the transmitted product, or anywhere in the transcribed region, if it does not encode the transmitted product.

Further, in the invention proposed vectors, such as plasmid vectors containing such genetic constructs. The term "vector" includes expression vector capable of expression in vitro or in vivo, and transformational vector capable of transfer from one cell or organism to another(oops). These vectors contain sequences that provide their replication in cells, such as prokaryotic cells such as E. coli or Agrobacterium. Preferably the vector is a binary vector containing a sequence of T-DNA specific for at least one border sequence of T-DNA, which can be entered in cells of barley. Further, in the image the proposed attachment of cells, containing such vectors such as Agrobacterium cells or barley, which can be regenerated cells, such as cells scutellum immature embryos. Alternative these cells may represent the transformed cells of barley containing the transgene.

Promoters/terminators

The transgene or other genetic construct according to the invention may include the area of initiation of transcription (promoter), which can provide regulated or constitutive expression in the endosperm of barley. This promoter may be tissue-specific, providing the expression selectively or exclusively in the endosperm. This promoter can be selected either from the specific to the endosperm (such as the promoter of high molecular weight glutenin, the promoter SSI wheat, the promoter of wheat SBEII, the promoter of wheat GBSS) promoter or promoters, which are not specific to the endosperm (such as the promoter of ubiquitin, either the CaMV35S promoters or with 35S enhancers). The promoter can be modulated by factors such as temperature, light or stress. Typically, the promoter provides the expression of the 5' genetic sequence. Design can also contain other elements that enhance transcription, such as nos 3' or ocs 3', areas polyadenylation or transcription terminators. Illustrated regions of DNA will be on the us in the vectors, containing the appropriate sequence of selective gene markers and other items, or vectors, which cotransformation with vectors containing these sequences.

Methods of transformation of barley

Methods of transformation of monocotyledonous plants, such as barley, for introducing genetic variation into the plant by incorporating the exogenous nucleic acid and for regeneration of plants from protoplasts or immature plant embryos are well known in the art, see, for example, Wan and Lemaux (1994), Tingay et al. (1997), the application for canadian patent 2092588, Nehra, an application for Australian patent No. 61781/94 National Research Council of Canada, Australian patent No. 667939 Japan Tobacco Inc., international patent application PCT/US 97/10621 Monsanto Company, US patent 5589617, other methods described in the application WO 99/14314. Vectors carrying the desired nucleotide sequence or genetic construct and a selective marker, you can type in regenerated cells cultivated barley tissues of plants or explants or in appropriate plant systems, such as protoplasts. Selective gene marker may provide the cells of barley resistance to antibiotics or herbicides, or to enable utilization of substrates, such as mannose. The selective marker is preferably attached glue the Cam barley resistance to hygromycin. The regenerated cells of barley get preferably from scutellum immature embryos, Mature embryos, calli from them, or tissue meristem.

The transformed plant may contain a selective marker gene, or a gene can be removed during or after regeneration, for example, by cutting out the selective marker gene from the genome or by selective segregation of the marker gene from a transgene that inhibits SBEIIa.

Screening plants in which the transgene or mutation has integrated into the chromosome, can be, for example, by using a suitable nucleic acid probe specific for the transgene, or by phenotypic observations. Any of several methods can be used to determine the presence of the transgenic plants. For example, polymerase chain reaction (PCR) can be used to amplify sequences that are unique to transgenic plants, the detection of the amplified products by gel electrophoresis or other methods. DNA can be extracted from plants using conventional methods, and reaction PCR is performed using primers that will distinguish between transformed and untransformed plants. For example, primers can be designed so that the ampli is to aciravati region DNA of the transforming vector, read on design, and the reverse primer designed on the basis of the gene of interest. These primers will amplify a fragment only if the plant has successfully transformed. An alternative way of confirmation of positive transformant is a blot-hybridization by Southern, well known in the art. Plants that are transformed or mutant can also be identified, that is to be distinguished from untransformed plants or wild-type plants, according to their phenotype, for example, given the presence of the selective marker gene or the presence of a specific protein, immunological methods, either by lack of protein, for example, in the absence of SBEIIa protein in the endosperm, which is determined on the basis of the ELISA assay (enzyme-linked immunosorbent assay). Indication used in the screening of these plants can also be carried out by observing phenotypic signs of grain, for example, by visual inspection or measurement wrinkled grain or testing high content of amylose, or microscopic inspection for the presence of double refraction.

Mutation

Introduction genetic variation, leading to reduced activity of SBEIIa enzyme or another enzyme in the endosperm of barley, can be achieved in achiev is Tate suitable mutations within the gene or regulatory sequences of the gene. The extent to which this gene Engibarov, will to some extent determine the characteristics of the starch. These mutations may represent a mutation truncating or null-mutations, and it is known that they have a significant impact on the nature of the starch, but the changed structure of amylopectin also be the result of a mutant with preservation of residual levels of expression, which has the enzymatic activity of the synthesis of amylopectin reduced to a degree sufficient to provide an interesting characterization of starch or grain of barley. Other chromosomal rearrangements can also be effective, and they can include deletions, inversions, duplications or point mutations.

Mutagenesis can be carried out by chemical means or by irradiation, for example by treatment of seeds EMC or sodium azide (Zwar and Chandler, 1995), or gamma radiation. Isolation of mutants can be made by screening plants or seeds subjected to mutagenesis. For example, it is possible to conduct screening populations of barley subjected to mutagenesis, high amylose content in grain and/or longer than normal, the distribution chains of amylopectin in length, or loss of SBEIIa protein using ELISA or modified the morphology of the grain (Green et al., 1997). Screening should preferably carry out the genotype of barley, which is not one of the activities SBE, for example in a negative SBEIIb genetic background. Then such mutations can be introduced in the desired genetic backgrounds by crossing the mutant with the desired plant genetic background and conduct the appropriate number of back crosses to displace the source of unwanted parental genetic background.

Mutations in genes encoding SBEIIa or other enzymes involved in the synthesis of amylopectin, will usually be the cause of high relative amylose content. The amount of amylose on an individual grain can be increased due to the changed flow of carbon from amylopectin to amylose, or it can be reduced if there is a significant decrease in the production of starch in the grain. In any case, the relative level of amylose as the percentage of starch is increased.

Suitability for food production

In another aspect of the invention proposed barley, which is suitable for the production of food products, grain, obtained from barley plants having a reduced level of SBEIIa activity in the developing endosperm of grain and starch specified grain having a relatively high amylose content and low content of amylopectin. Plant barley according to the present invention, preferably, not only the et a plant, with the grain that is suitable for food production and, in particular, for industrial food production. Such food products may include the manufacture of flour or other products, which can be a ingredient of industrial food production.

The desired genetic background of barley will include consideration of agronomy of yield and other characteristics. Such characteristics may consider whether it would be desirable to have a winter or spring type barley, agronomic performance, disease resistance and tolerance to abiotic stress. In Australia, it may be desirable to cross between barley varieties, such as Sloop, Schooner, Chebec, Franklin, Arapiles, Tantangara, Galleon, Gairdner or Picolla. The examples given are specific to the Australian industrial district, and other varieties may be suitable for other growing areas. Preferably, variant of the barley according to the invention is provided a yield not less than 80% from the corresponding varieties of wild type, at least in several areas of cultivation, more preferably not less than 90% and even more preferably not less than 95%. The yield can easily be measured in controlled field trials. Also preferably, barley plants were stripped shell, or were"naked", because the presence of a film on the grains of barley introduces additional difficulties in the processing of grain.

The starch content of the grain should be at least about 12% (wt./wt.) or 15%, preferably at least 25%, more preferably at least 35% and even more preferably close to the levels of wild-type 45-50% (wt./wt.). Lower starch content than the wild type, probably are the result of low levels of amylopectin. The grain may also be suitable for the industrial production of food products with a relatively high value vysokomolochnyh products. Other desirable features include the ability of the grain to grinding. Although husked barley can be produced from most forms of grain, some configurations of grain particularly resistant to crushing. Another characteristic that may influence the industrial applicability of the grain, is the color of the product made from this grain. If the film or other part of the grain has significant staining, different than usual, this may limit its industrial use to a particular use, for example as a component of bread containing colored solid or crushed grain. Typically the barley significant coloration is purple, and the color maybe is rcoi or intense which is very undesirable in most food products. Another aspect that can give the plant barley higher value is the degree of extraction of the starch from the grain, and higher speed extraction more useful. The grain shape is also another characteristic that can affect the industrial suitability of the plants, because the grain shape can affect the ease or difficulty of grinding the grain. For example, the barley grain vysokoimpulsnogo plants MK has a very elongated grain morphology, which makes it difficult grinding and processing. A convenient measure of this oblong form and related applicability is the ratio of the length of the grain to the thickness (L/T). This choice is often dictated by the nature of the starch. Preferably, this ratio was less than about 5.5, more preferably in the range of from about 4 to about 5 and most preferably less than 3.5, on average.

More filled grains may be desirable in achieving higher yields and some of the benefits of the invention, which can be achieved, such as the production of starch with high amylose or alternative starch with altered distributions of chain length. Thus, the grain preferably has namors the NISTO phenotype. Other aspects of the invention, however, may be better implemented by using grain, which is less than full. Thus, the share of the aleurone layer or embryo in relation to the starch may be higher in less filled with grain, thereby providing barley flour or other product which is more useful parts of the aleurone layer. A product with high aleurone layer may, therefore, have a higher content of some vitamins, such as folate, or higher levels of some minerals such as calcium, and this combined with higher levels of resistant starch and/or higher levels β-glucan can provide synergistic effects, such as providing enhanced absorption of minerals in the colon.

To maximize the amount of amylose, for barley plants may be desirable to have other phenotypic characteristics in addition to reduced SBEIIa activity. Genetic background may therefore include additionally the amo1 mutation in US (the causative gene is unknown) and the waxy mutation (found, for example, in sort Waxiro). Additionally, it may be desirable getting double mutations in other mutants of barley with wrinkled endospermum, where the causative gene is unknown.

Starch is easy : the amount of barley plants, using standard methods, for example, the way Schulman et al. (1991). On an industrial scale can be used wet or dry grinding. The starch obtained from corn barley plants according to the invention has a high relative amylose content. Barley plants having at least 35-45% of amylose in the starch, consider vysokomolochnye. In the present invention, however, offered barley with amylose content of more than 50% (wt./wt.), preferably at least 60% and more preferably at least 70%, 75%, 80% or 90%.

It should be clear that the relative level of amylose is in relation to the total content of starch, and therefore the remainder of the starch may predominantly represent an intermediate type of starch, or may primarily be a amylopectin, or a mixture of both types.

β-Glucan

It is known that there is a wide variety of levels β-glucan in barley in the range from about 4% to about 18% wt./wt. barley, but more typically from 4% to about 8% (e.g., Izydorcyk et al., 2000). Developed improved lines of barley, for example, contains between about 15% and about 18% wt./wt. β-glucan, but with the waxy phenotype.

Levels β-glucan, proposed by the present invention may depend on genetic background, to who m the enzymatic activity of the synthesis of amylopectin, including SBEIIa, lowered. The embodiment shown in the example, shows a relatively normal synthesis β-glucan, but in other forms of the invention may be considered an increased relative level β-glucan. Thus, a grain of barley plants preferably has a content of β-glucan between about 3 and 6% (wt./wt.) from the total mass of non-coated grains. Other forms of the invention may, however, be content β-glucans more than 6% or higher, such as 6-8%. Measured levels β-glucan mutants waxy reach from 15 to 18%, for example grade Prowashonupana, commercially available under the name Sustagrain™ (ConAgra™ Specially Grain Products Company, Omaha, Neb. USA), and the present invention can provide the same high levels as in this class, or higher.

The temperature of gelatinization

Gelatinization is a fracture (break) of molecular order within the starch granules associated with irreversible changes in properties such as granular swelling, crystallite melting, loss of double refraction, the development of viscosity and solubilization of starch. Vysokopilsky starch from AE (amylose extender) mutants of maize showed higher temperature of gelatinization than normal maize (Fuwa et al., 1999, Krueger et al., 1987). On the other hand, the starch mutants of barley sex6, have no which corresponds to the activity of a starch synthase IIa, had to lower the gelatinization temperature and enthalpy of the peak gelatinization was reduced in comparison with that of the control plants (Morell et al., 2003).

In another aspect of the invention, the starch may be modified temperature of gelatinization, as measured by differential scanning calorimetry. It can be either raised or lowered in comparison with starch from wild-type plants. The changed temperature of gelatinization can be an addition to the relatively high content of amylose. If the gelatinization temperature is lowered, it can be reduced in comparison with starch produced by other varieties of barley with a high content of amylose, or it can be reduced in comparison with starch from barley with normal levels of amylose. Alternative forms of the invention provide for a temperature of gelatinization, which is not changed or increased relative to the starch of barley wild-type. The temperature of gelatinization of the starch of the barley wild-type is typically about 56°for the temperature of the first peak measured by differential scanning calorimetry.

Volume swell

The starch may also be characterized by the rate of swelling in excess heated water compared with wild-type starch. Volume nebuchan what I typically measured by mixing the starch or flour with excess water and heating to elevated temperatures, typically above 90°C. the sample was Then collected by centrifugation, and the amount of swelling is expressed as the mass of precipitated substance divided by the dry mass of the sample. Low characteristic swelling useful if it is desirable to increase the starch content of the food product, in particular hydrated food.

The crystallinity

The structure of the starch of barley selected forms of the present invention may also differ by the fact that the degree of crystallinity is reduced compared to normal starch isolated from barley. The reduced crystallinity of the starch also believe is associated with enhanced organoleptic properties, and facilitate a more mild taste sensation. Thus, the starch may additionally have low crystallinity, resulting from low levels of activity of one or more than one enzyme in the synthesis of amylopectin. The crystallinity is usually examined by x-ray crystallography.

The distribution chains of amylopectin in length

One of the measures of the modified structure of amylopectin is the distribution of chain length or degree of polymerization of the starch. The distribution of chain length can be determined by electrophoresis of carbohydrates using fluorophore (FACE, fluorophore assisted carbohydrate electrophoresis) after removal of p is Svetlana isoamylase. The amylopectin starch according to the invention may have a distribution of chain length in the range from 5 to 60, which is higher than the distribution of starch from wild-type plants after the removal of branching. Starch with longer chains will also be a corresponding decrease in the frequency of branching. Thus, the starch may also have a distribution more long chains of amylopectin even present amylopectin.

Food features

Starch is the main source of carbohydrates in human nutrition, and grain according to the invention and the products obtained therefrom, can be used to manufacture food products. These foods can be consumed by humans or animals, such as livestock or pet foods. The grain obtained from modified plants of barley, can easily be used in processes for the manufacture of food products, and, therefore, the invention includes ground, crushed, broken, collapsed or flattened grain or products produced from a processed or whole grain barley plants described above, including flour. These products can then be used in various food products, such as bakery products such as bread, cakes, biscuits and the like, or food additives, such as thickeners or binders, shall as to obtain a malt barley or other beverages, pasta and instant soups. The grain or products produced from these grains according to the invention, particularly desirable in cereals for Breakfast. Vysokomolochnye starches according to the invention can also be used for the formation of gels of high strength, which are useful in the confectionery industry or provide the possibility of reducing the time of molding and canning. They can also be used as coatings, for example to reduce the absorption of oil in the potatoes or other foods deep freeze.

Dietary fiber

Dietary fiber in this description represents carbohydrates and products of enzymatic hydrolysis of carbohydrates that are not absorbed in the small intestine of healthy people, but is produced in the large intestine. It includes resistant starch, β-glucans and other soluble and insoluble carbohydrate polymers. You should include the part of carbohydrates, which is fermentive, at least partially, in the colon of the resident microflora.

The starch according to the invention preferably contains relatively high levels of dietary fiber, more specifically amylose and possibly an increased level β-glucan. Dietary fiber grains of the present invention may be or may not be the results which only increased the relative content of amylose in the endosperm. β-Glucan may be present at elevated levels and as such can make a significant contribution to the level of dietary fiber.

Aspects of the present invention can be also the result of a combination of the aleurone layer and germ in combination with high levels of dietary fiber. Specifically, this can occur when the grains are higher relative levels of aleurone or embryo. First, the barley has a significantly higher aleurone layer, other than commercial bread cereals as it has trehletniy aleurone layer. Secondly, if the barley grain is slightly wrinkled, the endosperm is present in low quantities, and the aleurone layer and the germ are present in relatively high quantities. Thus, the barley has a relatively high level of some useful elements or vitamins in combination with high resistance, and such items include divalent cations such as bioavailable CA++and vitamins, such as folate, or antioxidants, such as Tocopherols and tocotrienols. Calcium is essential for growth and bone formation soda and other tissue and reduces the risk of osteoporosis later in life. Found that folic acid has a protective effect against neural tube defects etc the reasonable use and reduces the risk of cardiovascular disease, through this reinforcing effects of a combination of resistant starch and β-glucan. Also consider that folic acid has the effect of reducing the risk of some cancers. Tocopherol and tocotrienols possess beneficial effects of antioxidants, and believe that they reduce the risk of cancer and heart disease, as well as have the effect of reducing the undesirable effects of oxidation of food components, such as fatty acids, which can lead to rancidity. One of the specific forms of the crushed product can be set in such a form, where the aleurone layer is included in this crushed product. Concrete grinding process can be performed so as to increase the number of the aleurone layer in the powdered product. A reference to the way done in Fenech et al. (1999). Thus, any product derived from corn, crushed, or otherwise processed to include the aleurone layer and the germ will have useful additional nutritional properties, without requiring the addition of these elements from other sources.

Resistant starch

Resistant starch is defined as the sum of starch and products of enzymatic hydrolysis of starch is not absorbed in the small intestine of healthy people, but coming into the large intestine. Thus, resistant starch excludes products digested and ICA is Ivashina in the small intestine. Resistant starches include physically inaccessible starch (form RS1), resistant granules (RS2), retrogration starch (RS3) and chemically modified starch (RS4).

Changed structure of the starch and, in particular, high levels of amylose starch according to the invention lead to an increase in the stability of the starch by eating. Resistant starch may also be increased if β-glucan is present in elevated levels, which probably exerts protective effects by binding β-glucan with starch granule. The starch may be in the RS1 form, which to some extent inaccessible to enzymatic hydrolysis. Probably link the starch-lipid, as measured on the basis of the V-complex crystallinity, also contributes to the level of resistant starch. In this case, the resistance probably occurs because of physical inaccessibility of starch due to the presence of lipid, and, accordingly, may be considered as RS1 starch. Starch is shown in example barley plants may be resistant to enzymatic hydrolysis in connection with the structure of starch granules and, accordingly, may have a RS2 starch. Each of these characteristics may be present individually or in combination.

It should be clear that one of the advantages of the present invention is the Ohm, it provides products that have special nutritional value, and thus there is no need for the modification of starch or other components of barley grain. However, it may be desirable to obtain the modification of starch, β-glucan or other parts of the grain, and the invention embraces such modified part. Methods of modification are well known and include the extraction of starch or β-glucan or other component parts of the conventional methods and modified starches to improve sustainable form. Starch or β-glucan can be modified by treatment with heat and/or moisture, physically (for example, grinding in a ball mill), by enzymatic (using, for example, αor β-amylase, pullulanase or the like), chemical hydrolysis (wet or dry using liquid or gaseous reagents, oxidation, cross-linking bifunctional reagents (for example, trimetaphosphate sodium, phosphorus oxychloride) or carboxyethylgermanium.

The glycemic index

The glycemic index (GI) is a comparison of the effects of the test food by the impact of white bread or glucose on changes in the concentration of glucose in the blood. The glycemic index is a measure of the likely effect the KTA food product, concerning the concentration of glucose in serum after eating and the need for insulin for glucose homeostasis in the blood. One of the important products proposed by the invention as a result of the high content of amylose and possibly high content of β-glucan is a low-calorie product with a low glycemic index. Low-calorie product may be based on the inclusion of flour obtained from crushed barley grain. It may be desirable, however, to first bring down the grain, removing, perhaps 10% or 20% wt./wt. grain, removing through this aleurone layer, and a larger decrease in removing the fetus. The effect of the stage of collapse is to reduce the lipid content and, consequently, in reducing the calorie content of the food product. Such foods will have the effect of saturation, improve the health of the large intestine, reducing serum concentrations of glucose and lipid after a meal, as well as providing low-calorie food product. Using the collapsed product will result in reduced nutrient benefits of the aleurone layer and the germ. The flour obtained from the collapsed product probably has an improved appearance, since the product obtained in this way has a tendency to white color.

Non-food note is in

In the present invention proposed a modified or improved starch with elevated levels of amylose and decreased levels of amylopectin, whose properties satisfy any of a variety of industrial requirements. Starch is widely used in non-food industries, including paper, textiles, cardboard and glue industry (Young, 1984). Physical properties of unmodified starch limit its usefulness in some applications, and often require chemical modification, which can be expensive or have other disadvantages. In the proposed invention the starch, which may require less modification after receipt, in particular, due to the lower content of amylopectin in combination with other physical properties. For example, the forming temperature of the paste, the resistance to shear stress, the film strength and/or resistance to water - starch and the product obtained from grain according to this invention, can be changed. Starch can also be used to obtain a biodegradable packaging material for bulk materials that can be used as a replacement for polystyrene.

It should be clear that, although guidance is given on the aspects of the present invention, it invented the e may refer to combinations of two or more than two aspects of the present invention.

EXAMPLES

EXAMPLE 1. MATERIALS AND METHODS

Wednesday, inducing callus

For the induction of callus from a germ barley used environment BCI-DM containing Dicamba (2.5 mg/l). One liter of medium:

MS Sol Macro (10x the original solution)100 ml
MS Micro (100x the original solution)10 ml
Iron (200 solution)5 ml
EDTA (200 original solution)5 ml
Maltose15.0 g
Thiamine-HCl (1 mg/ml)1 ml
Myo-Inositol250 mg
Casein hydrolysate1 g
Dicamba (1 mg/ml)2.5 ml
Proline345 mg

the pH was brought to 5.8 and added 3.5 g/l Phytagel. After autoclaving the medium was added to 150 mg/l Timentina and 50 mg/l of hygromycin.

Wednesday regeneration of barley

The barley calli were regenerated in the environment FHG containing VAR (1 mg/l).

FHG-1 Macro (10x the original solution)100 ml
FHG-1 Micro (100x the original solution)10 ml
Thiamine-HCl (1 mg/ml)1 ml
Iron (200 solution)5 ml
EDTA (200 source is Astor) 5 ml
VAR (1 mg/ml)1 ml
Inositol100 mg
Glutamine730 mg
Maltose62 g

the pH was brought to 5.8 and added 3.5 g/l Phytagel. After autoclaving the medium was added to 150 mg/l Timentina and 20 mg/l of hygromycin.

Identification and analysis of carbohydrates

Starch was isolated from barley grain, using the method Schulman et al. (1991). The starch content was determined using a test kit total starch supplied by Megazyme (Bray, Co Wicklow, Republic of Ireland). Then the starch content compared to control plants. Subtract the weight of the starch from the total mass of grain to obtain the total non-starch content of the grain determines whether the reduction of the total mass due to lower starch content.

Determination of amylose or relationship amylose/amylopectin by HPLC method for the separation unbranched starch or binding of iodine were performed as described by Batey and Curtin (1996). Briefly, the starch was degreased by dissolving in DMSO and resultant deposition rates of ethanol. After re-dissolving starch in DMSO and adding water, further diluting and adding a solution of iodine/potassium iodide absorption of the solution was measured at 605 nm. The amylose content was determined on the basis of the standard to the willow, obtained for mixtures of amylose and amylopectin, overlapping the range of 0-100% amylose. Analysis of the relationship amylose/non-branched amylopectin starches can also be carried out according to Case et al. (1998).

Levels β-glucan was determined using a kit supplied by Megazyme (Bray, Co Wicklow, Republic of Ireland).

Starches were subjected to removal of branches and distribution chains in length were analyzed using electrophoresis of carbohydrates using fluorophore (FACE, fluorophore assisted carbohydrate electrophoresis using a capillary electrophoretic instrument according to Morell et al. (1998).

Differential scanning calorimetry (DSC)

DSC measures the change in the temperature of gelatinization, which appeared in the starch due to changes in the ratio of amylose and amylopectin. The gelatinization was measured in a differential scanning calorimeter Pyris 1 (Perkin Elmer, Norwalk CT, USA). Starch was mixed with water in the ratio of 2 parts water:1 part of starch and the mixture (40-50 mg, accurately weighed) was placed in a mold made of stainless steel and sealed. The sample was scanned at 10°per minute from 20°to 140°and as the comparison used a blank mold of stainless steel. Temperature and enthalpy of gelatinization was determined using the software Pyris.

RVA analysis

Viscosity was measured on the device Rapid-Visco-Analyser (RVA, Newport Scientific Pty Lt Warriewood, Sydney), using the conditions described in Batey et al., 1997, for flour from whole grains. To inhibit α-amylase, in all analyses included the silver nitrate at a concentration of 12 mm. The measured parameters were peak viscosity (highest viscosity, hot paste), strength retention, the final viscosity and temperature of formation of paste.

Swelling of the flour

The amount of swelling of the flour was determined according to the method Konik-Rose et al. (2001). The increased absorption of water was measured by weighing the sample before and after mixing of the sample with water at certain temperatures and subsequent collection kastrissianakis substances.

EXAMPLE 2: ALLOCATION of SBE GENES FROM BARLEY

Construction of cDNA and genomic libraries of barley

CDNA library and genomic library of barley received standard methods in phage vectors (Sambrook et al., 1989). The cDNA library was obtained ZipLox vector (Life Technology) according to the protocols supplied with the reagents. The titer of the library, tested strain of E. coli Y1090(ZL), was 2×106PFU (plaque-forming units). Genomic library barley, obtained from E. Lagudah (CSIRO), was constructed from DNA from cultivar Morex. DNA was subjected to enzymatic hydrolysis Mbol and ligated in the vector EMBL3cos, hydrolyzed EcoRI/BamHI. The cloned fragments can be release during enzymatic hydrolysis of SalI.

The selection is of posledovatelnostei genes SBEIIa and SBEIIb from a genomic library of N. vulgare

Conditions for screening libraries were: hybridization in a mixture of 25% formamide, 5×SSC, 0.1% of LTOs, 10× denhardt's solution, 10 ág/ml DNA salmon sperm at 42°C for 16 h followed by washing 2×SSC, 0,1% - ordinator at 65°C for 3×1 h (medium stiffness). Clones containing genes SBEIIa and SBEIIb or significant areas, were isolated and sequenced. Comparison of DNA sequences with sequences from the part numbers listed in table 1, confirmed that both the gene of interest were isolated from barley. The cDNA sequence SBEIIa and SBEIIb can be also obtained by PCR with reverse transkrypcja (RT-PCR) with specific primers, methods, well known in the art. The cDNA sequence SBEIIa and SBEIIb barley shown in figures 1 and 2, and the genomic sequence of SBEIIa and SBEIIb wheat is shown in figure 3 and 4.

Table 1

Genes for enzymes razvetvlyayushchikh starch, characterized in cereal
IsoformType clonecatalog No.Link
SBE
CornSBEIcDNAU17897Fisher et al., 195
genomicAF072724Kim et al., 1998a
SBEIIbcDNAL08065Fisher et al., 1993
genomicAF072725Kim et al., 1998
SBEIIacDNAU65948Gao et al., 1997
WheatSBEIIcDNAY11282Nair et al., 1997
SBEIcDNA andAJ237897 (SBEI gene)Baga et al., 1999
genomicAF002821 (SBEIRahman et al., 1997
pseudogene)Rahman et al., 1999
AF076680 (SBEI gene)
AF076679 (SBEI cDNA)
SBEIcDNAY12320Repellin et al., 1997
SBEIIacDNA andAF338432 (cDNA)Rahman et al., 2001
genomicAF338431 (gene)
RiceSBEIcDNAD10752Nakamura and
Yamanouchi, 1992
SBEIgenomicD10838Kawasaki et al.,
1993
SBE3cDNAD16201Mizuno et al., 1993
BarleySBEIIaand cDNA andAF064563 (SBEIIb gene)Sun et al., 1998
SBEIIbgenomicAF064561 (cDNA
SBEIIb)
ÈA; AF064562 (SBEIIa gene)
AF064560 (cDNA
SBEIIa)

EXAMPLE 3: DESIGN FOR EXPERIMENTS ON TRANSFORMATION TO CHANGE EXPRESSII SBEIIA AND SBEIIB BARLEY

Duplex RNA (dsPHK) design has been to reduce the expression or SBEIIa or SBEIIb genes of barley. In such constructions the desired nucleic acid sequence, which corresponds to the site of genes SBEIIa or SBEIIb, met both in sense and antisense orientations relative to the promoter, so that the expressed RNA contain complementary regions that were capable of base pairing and the formation of a duplex or double-RNA. The spacer elements located between the sense and antisense sequences contained the intron sequence which when transcribed in the form of a plot of RNA in transformed plants will be subjected to splicing with the formation of a compact "stem" duplex structure. Found that the inclusion of intron increases the efficiency of silence genes, attached duplex RNA structures (Smith et al., 2000). The desired nucleic acid was cross-linked to the promoter is the selected high molecular weight glutenin (HMWG) (promoter subunit DX5 gene, catalog number H, Anderson et al., 1989) and the termination sequence of the gene nepalensis of Agrobacterium (nos3').

The duplex-RNA constructs containing the sense/antisense fragments of SBEIIa or SBEIIb derived from genes of wheat SBEIIa and SBEIIb reasons, a high degree of sequence identity between the genes of wheat and barley, the original was designed in vector pDV03000, then a cut and ligated with the transforming vector of barley pWBVec8. These structures are schematically shown in Figure 5. Vector pWBVec8 contain a number of sites enzymatic restriction to embed the desired DNA sequences.

Duplex RNA structure SBEIIa containing 1536 BP nucleotide sequence amplified by PCR from the SBEIIa gene from wheat (GenBank reference number AF338431, see figure 3). This sequence consisted of 468 BP sequence, which contained a full-sized exons 1 and 2 and part of exon 3 (nucleotide position 1058-1336, 1664-1761 and 2038-2219 figure 3) with the restriction sites EcoRI and kpni restriction sites on either side (fragment 1), 512 BP sequence that consists of exons 3 and 4 and a full-sized intron 3 SBEIIa (position of the nucleotides 2220-2731 figure 3) with the restriction sites kpni restriction sites and SacI on each side (fragment 2) and a fragment of 528 BP, consisting of a full length of exons 1, 2 and 3 SBEIIa (position of the nucleotides 1058-1336, 1664-1761 and 2038-2279 figure 3) sites with the enzyme BamHI and SacI on each side (fragment 3). Fragments 1, 2 and 3 ligated in such a way that the sequence of fragment 3 was Legerova with fragment 2 in the antisense orientation relative to the slice 1. This gene construct in the vector pDV03000 outlined pDV03-IIa, and the duplex-RNA gene identified ds-SBEIIa.

Strategy for duplex RNA structures SBEIIb was like. Design SBEIIb containing fragment 1607 BP, amplified by PCR from the SBEIIb gene of wheat (this sequence is depicted in Figure 4). This sequence consisted of 471 BP sequence, which contained a full-sized exons 1 and 2 and part of exon 3 (nucleotide position 489-640, 789-934 and 1598-1769 figure 4) with the restriction sites EcoRI and kpni restriction sites on either side (fragment 1), 589 BP sequence that consists of exons 3 and 4 and a full-sized intron 3 SBEIIb (position of the nucleotides 1770-2364 figure 4) with the restriction sites kpni restriction sites and SacI on each side (fragment 2) and a fragment of 528 BP, consisting of a full length of exons 1, 2 and 3 SBEIIb (position of the nucleotides 489-640, 789-934 and 1598-1827 figure 4) with the restriction sites BamHI and SacI on each side (fragment 3). Fragments 1, 2 and 3 ligated in such a way that the sequence of fragment 3 was Legerova with fragment 2 in the antisense orientation relative to the slice 1. This gene structure SBEIIb duplex RNA in the vector pDV03000 outlined pDV03-IIb, and the duplex-RNA gene identified ds-SBEIIb.

the assets of the promoter - sense/antisense - terminator was built into the binary vector pWBVec8 using restriction enzymes ApaI and NotI. The design of SBEIIa in the vector pWBVec8 outlined pVec8-IIa, a design SBEIIb in the vector pWBVec8 outlined pVec8-IIb. These structures are shown schematically in Figure 5.

The identity between the sequences used wheat SBEIIa and the corresponding sequence of barley SBEIIa was 93% when using the Gap program to compare sequences. Similarly, the identity between the sequence of the wheat SBEIIb and the corresponding sequence of SBEIIb barley was 92%. Technology duplex RNA effective to silence the expression of genes that have sequence identities above about 85% in respect of the duplex region, and, therefore, expected that the duplex, constructed with sequences of wheat, to be effective against the sequences of barley.

EXAMPLE 4: TRANSFORMATION of BARLEY

Methods of transformation of barley by Agrobacterium tumefaciens or biolistics described (Tingay et al., 1997; Wan et al., 1994) and can be used to transfer DNA structures, generating transgenic plants. In this example, the gene construct binary vectors obtained as described above was injected into a highly virulent strain of Agrobacterium using technogically conjugation and then IP is was olovely for the introduction of T-DNA, containing inhibitor gene (ds-SBEIIa or ds-SBEIIb) and the selective marker gene (encoding resistance to hygromycin expressed from the promoter CaMV35S), the regenerated cells scutellum immature embryos of barley, as described below.

Developing seeds of barley cultivar Golden Promise, 12-15 days after pollination, extracted from the growing ear grown in the greenhouse plants and sterilized for ten minutes in 20% (vol./about.) bleach, then rinsed once with 95%ethanol and seven times with sterile water. Then the germ (about 1.5 to 2.5 mm in size) were isolated from seeds under aseptic conditions, and the Central cylinder was cut out from each embryo. The embryos were placed cut side down on a Petri dish containing medium induction of callus. Transconjugate Agrobacterium (strain AGL1) were grown in broth MG/L (containing 5 g mannitol, 1 g L-glutamic acid, 0.2 g KH2PO4, 0.1 g NaCl, 0.1 g MgSO4·7H2O, 5 g of tryptone, 2.5 g yeast extract and 1 mcg of Biotin per liter, pH 7.0)containing streptomycin (50 mg/l) and rifampicin (20 mg/l) with aeration at 28°With up to a concentration of approximately 2-3×108cells/ml, and then approximately 300 µl of cell suspension was added to the embryos in a Petri dish. After 2 min, excess liquid was removed from the Cup tip, and the embryos turned to atrasan the back side (the axial direction of scutellum) was on top. Then the embryos were transferred to fresh Cup with medium induction of callus and were placed in the dark for 2-3 days at 24°C. the Embryos were transferred to selective medium for the induction of callus (50 μg/ml of hygromycin and 150 µg/ml Timentina). The embryos were left in this medium for 2 weeks in the dark at 24°C. Then healthy callus was separated and placed on fresh selective medium and incubated in the next two weeks at 24°in the dark. Afterwards, the embryos were incubated at 24°exposed to light for 2 weeks on regeneration medium containing a cytokinin, and carried in carpobrotus medium containing cytokinin and auxin, three 2-week period. Then the young plants were transferred to a solid mixture and kept on moist terrace for 2 weeks and finally was transferred to a glass greenhouse. This method has processed a total of 400 embryos using pVec8-IIb, and 300 embryos using pVec8-IIa, and 18 plants from 7 calli transformation IIb and 18 plants from 14 calli transformation IIa survived on the selective medium, suggesting that they were successfully transformed these gene constructs. Expected that not all plants that have been transformed selective marker gene, integrated SBEIIa or SBEIIb inhibitor gene; they can be easily distinguished, as described in the following examples.

EXAMPLE 5:ANALYSIS OF PLANTS AND GRAINS OF BARLEY, TRANSFORMED DUPLEX RNA STRUCTURES

The presence or absence of the transgene(s) in plants or seeds or plants descendants of barley were identified or confirmed using PCR techniques or analysis of blot-hybridization on Southern. DNA was obtained from samples of leaves from the alleged transformed plants by standard methods.

PCR analysis of transformed barley plants detection of transgenes

Forward and reverse primers used for screening for the presence of the transgene ds-SBEIIa, were as follows: WH 3' (5'-CAA CCA TGT CCT GAA CCT TCA CC-3') SEQ ID No. 5 and AR2akpnR (5'-GGT ACC CCA TCT CCT GGT TTT GGG ACA AC-3') SEQ ID No. 6, respectively. This primer pair amplified a fragment of 569 BP, corresponding to the position within the promoter sequence HMWG of the transgene to the position of the nucleotide 2219 figure 3, one of those plants that contained the transgene, ds-SBEIIa. The primers used for screening for the presence of the transgene ds-SBEIIb, were as follows: WH 3' (as above) and AR2bkpnR (5'-GGT ACC GTC CAT TTC CCG GTG GTG GCA G-3') SEQ ID No. 7. This primer pair amplified product 571 BP, corresponding to the position within the promoter sequence HMWG of the transgene to the position of the nucleotide 1768 in figure 4, one of those lines that contained the transgene, ds-SBEIIb. PCR amplification was performed in a 20 µl reaction mixture containing 2.5 units of Hotstar Taq, 1×buffer-added farm is that containing 1.5 mm MgCl2, 0.125 mm of each deoxynucleotide (dNTPs), 1 μm each of forward and reverse primers and 100 ng DNA. The PCR program included an initial stage of denaturation at 95°C for 5 min followed by 36 cycles of 95°C for 30 sec, 59°C for 1 min and 72°C for 2 min and ended with 72°C for 5 minutes

Positive transformants barley identified for both structures SBEIIa and SBEIIb (6). The data are summarized in table 2.

Table 2.

Summarizing the results of PCR and blot-hybridization on Southern transgenic lines of barley SBEIIa and SBEIIb
Transgenic line SBEIIb, No.No. transformation eventandPCRSouthernTransgenic line SBEIIa, No.No. transformation eventandPCRSouthern
IIb1.11--IIa1.11--
IIb1.21--IIa2.12--
IIb1.31++ (OS)IIa3.13+-
IIb2.12++IIa3.23+-
IIb2.22++IIa4.14.1++
IIb3.13++IIa4.24.2++
IIb4.14++IIa5.15+HP
IIb4.24++IIa5.25++
IIb4.34++IIa6.16++
IIb4.44++IIa6.26++
IIb4.54++IIa7.17--
IIb4.64-+IIa9.19+HP
IIb5.15++ (C)IIa10.110+HP
IIb8.18+-IIa11.111--
IIb8.38+-IIa13.213+HP
IIb8.48++ (C)IIa13.313+HP
IIb9.19++IIa15.115+HP
IIa16.116--
a: transformation Event with the same number allocated from the same callus, and they may be identical or independent. Different numbers of independent transformants.

(C): weak; (OS): very weak; NR: no result

Blot-hybridization analysis of the Southern transformed barley

Blot-hybridization analysis of the Southern cross was performed on DNA from plants transgenic for ds-SBEIIa and ds-SBEIIb, and their offspring, to confirm the PCR results. DNA subjected to hydrolysis EcoRI, were obtained from plants by standard methods, were subjected to electrophoresis in a 1-percentage agarose gels and transferred using blotti the ha on a nylon membrane Hybond N+ (Amersham). Radioactively labeled probes was obtained from a region of intron 3 SBEIIa genes (position 2220-2731, see figure 3) and SBEIIb (position 2019-2391, see Figure 4). These segments are parts of the respective structures ds-SBEIIa and ds-SBEIIb (example 3) and was in the state of radioactive labels, using a system of tagging Megaprime DNA (Amersham Pharmacia Biotech UK Ltd), and was used for hybridization. Hybridization was performed in a mixture of 25% (vol./about.) formamide, 5×SSC, 0.1% of LTOs, 10× denhardt's solution, 100 μg/ml DNA salmon sperm at 42°C for 16 h followed by washing 2×SSC, 0,1% - ordinator at 65°C for 3×1 h Autoradiography of the membranes revealed a band of positive hybridization on the tracks corresponding to the plants that were positive for these structures (Fig.7). Fragments of the endogenous genes of barley SBEIIa and SBEIIb was not detected in the hybridization due to the difference in the sequence of the used probe intron 3 wheat.

The results of PCR and hybridization on Southern summarized in table 2. In General, the results of PCR and hybridization on Southern correlated well. Differences could be associated with false-negative results and can be easily resolved by re-analyses. Plants that were positive for the transgene, as demonstrated in both ways, included 4 independent transformation event on the I ds-SBEIIa on the Southern (IIa 4.1, IIa 4.2, IIa 5 and IIa 6) and 5 independent events for ds-SBEIIb (event # IIb 2, IIb 3, IIb 4, 5 and IIb IIb 9).

Analysis of the proteins of the endosperm of barley using polyacrylamide gel electrophoresis (SDS page)

To determine the impact of transgenes ds-SBEIIa and ds-SBEIIb on gene expression SBEIIa and SBEIIb of barley from a transformed plant, the expression of specific proteins in the tissue of the endosperm of developing seeds was determined by electrophoresis in SDS page in adenocarinoma conditions and Western blot analysis. As expected T1 seeds (seeds from t0 plants) will be split by the transgenes, the endosperm from each of the ten individual developing grains T1 from each of the t0 plants 20 days after flowering were analyzed for the expression of protein SBEIIa and SBEIIb. To save the T1 plants, embryos were extracted from developing seeds and cultivated for plant regeneration T1. The endosperm, cut off from all maternal tissues (0.2 g), homogenized in 600 μl of 50 mm KPi buffer (42 mm2HPO4and 8 mm KN2PO4), pH 7.5, containing 5 mm EDTA, 20% glycerol, 5 mm DTT (Dimitrios) and 1 mm Pefabloc. The crushed samples were centrifuged for 10 min at 13,000 g, and the supernatant was divided into aliquots and frozen at -80°s to use. The protein levels were measured with the reagent Kumasi using BSA (bovine serum albumin) as a standard. Summary the e-soluble proteins, equivalent to 20 μg extracted from each of the endosperm, was applied to the track and were subjected to electrophoresis in an 8%were adenocarinoma polyacrylamide gels containing 0.34 M Tris-HCl (pH 8.8), acrylamide (8%), ammonium persulfate (0,06%) and TEMED (0.1 per cent). After electrophoresis proteins were transferred to nitrocellulose membrane according to Morell et al. (1997) and subjected to immunological reactions with specific antibodies for SBEIIa and SBEIIb. The antibody used for detection of SBEIIa, represented 3KLH of the rabbits, which was generated against a synthetic peptide AASPGKVLVPDESDDLGC SEQ ID No. 8 (a sequence from N-Terminus SBEIIa) and diluted 1:5000 for use. The antibody used for detection of SBEIIb, was represented by R6, generated against a synthetic peptide AGGPSGEVMIGC SEQ ID No. 9 (derived sequence from N-Terminus SBEIIb) and diluted 1:6000 before use. The second antibody was a GAR-HRP conjugate (dilution 1:3000), and immunoreactive bands were detected using the detection system, Amersham ECL.

The protein expression in developing seeds from T1 plants transformed genes ds-SBEIIa and ds-SBEIIb, as it turned out, was undergoing segregation ratio of 1:2:1 strong band:moderate - weak bands:no band for some of the transgenic lines (for example, see Fig and 9). This ratio corresponds to the expected is the rate of segregation of homozygous (wild type = zero transgenes):heterozygotes:homozygous for the transgene. The T1 plants of the rescued embryos were grown to obtain T2 seeds that were subjected to screening by PCR and analysis of gene protein to confirm the genetic status of the T1 seeds respect to the transgene.

These data indicate that the duplex RNA structure effective in reducing gene expression, SBEIIa and SBEIIb in the endosperm of barley.

The SBEIIb gene expression in transgenic seeds containing the transgene ds-SBEIIa and SBEIIa gene expression in seeds containing ds-SBEIIb, also analyzed by the method of Western blotting. Suddenly in transgenic seeds containing the ds-SBEIIa, for example, in the event of transformation IIa 4.1, was significantly reduced SBEIIb. See Fig.9, showing only a low level of expression of SBEIIb in the seeds from the line IIa 4.1.8 (note very weak bands on 4 tracks of 7). This line contained the transgene, ds-SBEIIa and had negligible expression of SBEIIa. However, the opposite effect was observed in the seeds, transgenic for ds-SBEIIb. Expression of SBEIIa was unchanged in the seeds, which SBEIIb was completely silent due to the ds-SBEIIb (Figure 10), namely transgenic lines, which were the result of transformation events IIb 4 and IIb 2. The area encompassing exons 1-3, used for both duplex structures ds-SBEIIa and ds-SBEIIb. Alignment of sequences of the SBEIIa and SBEIIb in this area showed only about 70% identichnost is I. The longest period of 100% identity was a region of 21 BP in exon 2. Although it is possible that the expression of SBEIIb was suppressed by the design of the ds-SBEIIa due to the sequence homology, it is also possible that the SBEIIb activity was reduced by transgene ds-SBEIIa through any other mechanism.

The levels of gene expression, SBEIIa and SBEIIb can be a specific, defined at the mRNA level using standard techniques, such as methods of hybridization on Northern and RT-PCR, for example, using probes from non-conservative districts or pairs of primers, which hybridize with the unique sites in one of the genes, but not in another, for example, a 3'-noncoding regions. Such areas or sites can be easily identified by comparing the sequences of these two genes.

EXAMPLE 6. Analysis of the COMPOSITION AND CONTENT of GRAIN, INCLUDING STARCH

The composition and content of grain, in particular, starch can be measured using standard techniques, such as described in example 1.

After extraction of soluble proteins, as described above, the starch granules from the individual samples of the endosperm of developing seeds containing the transgene ds-SBEIIa, visualized under a light microscope. A significant change in the morphology of starch granules (see, for example, 11) observed in the developing endose the IU where was reduced expression of SBEIIa, for three of the five analyzed event transformation: IIa 4.1, IIa 4.2 IIa and 13, but not for events IIa 5 or IIa 6, which could have a lesser degree of inactivation of the gene. For example, starch from seeds IIa 4.2.5, who had no stripes SBEIIa on protein immunoblot was highly distorted compared to the normal granules in the seeds IIa 4.2.3, which had a strong band SBEIIa on protein immunoblot (table 3). Results light microscopy were confirmed by scanning electron microscopy (SEM), which can also be used for direct observation of starch granules. For this purpose, purified starch sprayed with gold and scanned at 15 kV at room temperature. Seeds with reduced expression of SBEIIa showed distorted irregular shape, which was visible under the scanning electron microscope, for example the distortion of the granules in the seeds IIa 4.2.5 compared with seeds IIa 4.2.3 (Fig).

In contrast to plants containing the ds-SBEIIa, plants, transformed ds-SBEIIb, showed the starch granules of the endosperm with normal morphology in the study of microscopy, such as the line IIb 4.1 (see table 3). This suggests that the decrease in expression of one SBEIIb not significantly change the morphology of starch granules.

12
Table 3

The morphology of starch granules in endosperm tissue T1 transgenic barley lines ds-SBEIIa and ds-SBEIIb
No.Transgenic lineThe protein band on the immunoblotThe morphology of starch granules (light microscopy)
1IIa 4.1.8No bandDistorted
2IIa 4.1.4Strong bandNormal
3IIa 4.1.3Strong bandNormal
4IIa 4.2.1No bandDistorted
5IIa 4.2.9No bandDistorted
6IIa 4.2.5No bandDistorted
7IIa 6.2.8No bandNormal
8IIa 5.2.3No bandNormal
9IIa 6.2.2Strong bandNormal
10IIa 4.2.3Strong bandNormal
11IIa 13.1.9No bandNormal
IIa 13.1.10Weak bandNormal
13IIa 13.1.3Strong bandNormal
14IIa 13.2.4No bandSome distortion
15IIa 13.1.6Weak bandNormal
16IIb 4.1.9No bandNormal
17IIb 4.1.8No bandNormal
18IIb 4.1.2No bandNormal

Birefringence is a substance's ability to reflect light in two directions; it forms a dark cross, called the "Maltese cross"on each starch granule when observed in polarizing microscope. Birefringence is a measure of the degree of ordered structural organization of polymers inside the granules (Thomas and Atwell, 1999). Starch granules of the endosperm of seeds IIa 4.2.5 (with reduced SBEIIa activity in polarized light showed that in these granules is a significant loss of double refraction compared to pellets made from seeds IIa 4.2.3 (wild type). On average, 44,8% of the granules in the seeds IIa 4.2.5 had double the th refraction as opposed to 2.2% in the seeds IIa 4.2.3 (table 4). The loss of double refraction in starch granules is generally well correlated with a high content of amylose.

Table 4

Birefringence of starch granules of the endosperm T1 transgenic barley lines ds-SBEIIa
LineField microscopeThe number of granules, does not exhibit DLThe number of granules exhibiting partial DLThe number of granules exhibiting full DL
A (negative SBEIIa)1381912
248229
2262535
4171225
Only129 (44,8%)78 (27,1%)81 (28,1%)
A (control)158205
239104
335200
42285
Only13 (2,1%)24 (3,8%) 593 (94,1%)
DL: double refraction

Analysis of the weight of grain of transgenic seeds from plants grown in the greenhouse, from the line IIa 4.2, containing the ds-SBEIIa revealed that even in the seeds with highly distorted starch granules was no significant reduction in the weight of grain and, consequently, production of starch (table 5). This differs from underweight grain observed in barley, which is mutant in SSIIa gene, which exhibits a significantly reduced production of starch (Morel et al., 2003). This suggests that the average weight of grain and, consequently, the yield of barley with reduced SBEIIa activity in the endosperm, grown in the field, is almost normal.

Table 5

Grain weight of T1 seeds from transgenic for SBEIIa lines of barley IIa 4.2
No.No. of seed of the lineThe morphology of starch granulesGrain weight (mg)
1IIa 4.2.1Normal46,4
2IIa 4.2.2Strongly distorted39,3
3IIa 4.2.3Distorted39,0
4IIa 4.2.4Distorted 40,8
5IIa 4.2.5Strongly distorted37,3
6IIa 4.2.6Normal41,8
7IIa 4.2.7Normal35,0
8IIa 4.2.8Strongly distorted41,5
9IIa 4.2.9Strongly distorted41,1
10IIa 4.2.10Strongly distorted38,6

Levels of amylose and amylopectin in grains of transgenic barley

Seeds with starch granules having a distorted shape, described by vysokoimpulsnogo barley (Morell et al., 2003) and in maize with low amylopectin (LAPS), with approximately 90% of amylose in the starch (Sidebottom et al., 1998). The amylose content can be determined by using HPLC with a displacement size of 90% (wt./about.) DMSO or largest blue color with iodine (iodometric method)as described in example 1. On the basis of the weight of grain and content of amylose amount of amylose stored grain can be calculated and compared to the transgenic and control lines.

Starch was isolated from grains of barley generation T1 splitting ds-SBEIIa or T2 generation (possibly homozygous for the ds-SBEIIa) from plants, transgenic gene ds-SBEIIa or receive the data as a result of crossing between the line IIa 4.2.5 and line IIb 4.3.8 (containing ds-SBEIIa, and ds-SBEIIb), and amylose content was determined by the colorimetric method according to Morrison and Laignelet (1983). Determined the content of amylose starch of the five United grain samples listed below. The absorption read at 650 nm, translated in the percentage of amylose using a regression equation derived on the basis of standard samples (in the range from 0 to 100% amylose), derived from amylose and amylopectin potato, Y=137,h-30,361, where x is the absorption at 650 nm, and Y represents the percentage of amylose.

Samples:

Pool 1: the seven seeds of T1, which showed a strong distortion of starch granules from transgenic lines IIa 4.1.

Pool 2: six seeds of T1, which showed some distortion pellets from transgenic lines IIa 4.1.

Pool 3: the seven seeds of T1, which was the normal form of granules, from transgenic lines IIa 4.1.

Pool 4: six seeds T2, which showed a strong distortion of the granules, from transgenic lines IIa 4.2.5.

Pool 5: five seeds F1, which showed a strong distortion of the granules, from a cross between IIa 4.2.5 and IIb 4.3.8 (transgenic line ds-SBEIIb).

Controls: mutant barley M for SSIIa (Morel et al., 2003), barley cultivar Himalaya and mutant wheat for SSIIa (Yamamori et al., 2000).

Starch from grains from barley with reduced SBEIIa activity on the basis of distorted starch granules showed more than 80% amylose. With the actual content of amylose was increased with the degree of distortion of the starch granules, to compare pools 1, 2 and 3 (table 6). The content of amylose for pools 1 and 2 were higher than for starch mutant in SSIIa lines of barley M (table 6). The amylose content was even higher (over 90%) in the pool 5, consisting of F1 seeds from crosses between transgenic lines ds-SBEIIa and ds-SBEIIb. It should be noted that the absorption values obtained in this way may be somewhat affected by the structure of amylopectin.

Table 6.

The amylose content in the grain of transgenic barley lines with low activity SSIIa
The sample of starchThe content of amylose (% starch)
Repeat 1Repeat 2Repeat 3Average
Pool 185,0an 80.2an 80.281,8
Pool 260,652,151,7of 54.8
Pool 339,440,540,040,0
Pool 484,484,688,385,8
Pool 5for 95.394,8106,198,7
Barley M66,9of 60.558,461,9
Barley Himalaya21,821,622,3of 21.9
Mutant wheat SSIIa52,146,754,551,1

This means that the content of amylopectin in the starch of the grain is greatly reduced, from approximately 75% in wild type to less than 20% or even less than 10%, because the starch of the grain is almost exclusively made up of amylose and amylopectin.

EXAMPLE 7. The SBEIIA GENE MUTATION IN BARLEY

The SBEIIa gene mutation in barley, resulting in lack of expression of SBEIIa, can be obtained either through irradiation with gamma rays or by means of chemical mutagenesis, for example by ethylmethanesulfonate (EMC). For the induction of mutations by gamma-rays seeds were irradiated at a dose of 20-50 cu from source60With (Zikiryaeva and Kasimov, 1972). EMS mutagenesis was carried out by seed treatment with EMS (0,03% vol./vol.), as Mullins et al. (1999). Mutant grains were identified on the basis of the high content of amylose or a change in the morphology of the starch grain and confirmed in the ways described. Mutants in SBEIIa can be re-mutagenesis in the second round and to conduct screening progeny for the loss of activity SBEIIb in addition to the SBEIIa or mutant SBEIIa could be crossed with mutant SBEIIb to combine these mutations and to get nereshennye variant of barley, to the nd essentially no SBEII activity in the endosperm.

EXAMPLE 8. CLONING of the GENE SBEI AND constructs FOR INHIBITING expression of SBEI IN BARLEY

The allocation of SBEI gene can be carried out by hybridization of probes from cDNA or genomic library barley or PCR methods. Design of PCR primers can be based on homologous genes from wheat, for example, on the basis of the DNA sequences presented in GenBank AF076679. Used primers can be the following;

5' ACGAAGATGCTCTGCCTCAC 3' SEQ ID No. 10 and

5' GTCCAACATCATAGCCATTT 3' SEQ ID No. 11, and they result in PCR product of approximately 1015 BP

The SBEI gene sequence is used to design inhibitory gene constructs just as described above for SBEIIa and SBEIIb, and enter them in barley.

EXAMPLE 9. COMBINING MUTANTS SBEIIA WITH OTHER MUTANTS SYNTHESIS of STARCH

Plants transgenic for ds-SBEIIa and reduced SBEIIa activity, were crossed with lines of barley M (SSIIa mutant) and High Amylose Glacier (HAG). We set the following crosses:

1) the line IIa 4.1.10 × HAG

2) the line IIa 4.1.16 × HAG

3) line IIa 4.1.20 × M

4) the line IIa 4.1.19 × HAG

The F1 plants were self-pollination and lines homozygous for both mutations identified using genetic and molecular analysis. Expected that the combination of the transgene ds-SBEIIa with mutation SSIIa will starches with a very high content is melosi together with a high content of glucan. The combination of the transgene ds-SBEIIa with mutation HAG may lead to further changes in the composition of starch with improved features in addition to a high content of amylose.

EXAMPLE 10. Characteristics of the BARLEY GROWN IN the FIELD

Weight of grain and content β-glucan was measured for several varieties of barley grown in the field, including line M and M (SSIIa mutant, approximately 60-65% amylose). Based on the results (table 7) it should be noted that the grain M and M was reduced grain size and enhanced content β-glucan regarding varieties of wild type (3,0-6,0% β-glucan). Medium weight grown in a field with grain wild type was in the range of 35-45 g/1000 grains grown in these conditions. Content β-glucan in the grain varieties of wild type was in the range of 3-6%.

Table 7

Grain weight and the levels β-glucan from barley grown in the field
CultivarThe mass of 1000 grains (g)and% beta-glucanand
Tantangera34,90, 35,403,01, 3,37
Sloop37,90, 41,903.04 from, 2,54
Waxiro36,60, 37,105,14, 6,86
Schooner42,60, 38,603,85, to 3.73
Gairdner44,80, 37,10br4.61, 4,19
Namoi40,80, 40,805,19, 4,34
Himalaya39,60, 37,906,04, 5,50
M25,10, increased by 28.7010,01, at 9.53
M28,90, 30,308,02, 8,65
Tantangera x M DH21,20, 21,40the remaining 9.08, 10,95
a: Given double values for individual plots in the field

Specialists in the art will understand that various modifications and changes of these methods may be made without straying from the scope of the invention.

Example 11.

Examples of the claimed compositions

The cereal bars

IngredientsWeight (g)% of the total mass
The Canola oil56,008,0%
Water28,004,0%
Brown sugar56,008,0%
Powdered sugar56,008,0%
Honey70,0010,0%
Rolled barley grain according to the invention140,00 20,0%
Carolina rice52,507,5%
Air wheat52,507,5%
Coconut (shredded)56,008,0%
Dried apricot66,509,5%
Dried seedless raisins66,509,5%
Total weight ingredients700100,0%

Preheat oven to 175°C. Grease with butter the cake pan size 27.5 cm × 17,5 see In a saucepan of medium size with a small heat combine the butter, sugar, water, powdered sugar and honey. Cook while stirring until then, until the sugar has dissolved. Stop heating. Add the barley grain, coconut, Carolina rice, air grains of wheat, apricot and raisins. The mixture is stirred with a wooden spoon until smooth. The resulting mass is put in the prepared baking dish. Bake for 15-18 minutes in a preheated oven. The form of cooling and muesli cut into cubes.

All the muffins
IngredientsVipec the % The test mass (g)% by weight of the total ingredients
Estimated number404%600100,00%
Pastry flour100%148,4324,74%
Flour from whole grain barley according to the invention81%120,0120,00%
Baking powder5%7,071,18%
Sol1%1,480,25%
Eggs48%70,6811,78%
Honey60%89,0614,84%
Milk70%103,9017,32%
The Canola oil35%52,308,72%
Vanilla extract5%7,071,18%

Preheat oven to 190°C. is Poured molds for muffins nonstick solution or put them in a special paper molds for muffins. Mix the flour from whole grain barley, confectionery the UCU, baking powder and salt in a medium bowl until smooth. In a large bowl, beat eggs, then beat the eggs and add the honey and beat for 30 seconds. Then add milk, oil and vanilla extract and beat. Then the resulting mass is mixed with the mixture of flour. The mixture fills the mold by three quarters. Bake for 22 minutes. Received the muffins cool for 5 minutes.

1. The grain obtained from plants of barley, which contains the introduced mutation in the gene SBElla (Watashi starch enzyme lla) or a transgene that encodes an inhibitor of the activity SBElla, and this plant barley has a lower level of enzyme activity SBElla in the endosperm and starch specified grain has a relative amylose content of at least 40% (wt./wt.).

2. Grain according to claim 1, where the plant is barley additionally has reduced aktivnosti enzyme SBEllb (Watashi starch enzyme llb) in the endosperm.

3. Grain according to claim 1, where the plant is barley contains an exogenous nucleic acid expressing the inhibitor SBElla.

4. Grain according to claim 3, where the inhibitor causes a reduced expression of the enzyme SBElla.

5. Grain according to claim 1, in which the grain is nenormiruemym.

6. Grain according to claim 5, having a starch content of at least 25% (wt./wt.).

7. Grain according to claim 6, having a starch content of at least 35% (wt./wt.).

8. Grain according to claim 7, having a starch content of about 45-50% (wt./wt.).

9. Grain according to claim 5, having an average ratio of length to thickness of less than about 3.5.

10. Grain according to claim 5, having an average mass of at least about 36 mg

11. Grain according to claim 1, where the relative amylose content of the starch is at least 60% (wt./wt.).

12. Grain according to item 11, where the relative amylose content of the starch is at least 70% (wt./wt.).

13. The grain on section 12, where the relative amylose content of the starch is at least 80% (wt./wt.).

14. Grain according to claim 1, which is a ground-up, crushed, collapsed, flattened, crushed grain, chopped or whole grain.

15. The barley grain, containing the mutation in the gene SBElla or a transgene that encodes an inhibitor of the activity SBElla, and containing starch having a relative amylose content of at least 75% (wt./wt.).

16. The barley grain in § 15, where the content of amylose measured by iodometric method.

17. Grain at 15, which contains 3-6% (wt./wt.) β-glucan.

18. Grain under item 15, which contains 6-8% (wt./wt.) β-glucan.

19. Flour or whole-wheat flour produced from grain according to any one of claims 1 to 18.

20. The starch obtained from corn barley plants, and plant barley contains introduced a mutation in the gene SBElla or a transgene that encodes an inhibitor of the activity SBElla, and has a reduced level of enzyme activity SBElla in the endosperm, where specified, the starch is unmodified and has a relative amylose content of at least 40% (wt./wt.).

21. The starch according to claim 20, where the plant is barley additionally has a reduced level of enzyme activity SBEllb in the endosperm.

22. The starch according to claim 20, where the plant is barley contains an exogenous nucleic acid expressing the inhibitor SBElla.

23. The starch according to article 22, where the inhibitor causes a reduced level of expression of the enzyme SBElla.

24. The starch according to claim 20, where the relative amylose content of the starch is at least 60% (wt./wt.).

25. The starch in paragraph 24, where the relative amylose content of the starch is at least 70% (wt./wt.).

26. The starch A.25, where the relative amylose content of the starch is at least 80% (wt./wt.).

27. Composition for production of food products containing starch according to any one of p-26, etc is another food ingredient or water.

28. Composition for the production of food products containing starch granules of the endosperm of barley and other food ingredient or water, where the starch of these starch granules contains at least 75% (wt./wt.) amylose and endosperm of barley comes from barley plants containing the introduced mutation in the gene SBElla or a transgene that encodes an inhibitor of the activity SBElla.

29. Plant barley, containing the mutation in the gene SBElla or a transgene that encodes an inhibitor of the activity SBElla, and having a reduced level of enzyme activity SBElla in the endosperm, where the starch in the grain of this plant barley has a relative amylose content of at least 40% (wt./wt.).

30. Plant barley in clause 29, further having a reduced activity of the enzyme SBEllb in the endosperm.

31. Plant barley in clause 29 containing the exogenous nucleic acid expressing the inhibitor SBElla.

32. The plant of barley for p, where the inhibitor causes a reduced expression of the enzyme SBElla.

33. Plant barley in clause 29, where the grain is nenormiruemym.

34. Plant barley in clause 29, where the grain has a starch content of at least 25% (wt./wt.).

35. Plant barley at 34, where the grain has a starch content of at least 35% (wt./wt.).

36. The plant of barley for p, where the grain has a starch content of about 45-50% (wt./wt.)

37. Plant barley in clause 29, where the grain has an average ratio of length to thickness of less than about 3.5.

38. Plant barley in clause 29, where the grain has an average weight of at least about 36 mg

39. Plant barley in clause 29, where the relative amylose content of the starch is at least 60% (wt./wt.).

40. Plant barley in § 39, where the relative amylose content of the starch is at least 70% (wt./wt.).

41. The plant of barley for p, where the relative amylose content of the starch is at least 80% (wt./wt.).

42. The method of obtaining barley plants, capable of producing grain having a starch containing at least 40% amylose, which includes stages:

a) introducing a genetic variation into a parent plant or seed of barley, including either the introduction of mutations in the gene SBElla, or the introduction of a transgene that encodes an inhibitor of the activity SBElla, and

b) identification of the plant or seed in a child of the parent plant or seed of barley from stage (a), where this plant or seed-child has a lower activity SBElla in the endosperm.

43. The method according to § 42, where the introduction of genetic variation in stage (a) includes the introduction of exogenous nucleic acids expressing the inhibitor activity SBElla.

44. The method according to § 42, where stage (a) comprises mutagenesis of a parent is about barley plants or seed.

45. A method of obtaining a homozygous barley plants with a reduced activity as SBElla and SBEllb enzyme activities in the endosperm, including

a) mutagenesis of seed from a plant having reduced activity of the enzymatic activity SBElla through which is injected a mutation in the gene SBEllb, or

b) crossing a plant having a reduced enzymatic activity SBElla, with the plant having a reduced enzymatic activity SBEllb;

and identification of barley plants with a reduced activity as SBElla and SBEllb.

46. Starch granules of barley obtained from barley plants under clause 29, containing starch having an amylose content of at least 40% (wt./wt.).



 

Same patents:

FIELD: biotechnology, food processing industry.

SUBSTANCE: barley plants are mutated in SSII gene to reduce SSII activity. Such barley corn has starch structure with. Moreover said corn optionally has relatively high β-glucan content. Starch is characterized with decreased gelatinization viscosity, low crystallinity, and high levels of lipid-bonded starch of V-form crystallinity.

EFFECT: barley plants having reduced amylopectin content and relatively high amylose content.

33 cl, 39 dwg, 10 tbl, 2 ex

The invention relates to a heterophase polymeric compositions having high resistance to aging under conditions of low temperature and humidity

The invention relates to the pulp and paper industry and can be used for the preparation of adhesives in the manufacture of cardboard and corrugated Board

The invention relates to the production of plastics based on natural polymers used in the production of termoformovannyh products of various configurations

The invention relates to a process of manufacturing molded sheets having a linked starch matrix, reinforced fiber, and can be used for the manufacture of ordinary paper and cardboard

The invention relates to methods for manufacturing compositions based on starch with uniformly distributed fibers, which can be used for the manufacture of packaging products and packaging materials

The invention relates to biologically destroy molded product based on vegetable fibrous material, which is integrated in a matrix of at least translated at elevated temperature and elevated pressure in gillespeterson state, termoplasticheskie processed, biogenic material, and method of its manufacture

The invention relates to the production of plastic materials, in particular cellulose acetate plastics (acrolaw), used in production of various thermodormancy products, including consumer packaging, houseware and others, used in contact with food products

FIELD: plant gene engineering and food processing industry.

SUBSTANCE: glutamate-glyoxilate-aminotransferase activity is inhibited in plant by disruption of gene functionality encoding thereof. Due to inhibition of said enzyme activity glutamate levels in modified plant is higher in contrast to corresponding wild-type plants cultivated under the same conditions, including seeds thereof. Seeds and other plant parts are useful in foodstuff productions.

EFFECT: new method for elevation of glutamate content in plants.

31 cl, 12 dwg, 3 tbl, 2 ex

FIELD: biotechnology, food processing industry.

SUBSTANCE: barley plants are mutated in SSII gene to reduce SSII activity. Such barley corn has starch structure with. Moreover said corn optionally has relatively high β-glucan content. Starch is characterized with decreased gelatinization viscosity, low crystallinity, and high levels of lipid-bonded starch of V-form crystallinity.

EFFECT: barley plants having reduced amylopectin content and relatively high amylose content.

33 cl, 39 dwg, 10 tbl, 2 ex

FIELD: biotechnology, in particular production of genetically modified plants with altered level of one metabolite secondary product.

SUBSTANCE: claimed method includes selection of nuclear acid sequence encoding enzyme, which is absent in secondary metabolite process, but is capable to modify utilization of intermediate substrate in secondary metabolite process connected with plant nutrient profile. Then recombinant molecule is constructed, which contains abovementioned sequence, to transform plant cell. From this cell genetically modified plant is regenerated. Obtained plant is useful in animal feed preparation.

EFFECT: plants with high nutrient value and improved quality.

35 cl, 33 dwg, 22 ex

FIELD: biotechnology, in particular modification of galactomannanes in green coffee beans by decreasing of endogen levels of α-D-galactosidase activity.

SUBSTANCE: claimed method includes preparation of coffee plant cell containing nucleic acid, transcribed to ribonucleic acid which antisense one in relates to mRNA derived from α-D-galactosidase gene under control of constitutive or inducible promoter. Further method includes production of plant containing such cell; instant coffee manufacturing from bean of said plant. Coffee solubility in increased by using of bean of said plant.

EFFECT: prevention of raw green coffee mass losses; instant coffee drinks of prolonged storage time without losses of quality.

5 cl

FIELD: plant gene engineering.

SUBSTANCE: nucleic acid construct is introduced into plant cells to provide enchased GDH gene expression. Enchased GDH gene expression provides decreased plant dormant period and simultaneous germination or spindling.

EFFECT: production of plants with high productivity.

16 cl, 7 dwg, 2 tbl, 1 ex

FIELD: plant selection, in particular method for cultivation of hybrid soy F1 plants.

SUBSTANCE: mechanizing seeding of mixture of hybrid soy F1 seeds with mutant soy seeds having feature of chlorophyll deficit is carried out. After breaking of primordial leaf phase hybrid plants are identified. After breaking of full maturation phase hybrid plants are harvested, threshed and used for selection.

EFFECT: mechanical seeding and cultivation of hybrid soy F1 seeds with minimizing bough and central spear chipping-up.

3 cl, 1 dwg, 1 ex

FIELD: cultivation of orchards, in particular, in vitro micromultiplication and sanitation of gladiolus plants.

SUBSTANCE: method involves separating explants; planting onto Murasige-Scuga nutrient medium; cultivating and dividing into segments; after separation, planting explants onto agarized Murasige-Scuga nutrient medium with 1/4 concentration of macro- and micro salts at constant illumination by means of luminescent lamps having intensity of 3,000-3,500 lux at temperature of 22-24 C; transferring multiplied explants onto agarized nutrient medium with 1/2 concentration of salts by Murasige-Scuga prescription; supplementing with 30-40 g/l of saccharose and 0.5-1.0 mg/l of growth promoters of 6-benzylaminopurine and 0.5-1.0 mg/l of alpha-naphthaleneacetic acid; simultaneously providing cultivation through callusogenesis on agarized nutritive medium supplemented with 0.5-1.0 mg/l of 6-benzylaminopurine and 1.0-1.5 mg/l of 2,4-dichlorophenoxyacetic acid, with following rooting on agarized nutritive medium at half the concentration of salts by Murasige-Scuga prescription, supplemented with 0.5-1.5 mg/l of alpha-naphthalenecetic acid, 30-40 g/l of saccharose and 4-5 g/l of activated carbon.

EFFECT: increased yield of multiplied material due to increased budding intensity, improved growth and development of explants.

3 tbl

FIELD: biotechnology, agriculture.

SUBSTANCE: invention relates to a system used in eradication of vegetable cells. Method involves transformation of plant with chimeric gene wherein the encoding gene sequence encodes PAP-S α-protein or PAP-S β-protein or its fragment and this gene comprises promoter that shows activity with response to specific irritating effect on plant. Also, the plant can be transformed with either a single construction comprising two chimeric genes wherein one of them encodes inactivated antiviral protein from phytolacca Americana and another gene encodes activator of inactivated antiviral protein from phytolacca Americana or with the construction set wherein each abovementioned chimeric gene is in the separated construction. Invention provides the effective removing required cells from the plant body.

EFFECT: valuable biological properties of system.

37 cl, 15 dwg

FIELD: plant gene engineering and food processing industry.

SUBSTANCE: glutamate-glyoxilate-aminotransferase activity is inhibited in plant by disruption of gene functionality encoding thereof. Due to inhibition of said enzyme activity glutamate levels in modified plant is higher in contrast to corresponding wild-type plants cultivated under the same conditions, including seeds thereof. Seeds and other plant parts are useful in foodstuff productions.

EFFECT: new method for elevation of glutamate content in plants.

31 cl, 12 dwg, 3 tbl, 2 ex

Up!