Antibody molecules possessing specificity with respect to human tumor necrosis factor-alpha and their using

FIELD: immunology, biotechnology.

SUBSTANCE: invention describes murine antibody and its humanized variant (CDP870) showing specificity to human tumor necrosis factor-alpha. Amino acid sequence is given in the description. Also, invention describes compounds showing affinity with respect to human tumor necrosis factor-alpha based on humanized antibody wherein lysylmaleimide group bound covalently with one or some methoxypoly(ethylene glycol) molecules by lysyl residue is joined to one of cysteine residues by C-end of heavy chain of the humanized antibody. Invention discloses DNA sequences encoding antibodies showing specificity to human tumor necrosis factor-alpha and variants if expression vectors involving indicated DNAs. Also, invention describes variants of a method for preparing a host-cell using expression vectors and variants of a method for preparing antibodies based on prepared host-cells. Invention discloses therapeutic compositions used in treatment of pathology mediated by tumor necrosis factor-alpha based on antibodies. Invention provides providing antibodies showing high affinity: 0.85 x 10-10 M for murine antibodies and 0.5 x 10-10 M for its humanized variant and low immunogenicity for human for humanized antibodies. Part of patients with improved ACR20 in administration of 5 and 20 mg/kg of CDP870 is 75% and 75% in 8 weeks, respectively. Half-life value of CDP870 in plasma is 14 days.

EFFECT: valuable biological and medicinal properties of antibodies.

58 cl, 24 dwg, 6 tbl, 1 ex

 

This invention relates to an antibody molecule having specificity against antigenic determinants necrosis factor alpha tumor person (TNFα). This invention relates also to therapeutic uses of the antibody molecules and methods for producing the antibody molecules.

This invention relates to antibody molecules. In the antibody molecule has two heavy chains and two light chains. Each heavy chain and each light chain has at its N-terminal side of the variable domain. Each variable domain consists of four frame regions (FR), interspersed with three complementarity determining (hypervariable) regions (CDR). Residues in the variable domains are usually numbered in accordance with the system devised by Kabat et al. This system is described in Kabat et al., 1987, in Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, NIH, USA (hereinafter referred to as "Kabat et al. (supra)"). This numbering system is used in this description, except where otherwise given a hint.

The designation of a residue at Kabat not always directly corresponds to the linear numbering of amino acid residues. The actual linear amino acid sequence may contain fewer amino acids or more amino acids compared with the strict Kabat numbering is in accordance with the shortening of structure the element or insert in the structural component or frame region, or CDR, the basic structure of the variable domain. The exact numbering of the residues at Kabat can be defined for specific antibodies by comparing homologous residues in the sequence of the antibody with the "standard" numbered according to Kabat sequence.

CDR variable domain of the heavy chain are located in residues 31-35 (CDRH1), residues 50-65 (CDRH2) and residues 95-102 (CDRH3) in accordance with the numbering according to Kabat.

CDR variable domain of the light chain are located at residues 24-34 (CDRL1), residues 50-56 (CDRL2) and residues 89-97 (CDRL3) in accordance with the numbering according to Kabat.

The design of the CDR-grafted antibody is described in European patent application EP-A-0239400, revealing the way in which the CDR of mouse monoclonal antibody are transplanted on the framework region of the variable domains of immunoglobulin by site-directed mutagenesis using long oligonucleotides. CDR define antigennegative specificity of antibodies and are relatively short peptide sequences carried frame regions of the variable domains.

The earliest work on the humanization of monoclonal antibodies, CDR-transplant was carried out on monoclonal antibodies, recognizing synthetic antigens, such as NP. However, examples in which a mouse monoclonal antibody recognizing lysozyme, and krishnamachari antibody recognize antigen on T-cells were humanitarian CDR-transplant, were described by Verhoeyen et al. (Science, 239, 1534-1536, 1988; Riechmann et al. (Nature, 332, 323-324, 1988), respectively.

Riechmann et al. found that the transfer only CDR (defined Kabat (Kabat et al. (supra) and Wu et al., J. Exp.Med., 132, 211-250, 1970)) was insufficient to ensure satisfactory antigennegative activity in the CDR-grafted product. It was found that the number of residues frame must be modified so that they match the remnants of the donor frame area. Proposed criteria for selecting which frame the remains of the need to change, described in the International patent application WO 90/07861.

Was published a number of reviews discussing CDR-grafted antibodies, including Vaughan et al. (Nature Biotechnology, 16, 535-539, 1998).

TNFα is a proinflammatory cytokine that is released by cells of the immune system and interacts with cells of the immune system. So, TNFα released by macrophages that have been activated by lipopolysaccharides (LPS) of gram-negative bacteria. As such, TNFα is, apparently, an endogenous mediator of the Central importance of participating in the development and pathogenesis of endotoxic shock associated with bacterial sepsis. It has been shown that TNFα positively regulated in several human diseases, including x onionskin diseases, such as rheumatoid arthritis, Crohn's disease, ulcerative colitis and multiple sclerosis. Mouse transgenic against TNFα person, produce high levels of TNFα constitutive and develop spontaneous destructive polyarthritis resembling rheumatoid arthritis (Kaffer et al., EMBO J. 10, 4025-4031, 1991). Thus, TNFα referred to as Pro-inflammatory cytokine.

Monoclonal antibodies against TNFα known from the prior art. Meager et al. (Hybridoma, 6, 305-311, 1987) describe a mouse monoclonal antibody against recombinant TNFα. Fendly et al. (Hybridoma, 6, 359-370, 1987) describe the use of mouse monoclonal antibodies against recombinant TNFα for defining neutralizing epitopes on TNF. Shimamoto et al. (Immunology Letters, 17, 311-318, 1988) describe the use of mouse monoclonal antibodies against TNFγ and their use for the prevention of endotoxic shock in mice. In addition, in the International patent application WO 92/11383 described antibodies, including CDR-grafted antibody specific for TNFα. Rankin et al. (British J. Rheumatology, 34, 334-342, 1995) describe the use of such CDR-grafted antibodies for treatment of rheumatoid arthritis. In US-A-5919452 described chimeric antibody against TNF and their use for the treatment of pathologies associated with the presence of TNF.

Antibodies to TNFα have been proposed for the prevention and treatment of bacterial endotoxin is the super-toxic shock (endotoxic shock) (Beutler et al., Science, 234, 470-474, 1985). Boomer et al. (Critical Care Medicine, 21, S441-S446, 1993) and Wherry et al., (Critical Care Medicine, 21, S436-S440) discuss therapeutic potential of antibodies against TNFα for the treatment of septic shock. The use of antibodies against TNFα for the treatment of septic shock is also discussed Kirschenbaum et al. (Critical Care Medicine, 26, 1625-1626, 1998). Induced by collagen arthritis can be effectively treated with the use of monoclonal antibodies against TNFα (Williams et al. (PNAS USA, 89, 9784-9788, 1992)).

Increased levels of TNFα find in synovial fluid and peripheral blood of patients suffering from rheumatoid arthritis. With the introduction of TNFα-blocking agents in patients suffering from rheumatoid arthritis, reduce inflammation, improve symptoms and slows down damage to joints (McKown et al. (Arthritis Rheum., 42, 1204-1208, 1999).

The use of antibodies against TNFα for the treatment of rheumatoid arthritis and Crohn's disease is discussed in Feldman et al. (Transplantation Proceedings, 30, 4126-4127, 1998), Adorini et al. (Trends in Immunology Today, 18, 209-211, 1997) and Feldman et al. (Advances in Immunology, 64, 283-350, 1997). Antibodies to TNFαused in such treatments usually are chimeric antibodies, such as described in US-A-5919452.

Two TNFα-blocking product is licensed currently for the treatment of rheumatoid arthritis. The first, called etanercept, sold Immunex Corporation in the form of Enbrel™. He pre which is a recombinant protein, containing two soluble P75 TNF-receptor domain associated with the Fc-part of human immunoglobulin. The second, called infliximab, sold Centocor Corporation in the form of Remicade™. He is a chimeric antibody with murine variable domains of anti-TNFα and constant domains of human IgG1.

Molecules of recombinant antibodies to TNFα prior art typically have low affinity against TNFα compared with antibodies, which received variable regions or CDRs, and usually must be produced in mammalian cells and their production is costly. Antibodies to TNFα the prior art is described in Stephens et al. (Immunology, 85, 668-674, 1995), GB-A-2246570 and GB-A-2297145.

There is a need in the molecule antibodies for the treatment of chronic inflammatory diseases, which can be reused and can be easily and efficiently obtained. There is also a need in the antibody molecule, which has a high affinity against TNFα and low immunogenicity in humans.

In the first aspect, the invention provides an antibody molecule having specificity against TNFαcontaining heavy chain, variable domain contains a CDR (as defined by Kabat et al. (supra))having the sequence given as H1 in figure 3 (SEQ ID O: 1 for CDRH1, in H2', figure 3 (SEQ ID NO: 2) or in the form of H2 in figure 3 (SEQ ID NO: 7) for CDRH2 or N3 in figure 3 (SEQ ID NO:3 for CDRH3.

The antibody molecule of the first aspect of the present invention contains at least one CDR selected from H1, H2 or H2 and H3 (SEQ ID NO: 1; SEQ ID NO: 2 or SEQ ID NO: 7 and SEQ ID NO: 3) for the variable domain of the heavy chain. Preferably the antibody molecule contains at least two and more preferably all three CDRs in the variable domain of the heavy chain.

In the second aspect of the present invention provided with the antibody molecule having specificity against TNFα person containing light chain, variable domain contains a CDR (as defined by Kabat et al. (supra)), having the sequence represented as L1 in figure 3 (SEQ ID NO: 4 for CDRL1, L2 in figure 3 (SEQ ID NO: 5 for CDRL2 or L3 in figure 3 (SEQ ID NO: 6 for CDRL3.

The antibody molecule of the second aspect of the present invention contains at least one CDR selected from L1, L2 and L3 (SEQ ID NO: 4 - SEQ ID NO: 6) for the variable domain of the light chain. Preferably the antibody molecule contains at least two or more, preferably all three CDRs in the variable domain of the light chain.

The antibody molecules of the first and second aspects of the present invention preferably have a complementary light chain, or a complementary heavy chain, respectively.

Preferably mo is Akula antibodies of the first or second aspects of the present invention contains a heavy chain in which the variable domain contains a CDR (as defined by Kabat et al. (supra)), having the sequence represented as H1 in figure 3 (SEQ ID NO: 1 for CDRH1, in the form of N2 or H2 in figure 3 (SEQ ID NO: 2 or SEQ ID NO: 7) for CDRH2 or H3 in figure 3 (SEQ ID NO: 3 for CDRH3 and a light chain, variable domain contains a CDR (as defined by Kabat et al. (supra)), having the sequence represented as L1 in figure 3 (SEQ ID NO:4 for CDRL1, as L2 in figure 3 (SEQ ID NO: 5 for CDRL2 or L3 in figure 3 (SEQ ID NO: 6 for CDRL3.

CDR presented in SEQ ID NO: 1 and 3-7 in figure 3, quoted above, derived from murine monoclonal antibody hTNF40. However SEQ ID NO: 2 consists of a hybrid CDR. This hybrid CDR contains part of the CDR2 of the heavy chain of the mouse monoclonal antibody hTNF40 (SEQ ID NO: 7) and part of the CDR2 of the heavy chain of sequence V-region germline groups of 3 people.

The complete sequences of variable domains of murine antibody hTNF40 is shown in figure 6 (light chain) (SEQ ID NO: 99) and figure 7 (heavy chain) (SEQ ID NO: 100). This mouse antibody called below "donor antibody".

The first alternative preferred variant of the first or second aspect of the present invention is a mouse monoclonal antibody hTNF40 with sequences of variable domains of light and heavy chains are shown in figure 6 (SEQ ID NO: 99) and figure 7 (SEQ ID NO: 100) with the responsibility. Constant region light chain hTNF40 is a Kappa chain, constant region of the heavy chain is IgG2a.

In the second alternative preferred embodiment, the antibody in accordance with either the first or second aspects of the present invention is a chimeric molecule mouse/man, here called chimeric molecule antibody hTNF40. The chimeric antibody molecule contains the variable domains of the murine monoclonal antibody hTNF40 (SEQ ID NO: 99 and 100) and the constant domains of a human. Preferably, the molecule is a chimeric antibody hTNF40 contains C-Kappa-domain guests (Hieter et al., Cell, 22, 197-207, 1980; Genebank access number J00241) in the light chain and 4 gamma-domain guests (Flanagan et al., Nature, 300, 709-713, 1982) in the heavy chain.

In the third alternative preferred embodiment, the antibody in accordance with the first and second aspects of the present invention is a CDR-grafted antibody molecule (molecule antibodies with transplanted CDR). The term "CDR-grafted antibody molecule" as applied here refers to a molecule antibodies in which the heavy and/or light chain contains one or more CDRs (including, if desirable, hybrid CDRs) from the donor antibody (e.g. mouse monoclonal antibodies), transplanted into the carcass of the variable regions of the heavy or light chain acceptor antibodies (e.g., human antibodies).

Preferably t is some CDR-grafted antibody has a variable domain, containing the acceptor framework regions of a human, and one or more donor CDRs, above.

When transplanting CDR can be used in any frame of the sequence of the variable region of a suitable acceptor with a class/type of the donor antibody from which originate the CDR data, including frame areas of the mouse, Primate and human. Examples of human skeletons, which can be used in this invention are KOL, NEWM, REI, EU, TUR, TEI, LAY and RUM (Kabat et al. (supra)). For example, KOL and NEWM can be used for the heavy chain, REI can be used for the light chain, a EU, LAY and RUM can be used for both heavy and light chain. The preferred frame for light chain are frame group 1 person, shown in figure 1 (SEQ ID NO: 83, 85, 87 and 89). The preferred frame regions for heavy chains are frame group 1 and group 3, shown in figure 2 (SEQ ID NO: 91, 93, 95 and 97 and SEQ ID NO: 106, 107, 108 and 109, respectively.

In CDR-grafted antibody of the present invention is preferably used as the acceptor antibody is an antibody that has a chain homologous chains of the donor antibody. Acceptor heavy and light chain should not be necessarily derived from the same antibody and may, if it is desirable to contain composite (composite) chain, having a frame region, originating from different chains.

In CDR-grafted antibody of the present invention the frame region need not necessarily have the same sequence, which is the acceptor antibody. For example, unusual residues may be changed on a more frequent rests for this class or type acceptor circuit. Alternatively, the selected residues in the acceptor frame fields can be modified so that they correspond to the residues found in the same position in the donor antibody. Such changes should be kept to the minimum necessary to restore the affinity of the donor antibody. The Protocol for selection of residues in the acceptor frame areas that need to be changed, is presented in WO 91/09967.

Preferably in the molecule CDR-grafted antibodies of the present invention, if the acceptor heavy chain has a frame group 1 person (shown in figure 2) (SEQ ID NO: 91, 93, 95 and 97), the data acceptor framework region of the heavy chain contain, in addition to one or more donor CDRs, donor residues at positions 28, 69 and 71 (according to Kabat et al. (supra)).

Alternatively, if the acceptor heavy chain has a frame area group 1, the data of the acceptor framework region of the heavy chain contain, in addition to one renesola donor CDR, donor residues at positions 28, 38, 46, 67, 69 and 71 (according to Kabat et al. (supra)).

Preferably in the molecule CDR-grafted antibodies of the present invention, if the acceptor heavy chain has a frame group 3 (shown in figure 2) (SEQ ID NO: 106, 107, 108 and 109), the data acceptor framework region of the heavy chain contain, in addition to one or more donor CDRs, donor residues at positions 27, 28, 30, 48, 49, 69, 71, 73, 76 78 (according to Kabat et al. (supra)).

Preferably in the molecule CDR-grafted antibodies of the present invention, if the acceptor light chain has a frame group 1 person (shown in figure 1) (SEQ ID NO: 83, 85, 87 and 89), the data acceptor framework region of the light chain containing donor residues at positions 46 and 60 (according to Kabat et al., (supra)).

Donor residues are residues from donor antibodies, i.e. antibodies which initially occur CDR.

The antibody molecule of the present invention may contain a complete antibody molecule, having full-sized heavy and light chains; a fragment, such as Fab, modified Fab, Fab'and F(ab')2or an Fv fragment; a monomer or dimer light chain or heavy chain; single-chain antibody, such as single-chain Fv in which the variable domains of the heavy and light chains connected by a peptide linker. Similarly, the var is abeline domains of the heavy and light chains can be combined with other domains of antibodies, if necessary.

Preferably the antibody molecule of the present invention is a Fab fragment. Preferably Fab-fragment is a heavy chain having the sequence represented as SEQ ID NO: 111, and a light chain having the sequence represented as SEQ ID NO: 113. Amino acid sequence shown in SEQ ID NO: 111 and SEQ ID NO: 113, preferably encoded by the nucleotide sequences represented in SEQ ID NO: 110 and SEQ ID NO: 112, respectively.

Alternatively, preferably, the antibody molecule of the present invention was modified Fab fragment in which the modification is an addition to the C-terminal side of its heavy chain one or more amino acids to create the possibility of joining the effector or reporter molecule. Preferably, the additional amino acids form a modified hinge region containing one or two cysteine residue, to which may be attached effector or reporter molecule. Such a modified Fab fragment preferably has a heavy chain having the sequence given as SEQ ID NO: 115, and a light chain having the sequence given as SEQ ID NO: 113. The amino acid sequence represented in SEQ ID NO: 115, preferably encoded nucleotide PEFC is a sequence, presented in SEQ ID NO: 114.

Preferred effector group is a polymeric molecule that can be attached to the modified Fab fragment to increase its biological half-life existence in vivo.

This polymer molecule can usually be synthetic or naturally occurring polymer, such as optionally substituted with straight or branched chain polyalkylene, polyalkylene or polyoxyalkylene polymer or a branched or unbranched polysaccharide, for example Homo - or heteropolysaccharides.

Particular optional substituents that may be present on the above synthetic polymers include one or more hydroxy, methyl or methoxypropyl. Specific examples of synthetic polymers include optionally substituted with straight or branched chain poly(ethylene glycol), poly(propylene glycol), poly(vinyl alcohol) or their derivatives, especially optionally substituted poly(ethylene glycol), such as methoxypoly(ethylene glycol) or its derivatives. Specific natural occurring polymers include lactose, amylose, dextran, glycogen, or their derivatives. "Derivatives" in use here include a reactive derivative, for example thio is selective reactive group, such as maleimide, etc. Reactive group may be linked directly or via a linker segment with the given polymer. It should be clear that the rest of the group will in some cases to form part of the product in the form of a linking group between the antibody fragment and a polymer.

The size of the polymer may vary, if desired, but will typically be in the range of the average molecular weight of from 500 Da to 50,000 Da, preferably from 5,000 to 40,000 and more preferably from 25,000 to 40,000 Da. The size of the polymer can be, in particular, selected based on the intended application of this product. For example, if the product must leave the blood and enter the tissue, for example, for use for the treatment of tumors, it may be advantageous to use a polymer with a low molecular weight, for example with a molecular weight of about 5000 Da. For applications in which the product remains in the bloodstream, it may be advantageous to use a polymer with a higher molecular weight, for example having a molecular weight in the range from 25000 Da to 40,000 Da.

Particularly preferred polymers include polyalkylene polymer, such as poly(ethylene glycol)or, especially, methoxypoly(ethylene glycol) or its derivative, and especially with a molecular weight in the range from approximately is about 25000 Da to about 40,000 Da.

Each polymer molecule attached to the fragment of the modified antibodies may be covalently linked to the sulfur atom of the cysteine residue localized in this fragment. Covalent bond is usually by a disulfide bond or, in particular, sulfur-carbon bond.

If desired, the antibody fragment may be attached to the effector or reporter molecule. The effector or reporter molecule can be attached to the fragment of the antibody through any available functional group of a side chain of the amino acid or the terminal amino acids located in this fragment, for example any free amino, imino, hydroxyl or carboxyl group.

The activated polymer can be used as a starting material in the preparation of modified polymer fragments of the antibodies described above. The activated polymer can be any polymer containing a thiol-reactive group, such as α-halogenecarbonate acid or ester, such as iodoacetamide, imide, such as maleimide, vinylsulfonic or disulfide. Such starting materials can be obtained commercially (e.g., from Shearwater Polymers Inc., Huntsville, AL, USA) or can be obtained from commercially available starting materials using conventional chemical procedures.

That casualcapacity poly(ethylene glycol) (PEG-parts) reference is made to "Poly (ethyleneglycol) Chemistry, Biotechnical and Biomedical Applications", 1992, J. Milton Harris (ed.). Plenum Press, New York, "Poly (ethyleneglycol) Chemistry, Biotechnical and Biomedical Applications", 1997, J. Milton Harris and S. Zalipsky (eds.), American Chemical Society, Washington DC and "Bioconjugation Protein Coupling Techniques for the Biomedical Sciences", 1998, M. Aslam and A. Dent, Grove Publishers, New York.

If you want obtaining a fragment of the antibodies bound to the effector or reporter molecule, it can be obtained by standard chemical procedures or procedures of recombinant DNA in which the fragment antibodies bind, either directly or through a linking agent with the effector or reporter molecule either before or after reaction with the activated polymer, as needed. Specific chemical treatments include, for example, the procedures described in WO 93/06231, WO 92/22583, WO 89/00195 and WO 89/01476. Alternatively, if the effector or reporter molecule is a protein or polypeptide, this connection can be achieved using procedures of recombinant DNA, for example, described in WO 86/01533 and EP-A-0392745.

Preferably the modified Fab fragment of the present invention is Paglierani (i.e. covalently attached PEG (poly(ethylene glycol)) in accordance with the method described in EP-A-0948544. Preferably the antibody molecule of the present invention is Paglierani modified Fab-fragm the fact, as shown in figure 13. As shown in figure 13, a modified Fab fragment has maleimido group covalently associated with a single thiol group in a modified hinge region. The lysine residue is covalently bonded with this maleimide group. To each amino group on the lysine residue attached polymer methoxypoly(ethylene glycol)having a molecular weight of approximately 20,000 Da. The total molecular weight of all effector molecule is, therefore, about 40,000 Da.

Preferably, in the connection shown in figure 13, a heavy chain-specific antibody part has the sequence presented as SEQ ID NO: 115, and the light chain has the sequence presented in SEQ ID NO: 113. This connection is called as CDP870.

The domains of the constant region of the antibody molecules of the present invention, if present, can be selected based on the intended function of the molecule antibodies and, in particular, the effector functions that may be required. For example, the domains of the constant region may be domains of IgA, IgD, IgE, IgG or IgM person. In particular, can be used domains of the constant region of human IgG, in particular isotypes IgG1 and IgG3, when the antibody molecule is intended for therapeutic applications and require the effector functions of antibodies. Alta is natively, can be used isotypes IgG2 and IgG4, when the antibody molecule is intended for therapeutic purposes and are not required effector functions of antibodies, for example, simply to block TNFα-activity.

The antibody molecule of the present invention may also have attached to it the effector or reporter molecule. For example, it may be macrocycle for chelation atom of heavy metal or toxin, such as ricin, attached to her covalent bridge structure. Alternatively, it may be used procedures of recombinant DNA technology to obtain molecules are antibodies in which the Fc-fragment (CH2, CH3, and hinge domains, domains CH2 and CH3 or CH3 domain of a complete immunoglobulin molecules have been replaced by functional nimmanahaeminda protein or have attached thereto a peptide bond functional non-immunoglobulin protein, such as the enzyme molecule or toxin.

The antibody molecule of the present invention preferably has a binding affinity of at least 0,85×10-10M, more preferably at least 0,75×10-10M and most preferably at least 0,5×10-10M (it should be noted that the preferred humanitariannet molecule antibodies of the present invention, described below, has an affinity of about 0.5×10 -10M, which is higher than the affinity of a murine monoclonal antibody from which it was obtained. Murine antibody has an affinity of about 0,85×10-10M)

Preferably the antibody molecule of the present invention contains a variable domain light chain hTNF40-gL1 (SEQ ID NO: 8) and the variable domain of the heavy chain gh3hTNF40.4 (SEQ ID NO: 11). Sequences of variable domains of light and heavy chains are shown in figures 8 and 11, respectively.

This invention also pertains to variants of the antibody molecules of the present invention, which have an improved affinity against TNFα. Such variants can be obtained through a number of protocols achieve affinity, which includes the mutation CDR (Yang et al., J. Mol. Biol., 254, 392-403, 1995), the shuffling circuits (Marks et al., Bio/Technology 10, 779-783, 1992), the use of strains mutators E. coli (Low et al., J. Mol. Biol., 250, 359-368, 1996), DNA shuffling (Patten et al., Curr. Opin. Biotechnol. 8, 724-733, 1997), phage view (Thompson et al., J. Mol. Biol., 256, 77-88, 1996) and associated with Paul PCR (Crameri et al., Nature, 391, 288-291, 1998). Vaughan et al. (supra) discusses these methods achieve affinity.

This invention also provides a DNA sequence encoding a heavy and/or light chain of the antibody molecules of the present invention.

Preferably the DNA sequence encodes a heavy or light chain of the antibody molecules of the present invention.

In one preferred embodiment, the DNA sequence encodes the light chain and contains the sequence shown in SEQ ID NO: 8 (hTNF40-gL1) or SEQ ID NO: 9 (hTNF40-gL2), or its degenerate equivalent.

In an alternative preferred embodiment, the DNA sequence encodes a heavy chain and contains the sequence shown in SEQ ID NO:10 (gh1hTNF40.4) or SEQ ID NO: 11 (gh3hTNF40.4), or its degenerate equivalent.

The DNA sequence of this invention may contain synthetic DNA, for example, obtained by a chemical procedure, cDNA, genomic DNA, or any combination thereof.

This invention also relates to a vector for cloning or expression that contains one or more DNA sequences of this invention. Preferably the vector for cloning or expression contains two DNA sequences encoding the light and heavy chain of the antibody molecules of the present invention, respectively.

In the preferred embodiment, this invention provides expressing E.coli vector containing the DNA sequence of this invention. Preferably expressing this vector represents pTTO(CDP870), shown schematically in figure 22.

The invention also includes a vector pDNAbEng-G1, shown in figure 19.

Common ways in which the data vectors may be constructed, transfection methods and the methods of cultivation are well known for is the illusion in this area. In this regard, reference is made to "Current Protocols in Molecular Biology", 1999, F.M.Ausubel (ed.), Wiley Interscience, New York and Maniatis Manual, published by Cold Spring Harbor Publishing.

DNA sequences that encode the antibody molecule of the present invention can be obtained by methods well known to specialists in this field. For example, DNA sequences encoding a portion of the heavy and light chains, or complete heavy and light chain antibodies, can be synthesized, if it is desirable, of specific DNA sequences or based on the corresponding amino acid sequence.

DNA encoding the acceptor framework sequences that are widely available to professionals in this field and can be easily synthesized based on known amino acid sequences.

Standard methods of molecular biology can be used to obtain the DNA sequence encoding the antibody molecule of the present invention. The desired DNA sequence can be synthesized in whole or in part by the use of methods of synthesis of oligonucleotides. Methods site-directed mutagenesis and polymerase chain reaction (PCR) can be used if necessary.

Any suitable system of a host cell-vector can be used for the expression of posledovatelno is her DNA, encoding the antibody molecule of the present invention.

Bacterial, such as E. coli or other microbial systems may be used partly for the expression of fragments of antibodies, such as Fab and F(ab')2fragments and especially Fv fragments and single-chain antibody fragments, for example, single-chain Fv. Systems for the expression of eukaryotic host cells, such as expression systems in mammalian cells, can be used to produce larger molecules, antibodies, including a complete antibody molecules. Suitable cells of mammalian hosts include Cho cells, myeloma or hybridoma cells.

This invention also provides a method of producing antibody molecules of the present invention, involving the cultivation of the host cell containing the vector of the present invention, under conditions suitable for expression of the protein from DNA encoding the antibody molecule of the present invention, and the allocation of a given molecule antibodies.

Preferably, the method of obtaining the antibody molecules of the present invention provides for the cultivation of E. coli expressing containing a vector containing the DNA sequence of this invention, under conditions suitable for expression of the protein from the DNA sequence, and selection of antibody molecules. The antibody molecule which can secretariats of cells or target periplasm by suitable signal sequences. Alternative these antibody molecules can accumulate in the cytoplasm of the cell. Preferably, the antibody molecule is aimed at periplasm. Depending on the produced molecules are antibodies and method used, it is desirable to give the molecules of antibodies to re-meet and adopt a functional conformation. Procedures for creating the possibility of re-stacking of the molecules of antibodies is well known to specialists in this field.

The antibody molecule can contain only the polypeptide heavy chain or light chain polypeptide, and in this case, only the coding sequence of the polypeptide heavy chain or light chain polypeptide should be used for transfection of a host cell. To obtain products containing both heavy and light chain, the cell line can be transliterowany two vectors, the first vector encodes a light chain polypeptide and the second vector encodes a polypeptide heavy chains. Alternatively, it may be used only vector, and this vector comprises a sequence encoding a polypeptide light chain and heavy chain.

This invention also provides a therapeutic or diagnostic composition comprising the antibody molecule of the present invention in combination with a pharmaceutically acceptable excipient, razbam the holder or carrier.

This invention also provides a method of obtaining a therapeutic or diagnostic compositions involving mixing the antibody molecules of the present invention together with a pharmaceutically acceptable excipient, diluent or carrier.

The antibody molecule may be the only active ingredient in a therapeutic or diagnostic composition or may be accompanied by other active ingredients, including ingredients antibodies, such as antibodies against T-cells against IFNγ or against LPS, or non-antibody ingredients such as xantina.

The pharmaceutical compositions should preferably contain a therapeutically effective amount of the antibody of the present invention. The term "therapeutically effective amount" as applied here refers to the amount of therapeutic agent required to treat, mitigate or prevent subject to treatment of a disease or condition or symptoms detected therapeutic or preventive effect. For any antibodies therapeutically effective dose can be initially determined either by tests on cell cultures or animal models, usually rodents, rabbits, dogs, pigs or primates. The animal model can also be used for opredelenijami of concentration range and route of administration. Such information can then be used to determine the applicable doses and routes for administration to humans.

The precise effective amount for a subject-a person will depend on the severity of the pathological condition, General health of the subject, age, weight and sex of the subject, diet, time and frequency of administration, combination (combinations) of drugs, sensitivity reactions and tolerance/response to therapy. This quantity can be determined by routine experimentation and is within the ability of the judgment of the attending physician. Typically, an effective dose will be from 0.01 mg/kg to 50 mg/kg, preferably 0.1 mg/kg 20 mg/kg, more preferably about 15 mg/kg As shown in the examples below, doses of 1, 5 and 20 mg/kg was used for the treatment of patients suffering from rheumatoid arthritis.

The composition can be administered individually to the patient or can be administered in combination with other agents, drugs or hormones.

The dose at which injected the antibody molecule of the present invention, depends on the nature of the subject to treatment status, the extent to which the level is subject to neutralization of TNFα raised, or are expected to he increased above the desired level, and whether the molecule antibodies prophylactically or to treat an existing condition.

So, n is the sample, if the product is intended for the treatment or prevention of chronic inflammatory diseases such as rheumatoid arthritis, suitable doses of the antibody molecules of the present invention lie in the range between 0.5 and 50 mg/kg, more preferably between 1 and 20 mg/kg and most preferably about 15 mg/kg Frequency of dose will depend on the half-life of the molecule antibodies and the duration of its validity.

If the antibody molecule has a short half-life (e.g., 2-10 hours), it may be necessary to provide only one or more doses per day. Alternatively, if the antibody molecule has a long half-life (for example, 2 to 15 days), it may be necessary to give a dosage once per day, per week or even once every 1 or 2 months.

The pharmaceutical composition may also contain a pharmaceutically acceptable carrier for administration of this antibody. The media itself should not induce the production of antibodies harmful to the individual receiving the composition, and should not be toxic. Suitable carriers may be large, slowly metabolisable macromolecules, such as proteins, polypeptides, liposomes, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, copolymers of amino acids and inactive viral the particles.

Can be used pharmaceutically acceptable salts, for example salts of mineral acids, such as hydrochloride, hydrobromide, phosphates and sulfates, or salts of organic acids such as acetates, propionate, malonate and benzoate.

Pharmaceutically acceptable carriers for therapeutic compositions can optionally contain liquids such as water, saline, glycerol and ethanol. Additionally, such compositions may be present auxiliary substances such as wetting or emulsifying agents or pH-bafarawa substances. Such carriers enable the pharmaceutical compositions to be formed into tablets, pills, coated tablets, capsules, liquids, gels, syrups, suspensions and suspension for ingestion by the patient.

Preferred forms for administration include forms suitable for parenteral administration, for example injection or infusion, for example bolus injection or continuous infusion. If the product is intended for injection or infusion, it can take the form of a suspension, solution or emulsion in oily or aqueous media, and it may include forming agents, such as suspendida, preserving, stabilizing and/or dispersing agents. An alternative antibody molecule may be in dry form and recover in the required form before using primenenie suitable sterile fluid.

After the preparation of compositions of this invention can be administered directly to a subject. To be treated subjects can be animals. However, preferably, the compositions are adapted for administration to a subject person.

The pharmaceutical compositions of this invention can be administered in any way, including, but not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, vnutriobolochechnoe, intraventricular, transdermal, percutaneous (for example, see WO 98/20734), subcutaneous, intraperitoneal, intranasal, enteral, local, sublingual, intravaginal or rectal routes. Hypospray can also be used to administer the pharmaceutical compositions of the present invention. Usually, therapeutic compositions can be prepared in the form of injection solutions, or in the form of liquid solutions or suspensions. Can also be prepared solid forms suitable for dissolution or suspension in liquid media prior to injection.

Direct delivery of the compositions is generally performed by injection, subcutaneously, intraperitoneally, intravenously or intramuscularly, or composition is delivered to the interstitial space of a tissue. The compositions can also be administered in damage. The treatment regimen can be a schema p is imeneniya one dose or the effect of multiple doses.

It should be clear that the active ingredient in the composition is an antibody molecule. As such, it is susceptible to degradation in the gastrointestinal tract. Thus, if the composition must be entered by using the gastrointestinal tract, the composition should contain agents that protect the antibody from degradation, but which releases the antibody, as soon as it is absorbed from the gastrointestinal tract.

A thorough discussion of pharmaceutically acceptable carriers available in Remington's Pharmaceutical Sciences (Mack Publishing Company, N.J. 1991).

It is also considering that the antibody of this invention will be administered using gene therapy. To achieve this, the DNA sequence encoding heavy and light chains of antibody molecules under the control of suitable DNA components administered to the patient so that the chain antibodies expressed from these DNA sequences and assembled in situ.

This invention also provides an antibody molecule of the present invention for use for the treatment of diseases mediated by TNFα.

Further, the invention provides the use of the antibody molecules according to the invention for the preparation of drugs for the treatment of diseases mediated by TNFα.

Forefront of the La antibodies of this invention can also be used in any therapy, where desirable is to reduce the level of biologically active TNFαpresent in body of a human or animal. TNFα can circulate through the body or be present at an undesirable high level in the specific area of the body.

For example, elevated levels of TNFα observed in acute and chronic immune and immunoregulatory disorders, infections, including sepsis, bacterial endotoxin-toxic and cardiovascular shock, inflammatory disorders, neurodegenerative diseases, malignant diseases, and alcohol induced hepatitis. The details of numerous disorders associated with elevated levels of TNFαdescribed in U.S. patent US-A-5919452. The antibody molecules of the present invention can be used in the treatment of diseases mediated by TNFα. Specific relevant diseases that can be treated by the antibody molecule of the present invention include sepsis, congestive heart failure, septic or endotoxic shock, cachexia, respiratory distress syndrome of adults, AIDS, allergies, psoriasis, tuberculosis, inflammatory bone disorders, disorders associated with blood coagulation, burns, cases of rejection after transplantation of organs or tissues, Crohn's disease and autoimmune diseases such as tiree is the CIO and rheumatoid arthritis or osteoarthritis.

Additionally, the molecule or composition antibodies can be used to reduce the side effects associated with the generation of TNFα during neoplastic therapy; elimination or reduction associated with shock symptoms associated with the treatment or prevention of transplant rejection using antibodies against lymphocytes; or for treatment failure of multiple organs.

The antibody molecule of the present invention is preferably used for the treatment of rheumatoid arthritis or osteoarthritis.

This invention also provides a method of treating subjects-individuals or entities animals suffering from disorders or who have risk of acquiring disturbance-mediated TNFαand this method provides for the introduction of this subject an effective amount of the antibody molecules of the present invention.

The antibody molecule of the present invention can also be used in diagnostics, for example in the in vivo diagnosis and imaging of pathological conditions in which there is elevated levels of TNFα.

This invention also provides an antibody molecule containing a hybrid CDR including shortened donor CDR sequence, and the missing part is shortened donor CDR replaced with a different serial what inetu forms functional CDR. The term "hydride CDR" as applied here means CDR containing donor CDR, which was shortened at one or more positions, such as on one or both of its ends. The missing part is shortened donor CDR replaced by a different sequence for the formation of a complete and functional CDR. Hybrid CDR has at least one amino acid substitution compared to full donor CDR. The sequence that replaces the truncated part of the CDR may be any sequence. Preferably nedanovski part of the CDR sequence is a sequence of the antibody from which the received frame region of this molecule antibodies, for example, a sequence of antibody germ line.

It was found that the molecules of the antibody containing a hybrid CDR, retains essentially the same binding affinity as the antibody molecule containing a complete donor CDR. The term "essentially the same binding affinity" as applied here means at least 70%, more preferably at least 85% and most preferably at least 95% of the binding affinity of the corresponding antibody molecules that contain full donor CDR. As noted above, in some cases, the affinity of the antibodies of this invention can be higher than the aff is the oneness of the donor antibody. The use of a hybrid CDR provides the advantage of reducing the number of alien (i.e. donor) sequence present in the molecule of the antibody, and may increase the binding affinity of this antibody molecules compared with the corresponding antibody molecule containing a complete donor CDR.

Any of the CDRs of antibody molecules can be hybrid. Preferably CDR2 of the heavy chain is a hybrid in the antibody molecule.

Preferably, the shortening of the donor CDR is from 1 to 8 amino acids, more preferably from 4 to 6 amino acids. In addition, it is preferable that the cut was made at the end of the CDR.

Depending on the sequence of the truncated part of the CDR and different sequence that replaces a missing part, may be made a number of amino acid substitutions. Preferably produce at least 2 amino acid substitutions, more preferably at least 3 amino acid substitutions, and most preferably at least 4 amino acid substitutions.

A particular variant of this aspect of this invention is the antibody corresponding to the first aspect of the present invention, in which the second CDRs in the heavy chain has the sequence presented as SEQ ID NO: 2. It has a higher affinity against his antig is on, than the donor antibody from which it is made part of this CDR.

This invention also provides a nucleic acid sequence that encodes the antibody molecule containing a hybrid CDR of the present invention.

This invention also provides expressing a vector containing a nucleic acid sequence encoding an antibody molecule containing a hybrid CDR of the present invention.

This invention also provides a cell host transformed by the vector of the present invention.

This invention also provides a method of producing antibody molecules that contain hybrid CDR involving culturing the host cell of the present invention and isolating the antibody molecules.

The invention is described hereinafter for purposes of illustration in the following examples, which refer to the accompanying figures, in which:

Figure 1 shows a frame region subgroups 1 light chain compared with the frame areas of the light chain of hTNF40 (SEQ ID NO: 83-90).

Figure 2 shows a frame region of the subgroup 1 and subgroup 3 of the heavy chain of human compared with the frame regions of the heavy chain hTNF40 (SEQ ID NO: 91-98 and 106-109).

Figure 3 shows the amino acid sequence of CDR hTNF40 (SEQ ID NO: 1-7), where CDR H2' is a hybrid CDR, kotorom-terminal six amino acids are amino acids of the CDR sequences of H2 antibody germline subgroup 3, and amino acid substitutions in the sequence occurring as a result of such hybridization are underlined.

Figure 4 shows the vector pMR15.1.

Figure 5 shows the vector pMR14.

Figure 6 shows the nucleotide and predicted amino acid sequence of murine hTNF40V1 (SEQ ID NO: 99).

Figure 7 shows the nucleotide and predicted amino acid sequence of murine hTNF40Vh (SEQ ID NO: 100).

Figure 8 shows the nucleotide and predicted amino acid sequence of hTNF40-gL1 (SEQ ID NO: 8).

Figure 9 shows the nucleotide and predicted amino acid sequence of hTNF40-gL2 (SEQ ID NO: 9).

Figure 10 shows the nucleotide and predicted amino acid sequence gh1hTNF40.4 (SEQ ID NO: 10).

Figure 11 shows the nucleotide and predicted amino acid sequence gh3hTNF40.4 (SEQ ID NO: 11).

Figure 12 shows the vector CTIL5-gL6.

Figure 13 shows the structure of a compound called CDP870 containing a modified Fab fragment derived from the antibody hTNF40, covalently linked via a cysteine residue with lilmalayin linker, and each amino acid group on the lysyl residue has covalently attached thereto methoxy-PEG-balance, where n is approximately 420.

Figure 14 shows the vector pTTQ9.

Figure 15 shows the follower is ity oligonucleotide adapter OmpA (SEQ ID NO: 101).

Figure 16 shows the vector pACYC184.

Figure 17 shows the vector RTO-1.

Figure 18 shows the vector RTO-2.

Figure 19 shows the vector pDNAbEng-G1.

Figure 20 shows the oligonucleotide cassettes encoding different intergenic sequences for expression of the modified Fab E. coli (SEQ ID NO: 102-105);

Figure 21 shows the accumulation of the modified Fab in periplasm options IGS.

Figure 22 shows the vector pTTO (CDP870).

Figure 23 shows the scoring of disease activity (DAS) in patients receiving different doses of CDP870 and placebo. Median and IQ ranges are presented for groups of patients, according to the Protocol, in which the last observation indicates an improvement. Small squares show placebo, rhombuses show 1 mg/kg, the triangles show 5 mg/kg and large squares show 20 mg/kg

Figure 24 shows the number of painful joints, number of swollen joints, scoring pain, global assessment of disease activity by the medical examiner, the modified questionnaire health assessment (HAQ), C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR) in patients receiving different doses of CDP870 and placebo. Median and IQ range is presented for groups of patients, according to the Protocol, in which the last observation indicates an improvement. Small squares show PL is zero, diamonds show 1 mg/kg, the triangles show 5 mg/kg and large squares show 20 mg/kg

EXAMPLES

Cloning and gene expression of the chimeric molecule antibody hTNF40

Obtaining RNA from hybridoma cells hTNF40

Total RNA was obtained from 3×107hybridoma cells hTNF40, as described below. Cells were washed in physiological saline solution and was dissolved in Rectale (0.2 ml of 106cells). Added chloroform (0.2 ml to 2 ml of homogenate), the mixture was intensively shaken for 15 seconds and then left on ice for 15 minutes. The resulting aqueous and organic phases were separated by centrifugation for 15 minutes in an Eppendorf centrifuge and RNA was besieged from the aqueous phase by addition of an equal volume of isopropanol. After 15 minutes of incubation on ice, the RNA precipitated with centrifugation, washed with 70% ethanol, dried and dissolved in sterile, containing RNase water. The yield of RNA was 400 mcg.

PCR cloning of Vh and Vl hTNF40

cDNA sequences encoding the variable domains of the heavy and light chains hTNF40, was synthesized using reverse transcriptase to obtain single-stranded cDNA copies of mRNA present in the total RNA with subsequent polymerase chain reaction (PCR) on cDNA data with specific oligonucleotide primers.

a) Synthesis of cDNA

cDNA synthesized the reaction volume of 20 μl, containing the following reagents: 50 mm Tris-HCl pH 8.3, 75 mm KCl, 10 mm dithiothreitol, 3 mm MgCl2, 0.5 mm each of deoxyribonucleosides, 20 units RNAsin, 75 ng randomized hexanucleotide primer, 2 µg RNA hTNF40 and 200 units of reverse transcriptase of the virus murine Moloney leukemia. After incubation at 42°C for 60 minutes the reaction was stopped by heating at 95°C for 5 minutes.

b) PCR

Aliquots of cDNA were subjected to PCR using combinations of primers specific for the heavy and light chains. Nucleotide sequence of the 5'-primers for the heavy and light chains are shown in tables 1 and 2 respectively. All sequences contain in the following order: a restriction site that starts after 7 nucleotides from their 5'-ends of the sequence GCCGCCACC (SEQ ID NO: 12) for the optimal broadcast received mRNA, initiating codon and 20-30 nucleotides in the base sequence of the leader peptide known mouse antibodies (Kabat et al., Sequences of proteins of immunological interest, 5thEdition, 1991, U.S. Department of Health and Human Services, Public Health Service, National Institutes of Health).

the 3'primers are shown in table 3. Primer light chain extends through J-C connection antibody and contains a restriction site for the enzyme SplI to facilitate cloning of the PCR fragment Vl. 3'heavy chain primers are a mixture designed to generate the, to extend through J-C connection antibodies. the 3'Primer includes the ApaI restriction site to facilitate cloning. the 3'region of these primers contains a mixed sequence based on sequences found in the well-known mouse antibodies (Kabat et al., 1991 (supra)).

The above described combination of primers allow to clone PCR products for Vh and Vl directly in suitable expressing vector (see below) to obtain a chimeric (mouse-human) heavy and light chains and to Express these genes in mammalian cells with obtaining chimeric antibodies of the desired isotype.

Incubation (100 ál) of the PCR was determined as follows. Each reaction contained 10 mm Tris-HCl pH 8.3, 1.5 mm MgCl2, 50 mm KCl, 0.01% by weight/volume of gelatin, 0.25 mm each deoxyribonucleoside, 10 pmol of a mixture of 5'-primers (table 4), 10 pmol 3'-primer (CL12 (light chain) or R2155 (heavy chain) (table 3)), 1 µl of cDNA and 1 unit of Taq polymerase. Reactions were incubated at 95°C for 5 minutes and then held cycles at 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute. After 30 cycles, an aliquot of each reaction was analyzed by electrophoresis on agarose gel. Reaction light chain containing a mixture of 5'-primers of pools 1, 2 and 7 light chain, gave bands with sizes, fully consistent with username Vl-fragments, while the reaction from the pool 3 reactions of the heavy chain gave a fragment of the size expected for Vh gene. Band given by the primers pool 1 light chain, were not processed until the end, because preliminary results showed that this band corresponds to the pseudo light chain produced by hybridoma cell. The strip produced by the primers pool 7 light chain, was weaker than the band of the primer pool 2, and, therefore, were not processed until the end. Only a strip of pool 2 reaction light chain, which was the strongest band was traced to the end.

c) Molecular cloning of PCR fragments

DNA fragments produced in pool 2 of the reaction light chain, were digested with enzymes BstBI and SplI, was concentrated by precipitation with ethanol were subjected to electrophoresis on a 1.4% agarose gel and the DNA bands in the range of 400 BP was recovered. They cloned legirovaniem in vector pMR15.1 (figure 4), which was cleaved with BstBI and SplI. After ligation mixture transformed into E. coli LM 1035 and plasmids from the resulting bacterial colonies were screened for inserts by splitting BstBI and SplI. Typical plasmids with inserts from each ligation were further analyzed by sequencing of nucleotides.

Similarly, the DNA fragments produced in the pool 3 reactions of the heavy chain, were digested HindIII and ApaI and cloned, etc) in the R pMRl4 (figure 5), which was split HindIII and ApaI. Typical plasmids containing inserts were analyzed by nucleotide sequencing.

d) Analysis of the nucleotide sequence

Plasmid DNA from several isolates containing Vh-inserts sequenced using primers R1053 (see table 5) (which primire in the 3'region of the HCMV promoter in pMR14) and R720 (see table 5) (which primire in the 5'-region With a range of 4 people and allows sequencing through DNA insert pMR14). It was found that the nucleotide sequence of the Vh insertion in the number of clones were identical, except for differences in the region of the signal peptide and the J-region. This indicates that the investigated clones are independent isolates, arising out of the use of different primers from a mixture of oligonucleotides during PCR stage. A specific nucleotide sequence and predicted amino acid sequence of the variable domain of the heavy chain of the antibody hTNF40 (hTNF40Vh) is shown in figure 7 (SEQ ID NO: 100).

For analysis of the light chain clones investigated the sequence obtained from the priming R1053 (see table 5) and R684 (SEQ ID NO: 62) (which primire 5'-area-Kappa person and allows sequencing through DNA insert pMR15.1). The nucleotide sequence and predicted amino acid serial is inost Vl genes, arising from reactions in pool 2, were analyzed in the same way. Again it was found that the nucleotide sequence of the Vl-paste in some of the clones were identical, except for differences in the region of the signal peptide and the J-region, which shows that the investigated clones were independent isolates, arising out of the use of different primers from a mixture of oligonucleotides used during the PCR stage. A specific nucleotide sequence and predicted amino acid sequence of the variable domain of the light chain of the antibody hTNF40 (hTNF40V1) is shown in figure 6 (SEQ ID NO: 99).

Evaluation of the activity of chimeric genes

Activity of chimeric genes were assessed by their expression in mammalian cells and purification and quantification of newly synthesized antibodies. The methodology for this is described below, followed by a description of the biochemical analyses and analyses based on the cells used for the biological characteristics of these antibodies.

a) obtaining a chimeric molecule antibody hTNF40

Chimeric antibody for the biological evaluation of the received temporal expression matching pairs of heavy and light is EPA after cotransfection in the cells of the Chinese hamster ovary (Cho) using deposition of calcium phosphate.

The day before transfection polyethlyene flasks with cells CHO-L761 was trypsinization, cells were counted and bulb Kzt75 installed in such a way that each contained 107cells.

The next day the culture medium was changed 3 hours before transfection. For transfection, the calcium phosphate precipitate was obtained by mixing 1.25 ml of 0.25 M CaCl2containing 50 μg of each of expressing the vectors of the heavy and light chains, with 1.25 ml of 2×HBS (16,36 g NaCl, 11,0 g HEPES and 0.4 g of Na2HPO4in 1 liter of water with pH, increased to 7.1 using NaOH) and add directly to the data environment of the cells. After 3 hours at 37°in CO2-thermostat environment and the precipitate was removed and the cells were subjected to shock by adding 15 ml of 15% glycerol in phosphate buffered saline (FSB) for 1 minute. The glycerol was removed, cells were washed once FSB and incubated in the course lasts for 48-96 hours in 25 ml of medium containing 10 mm sodium butyrate. The antibody can be removed from the culture medium by binding to protein a-separate and elution from protein a-sepharose.

b) ELISA

For ELISA tablets Nunc ELISA were coated overnight at 4°With F(ab')2fragment goat polyclonal specific against the Fc fragment of a human antibody (Jackson Immunoresearch, code 109-006-098) at 5 µg/ml in buffer coating (15 mm sodium carbonate, 35 mm sodium bicarbonate, R is 6,9). Unbound antibody was removed by washing 5 times with distilled water. Samples and purified standards, subject to a quantitative definition, was diluted to approximately 1 mg/ml in buffer for conjugation (0,1 Tris-HCl, pH 7.0, 0.1 M NaCl, and 0.2% V/V tween-20, 0.2% weight/about Hammersten casein). The samples were titrated in microtiter wells in 2-fold dilutions to a final volume of 0.1 ml in each well and the plates were incubated at room temperature for 1 hour with shaking. After the first incubation stage, the tablets were washed 10 times with distilled water and then incubated for 1 hour as before, with 0.1 ml of mouse monoclonal antibodies against human Kappa (clone GD12)conjugated to peroxidase (The Binding Site, code MP135)at a dilution of 1 in 700 in the buffer for conjugation. The tablet was washed again and to each well was added the substrate solution (0.1 ml). The substrate solution contained 150 μl of N,N,N,N-tetramethylbenzidine (10 mg/ml in DMSO), 150 μl of hydrogen peroxide (30% solution) in 10 ml of 0.1 M sodium acetate/sodium citrate, pH 6.0. The tablet was shown for 5-10 minutes, until the absorbance at 630 nm was approximately 1.0 for the top standard. The absorbance at 630 nm was measured using a tablet reader and the concentration of samples was determined by comparison of the titration curves with the curves of the standard.

(C) Determination of the affinity constants (the relationship) using BiaCore analysis

The binding interaction between hTNF40 and TNF person were studied using BIA technology. Affinity purified goat polyclonal antibody directed against the constant region hTNF40, was immobilized on the surface of sensor chip dextranomer polymer using standard chemistry NHS/EDC. Relatively low levels (200-500 EN) hTNF40 was immobilized to guarantee the minimization of the effect of mass transfer. TNF person at various concentrations was passed through the immobilized hTNF40 to assess the kinetics of the Association. After injection of the ligand buffer was passed through this surface in such a way that it was possible to measure dissociation. Rate constants for Association and dissociation for the interaction between the solid phase hTNF40 and TNF person counted and determined the value of KD.

EXAMPLE 1

CDR-grafting (grafting) hTNF40

Molecular cloning of the genes for the variable regions of the heavy and light chains of the antibody hTNF40 and their application to obtain a chimeric (mouse-human) antibody hTNF40 described above. Nucleotide and amino acid sequences of Vl and Vh mouse hTNF40 shown in figures 6 and 7 (SEQ ID NO:99 and 100), respectively. This example describes a CDR-vaccination antibody hTNF40.

CDR-grafting light chain hTNF40

Mapping the building frame areas of the light chain of hTNF40 with frame areas even the PEX subgroups light chains of a human being (Kabat et al., 1991 (supra)) revealed that hTNF40 was most homologous antibody in subgroup 1 light chain of a human. Therefore, to construct a CDR-grafted light chain selected frame area corresponded to frame areas of consensus sequences of group 1 person.

Comparison of the amino acid sequence of frame areas murine hTNF40 and consensus light chain groups of 1 person presented on figure 1 and shows that there are 22 differences (underlined) between the two sequences. Analysis of the impact that any of the frame differences can affect the binding of antigen identified 2 remainder for research; they are in positions 46 and 60. Based on this analysis we have constructed two versions of the CDR-grafted light chain. In the first one, hTNF40-gL1 (SEQ ID NO:8), residues 46 and 60 come from the light chain of hTNF40, whereas in the second, hTNF40-gL2 (SEQ ID NO:9), all residues are consistent with the remains of a man, except for residue number 60, which is the remainder of the light chain of hTNF40.

The design of hTNF40-gL1, CDR-grafted light chain

The design of hTNF40-gL1 is given in detail below. These overlapping oligonucleotides (R-R) were used in polymerase chain reactions (PCR) to build a shortened grafted light chain. The assembled fragment does not contain a leader on the sledovatelnot antibodies and the first 17 amino acids of the frame 1.

oligonucleotide 1 R:

5'GAATTCAGGGTCACCATCACTTGTAAAGCCAGTCAGAACGTAGGTACTAAC

GTAGCCTGGTATCAGCAAA3' (SEQ ID NO: 52)

oligonucleotide 2 R:

5'ATAGAGGAAAGAGGCACTGTAGATGAGGGCTTTTGGGGCTTTACCTGGTTT

TTGCTGATACCAGGCTACGT3' (SEQ ID NO: 53)

oligonucleotide 3 R:

5'TACAGTGCCTCTTTCCTCTATAGTGGTGTACCATACAGGTTCAGCGGATCCG

GGGGTGTT3' (SEQ ID NO: 54)

oligonucleotide 4 P7985:

5'GACAGTAATAAGTGGCGAAATCTTCTGGCTGGAGGCTACTGATCGTGAGGGT

GAAATCAGTACCACTACCG3' (SEQ ID NO: 55)

oligonucleotide 5 P7986:

5'ATTTCGCCACTTATTACTGTCAACAGTATAACATCTACCCACTCACATTCGGT

CAGGGTACTAAAGTAGAAATCAAACGTACGGAATTC3' (SEQ ID NO: 56)

Front wheel drive P7981:

5'GAATTCAGGGTCACCATCACTTGTAAAGCC3' (SEQ ID NO: 57)

Front wheel drive P7980:

5'GAATTCCGTACGTTTGATTTCTACTTTAGT3' (SEQ ID NO: 58)

PCR reaction, 100 μl, was installed in such a way that it contained 10 mm Tris-HCl pH 8.3, 1.5 mm MgCl2, 50 mm KCl, 0.01% by mass/about gelatin, 0.25 mm each deoxyribonucleoside-triphosphate, 2 pmol R, R, R, R, R, 10 pmol P7980, R and 1 unit of Taq polymerase. The reaction was performed with cycles of 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute. After 30 cycles each reaction was analyzed by agarose gel electrophoresis and the PCR fragment was cut out from the gel and extracted using a set of Mermaid. The extracted fragment was digested with enzymes BstEII and SplI in a suitable buffer. Received the product in the end was subjected to agarose gel electrophoresis and a DNA fragment of 270 BP were extracted from the gel slice and ligated in the vector CTIL5-gL6 (figure 12), which was previously asseble the same enzymes. The above vector provides the missing leader sequence of the antibody and the first 17 amino acids of the frame 1.

Mixture for ligation was used to transform E.coli strain LM1035 and the resulting colonies were analyzed by using PCR, splits restrictase and nucleotide sequencing. Nucleotide and amino acid sequence of the Vl-region hTNF40-gL1 shown in figure 8 (SEQ ID NO: 8).

The design of hTNF40-gL2, CDR-grafted light chain

hTNF40-gL2 (SEQ ID NO: 9) were designed using PCR. The following oligonucleotides were used to introduce amino acid substitutions:

R1053: 5'GCTGACAGACTAACAGACTGTTCC3' (SEQ ID NO: 59)

R5350: 5'TCTAGATGGCACACCATCTGCTAAGTTTGATGCAGCATAGAT

CAGGAGCTTAGGAGC3' (SEQ ID NO: 60)

R5349: 5'GCAGATGGTGTGCCATCTAGATTCAGTGGCAGTGGATCA

GGCACAGACTTTACCCTAAC3' (SEQ ID NO: 61)

R684: 5'TTCAACTGCTCATCAGAT3' (SEQ ID NO: 62)

Two reactions, each 20 µl, was installed in such a way that they contained 10 mm Tris-HCl pH 8.3, 1.5 mm MgCl2, 50 mm KCl, 0.01% by mass/about gelatin, 0.25 mm each deoxyribonucleoside, 0.1 ág hTNF40-gL1, 6 pmol R1053/R5350 or R5349/R684 and 0.25 units of Taq polymerase. The reaction was performed with cycles of 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute. After 30 cycles each reaction was analyzed by agarose gel electrophoresis and the PCR fragments were cut from the gel and extracted using a set of Mermaid.

Aliquots of these FR is mentov was then subjected to a second round of PCR. The reaction, 100 µl contained 10 mm Tris-HCl pH 8.3, 1.5 mm MgCl2/50 mm KCl, 0.01% by mass/about gelatin, 1/5 of each of the PCR fragments from the first set of reactions, 30 pmol R1053 and R684 and 2.5 units Taq polymerase. The reaction temperature were the same as described above. After PCR mixture was extracted with a mixture of phenol/chloroform and then with chloroform, and precipitated with ethanol. The ethanol precipitate was removed by centrifugation, dissolved in a suitable buffer and digested with enzymes BstEII and Spll. The resulting product was finally subjected to agarose gel electrophoresis and a DNA fragment of 270 BP were extracted from the gel slice and ligated in the vector pMR15.1 (figure 4), which had been previously cleaved with the same enzymes.

Mixture for ligation was used to transform E.coli strain LM1035 and the resulting colonies were analyzed by using PCR, splits restrictase and nucleotide sequencing. Nucleotide and amino acid sequence of the Vl-region hTNF40-gL2 shown in figure 9 (SEQ ID NO:9).

CDR-grafting of the heavy chain hTNF4Q

CDR-vaccinated heavy chain hTNF40 were performed using the same strategy described for the light chain. It was found that the heavy chain is the most homologous heavy chains of a person belonging to subgroup 1, and therefore the consensus sequence of frame areas subgroups 1 person would be who and selected for acceptance CDR heavy chain hTNF40.

To study the need for homologous frame area for use as acceptor framework for CDR-grafting second frame region, group 3, was selected for humanization of the heavy chain hTNF40.

Comparison of hTNF40 with two different frame areas are shown in figure 2, where one can see that hTNF40 differs from the consensus of the subgroup 1 person in 32 positions (underlined), and differs from the consensus of the subgroup 3 people in the 40 positions (underlined). After analysis of the influence that each of these differences may have on the binding of antigen residues 28, 38, 46, 67, 69 and 71 retained as donors in gh1hTNF40.1, CDR-grafted heavy chain, with the frame group 1. The remains 27, 28, 30, 48, 49, 69, 71, 73, 76 and 78 retained as a donor in gh3hTNF40.4, CDR-grafted heavy chain, with the frame group 3. Residues 28, 69 and 71 retained as a donor in gh1hTNF40.4, CDR-grafted heavy chain, with the frame group 1.

Design gh1hTNF40.4, CDR-grafted heavy chain

gh1hTNF40.4 (SEQ ID NO:10) were collected by placing overlapping oligonucleotides PCR in the presence of suitable primers. The following oligonucleotides were used in PCR:

The transplant group 1 oligonucleotide 1 R:

5'GAAGCACCAGGCTTCTTAACCTCTGCTCCTGACTGGACCAGCTGCACCTGAG

AGTGCACGAATTC3' (SEQ ID NO: 63)

oligonucleotide 2 R:

5'GGTTAAGAAGCCTGGGCTTCCGTCAAAGTTTCGTGTAAGGCCTCAGGCTAC

GTGTTCACAGACTATGGTA3' (SEQ ID NO: 64)

olignucleotides 3 R:

5'CCAACCCATCCATTTCAGGCCTTGTCCCGGGGCCTGCTTGACCCAATTCATAC

CATAGTCTGTGAACACGT3' (SEQ ID NO: 65)

olignucleotides 4 R:

5'GGCCTGAAATGGATGGGTTGGATTAATACTTACATTGGAGAGCCTATTTATGT

TGACGACTTCAAGGGCAGATTCACGTTC3' (SEQ ID NO: 66)

oligonucleotide 5 R:

5'CCATGTATGCAGTGCGTTGTGGAGGTGTCTAGAGTGAACGTGAATCTGCCCTT

GAA3' (SEQ ID NO: 67)

oligonucleotide 6 R:

5'CCACAAGCACTGCATACATGGAGCTGTCATCTCTGAGATCCGAGGACACCGC

AGTGTACTAT3' (SEQ ID NO: 68)

oligonucleotide 7 P7994:

5'GAATTCGGTACCCTGGCCCCAGTAGTCCATGGCATAAGATCTGTATCCTCTAG

CACAATAGTACACTGCGGTGTCCTC3' (SEQ ID NO: 69)

Fwd: P7988:

5'GAATTCGTGCACTCTCAGGTGCAGCTGGTC3' (SEQ ID NO: 70)

Bwd P7987:

5'GAATTCGGTACCCTGGCCCCAGTAGTCCAT3' (SEQ ID NO: 71)

The reaction Assembly 100 µl) contained 10 mm Tris-HCl pH 8.3, 1.5 mm MgCl2, 50 mm KCl, 0.01% by mass/about gelatin, 0.25 mm each deoxyribonucleoside, 2 pmol of each of R, R, R, R, R, R and R, 10 pmol each of R and R and 1 unit of Taq polymerase. The reaction was performed with cycles of 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute. After 30 cycles, the reaction was extracted with a mixture of phenol/chloroform (1/1), then chloroform and precipitated with ethanol. After centrifugation, the DNA was dissolved in a suitable buffer and digested ApaLI and kpni restriction sites. The obtained fragment was isolated from agarose gel and ligated in pMR14 (figure 5), which had been previously cleaved with the same enzymes. pMR14 contains a constant region of the heavy chain gamma 4 people; when pMR14 split ApaLI and kpni restriction sites, split the initial vector capable of accepting the split DNA, so the 3'end of the cleaved DNA is joined in reading frame to the 5'-end sequence that encodes a constant region of the gamma 4. Thus, a heavy chain expressed from this vector will have the isotype gamma 4. Mixture for ligation was used to transform E. coli LM1035 and the resulting bacterial colonies were subjected to screening by splitting restrictase and analysis of the nucleotide sequence. In this way identified a plasmid containing the correct sequence for gh1hTNA40.4 (figure 10) (SEQ ID NO: 10).

Design gh3hTNF40.4, CDR-grafted heavy chain

gh3hTNF40.4 (SEQ ID NO: 11) were collected by placing overlapping oligonucleotides PCR in the presence of suitable primers. The following oligonucleotides were used in PCR:

The transplant group 3

oligonucleotide 1 R:

5*GATCCGCCAGGCTGCACGAGACCGCCTCCTGACTCGACCAGCTGAACCTCAG

AGTGCACGAATTC3' (SEQ ID NO: 72)

oligonucleotide 2 R:

5'TCTCGTGCAGCCTGGCGGATCGCTGAGATTGTCCTGTGCTGCATCTGGTTACG

TTGTGG3' (SEQ ID NO: 73)

oligonucleotide 3 R:

5'CCAACCCATCCATTTCAGGCCCTTTCCCGGGGCCTGCTTAACCCAATTCATTC

CATAGTCTGTGAAGACGT3' (SEQ ID NO: 74)

olignucleotides 4 R:

5'GGCCTGAAATGGATGGGTTGGATTAATACTTACATTGGAGAGCCTATTTATGT

TGACGACTTCAAGGGCAGATTCACGTTC3' (SEQ ID NO: 66)

oligonucleotide 5 R:

5'GGAGGTATGCTGTTGACTTGGATGTGTCTAGAGAGAACGTGAATCTGCCCTT

G3' (SEQ ID NO: 75)

oligonucleotide 6 R:

5'CCAAGTCAACAGCATACCTCCAAATGAATAGCCTGAGAGCAGAGGACACCGC

AGTGTACTAT3' (SEQ ID NO: 76)

oligonucleic the d 7 P7993:

5'GAATTCGGTACCCTGGCCCCAGTAGTCCATGGCATAAGATCTGTATCCTCTAG

CACAATAGTACACTGCGGTGTCCTC3' (SEQ ID NO: 77)

Front wheel drive P7996:

5'GTGGGGGGTGG3' (SEQ ID NO: 78)

Bwd P7987:

5'GAATTCGGTACCCTGGCCCCAGTAGTCCAT3' (SEQ ID NO: 71)

The reaction Assembly 100 µl) contained 10 mm Tris-HCl pH 8.3, 1.5 mm MgCl2, 50 mm KCl, 0.01% by mass/about gelatin, 0.25 mm each deoxyribonucleoside, 2 pmol of each of R, R, R, R, R, R and R, 10 pmol each of R and R and 1 unit of Taq polymerase. The reaction was performed with cycles of 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute. After 30 cycles, the reaction was extracted with a mixture of phenol/chloroform (1/1), then chloroform and precipitated with ethanol. After centrifugation, the DNA was dissolved in a suitable buffer for restriction were digested ApaLI and kpni restriction sites. The obtained fragment was isolated from agarose gel and ligated in pMR14 (figure 5), which had been previously cleaved with the same enzymes. PMR14 kept constant region of the heavy chain gamma 4 people. When pMR14 split ApaLI and kpni restriction sites, the split vector capable of accepting the split DNA, so that the 3'end of the cleaved DNA is joined in reading frame to the 5'-end sequence that encodes a constant region of the gamma 4. Thus, a heavy chain expressed from this vector will have the isotype gamma 4. Mixture for ligation was used to transform E. coli LM1035 and received smear the territorial colonies were subjected to screening by splitting restrictase and analysis of the nucleotide sequence. In this way identified a plasmid containing the correct sequence for gh3hTNF40.4 (figure 10) (SEQ ID NO: 11).

Getting CDR-grafted modified Fab fragment

CDR-grafted, modified Fab fragment, on the basis of antibody hTNF40, designed using vector RTO-1 E. coli. Variable regions of the antibody hTNF40 subcloning in this vector and intergenic sequence optimize to obtain pTTO(CDP870). This expressing vector RTO is intended to cause accumulation in periplasm soluble recombinant proteins in E. coli. The main features of this plasmid are:

(i) a marker of resistance to tetracycline is an antibiotic not inaktivirovanie product resistance gene, so that supported the selection of plasmacytomas cells;

(ii) low chopinot beginning of replication derived from plasmid RA that is compatible with plasmids containing originating from colE1 replicons;

(iii) a strong inducible tac promoter for transcription of the cloned gene (genes);

(iv) lacIqgene gives constitutive expression of the lac-repressing protein that supports the tac promoter in the repressed state until it is induced by IPTG/allolactose;

(v) a signal sequence, OmpA - gives periplasmatic the secretion of cloned gene (genes); and

(vi) translationinvariant signal sequence, OmpA short peptide lacZ, allowing efficient initiation of translation.

This vector was created for the expression of modified Fab-fragments of dicistronic matrix by creating a method for the selection of empirically optimal intergenic sequences from a number of four purposefully designed cassettes. Describes the application of this method in the construction of pTTO(CDP870).

Materials and methods

Methods DNA

Standard procedures were used for protocols, including the restriction of DNA, agarose gel electrophoresis, ligation, and transformation. Restrictase and modifying DNA enzymes were obtained from New England Biolabs or Boehringer Mannheim and used according to manufacturers ' recommendations. DNA fragments were purified from agarose using the GeneClean Protocol (BIO 101). Oligonucleotides were obtained from Oswell Oligonucleotide Service and synthesized at the scale of 40 nm. Plasmid DNA was isolated using sets of Plasmid DNA Mini/Midi kit from Qiagen. PCR was performed using Amplitaq" Perkin Eitner in accordance with the recommendations. DNA sequencing was performed using a kit for sequencing Applied Biosystems Taq cycle sequencing kit.

Induction in shake flasks

Culture of E. coli W3110 was grown in L-broth supplemented with tetracycline (7,5 mg/ml). For inductions fresh night culture (growing at 30° (C) was diluted to OD6000.1 to 200 ml L-BU is gone in the flask with septum 2 l and were grown at 30° With in the space thermostat. When OD6000,5 IPTG was added to 200 microns. Samples (normalized against OD) were taken at intervals.

Extraction of periplasmic

Samples of the culture was cooled on ice (5 minutes), then the cells were collected by centrifugation. After resuspendable in the buffer for extraction (100 mm Tris-HCl, 10 mm EDTA, pH 7.4), the samples were incubated over night at 30°With, then osvetleni by centrifugation.

The Assembly analysis

The concentration of the modified Fab was determined using ELISA. The tablets were coated at 4°during the night antibody against Fd 6045 (2 μg/ml in buffer coating, physiological saline, 100 μl per well). After washing 100 μl of the samples were submitted to the hole; cleared A5 V7 gamma-1 Fab', a source at 2 µg/ml was used as standard. Samples were serially diluted 2-fold across the plate in the buffer for conjugation of samples (per liter: 6,05 g triaminobenzene; of 2.92 g NaCl; 0.1 ml of Tween-20; 1 ml of casein (0,2%)); the plates were incubated for 1 hour at room temperature with stirring. The tablets were washed and dried, then was added 100 μl of antibodies against C-Kappa (GD12) man, conjugated to peroxidase (diluted with sample buffer for conjugation). Incubation was carried out at room temperature for 1 hour under stirring. The tablets were washed and dried, then EXT is ulali 100 µl of substrate solution (10 ml acetate/sodium citrate (0.1 M, pH 6); 100 μl of solution of H2O2; 100 μl of a solution of tetramethylbenzidine (10 mg/ml in dimethyl sulfoxide)). The absorbance at 630 nm was read after 4-6 minutes after substrate addition.

Construction of plasmids RTO-1

(a) Replacement of polylinker pTTQ9

Plasmid pTTQ9 was obtained from Amersham and are shown in figure 14. An aliquot (2 μg) was digested with restrictase SalI and EcoRI, the cleavage product was subjected to electrophoresis on 1% agarose gel and the large DNA fragment (4520 BP) was purified. Synthesized two of the oligonucleotide which, when annealed together encode polylinker district OmpA, shown in figure 15. This sequence has sticky ends that are compatible with SalI and EcoRI generated by restriction pTTQ9. When cloning this oligonucleotide "cassette in the vector pTTQ9 the SalI site is not regenerated, but the EcoRI site is maintained. Cassette encodes the first 13 amino acids of the signal sequence of the protein of the outer membrane of E. coli Omp-A, which is the binding site of the ribosome Shine-Dalgarno OmpA gene. In addition, there are restriction sites for enzymes XbaI, MunI, StyI and SplI. Sites MunI, StyI and SplI are located within the coding region of the signal sequence, OmpA and are designed as 5'-cloning sites for insertion of genes. Two of the oligonucleotide, which form the tape, annealed together mixing when the concentration is 5 pmol/μl and heated on a water bath to 95° C for 3 minutes and then slowly cooled to room temperature. Then annealed (hybridizing) sequence ligated to the cut SalI/EcoRI vector pTTQ9. The obtained plasmid intermediate product called pTQOmp was confirmed by DNA sequencing.

(b) Receiving and ligation of fragments

Plasmid, RTO-1 was designed by legirovaniem one DNA fragment from plasmid pACYC184 with two fragments generated from pTQOmp. pACYC184 were obtained from New England Biolabs and its restriction map is shown in figure 16. An aliquot (2 μg) was digested completely with restriction enzyme StyI, then treated with nuclease Mary (bean Golden); this treatment creates blunt ends by cutting 5'-overhangs grounds. After phenol extraction and ethanol precipitation the DNA was digested with the enzyme PvuII with the formation of fragments of size 2348, 1081, 412 and 403 BP Fragment 2348 gel purified after electrophoresis on agarose gel. This fragment encodes a marker of resistance to tetracycline and site of replication initiation RA. Then this fragment was treated with alkaline phosphatase calf intestine to remove the 5'-terminal phosphates, thus preventing self-ligation of this molecule.

An aliquot (2 μg) plasmids pTQOmp were digested with enzymes SspI and EcoRI and the fragment size 2350 BP was purified from unwanted fragments of size 2040 p. is. and 170 gel after electrophoresis in agarose gel; this fragment encodes the region of the terminator of transcription and gene lacIq. Another aliquot (2 μg) pTQOmp were digested EcoRI and XmnI obtaining fragments of size 2289, 1670, 350 and 250 BP Fragment of 350 BP, encoding the tac promoter, signal sequence, OmpA and multicameraframe, was purified from the gel.

Then these three fragment ligated using approximately equimolar amounts of each fragment to generate plasmid, RTO-1. All cloning compounds were checked by DNA sequencing. Restriction map of this plasmid is shown in figure 17. Then we created a plasmid, RTO-2 by inserting DNA encoding the constant region of light chain Kappa 1g man. It was received in the form of a fragment of the enzyme SplI-EcoRI from plasmids RNs and embedded in the corresponding sites in RTO-1. Plasmid, RTO-2 are shown in figure 18.

Embedding humanized variable regions hTNF40 in RTO-2

hTNF40gL1 (SEQ ID NO:8), the variable region of light chain, was obtained by PCR-rescue" from the appropriate vector for expression in mammalian cells pMR10.1. Leader sequence OmpA replaces the native leader of the Ig. The sequence of PCR primers are shown below:

5'-primer:

CGCGCGGCAATTGCAGTGGCCTTGGCTGGTTTCGCTACCGTAGCGCAAGCTGACATT CAAATGACCCAGAGCCC (SEQ ID NO: 79)

3'-primer: TTCAACTGCTCATCAGATGG (SEQ ID NO: 8)

After PCR under standard conditions the product was purified, digested with enzymes MunI and SplI and then was purified from the gel. Then the purified fragment was inserted into the sites MunI/SplI pTTO-2 to generate the intermediate plasmid with a light chain pTTO (hTNF40L).

Variable region of the heavy chain gh3hTNF40.4 was obtained in the same way from the vector R-gamma-4. The sequence of PCR primers are shown below:

5'-primer:

GCTATCGCAATTGCAGTGGCGCTAGCTGGTTTCGCCACCGTGGCGCAAGCTGAGGT TCAGCTGGTCGAGTCAGGAGGC (SEQ ID NO: 81)

3'-primer: GCCTGAGTTCCACGACAC (SEQ ID NO: 82)

After the PCR product was purified, digested with enzymes NheI and ApaI and then was subcloned into the vector pDNAbEng-G1 (figure 19). After confirming the DNA sequencing heavy chain was restrictively enzyme EcoRI and subcloned into the EcoRI site of RTA (hTNF40L) to generate expression plasmids pTTO (hTNF40) E.coli.

Optimization of intergenic sequences for expression of the modified Fab

In the vector rtta expression of the modified Fab comes from dicistronic matrix that encodes a first light chain, and then a heavy chain. The DNA sequence between the two genes (intergenic sequence, IGS) can affect the level of expression of the heavy chain effect on the rate of translation initiation. For example, short intergenic sequence can lead to translational coupling between the light and heavy chains due to the fact that with ribosome may not be fully dissociates from mRNA after completion of the synthesis of light chains before initiating the synthesis of the heavy chain. "Force" any binding site of the ribosome Shine-Dalgarno (SD) (homology relative to 16S rRNA) may also have an effect as the length and composition of between SD sequence and the start codon ATG. Potential secondary structure of mRNA around the ATG is another important factor; ATG must be in "the loop"and not be enclosed in "stalk", whereas the reverse situation applies to SD. Thus, by modifying the composition and length of the IGS can be modified due to the initiation of translation and, consequently, the level of production of the heavy chain. It seems likely that the optimal rate of translation initiation must be achieved to maximize the expression of the heavy chain specific modified Fab. For example, one modified Fab high level of expression may be tolerated, but for another modified Fab with a different amino acid sequence high level of expression may be toxic, possibly due to the differing efficiencies of secretion or styling. For this reason, was designed series of four intergenic sequences (figure 20), which allows to empirically determine the optimum IGS for modified on the basis of hTNF40 Fab. IGS1 and IGS2 have very short intergenic sequence (-1 and +1, respectively), and it can be expected that they Yes the t is closely coupled to the transmission; these SD sequence (underlined) are slightly different. These two sequences, the most likely to report a high level of translation initiation. IGS3 and IGS4 have a greater distance between the start codons and stop codons (+13) and differ in their sequence; IGS3 has a "stronger" SD sequence. All sequences examined in relation to the secondary structure (using m/fold) and "optimized"to the extent possible; however, with the close pairing the broadcast data of the two circuits is the lack of dissociation of the ribosome means that mRNA may not be "naked", which prevents the formation of secondary structure.

Cloning options IGS

IGS-cassette, shown in figure 20, are flanking the cloning sites SacI and MunI. They are constructed by annealing of complementary oligonucleotide pairs. The vector fragment was obtained by splitting RTO (hTNF40) SacI and NotI, and the fragment of the heavy chain was obtained by splitting pDNAbEng1 (hTNF40H) MunI and NotI. Then perform a three-stage ligation using equimolar amounts of these two restriction fragments and about 0.05 pmol of each annealed oligo-cassette. This created four expression plasmids pTTO (hTNF40 IGS-1), pTTO (hTNF40 IGS-2), pTTO (hTNF40 IGS-3), pTTO (hTNF40 IGS-4).

Analysis of expression in shake flasks is x

These four plasmids were transformed into E. coli strain W3110, along with the original expression design, and then analyzed for the expression in shake flasks as described. The results of a typical experiment are shown in figure 21. Various intergenic sequence reported by different profiles of expression. IGS1 and IGS2 accumulate periplasmatic, modified Fab quickly with a peak at 1 hour after induction, after which the extracted level falls. The specified peak is higher and falls more sharply for IGS1. These findings are consistent with a high level of synthesis, as expected for a close translation pair for data structures. IGS1, obviously, gives a higher level of expression of the heavy chain, than it makes IGS2. In this case, it seems that such a high level of expression is poorly tolerated because periplasmatic levels of expression fall after 1-hour peak. This can be seen on the profile of growth IGS1-culture (not shown), which peaks at 1-hour post-induction before the fall, which involves the death and lysis of cells. IGS3 accumulates modified Fab more slowly, but reaches a maximum at 2 hours after induction with a higher peak value (325 ng/ml/OD), before the levels are falling. The growth of this culture lasted until 3 hours after range of complete the AI and have attained higher biomass at the maximum (not shown). This is consistent with a lower level of synthesis of heavy chain. IGS4 material accumulates at a slower speed and can not reach the high peaks of the other 3 designs. All options IGS significantly exceed the original vector. The hypothesis that different sequences of IGS report different speeds of translation initiation, the data supports the experimental results. In relation to modified on the basis of hTNF40 Fab, it seems that the high rate of translation initiation of the heavy chain is poorly tolerated and is therefore not optimal. Slower speed, such as reported IGS3, leads to better growth characteristics, and consequently accumulates the best solution over time.

After comparing productivity in fermenter design IGS3 was selected as the most productive and was named pTTO(CDP870) - see figure 22.

A heavy chain encoded by the plasmid pTTO(CDP870)has the sequence shown in SEQ ID NO: 115, and the light chain has the sequence given in SEQ ID NO: 113.

Pegylation CDR-grafted, created on the basis of hTNF40 modified Fab

Purified modified Fab kongugiruut site-specifically with a branched PEG molecule. This is achieved by activation of a single cysteine residue in a shorter hinge region is modificirovannogo Fab followed by reaction with (PEG)-lilmalayin, as described previously (..Chapman et al., Nature Biotechnology, 17, 780-783, 1999). Mahilyowskaya molecule is shown in figure 13, and it is named connection CDP870.

Efficiency Paglinawan CDR-grafted, created on the basis of hTNF40 modified Fab (CDP870) in the treatment of rheumatoid arthritis

CDP870 has a long half-life existence in the body for approximately 11 days.

The authors evaluated the safety and efficacy of intravenous administration of CDP870 in a randomized doubly-blind placebo-controlled trial with higher doses in patients with rheumatoid arthritis (RA).

Ways

Patients

Patients aged between 18 and 75 years who met the revised in 1987 diagnostic criteria of the American College of rheumatology (ACR) for rheumatoid arthritis (RA) (Arnett et al., Arthritis Rheum., 31, 315-324, 1988), were recruited from the outpatient rheumatology clinics in London, Cambridge, Norfolk and Norwich (United Kingdom of great Britain and Northern Ireland). It was required that patients had clinically active disease defined by the presence of at least 3 of the following criteria: ≥6 painful or sensitive to the touch of the joints; ≥45 minutes stiffness early in the morning and the erythrocyte sedimentation rate (ESR) ≥28 mm/hour, They had to be able to answer n is at least one disease modifying Antirheumatic drug (DRARD) and not to be subjected to treatment for at least 4 weeks. Corticosteroids were permitted if the dose was ≥7.5 mg/day prednisolone. Pregnant women, lactating women and women, potentially capable of procreation, not using an effective method of contraception were excluded from the study. Patients were excluded if they had a previous history of malignancy associated with severe medical conditions, previous failure in TNF-neutralizing therapy or are allergic to polyethylene glycol. Written informed consent was obtained from each patient before inclusion in the lists for study. The study was approved by local research ethics committees.

The treatment Protocol

36 patients with RA were divided into 3 groups, and each received an increasing dose of the test drug (1, 5 or 20 mg/kg). Each group of 12 patients was divided in 8 patients to obtain CDP870 and 4 patients to receive placebo. CDP870 was given as a single intravenous infusion (100 ml in total) for 60 minutes. Placebo (sodium acetate buffer) was injected in a similar way as a single intravenous infusion of 100 ml for 60 minutes. The treatment was performed on an outpatient basis. After 8 weeks all patients had the opportunity to get an infusion of either 5 or 20 mg/kg CDP870 open manner (i.e. notifying the patient about feliciaday).

Clinical evaluation

The disease is rheumatoid arthritis (RA) was evaluated on the basis of sets of main data of the world health organization and International League of Associations for Rheumatology (Boers et al., J. Rheumatol. - Supplement, 41, 86-89, 1994) and the European League against rheumatism (EULAR) (Scott et al., Clin. Exp.Rheumatol., 10, 521-525, 1992) with the number of joints 28. Changes in disease activity was assessed using a scoring of disease activity (Prevoo et al., Arthritis Rheum., 38, 44-48, 1995) and criteria ACR responses (Felson et al., Arthritis Rheum., 38, 727-735, 1995). Assessments were performed before treatment and at 1, 2, 4, 6 and 8 weeks after treatment. Patients were also evaluated for safety and tolerability of the test drug. Hematology, biochemistry, antibodies against CDP870 and adverse effects were assessed at each visit.

The concentration of CDP870 in plasma and antibodies against CDP870

CDP870 were measured using enzyme-linked immunosorbent assay (ELISA). Serial dilution of the plasma of the patients were incubated in microtiter plates (Nunc)coated with recombinant TNFα person (Strathmann Biotech GmbH, Hannover). Caught CDP870 found conjugated with horseradish peroxidase goat antibodies against the light chain of the Kappa person (Cappel, ICN), followed by the substrate tetramethylbenzidine (TMB).

Antibodies to CDP870 were subjected to screening (at a dilution of 1/10 plasma) using the ELISA with a double antigen sandwich with biotinylated CDP870 as the second layer. Bound antibodies were detected using HRP-streptavidin and TMB substrate. The analysis was calibrated using standard IgG hyperimmune rabbit. The unit of activity is equivalent to 1 µg rabbit standard.

Statistical analysis

This test was exploratory in nature and the sample size was based on previous experience with similar agents. The efficacy of CDP870 analyzed by calculating the scoring of disease activity (DAS) and R20/50-response for treatment and using a closed testing procedure for each Protocol. Score disease activity was calculated as follows: DAS=0,555×the square root of (28 tender joints)+0,284×the square root of (28 swollen joint)+0,7×In(ESR)+0,0142×(global assessment of the patient). First United active group compared with placebo. If this comparison was significant at 5% level, each group doses compared with placebo. All comparisons were two-tailed with a level of confidence of 5%. All values of P were obtained from the research analysis and should not be used to interpret with final conclusions.

Results

Demography

Were enrolled 36 patients with RA. Their demographic details are shown in table 6. The average age was 56 years and 30 patients now were women. The mean duration of RA was 13 years old, and 21 patients had a positive rheumatoid factor. Patients in different groups have similar demographic characteristics. In the period of the blind doses of 6/12 placebo-treated patients withdrew from the trials due to the deterioration of RA at the moment ≥4 weeks after administration of doses. 2/24 receiving CDP870 patients withdrew from the trials, both in group 1 mg/kg, due to the worsening of RA/absence verification test results at the moment>4 weeks after administration of doses. The difference was statistically significant (p=0.009, Fisher's exact test).

Table 6

Demographic details (average ± standard deviation)
NumberGender (M:F)AgeDisease durationRheumatoid factorThe number of previous DMAJRD
Placebo121,1151±812±88 (67%)5±1
1 mg/kg81:759±712±74 (50%)4±1
5 mg/kg82:654±1313±55 (63%)± 2
20 mg/kg82:661±1114±134 (50%)4±2

Clinical efficacy

The proportion of patients with ACR20 improvement for the population according to the Protocol from the last observation and the evidence of improvement was at 16.7, 50, of 87.5 62.5% after placebo, 1, 5 and 20 mg/kg CDP870 (p=0,012 effect of combined treatment) at 4 weeks and 16.7, 25, 75 and 75% (p=0,032) at 8 weeks. Reduction estimates DAS (median) for the population according to the Protocol from the last observation and the evidence of improvement was to 0.15, 1,14, 1,91 and 1.95 after placebo, 1, 5 and 20 mg/kg CDP870 (p=0.001 effect of combined treatment) at 4 weeks and 0.31, and 0.09, 2,09 and 1.76 (p=0.008) at 8 weeks (figure 23).

Changes in individual components of the set of master data of the world health organization and International League of Associations for Rheumatology shown in figure 24.

After open for patient dose CDP870 found similar beneficial effects. Of the 36 patients enrolled in this trial, 32 received a second infusion of CDP870. The proportion of patients with ACR20 improvement from the previous first infusion was 72,2 and 55.6% after 5 and 20 mg/kg CDP870 at 4 weeks, and 55.6 and 66.7% at 8 weeks.

Side effects

The treatment was well tolerated without-related infusion reactions. Not reported allergic reaction or to the author of the rash. In doubly-blind phase were 19, 38, 8, and 14 of side effects in the placebo groups, 1, 5 and 20 mg/kg, respectively. The most common was headache with 9 cases in 5 patients (1 placebo, 3 at 1 mg/kg, 1 at 20 mg/kg). One patient who received placebo, and 3 patients who received CDP870 (1 at 5 mg/kg and 2 at 20 mg/kg), developed infections of the lower respiratory tract. They were reported as mild or moderate. They were treated with oral antibiotics, and they were held over a period of 1-2 weeks. Three patients each in groups 1 and 5 mg/kg and one at the group of 20 mg/kg, had a urinary tract infection after 1-2 months after treatment CDP870. One adverse event was described as heavy, which was a case of pain in the neck, which appeared after 3 days after infusion of 1 mg/kg Increase in antinuclear antibodies was observed in 4 patients: 1 in the placebo group (negative in relation to 1/40), 2 in group 1 mg/kg (negative in relation to 1/40, negative in relation to 1/80) and 1 in group 20 mg/kg (negative in relation to 1/40). We detected no change in antibodies against DNA or antibodies against cardiolipin.

The concentration of CDP870 in the plasma and the levels of anti-SRR

As expected, for all dose levels CDP870 maximum plasma concentration was observed at the end of the infusion, and it was proportional to the dose, after which the plasma concentration slowly decreased. P is ofil concentration of CDP870 in plasma seems to be very similar to the profile observed previously in volunteers, when it was calculated that the biological half-life was approximately 14 days. In repeated dose observed a similar profile compared with infusion of a single dose.

After a single intravenous injection of antibody levels against CDP870 were low or neglectible.

Discussion

Neutralization of TNFα is an effective treatment strategy in case of rheumatoid arthritis (RA). Currently, it requires the use of biological agents, such as chimeric mAb or soluble protein receptor/Fc humans, which are expensive to prepare. Therapeutic neutralization of TNFα the agent should bind TNFα with high affinity and have a long half-life in plasma, low antigenicity and high tolerability and safety. He should be available for all patients with RA who could benefit from blockade of TNFα. One technology that could achieve these goals is to conjugation with polyethylene glycol TNFα-binding fragment of an antibody formed in E.coli. In this preliminary study, the authors found that CDP870, Targeted, directed against TNFα, modified Fab, is an effective and well-tolerated by patients with RA.

Research the Finance in vitro showed what CDP870 has a similar TNFα neutralizing activity relative to the original mouse antibody against TNFα. This study confirms that CDP870 reduce inflammation and improve symptoms in RA. Clinical improvement, as measured by criteria ASR-responses in groups of 5 and 20 mg/kg (75%, 75%)was comparable with etanercept (60%) (Moreland et al., Annals Int. Med., 130, 478-486, 1999) and infliximab (50%) (Maini et al., Lancet, 354, 1932-1939, 1999). At secondary and tertiary levels of the tested doses of therapeutic effect lasted for 8 weeks, which is comparable with previous other mAb (Elliot et al., Lancet, 344, 1105-1110, 1994; Rankin et al., Br. J. Rheumatol., 34, 334-342, 1995). An earlier study showed that therapeutic effect of antibodies against TNFα related to its half-life in plasma and the formation of circulating antibodies (Maini et al., Arthritis Rheum. 38, (Supplement): S186 1995 (Abstract)). The study authors showed that CDP870 is a half-period of existence in the plasma of 14 days, which is equivalent to a half-period of the existence of a whole antibody (Rankin et al., (supra)) and much more than half of existence is not conjugated Fab'fragments. In addition, CDP870 generate only very low levels of response in the form of antibodies.

One of the important objectives of this invention is the study of the tolerability and safety introduction this Paglinawan Fab'. The study authors CP870, appears well tolerated. Although additional research is needed to assess long-term toxicity, especially the risk of demyelinating diseases, infections and skin rashes, which was reported for etanercept and infliximab.

In General, CDP870 is therapeutically effective in RA and was well-tolerated in this short term study.

It should be clear that the above examples are merely illustrative and do not limit the scope of this invention defined by the following claims.

1. Molecule antibody specific to TNFα man, containing heavy and light chain, where the variable domain of the heavy chain contains the CDR-sites with the sequence SEQ ID NO: 1 for CDRH1, SEQ ID NO: 2 or SEQ ID NO: 7 for CDRH2 and SEQ ID NO: 3 for CDRH3, and the variable domain of the light chain contains the CDR-sites with the sequence SEQ ID NO: 4 for CDRL1, SEQ ID NO: 5 for CDRL2 and SEQ ID NO: 6 for CDRL3, and, optionally, which is modified Fab-fragment, With the end of the heavy chain of which contains one or more amino acids to enable attachment of the effector or reporter molecule.

2. The antibody molecule according to claim 1, which contains SEQ ID NO: 2 for DRH2.

3. The antibody molecule according to claim 1 or 2, which is a CDR-grafted antibody molecule.

4. The antibody molecule according to claim 3, where the variable domain contains the acceptor framework region of a human and the donor CDR, which is not human.

5. The antibody molecule according to claim 4, where the acceptor framework region of a human variable domain of the heavy chain based on the consensus sequences of group 1, and contain donor residues, non-human, in positions 28, 69 and 71.

6. The antibody molecule according to claim 4, where the acceptor framework region of a human variable domain of the heavy chain based on the consensus sequences of group 1, and contain donor residues, non-human, 28, 38, 46, 67, 69 and 71.

7. The antibody molecule according to claim 4, where the acceptor framework region of a human variable domain of the heavy chain based on the consensus sequences of the group of 3 people and contain donor residues, non-human, in the provisions of 27, 28, 30, 48, 49, 69, 71, 73, 76 and 78.

8. The antibody molecule according to any one of claims 4-7, where the acceptor framework region of a human variable domain of the light chain based on the consensus sequences of group 1, and contain donor residues, non-human, in the provisions of 46 and 60.

9. The antibody molecule according to any one of claims 1, containing the variable region of the light chain of hTNF40-gL1 (SEQ ID NO: 8) and the variable region of the heavy chain gh3hTNF40.4 (SEQ ID NO: 11).

10. The antibody molecule according to any one of claims 1 to 9, which is a Fab fragment.

11. The antibody molecule of claim 9 or 10, which is a Fab fragment containing the heavy chain sequence of SEQ ID NO: 111, and a light chain of sequence SEQ ID NO: 113.

12. The antibody molecule according to any one of claims 1 to 9, which is a modified Fab fragment, With the end of the heavy chain of which contains one or more amino acids to enable attachment of the effector or reporter molecule.

13. The antibody molecule according to item 12, where additional amino acids form a modified hinge region containing one or two cysteine residue, to which may be attached effector or reporter molecule.

14. The antibody molecule according to item 13, which is a modified Fab fragment containing the heavy chain sequence of SEQ ID NO: 115 and light chain sequence of SEQ ID NO: 113.

15. Molecule antibody specific to TNFα human light chain which contains the sequence of SEQ ID NO: 113.

16. The antibody molecule according to item 15, the light chain of which consists of the sequence SEQ ID NO: 113.

17. Molecule antibody specific to TNFα human heavy chain which contains the sequence of alnost SEQ ID NO: 115.

18. Molecule antibodies at 17, a heavy chain which comprises the sequence of SEQ ID NO: 115.

19. Molecule antibody specific to TNFα human light chain which contains the sequence of SEQ ID NO: 113, and a heavy chain which contains the sequence of SEQ ID NO: 115.

20. The antibody molecule according to claim 19, light chain which consists of the sequence SEQ ID NO: 113, and a heavy chain which comprises the sequence of SEQ ID NO: 115.

21. The antibody molecule according to any one of claims 1 to 20, the affinity of which in relation to TNFα is at least 0,85·10-10M

22. The antibody molecule according to item 21, which is obtained according to the Protocol achieve affinity.

23. The antibody molecule according to claim 1, which is a mouse monoclonal antibody hTNF40 against TNFα.

24. The antibody molecule according to claim 1, which is a chimeric molecule of the antibody containing the variable domains of the light and heavy chains of the monoclonal antibody according to item 23.

25. Connection with affinity against TNFαcontaining the antibody molecule according to any one of p-20 with covalently attached to the amino acid at the C-end or towards the end of its heavy chain effector or reporter molecule, where the effector or reporter molecule is one or more molecules methoxypoly (ethylene glycol).

26. Connection with affinity against TNFαcontaining molecule antibodies on 14 connected to one of the cysteine residues at the C-end of the heavy chain lilmalayin group, where each amino group litelnogo residue covalently linked to the remainder methoxypoly (ethylene glycol) with a molecular mass of approximately 20000 Yes.

27. Connection with affinity against TNFαcontaining specific for TNFα human molecule antibody light chain which contains the sequence of SEQ ID NO: 113, and a heavy chain which contains the sequence of SEQ ID NO: 115, attached to one of the cysteine residues at the C-end of the heavy chain of one or more molecules methoxypoly (ethylene glycol).

28. Connection item 27 containing molecule antibody specific to TNFα human light chain consists of the sequence SEQ ID NO: 113, and a heavy chain which comprises the sequence of SEQ ID NO: 115, attached to one of the cysteine residues at the C-end side of the heavy chain by one or more molecules methoxypoly (ethylene glycol).

29. Connection with affinity against TNFαcontaining specific for TNFα human molecule antibody light chain which contains the sequence of SEQ ID NO: 113, attached to one of the cysteine residues at the C-end of the heavy chain lilmalayin group, where each amino group litelnogo residue covalently linked to the remainder methoxypoly (ethylene glycol) with a molecular mass of approximately 20000 Yes.

30. Conn is out in clause 29, containing molecule antibody specific to TNFα human light chain consists of the sequence SEQ ID NO: 113, attached to one of the cysteine residues at the C-end of the heavy chain lilmalayin group, where each amino group litelnogo residue covalently linked to the remainder methoxypoly (ethylene glycol) with a molecular mass of approximately 20000 Yes.

31. Connection with affinity against TNFα individuals containing specific for TNFα human molecule antibody, a heavy chain which contains the sequence of SEQ ID NO: 115, attached to one of the cysteine residues at the C-end of the heavy chain lilmalayin group, where each amino group litelnogo residue covalently linked to the remainder methoxypoly (ethylene glycol) with a molecular mass of approximately 20000 Yes.

32. Connection p containing molecule antibody specific to TNFα human heavy chain consists of the sequence SEQ ID NO: 115, attached to one of the cysteine residues at the C-terminal side of the heavy chain lilmalayin group, where each amino group litelnogo residue covalently linked to the remainder methoxypoly (ethylene glycol) with a molecular mass of approximately 20000 Yes.

33. Connection with affinity against TNFα individuals containing specific to TNα human molecule antibody light chain which contains the sequence of SEQ ID NO: 113, and a heavy chain which contains the sequence of SEQ ID NO: 115, attached to one of the cysteine residues at the C-end of the heavy chain lilmalayin group, where each amino group litelnogo residue covalently linked to the remainder methoxypoly (ethylene glycol) with a molecular mass of approximately 20000 Yes.

34. Connection p containing molecule antibodies specific against TNFα human light chain consists of the sequence SEQ ID NO: 113, and a heavy chain which comprises the sequence of SEQ ID NO: 115, attached to one of the cysteine residues at the C-end of the heavy chain lilmalayin group, where each amino group litelnogo residue covalently linked to the remainder methoxypoly (ethylene glycol) with a molecular mass of approximately 20000 Yes.

35. The antibody molecule according to any one of claims 1 to 24, containing a hybrid CDR containing shortened donor CDR sequence, where the missing part of the donor CDR replaced by a different sequence and forms a functional CDR.

36. Molecule antibodies on p, where the missing part of the CDR sequence is a part of the antibody from which the received frame region of the molecule antibodies.

37. Molecule antibodies on p, DG is the missing part of the CDR sequence is a part of the antibody germ line with the consensus of frame areas.

38. The antibody molecule according to any one of PP 37, where in the molecule antibodies plot heavy chain CDRH2 is a hybrid.

39. The antibody molecule according to any one of p-38, where the specified shortening made With the end of the CDR.

40. The DNA sequence that encodes the heavy and light chain of the antibody molecules according to any one of claims 1 to 24 and 35-39, where the molecule antibodies specific for TNFα man.

41. The DNA sequence that encodes a heavy chain of the antibody molecules according to any one of claims 1 to 24 and 35-39, where the molecule antibodies specific for TNFα man.

42. The DNA sequence that encodes the light chain of the antibody molecules according to any one of claims 1 to 24 and 35-39, where the molecule antibodies specific for TNFα man.

43. The DNA sequence for p or 42 containing the sequence of SEQ ID NO: 8 or 10.

44. The DNA sequence for p or 41 containing the sequence of SEQ ID NO: 10 or 11.

45. The DNA sequence for p containing the sequence of SEQ ID NO: 110, 112 or 114.

46. The expression vector containing the DNA sequence according to any one of p-45.

47. The E. coli expression vector containing a DNA sequence according to any one of p-45.

48. The E. coli expression vector for p, which is rtto (CDP870).

49. A method of obtaining a host cell, providing for transforming cells with a vector for p-48.

50. The method of obtaining mol is coli antibody according to any one of claims 1 to 24 and 35-39, providing for the cultivation of the host cell obtained by the method according to § 49, and selection of antibody molecules.

51. The method according to item 50, in which the host-cell is E. coli.

52. The method according to § 51, in which the molecule antibodies aimed at periplasm.

53. A therapeutic composition comprising an effective amount of the antibody molecules according to any one of claims 1 to 24 or 35-39 or compound according to any one of p-31, for the treatment of diseases mediated by TNFα.

54. The antibody molecule according to any one of claims 1 to 24 or 35-39 specific to TNFα man, or a compound according to any one of p-34, for the treatment of diseases mediated by TNFα.

55. The antibody molecule or compound according to item 54 for the treatment of rheumatoid arthritis or osteoarthritis.

56. The antibody molecule according to any one of claims 1 to 24 and 35-39 specific to TNFα the person to produce medicines for the treatment of diseases mediated by TNFα.

57. The antibody according p, where pathology is a rheumatoid arthritis or osteoarthritis.

58. The expression vector pDNAbEng-G1, shown in figure 19.



 

Same patents:

FIELD: immunology, biotechnology.

SUBSTANCE: invention relates to variants of nucleic acid construct (NK-construct) encoding of MUC1 antigen based on seven full repeated VNTR-units. Variants include NK-constructs selected from group containing MUC1 based on seven full repeated VNTR-units, MUC1 based on seven full repeated VNTR-units without signal sequence, MUC1 based on seven full repeated VNTR-units without signal sequence, transmembrane and cytoplasm domains, full MUC1 based on seven full repeated VNTR-units without transmembrane and cytoplasm domains, as well as mutants of abovementioned variants, wherein at least one VNTR is mutated to reduce of glycosylation potential. Disclosed are NK-constructs additionally containing epitopes selected from group: FLSFHISNL, NLTISDVSV or NSSLEDPSTDYYQELQRDISE. Also described are variants of expressing plasmide carrying NK-construct represented as DNA, protein having anti-tumor activity, encoded with NK-construct and pharmaceutical composition with anti-tumor activity based on said protein, NK-construct or plasmide. Application of NK-construct and protein for producing of drug for treatment or prevention of MUC-1 expressing tumors; method for therapy by using NK-construct, protein, or plasmide also are disclosed.

EFFECT: NK-constructs with increased anti-tumor activity.

20 cl, 25 dwg, 5 ex

FIELD: gene engineering.

SUBSTANCE: the present innovation deals with the ways for obtaining transgenic poultry due to introducing retroviral vectors into blastodermal cells through the fissure in the shell of nonhatching egg from the side of its blunt end. With the help of insulin syringe one should introduce gene constructions for the depth of about 2-3 cm near a germinal disk. The innovation enables to simplify the procedure of introducing gene constructions into target cells at maintaining general efficiency of transgenesis that leads to the decrease of embryonic lethality.

EFFECT: higher efficiency.

FIELD: genetic engineering.

SUBSTANCE: invention relates to vectors used in genetic engineering. Invention proposes a lentiviral vector with condition-dependent replication that comprises two nucleotide sequences. The first nucleotide sequence reduces probability for formation of lentiviral vector able for replication. The second nucleotide sequence inhibits replication of lentivirus of wild type, helper virus or helper vector but it doesn't inhibit replication of dependent vectors, or it encodes proteins showing the same properties. Also, invention discloses these nucleotide sequences, method for preparing such vectors and their using. Invention can be used in medicine in prophylaxis and therapeutic treatment of viral diseases, in particular, HIV infection.

EFFECT: valuable biological properties of vectors.

45 cl, 53 dwg, 12 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to water soluble polypeptides (SEQ ID NO.12) and (SEQ ID NO.7), derived from full-length tryptophanyl-tRNA-synthetase and having angiostatic activity in relation to eye neovasculatisation. Also disclosed are polynucleotides, encoding truncated polypeptide forms (SEQ ID NO.12) and (SEQ ID NO.7), and E.coli cell, expressing abovementioned polypeptides. Said polypeptides are useful in injecting angiostatic composition and kit for inhibiting of eye neovasculatisation.

EFFECT: polypeptides having non-immunogenic angiogenic properties.

22 cl, 5 dwg, 2 tbl, 5 ex

FIELD: biotechnological methods.

SUBSTANCE: invention concerns new polynucleotides, which encode polypeptide having tripeptidylpentidase activity. To produce this polypeptide, host cell is transformed with polynucleotide or polynucleotide-containing vector and then cultured under suitable polynucleotide expression conditions.

EFFECT: enabled production of new protease from thread fungi.

14 cl, 3 tbl, 11 ex

FIELD: medicine, gene engineering, in particular production of new variants of gamma-interferon polypeptide having gamma-interferon activity.

SUBSTANCE: new polypeptide variants include S99T replacement in contrast with huIFNG amino acid sequence, may be shortened on C-end and are capable of enhancing utilization of natural N-glycosilation site in 97 place. Mutant forms of gamma-interferon containing threonine in 99 place may include from 1 to 10 modifications without losses polypeptide activity. Polypeptide is obtained by expression in host cells transformed with vector including nucleic acid encoding mutant IFNG. Conjugant of mutant with PEG is obtained by pegilation, wherein said conjugant has increased half-life time in serum and reduced immunogenicity. Obtained IFNG polypeptide is useful in pharmaceutical composition for treatment and prevention of interstitial pulmonary diseases.

EFFECT: mutant gamma-interferon with enhanced utilization of natural N-glycosilation site in 97 place in contrast with natural form of huIFNG.

43 cl, 3 dwg, 4 tbl, 11 ex

FIELD: microbiological and medicine industry, gene and protein engineering.

SUBSTANCE: disclosed is recombinant plasmide DNA pU8HBc-preS1. Said plasmide encodes chimerical protein gene of hepatitis B virus core antigen bearing pre-S1 region (27-37 a.b.) epitope of hepatitis B virus surface protein. Also disclosed is bacterium strain Escherichia coli DH5αF'/pU8HBc-preS1, bearing of such plasmide and producing hybrid protein HBc-preS1.

EFFECT: invention useful in medicine.

2 cl, 8 dwg, 3 ex

FIELD: immunotherapy, medicine.

SUBSTANCE: disclosed is fusion protein, including stress protein and HBV protein. Said protein after administration to patient indices or enhances of immune response against HBV protein. Also disclosed are nucleic acids containing such protein, pharmaceutical composition, vectors and method for protein production. Moreover disclosed are methods for inducing or enhancing of immune response against HBV protein.

EFFECT: improved composition for immune response against HBV protein.

46 cl, 17 dwg, 3 ex

FIELD: biotechnology, in particular tumor immunotherapy.

SUBSTANCE: invention relates to monovalent and divalent single-stranded (diantibody) Fv-fragments (scFv) of antibodies obtained by using of extracted RNA producing of hybridoma Mab CB/ior-CEA.1. Antibodies fragments according to the invention have predetermined amino acid sequence (such as defined in sequence list), are specific to human CEA, have CEA affinity constant of (5.0±0.4)x10-9 l/mol for monovalent fragment and (2.8±0.3)x10-10 l/mol for diantibody. Disclosed is application of abovementioned fragments in pharmaceutical compositions for treatment of human CEA-expressing tumors and determination of tumor localization in vivo. Described is modified cell expressing said antibody fragment, as well as multicellular genetically modified organism such as transgenic plant. ScFv fragments of monovalent antibody and diantibody have no Fc-domains and have smaller molecule size than mice Mab and as a result fragments are better penetrate in tissue in vivo and have less immunogenic action in living body.

EFFECT: antibody fragments with improved specificity to human cancer-embryonic antigen.

12 cl, 6 dwg, 8 tbl, 9 ex

FIELD: medicine; biology.

SUBSTANCE: method involves introducing vector containing DNA-sequence into area under protection encoding T-cadgerin and being capable of providing its expression in target tissue or cells compatible with target tissue cells transected with said vector in advance and selected with respect to T-cadgerin expression level. The method has been tested on model system by implanting Matrigel to mice. Reliable implant mass-, implant hemoglobin contents- and capillary and medium-sized blood vessel number reduction has been observed in experimental animals, receiving cells L929 (clone TC3) expressing T-cadgerin, in two weeks after the injection.

EFFECT: enhanced effectiveness in treating pathological states with new blood vessel formation being suppressed.

7 cl, 8 dwg

FIELD: immunology, biotechnology, in particular antibody modified by gene-engineering methods.

SUBSTANCE: obtained antibody contains two or more V-regions of H-chain and two or more V-regions of L-chain of monoclonal antibody and is capable of signal transduction into cells by formation of cross-linked cell surface molecule (molecules). Modifies antibody is useful as transduction signal agonist and as prophylaxis and/or treatment agent for various diseases, such as cancer, inflammation, hormonal disturbances and blood diseases. Modifies antibody also is useful in inducing of antagonistic action in relates to cells. Also disclosed are method for detection of abovementioned antibody and method for measurement of antibody antagonistic action in relates to cells.

EFFECT: antibodies of low molecular mass having antagonistic action due to cross-linking of cell surface molecule or intracell molecule.

31 cl, 96 dwg, 3 tbl, 8 ex

FIELD: biotechnology, in particular tumor immunotherapy.

SUBSTANCE: invention relates to monovalent and divalent single-stranded (diantibody) Fv-fragments (scFv) of antibodies obtained by using of extracted RNA producing of hybridoma Mab CB/ior-CEA.1. Antibodies fragments according to the invention have predetermined amino acid sequence (such as defined in sequence list), are specific to human CEA, have CEA affinity constant of (5.0±0.4)x10-9 l/mol for monovalent fragment and (2.8±0.3)x10-10 l/mol for diantibody. Disclosed is application of abovementioned fragments in pharmaceutical compositions for treatment of human CEA-expressing tumors and determination of tumor localization in vivo. Described is modified cell expressing said antibody fragment, as well as multicellular genetically modified organism such as transgenic plant. ScFv fragments of monovalent antibody and diantibody have no Fc-domains and have smaller molecule size than mice Mab and as a result fragments are better penetrate in tissue in vivo and have less immunogenic action in living body.

EFFECT: antibody fragments with improved specificity to human cancer-embryonic antigen.

12 cl, 6 dwg, 8 tbl, 9 ex

FIELD: immunology, biotechnology.

SUBSTANCE: described are rabies virus-neutralizing antibody and fragments thereof; method for treatment of subject being affected by rabies virus using said antibody and fragments thereof. Disclosed are variants of isolated nucleic acids, encoding polypeptides bearing light and/or heavy antibody strain, respectively. Disclosed is expression vector bearing at least one from abovementioned nucleic acids. The invention makes it possible to increase subject survival after rabies virus attack.

EFFECT: method for prophylaxis and treatment of rabies virus infections.

14 cl, 1 tbl, 5 ex

FIELD: biotechnology, genetic engineering, virology, medicine.

SUBSTANCE: invention reports about the construction of recombinant plasmid DNAs pCL1 and pCH1 in vitro comprising artificial genes encoding light and heavy chains of human full-scale antigen against Ebola virus prepared by genetic engineering methods and created on basis of variable fragments of recombinant antibody 4d1 light and heavy chains from phage library of human single-chain antibody, and human constant genes IgG1, cytomegalovirus promoter and polyadenylation BGH site. The combining use of plasmid DNA pCL1 and pCH1 provides the biosynthesis of human recombinant full-size antibodies of class IgG1 interacting with Ebola virus. Using recombinant full-size antibodies raised against Ebola virus can be used as a basis for the development of preparations used in diagnosis and treatment of dangerous diseases caused by this infectious agent.

EFFECT: valuable medicinal properties of plasmid.

4 cl, 7 dwg, 6 ex

FIELD: immunology, biotechnology.

SUBSTANCE: invention describes antibody and its fragments neutralizing rabies virus and a method for treatment of patient subjected for effect of rabies virus by using indicated antibody and its fragment. Invention discloses variants of isolated nucleic acids encoding polypeptides carrying light and heavy chain of antibody, respectively. Also, invention describes expressing vector carrying at least one of indicated nucleic acids. Using this invention enhances span-life of patients after effect with rabies virus on them and can be used in corresponding prophylactic therapy of such patients.

EFFECT: valuable medicinal properties of antibody and nucleic acid.

14 cl, 1 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: obtained human antibody or its antigen-binding fragment specifically binds tumor necrosis factor hTNFα. The like antibodies show high affinity relative to hTNFα in vitro and in vivo. Antibodies according to the invention are taken as a full-length antibody or its antigen-binding fragment. The antibodies or their fragments are usable for detecting hTNFα and for inhibiting hTNFα activity in human beings suffering from a disorder in the case of which hTNFα activity is harmful.

EFFECT: wide range of applications of high affinity recombinant antibodies to hTNFα or their fragments of low dissociation kinetics.

15 cl, 11 dwg, 17 tbl

FIELD: biotechnology, immunology, molecular biology, medicine, pharmacy.

SUBSTANCE: invention describes the isolated human antibody or its antigen-binding fragment able to bind the human tumor necrosis factor (TNF-α). Amino acid sequence is given in the description. Invention discloses nucleic acid encoding heavy and light chain of isolated human antibody. Nucleotide sequences are given in the description. Invention describes recombinant vector expressing variable region of heavy and light chains of isolated human antibody, Chinese hamster ovary cells CHO dhfr- carrying vector. Invention discloses a method for synthesis of isolated human antibody. The isolated human antibody or its antigen-binding fragment can be used as an active component of pharmaceutical composition used in treatment of disturbances when activity of TNF-α is harmful. Using the invention allows neutralization of effect of TNF-α in case when its activity is harmful. Invention can be used in medicine.

EFFECT: valuable medicinal properties of antibody, improved method for synthesis.

17 cl, 11 dwg, 17 tbl, 4 ex

FIELD: immunology; treatment of mediated diseases IL-1 and failures.

SUBSTANCE: bonding molecule IL-1β which is antibody to human IL-1β and especially human antibody to human IL-1β where hypervariable sections CDRs of heavy and light chains have definite amino acid sequences. Antibody may be used for treatment of mediated disease IL-1, for example osteoarthritis, osteoporosis and other inflammatory processes of bones of rheumatism or podagra nature. Constructions of deoxyribonucleic acid are described which code heavy and light chains or their fragments and expressive vectors which may be replicated in cells including deoxyribonucleic acid constructions. Method of obtaining bonding molecule IL-1β by means of cell transformed by vector is described. Proposed antibody may be used both in prophylactic and treatment of diseases.

EFFECT: enhanced efficiency.

15 cl, 3 dwg, 5 ex

FIELD: medicine, immunobiology, pharmacy.

SUBSTANCE: humanized monoclonal antibody (monAb) or its fragments comprises heavy and/or light chain with the binding rate constant with AILIM 1.0 x 103 (1/M x s) and above, and the dissociation rate constant between monAb and AILIM 1.0 x 10-3 (1/s) or less. MonAb shows also a nucleotide sequence encoding variable region of light and/or heavy chain and corresponding amino acid sequences. Invention relates to DNA and it part encoding monAb or its fragments, and vectors comprising nucleotide sequences encoding antibody or its fragments. The humanized monAb can be prepared by using a genetically recombinant host. MonAb is comprised as a component of pharmaceutical compositions used for inhibition or induction of AILIM-mediated transfer of signal into cell for induction of antibody-dependent cytotoxicity against AILIM-expressing cell and others. Invention can be effective in treatment of different autoimmune diseases associated with AILIM-mediated transfer of co-stimulating signal. Invention can be used in medicine for treatment of diseases associated with AILIM-mediated transfer of co-stimulating signal.

EFFECT: valuable medicinal properties of antibody.

75 cl, 78 dwg, 14 ex

FIELD: genetic engineering, molecular biology.

SUBSTANCE: invention proposes a method for detecting genes encoding membrane-bound transmembrane proteins. Method involves expression of the nucleic acid chimeric sequence in the cell-host consisting of DNA fragment encoding secreting protein that is able to bind antigen and DNA fragment to be tested; interaction of cells expressing the fused protein with antigen; selection of cells on surface of that indicated antigen is bound; isolation of recombinant vector containing in selected cells of DNA fragment to be tested and, if necessary, determination of its sequence. Also, invention proposes the developed vector constructions and comprising their sets designated for realization of the proposed method. Invention provides significant simplifying the screening process of libraries and cloning genes encoding transmembrane proteins. Invention can be used for detecting and preparing genes encoding any membrane-bound proteins used in different branches of science and practice.

EFFECT: improved isolating method, valuable biological properties of protein.

27 cl, 7 dwg, 1 tbl, 8 ex

FIELD: medical engineering.

SUBSTANCE: device has substrate having polymeric working layer on it, produced from copolymer based on methacrylic acid derivatives with biological macromolecules (probes) immobilized thereon. The substrate is manufactured from activated or not activated glass, metal or polymer material. The working layer has macroporous monolithic copolymer glycidyl methacrylate and ethylene glycol methacrylate taken in (50:70)-(50:30) proportions by mass with affine biological probes immobilized thereon. Probe-copolymer proportion is 2-10 mg/g of copolymer, for protein, 1-20 mg/g of copolymer for peptide and for oligonucleotide, nucleic acid - 0.5-3 mg/g of copolymer, pore radius of 0.4-1.5 mcm, it has thickness of 50-700 microns and is manufactured as continuous or discrete microcellular layer. The method for manufacturing biochip involves preparing substrate, producing working layer by monomer copolymerization on methacrylic acid derivatives base, immobilizing biological macromolecules - probes on forming copolymer, washing, drying the received biochip. Radical copolymerization of glycidyl methacrylate and ethylene glycol methacrylate taken in (50:70)-(50:30) proportions by mass is carried out for producing working layer with photo-or thermal initiation in poregenic solvent medium being applied. Proportion of the sum of monomer volumes to solvent volume being equal to 6:9, initiator concentration in reactionary medium being equal to 0.2-1.0% by weight, given reaction mixture is placed on substrate as continuous or discrete layer. Macroporous monolithic continuous or discrete microcellular layer is formed as a result of copolymerization on the substrate. Then, covalent immobilization of biological macromolecules is carried out in the layer pores or their direct synthesis on formed copolymer with its native or modified epoxy groups being used. Biological affine probe is produced. The probe is introduced into copolymer in quantity of 2-10 mg/g of copolymer for fiber, for peptide - 1-20 mg/g of copolymer and for oligonucleotide or nucleic acid - 0.5-3 mg/g of copolymer.

EFFECT: manufacturing reusable biochip with predetermined controllable and reproduced quality.

17 cl

Up!