Muc1 antigen with reduced number of repeated vntr-units

FIELD: immunology, biotechnology.

SUBSTANCE: invention relates to variants of nucleic acid construct (NK-construct) encoding of MUC1 antigen based on seven full repeated VNTR-units. Variants include NK-constructs selected from group containing MUC1 based on seven full repeated VNTR-units, MUC1 based on seven full repeated VNTR-units without signal sequence, MUC1 based on seven full repeated VNTR-units without signal sequence, transmembrane and cytoplasm domains, full MUC1 based on seven full repeated VNTR-units without transmembrane and cytoplasm domains, as well as mutants of abovementioned variants, wherein at least one VNTR is mutated to reduce of glycosylation potential. Disclosed are NK-constructs additionally containing epitopes selected from group: FLSFHISNL, NLTISDVSV or NSSLEDPSTDYYQELQRDISE. Also described are variants of expressing plasmide carrying NK-construct represented as DNA, protein having anti-tumor activity, encoded with NK-construct and pharmaceutical composition with anti-tumor activity based on said protein, NK-construct or plasmide. Application of NK-construct and protein for producing of drug for treatment or prevention of MUC-1 expressing tumors; method for therapy by using NK-construct, protein, or plasmide also are disclosed.

EFFECT: NK-constructs with increased anti-tumor activity.

20 cl, 25 dwg, 5 ex

 

The present invention relates to new nukleinovokisly constructs useful in vaccination protocols nucleic acid for the treatment and prevention of tumors expressing MUC1. In particular, the nucleic acid is a DNA, and DNA constructs containing the gene encoding MUC1 derived with less than 10 fully repeating blocks. This invention additionally provides pharmaceutical compositions containing the above-mentioned constructs, in particular pharmaceutical composition, adapted for delivery via particles, methods for their preparation and their use in medicine. Also proposed new proteins encoded by this nucleic acid, and pharmaceutical compositions containing them.

Prior art

The epithelial mucin MUC1 cells (also known as episialin or polymorphic epithelial mucin, REM) is a high molecular weight glycoprotein expressed in many epithelial cells. This protein consists of a cytoplasmic tail, transmembrane domain, and a variable number of tandem repeats of the motif of the 20 amino acids (called here VNTR-monomer, it can also be known as VNTR-epitope or VNTR-repeat), with a large proportion of residues of Proline, serine and threonine. The number of repeats varies from GE is micheskogo polymorphism in locus MUC1 and often is in the range of 30-100 (Swallow et al., 1987, Nature 328:82-84). In normal epithelium of ducts MUC1 protein found only on the apical surface of the cells facing the lumen of the duct (Graham et al., 1996, Cancer Immunol Immunother 42:71-80; Barratt-Boyes et al., 1996, Cancer Immunol Immunother 43:142-151). One of the most striking properties of the molecule MUC1 is its extensive glycosylation on the oxygen atoms. There are five proposed sites for glycosylation of oxygen available within each VNTR-monomer MUC1. In accordance with the following numbering system, they are Thr-4, Ser-10, Thr-11, Thr-19 and Ser-20.

VNTR can be characterized as typical or full repeats with the sequence shown below, or minor deviations from this full repeat containing two or three differences to 20 amino acids.

The following represents the sequence of the full repeat:

The underlined amino acids can be replaced by amino acid residues shown.

Incomplete repetitions have different amino acid substitutions in the consensus sequence with identity 55-90% at the amino acid level. Four partial repeat is shown below, and replace the underlined:

Incomplete repeats in wild-type MUC1 flank the area is full of repetitions. In malignant carcinomas arising from neoplastic Tr is nformatio these epithelial cells, several changes affect the expression of MUC1. Polarized expression of the protein is lost, and is found distributed throughout the surface of transformed cells. The total number of MUC1 also increased, often 10 times or more than 10 times (Strous&Dekker, 1992, Crit Rev Biochem Mol Biol 27:57-92). Most important, significantly changing the quantity and quality of the attached oxygen hydrocarbon chains. Glycosylated less residues serine and threonine. The hydrocarbon chains, which are abnormal shortened, that creates a tumor-associated carbohydrate antigen STn (Lloyd et al., 1996, J Biol Chem, 271:33325-33334). As a result of these changes in glycosylation of different epitopes on MUC1 peptide chain, which previously screened carbohydrate chains are available. One of the epitopes, which becomes available in this way is formed by a sequence APDTR (Ala 8 - Arg 12 figure 2)present in each fully repeating monomer VNTR, consisting of 20 amino acids (Burchell et al., 1989, IntJ Cancer 44:691-696).

Obviously, these changes in MUC1 mean that the vaccine, which can activate the immune system against this form of MUC1 expressed in tumors, can be effective against tumors of the epithelial cells and, indeed, of other types of cells, which are found MUC1, such as T-cell lymphocytes. One of the main effect the mechanisms, used by the immune system to destroy cells expressing abnormal proteins, is the immune response of cytotoxic T-lymphocytes, and the response desired in the vaccine for the treatment of tumors as well as or antibody-based test response. A good vaccine should enable all parties of the immune response. However, the existing carbohydrate and peptide vaccines such as Theratope or BLP25 (Biomira Inc., Edmonton, Canada), preferably activate one side of the immune response - humoral and cellular response, respectively, and to generate a more balanced response more desirable good design vaccines.

Nukleinovokisly vaccines offer many advantages over the conventional vaccination proteins in that they are easy to obtain in large quantities. It was reported that even at low doses, they induce strong immune responses and can induce immune response of cytotoxic T-lymphocytes or antibody-based test and answer.

With a full MUC1, however, very difficult to work because of the highly repetitive sequences, because it is more prone to recombination, and such cases recombination cause significant difficulties in biopharmaceutical development. Additionally, the enrichment of VNTR-OS-pairs makes sequencing. Next, for legal reasons it is necessary for the ability to characterize the DNA construct. Very problematic to be sequenced molecule with the structure having such a high frequency of repetition. In such a situation it is unknown exactly how many recurring units present in wild-type MUC1, and this inability to accurately characterize full-MUC1 makes it unacceptable for legal approval.

It is considered that the VNTR region MUC1 contain immunodominant epitopes. Surprisingly, these inventors have found that it is possible to reduce the number of VNTR obtaining immunogenic construct, which is equivalent antitumor activity when compared with full-MUC1 wild type. The construct of the present invention is stable. In particular, these constructs are stable in terms of growth characteristics, retention plasmids and quality of the plasmid when grown in cultures of E.Coli within 9 subcultures, each with a duration of 10-14 hours.

Brief description of the invention

The present invention provides nukleinovokisly sequence encoding the antigen MUC1, which is able to induce an immune response in vivo and is stable and has a reduced susceptibility to recombination in comparison with full-MUC1. Stability is a measure of the number of plasmids in a certain form. It is preferable that the pollution recombinogenic form after krupnomas the aqueous cultivation is less than 2.0% when determining on an agarose or polyacrylamide gel with visualization by eye. Large-scale in typical cases means growing in scale greater than one liter. A separate measure of stability is the fact that a copy plasmids remained stable during the period of re-seeding. Preferably, the number of copies of the plasmid increases with the number of transfers, especially from replanting 1 to reseeding 9. Preferably, the number of copies of the plasmid increases by about 10%, 20%, 30%, 35%, 40%, most preferably about 50%, for 9 re-seeding. In specific embodiments, this invention provides constructs having from 1 to 15, preferably between 1 and 10, full of VNTR repeats blocks. It is preferable that there is less than 8 full repeats. The preferred embodiment offers DNA constructs with one, two, three, four, five, six and seven repetitions, respectively. In certain embodiments of this invention, the region of incomplete replay saved. Preferred are constructs containing one or seven full repetitions. Proteins encoded by these constructs are new and form an aspect of this invention.

In another aspect of this invention nukleinovokisly sequence is a DNA sequence in the form of plasmids. Preferably, the plasmid is supercoiled.

In another aspect of this invention offered by pharmac viteska composition, containing nukleinovokisly the sequence of which is disclosed here, and pharmaceutically acceptable excipient, diluent or carrier.

Preferably, the carrier is a grain of gold, and the pharmaceutical composition can be delivered by delivery of drugs through the particles.

And in yet another additional embodiment of this invention provides a pharmaceutical composition and nukleinovokisly constructs for use in medicine. In particular, the proposed nukleinovokisly construct according to this invention in the manufacture of medicaments for use in the treatment or prevention of tumors expressing MUC1.

This invention additionally provides methods of treatment of a patient suffering from or susceptible to tumors expressing MUC1, especially from carcinoma of the breast, lung, ovarian, prostate (especially non-small cell lung carcinoma), stomach and other gastrointestinal sites, the introduction of safe and effective amount of a composition or nucleic acids, which are described here.

And in yet another additional embodiment of this invention provides a method of obtaining a pharmaceutical composition, which is described here, the mixing nukleinovokisly construct or protein according to this invention with pharmaceutically acceptable ek is sapientum, diluent or carrier.

Detailed description of the invention

As described here, nukleinovokisly constructs according to this invention typically have less than 15, more typically less than 10 full repetitions. The MUC1 molecule wild type (see Figure 1) contains a signal sequence, leader sequence, incomplete or atypical VNTR, the VNTR region is full, additional atypical VNTR, extracellular domain, not related to VNTR, transmembrane domain and cytoplasmic domain.

Preferred embodiments of this invention have less than 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 replays. Particularly preferred constructs have 1, 2 or 7 full repetitions.

The extracellular domain is not related to VNTR consists of approximately 80 amino acids from the 5'end of the VNTR and 190-200 amino acids from the 3'-end of the VNTR. All constructs according to this invention contain at least one epitope of this area. The epitope is typically formed by a sequence of at least seven amino acids. Accordingly, the constructs of the present invention include at least one epitope of the extracellular domain that is not related to the VNTR. Preferably, they include essentially all or, more preferably, all of the domains that are not related to the VNTR. Especially preferred is the fact that this construct sod is RIT at least one epitope contained in the sequence FLSFHISNL, NSSLEDPSTDYYQELQRDISE or NLTISDVSV. More preferred is that the construct is incorporated two, preferably three, epitope sequence.

In the preferred embodiment of the constructs containing N-terminal leader sequence. Signal sequence, transmembrane domain and cytoplasmic domain, individually, are optional in the construct. All of them can be present or one or more than one of them can be excluded.

Preferred constructs in accordance with this invention are:

1) 7 MUC1 VNTR (i.e. full Mis1 only 7 full repetitions);

2) 7 MUC1 VNTR Δss (same as 1, but also devoid of the signal sequence);

3) 7 MUC1 VNTR ΔTM ΔCYT (same as 1, but lacking the transmembrane and cytoplasmic domains);

4) 7 MUC1 VNTR Δss ΔTM ΔCYT (the same as 3, but also devoid of the signal sequence).

Also preferred are constructs that are equivalent to the above 1 to 4, but containing only 2 VNTR or 1 VNTR. VNTR in such constructs have the full sequence repeat, what is described here previously. In one embodiments, one or more than one of the VNTR-blocks motivovany to reduce potential glycosylation change plot gli is atilirovanie. This mutation is a preferable replacement, but may be an insertion or a deletion. In typical cases, at least one threonine or serine is replaced with valine, isoleucine, alanine, asparagine, phenylalanine or tryptophan. In the monomer VNTR wild-type features 5 alleged sites of glycosylation on the oxygen available within each VNTR-monomer MUC1. They are (see numbers) Thr-4, Ser-10, Thr-11, Thr-19 and Ser-20. Thus, it is preferable that at least one, preferably 2 or 3, or more than three, preferably at least four, the remainder of the replaced amino acid, as noted above.

Preferred substitutions include:

Thr 4 → Val

Ser 10 → Ala

Thr 11 → lle or Val

Thr 19 → Val

Ser 20 → Ala

In yet another embodiment of the constructs MUC1 provided nukleinovokisly sequence that encodes a heterologous T-cell epitope. Such epitopes include T-cell epitopes of bacterial proteins and toxins, such as tetanus and diphtheria toxins, such as epitopes P2 and P30 of tetanus toxin. Such epitopes can be part of a longer sequence. These epitopes can be incorporated in the molecule of nucleic acid at the 3' - or 5'-end sequence in accordance with this invention.

You can be in the control of other partners in the merger, such as those that originate from crustal antigen hepatitis b or tuberculosis. In one of the embodiments of the partner in the merger comes from Mycobacterium tuberculosis, RA12, subsequence MTWA (amino acids 192 to 323) (Skeiky et al., Infection and Immunity (1999) 67:3998-4007).

Other immunological partners merger include, for example, protein D from Haemophilus influenzae (WO 91/18926) or part (in typical cases C-terminal part) LYTA from Streptococcus pneumoniae (Biotechnology 10:795-798, 1992).

In accordance with another aspect of this invention offered expression vector that contains a polynucleotide sequence in accordance with this invention and capable of directing its expression. This vector may be appropriate to control the expression of heterologous DNA in the cells of bacteria, insect or mammal, particularly human cells.

In accordance with another aspect of this invention offered the host cell containing the polynucleotide sequence in accordance with this invention or the expression vector according to this invention. These host cells can be bacterial, such as E. coli, mammalian cells such as human, or can be cells of an insect. Mammalian cells containing the vector in accordance with the present invention can be cells to the cult of the re, transfitsirovannykh in vitro or can be transfitsirovannykh in vivo by introduction of the vector to the mammal.

The present invention additionally provides a pharmaceutical composition comprising a polynucleotide sequence in accordance with this invention. Preferably, this composition contains a DNA vector. In the preferred embodiment, the composition contains a collection of particles, preferably gold particles coated with DNA containing a vector encoding polynucleotide sequence according to this invention, and this sequence encodes the amino acid sequence of MUC1, which is described here. In alternative embodiments, the composition comprises a pharmaceutically acceptable excipient and a DNA vector in accordance with the present invention.

The composition may also include adjuvant or be introduced either simultaneously or sequentially with an adjuvant or immunostimulatory agent.

Thus, in this embodiment of this invention, the vectors of this invention must be used with an immunostimulating agent. Preferably, this immunostimulating agent is injected at the same time as nukleinovokisly vector according to this invention, and in preferred embodiments they are a member of the drug together. Such immunostimulatory agents is s include (but this list is by no means exhaustive and does not exclude other agents): synthetic imidazoquinolines, such as imiquimod [S-26308, R-837], (Harrison, et al. Reduction of recurrent HSV disease using imiquimod alone or combined with glycoprotein vaccine', Vaccine 19:1820-1826, (2001)); and resiquimod [S-28463, R-848] (Vasilakos, et al. "Adjuvant activites of immune response modifier R-84 8: Comparison with CpG one5, Cellular Immunology 204:64-74 (2000)), chiffony the base of CARBONYLS and amines, which are constitutively expressed on the surfaces of antigen-presenting cells and T-cells, such as tucaresol (Rhodes, J. et al. "Therapeutic potentiation of the immune system by costimulatory Schiff-base-forming drugs. Nature 377:71-75 (1995)), cytokine, chemokine and co-stimulating molecules as protein and peptide, which should include proinflammatory cytokines, such as interferons, in particular interferon and GM-CSF, IL-1a, IL-1p, TGFα and TGFβTM-inducers, such as interferon, IL-2, IL-12, IL-15, IL-18 and IL-21, Th2 dysbalance-inducers such as IL-4, IL-5, IL-6, IL-10 and IL-13, and other genes chemokines and costimulation, such as MCP-1, MIP-1α, MIP-1β, RANTES, TCA-3, CD80, CD86 and CD40L, other immunostimulatory targeting ligands such as CTLA-4 and L-selectin, proteins and peptides that stimulate apoptos, such as Fas, (49), adjuvants on the basis of synthetic lipids, such as Vaxfectin (Reyes et al., "Vaxfectin enhances antigen specific antibody titres and maintains Th1 type immune responses to plasmid DNA immunization". Vaccine 19; 3778-3786), squalene, α-tocopherol, Polysorbate 80, DOPC and cholesterol, endotoxin [LPS], Beutler, B., Endotoxin, Toll-like receptor 4, and the afferent limb of innate immunity'. Current Opinion in Microbiology 3:23-30 (2000)); oligo -, and e is the CpG nucleotides, Sato, Y. et al., "Immunostimulatory DNA sequences necessary for effective intradermal gene immunization". Science 273 (5273):352-354 (1996). Hemmi, H. et al., "A Toll-like receptor recognizes bacterial DNA", Nature 408:740-745, (2000), and other potential ligands, which include Toll-receptors for the production of Th1-inducing cytokines, such as synthetic mycobacterial lipoproteins, mycobacterial protein P19, peptidoglycan, tachieva acid and lipid A. Other bacterial immunostimulatory proteins include cholera toxin, the toxin of E. coli and mutant toxoid.

Specific preferred adjuvants to induce a predominantly Th1 response-type include, for example, a derivative of Lipid A, such as monophosphoryl lipid A, or, preferably, 3-des-O-acylated monophosphoryl lipid A. Adjuvants MPL® available from Corixa Corporation (Seattle, WA; see, for example, U.S. Patent No. 4436727; 4877611; 4866034 and 4912094). CpG-containing oligonucleotides (in which the CpG dinucleotide is not methylated) also induce a predominantly Th1 response. Such oligonucleotides are well known and disclosed, for example, in WO 96/02555, WO 99/33488 and U.S. Patent No. 6008200 and 5856462. Immunostimulatory DNA sequences are also described, for example, Sato et al., Science 275:352, 1996. Another preferred adjuvant contains saponin, such as Quil a or its derivatives, including QS21 and QS7 (Aquila BioPharmaceuticals Inc., Framingharn, MA); Escin, Digitonin; or Gypsophila saponins and and Chenopodium quinoa.

Also proposed the use of polynucleotide or protein in accordance with this invention or a vector according to this invention in the treatment or prevention of a tumor or metastasis, expressing MUC1.

The present invention also provides methods of treating or preventing tumors expressing MUC1, any symptoms or diseases associated with them, including metastases, and when these methods introduce an effective amount of polynucleotide, vector or pharmaceutical composition in accordance with this invention. Introduction the pharmaceutical compositions may take the form of one or more than one of individual doses, for example in the mode of therapeutic vaccination primary vaccination - supporting vaccination". In certain cases, the primary vaccination" can be implemented mediated by particles for DNA delivery delivery polynucleotide in accordance with the present invention, preferably incorporated in the produced from a plasmid vector, and "supporting vaccination can be carried out by introduction of a recombinant viral vector containing the same polynucleotide sequence, or the implementation supports the vaccine protein in Freund. Or primary vaccination can be carried out virus is the first vector or protein drug, in typical cases, the protein preparation is made with the adjuvant, and supports DNA vaccine of the present invention.

As discussed above, the present invention includes expression vectors, which contain the nucleotide sequence of this invention. In the field of molecular biology such expression vectors construct a routine way, and it may, for example, include the use of plasmid DNA and appropriate initiators, promoters, enhancers and other elements, such as, for example, polyadenylation signals, which may be necessary and which are positioned in the correct orientation to make possible the expression of the protein. Other suitable vectors should be obvious to specialists. For additional examples in this regard, reference is made to Sambrook et al. Molecular Cloning: a Laboratory Manual. 2nd Edition. CSH Laboratory Press, (1989).

Preferably, polynucleotide according to this invention or for use in this invention in the vector is a healthy way connected with the control sequence, which is capable of expression of the coding sequence of the host cell, i.e. the vector is an expression vector. The term "healthy way associated" refers to juxtaposition, which describes the components of the local who are in a relationship, allowing them to function in the intended way. Regulatory sequence such as a promoter, healthy way associated with the coding sequence is positioned in such a way that it reaches the expression of the coding sequence under conditions compatible with the regulatory sequence.

The vectors may be, for example, plasmids, artificial chromosomes (e.g., YOU, PAC, YAC), virus or phage vectors provided with zero points replication, possibly by the promoter for the expression of polynucleotide and possible regulator of the promoter. The vectors may contain one or more than one breeding marker genes such as the gene for resistance to ampicillin or kanamycin in the case of bacterial plasmids or gene of resistance to fungal vector. Vectors can be used in vitro, for example for the production of DNA or RNA used for transfection or transformation of the host cell, for example, the host cell of the mammal, for example, for the production of protein encoded by the vector. Vectors can also be adapted for use in vivo, for example, in the way that DNA vaccination or gene therapy.

Promoters and other signals regulating the expression can be chosen to be compatible with the host cell for which expression is. Nab is emer, the mammalian promoters include the promoter of metallothionein, which can be induced in response to heavy metals such as cadmium, and promoter β-actin. You can also use viral promoters such as the promoter of the large T-antigen SV40 immediate early (immediate early, IE) promoter, cytomegalovirus (CMV) human promoter of the long terminal repeats (LTR) of the rous sarcoma virus, the promoter of the adenovirus or the promoter of human papillomavirus (HPV), especially the upstream regulatory region of HPV (URR). All these promoters are well described and easily accessible in this area of technology.

The preferred promoter element is the immediate early CMV promoter without intron A, but includes exon 1. Accordingly, a vector containing polynucleotide according to this invention under the control of the IE-HCMV promoter.

Examples of suitable viral vectors include viral vectors, representing the herpes simplex virus, vaccinia virus, alpha virus vectors and retroviruses, including lentiviruses, adenoviruses and adeno-associated viruses. Methods of gene transfer using these viruses known to specialists. Retroviral vectors, for example, can be used for stable integration of polynucleotide according to this invention in the host genome, although recombination is preferred. Defective replication of adenoviral vectors, in contrast, remain episomal and therefore make possible a transient expression. Vectors capable of driving expression in insect cells (for example, baculovirus vectors), in human cells or in bacteria, can be used to obtain some amount of HIV protein encoded by polynucleotide of the present invention, for example, for use as subunit vaccines or immune assays. Polynucleotide according to this invention have particular application in viral vaccines, because previous attempts to generate a full-sized constructs of vaccinia virus were unsuccessful.

Polynucleotide in accordance with this invention have application in the production of the encoded protein expression, which may take place in vitro, in vivo or ex vivo. Therefore, these nucleotides can be involved in the synthesis of recombinant proteins, for example, to increase the output of or in essence, they may find use as therapeutic agents of a kind used in the methods of DNA vaccination. In cases where polynucleotide of the present invention is used in obtaining the encoded proteins in vitro or ex vivo cells, such as cells in culture, we need to modify the include polynucleotide be ekspressirovali. Such to EDI include unstable or preferably a stable cell line of a mammal. Specific examples of cells that can be modified by inserting vectors encoding the polypeptide in accordance with this invention include mammalian cells NEXT, Cho, HeLa, 293, and COS. Preferably, the selected cell line should be such, which is not only stable, but also allows full glycosylation of the polypeptide and its expression on the cell surface. Expression can be achieved in transformed oocytes. The polypeptide can be Express with polynucleotide of the present invention in cells of the transgenic animal, which is not a person, preferably a mouse. Transgenic animal, which is not the person expressing the polypeptide with polynucleotide according to this invention, included in the scope of this invention.

This invention provides another method of vaccination of a mammal subject, and he administered an effective amount of such a vaccine, or vaccine composition. It is most preferable that the expression vectors for use in DNA vaccines, vaccine compositions and immunotherapy tools should be plasmid vectors.

DNA vaccines can be administered in the form of "naked DNA", for example, in the liquid drug is injected using a syringe or a high pressure stream, or in the form DNA, introduced in status is in liposomes or irritating agent for improving transfection, or delivery of DNA using particle mediated DNA delivery PMDD). All of these delivery systems are well known in this field. The vector can be embedded to a mammal, for example, delivery system, representing a viral vector.

The compositions of the present invention can be delivered in a number of ways, such as intramuscular, subcutaneous, intraperitoneal or intravenous.

In a preferred embodiment the composition is delivered into the skin. In particular, the composition is delivered by methods of introducing the gene gun (especially the bombardment of particles), which cause the vector to the pellet (e.g., gold), which is then injected under high pressure into the epidermis, for example, as described in Haynes et al., J Biotechnology 44:37-42 (1996).

In one illustrative example, the acceleration of particles under the action of gas can be achieved by devices such as those manufactured by Powderject Pharmaceuticals PLC (Oxford, UK) and Powderject Vaccines Inc. (Madison, W1), some examples of which are described in U.S. Patent No. 5846796, 6010478, 5865796, 5584807 and in European Patent No. 0500799. This approach makes possible the delivery without the use of needles, and the preparation of microscopic particles, such as a polynucleotide that represents a dry powder, accelerate to a high speed stream of helium gas, which generate a device held in the hand, introducing these particles in the target tissue is ü, of interest, in typical cases in the skin. These particles are preferably granules of gold with a diameter of 0.4 to 4.0 μm, more preferably from 0.6 to 2.0 μm, coated with the conjugate DNA, which conclude in a cartridge or cassette to be placed in a "gene gun."

In a related embodiment, other devices and methods that may be useful for injection compositions of the present invention under the action of gas and without needles, include those which supplies Bioject, Inc. (Portland, OR), some examples of which are described in U.S. Patents№№ 4790824, 5064413, 5312335, 5383851, 5399163, 5520639 and 5993412.

The vectors containing the nucleotide sequence encoding the antigenic peptide is administered in such quantity that should be prophylactically or therapeutically effective. The number of nucleotide on the dose for injection is, in General, in the range from one PG to 1 milligram, preferably from 1 PG to 10 micrograms for delivery via particles and from 10 micrograms to 1 milligram for other paths. The exact number can vary significantly depending on the weight of the patient, which are subjected to immunization, and route of administration.

You can enter immunogenic component containing the nucleotide sequence encoding the antigenic peptide, one or more times, e.g. the R from 1 to 7 times, preferably between 1 and 4 times, at intervals of between about 1 day and about 18 months. But again, this mode of treatment should significantly vary depending on the size of the patient, the disease from which treat/protect, the number of input nucleotide sequence of route of administration and other factors that should be obvious to skilled practitioners of the medic. The patient may receive one or more than one of the other anticancer drugs as part of their overall treatment.

Suitable methods for the introduction of naked polynucleotide or vector into the patient also include the local application with the appropriate media. Nucleic acid can enter the local way on the skin or on the mucous surface, for example by introduction into the nose, through the mouth, vagina or rectum. Naked polynucleotide or vector can be given together with a pharmaceutically acceptable excipient, such as phosphate buffered saline (phosphate buffered saline, PBS). The uptake of DNA can additionally help promoting agents, such as bupivacaine, either individually or when DNA preparation. Other methods of introducing nucleic acids directly to the recipient include ultrasound, electrical stimulation, electroporation and micropose, which is described in the Patent school is 5697901.

The absorption of the nucleic acid constructs can be facilitated several known transfection methods, such as those that include the use of transfection agents. Examples of these agents include cationic agents, such as calcium phosphate, DEAE-dextran, and lipofectin, such as lipofectin and transfected. The dosage of the nucleic acid for introduction you can modify.

Nukleinovokisly sequence of the present invention can also enter the transformed cells. Such cells include cells derived from the subject. Naked polynucleotide or vector of the present invention can be introductionat in these cells in vitro, and these transformed cells can later return to the subject. Polynucleotide according to this invention can be incorporated into nucleic acid already present in the cell, in the event, representing homologous recombination. Transformed cells can, if desired, to grow in vitro, and one or more than one of the resulting cells can be used in this invention. Cells can be delivered to the proper place in the patient's well-known surgical or microsurgical techniques (for example, transplantation, microinjection, and so on).

Examples

1.1 Generation of constructs

the J. correlations between all constructs, detailed below, can be found in figure 1.

1.2 Construction of expression cassettes full-size MUC1

The starting point for the design of the cassette expression of MUC1 was plasmid pcDNA3-FL-MUC1 (ICRF, London). This plasmid has the skeleton of pcDNA3 (Invitrogen)containing cDNA-new full-size cassette MUC1 (FL-MUC1), cloned in the BamHI site. On the basis of restriction mapping performed in the ICRF, MUC1 gene is approximately 32 block VNTR (variable number of tandem repeats). The presence of MUC1 confirmed fluorescent sequencing using primers 2004MUC1-2014MUC1 (Appendix a). The sequence of MUC1, which is based on the sequence FL-MUC1 shown in figure 2. In the first stage of this method of cloning BamHI fragment containing the cDNA first sequence of the full-MUC1 isolated and cloned into the BamHI-site of the expression vector pcDNA3.1(+)/Hygro (Invitrogen), generating plasmid JNW278. The correct orientation of the fragment relative to the CMV promoter was confirmed by PCR and fluorescent sequencing.

In the next stage of cloning deleted the 3'-untranslated region (UTRs) and replaced the improved sites for restriction enzymes to facilitate future cloning procedures. The MUC1 fragment amplified in PCR with primers 2062MUC1 and 2063MUC1 (Appendix a) when using JNW278 as matrix and p is has Dorgali restriction when using BstXI and Xhol. In parallel, the plasmid JNW278 were subjected to restriction analysis using BstXI and Xhol. Purified vector skeleton ligated with PCR-fragment, generating plasmid JNW314. Restriction analysis and fluorescent sequencing confirmed the presence of the correct fragment.

In parallel deleted the 5'-UTR was replaced with an optimal Kozak sequence and improved sites for restriction enzymes. JNW278 subjected to the action of restricts Nhel and Xhol, removing the entire cDNA sequence of MUC1. The MUC1 fragment amplified in PCR with PCR primers 2060MUC1 and 2061 MUC1 (Appendix a), were subjected to restriction analysis by restrictase Nhel and Xhol and ligated into the skeleton of the vector, generating plasmid JNW294.

The next phase of the clone was subjected JNW294 action restrictase BsaMI, releasing two fragments (approximately 2.3 thousand base pairs and 3.2 thousand base pairs). The larger of the two fragments (Fragment A) was isolated and purified. In parallel subjected JNW314 action restrictase BsaMI and the larger of the two fragments (Fragment size of approximately 7 thousand base pairs), isolated and purified. Fragments and ligated together, generating plasmid JNW340. Correct orientation confirmed by restriction mapping using Nhe-Xhol and, separately, Xbal.

At the final stage of the cloning of the expression cassette isolated from JNW340 split is eaten with restrictase Nhel and Xhol, releasing a fragment of approximately 4 thousand base pairs. Expression plasmid pVAC1 (Thomson Immunology 95: R, 1998) was subjected to the action of restricts Nhel and Xhol and ligated with cassette MUC1, generating plasmid JNW358 for the expression of full-MUC1. The correct orientation of the MUC1 sequence relative to the CMV promoter confirmed by restriction cleavage and fluorescent sequencing. The sequence of the cassette in the expression of MUC1 is shown in Figure 3.

1.3 Design vector MUC1 containing one VNTR-block

The starting point for the design of the cassette for the expression of MUC1 containing one VNTR-block is JNW278. The unique property of DNA sequences with a high number of VNTR repeats is the presence of a site for restrictase Fsel in each of the repeating units. JNW278 were subjected to full restriction cleavage using Fsel, the skeleton of the vector was isolated and ligated again, generating plasmid JNW283. The presence of a single VNTR-block confirmed by restriction analysis, PCR and fluorescent sequencing. The sequence of MUC1 in JNW283 shown in figure 2.

1.4 Construction of vector for expression of MUC1 containing one VNTR-block

To transfer cassettes MUC1 containing one VNTR-block, JNW283 in the expression plasmid pVAC was carried out following the stage of cloning. In the first stage to the onirovaniya deleted the 5'- and 3'-untranslated region (UTRs) and replaces them with superior sites for restriction enzymes to facilitate future cloning procedures. The MUC1 fragment amplified in PCR with primers 2060MUC1 and 2062MUC1 when using JNW283 as a matrix and subjected to the action of restricts Nhel and Xhol. In parallel, the plasmid pVAC were subjected to restriction analysis using Nhel and Xhol. The cleaned skeleton vector ligated with PCR-fragment, generating plasmid JNW322. Restriction analysis and fluorescent sequencing confirmed the presence of the correct fragment.

1.5 Design of the cassette MUC1 containing a small number of VNTR-blocks

The starting point for the design of the cassette for the expression of MUC1 containing a small number of VNTR-blocks is JNW283, which was linearizable when using Fsel. Generated VNTR-blocks partial cleavage of the plasmid JNW278 the restriction enzyme Fsel with the release of a series of short fragments with sizes ranging from 60 base pairs (the equivalent of one VNTR-block) to approximately 420 base pairs, which corresponds to seven VNTR-blocks. A series of VNTR fragments generated by partial cleavage JNW278 shown in Fig.7. Fragment sizes of 60-500 base pairs was purified by gel extraction and ligated with Fsel-linearized JNW283. First clones were subjected to PCR screening using primers 2005MUC1 and 2013MUC1 that is positioned 5'and 3'sides, respectively, VNTR-region sequence of MUC1. PCR was set up so that the clones that contained the centre of the public VNTR-blocks, gave PCR fragments, larger than the PCR fragments corresponding to one VNTR-block sequence JNW283. PCR-positive clones were subjected to additional analysis of restriction cleavage and fluorescent sequencing to confirm the number present VNTR-blocks. When using this Protocol have received a lot of different plasmids, including JNW319, which has a total of seven VNTR-blocks, and JNW321, which has two VNTR-block. Sequence JNW319 and JNW321 shown in Figure 4 and 5. VNTR-blocks in JNW319 exhibit polymorphisms that are present in the wider population (indicated by asterisks).

1.6 Construction of vector for expression of MUC1 containing seven VNTR-blocks

To transfer cassettes MUC1 containing seven VNTR-blocks, in the expression plasmid pVAC was carried out following the stage of cloning. At the first stage of cloning deleted the 3'-untranslated region (UTRs) and replaced it improved sites for restriction enzymes to facilitate future cloning procedures. The MUC1 fragment amplified in PCR with primers 2062MUC1 and 2063MUC1 when using JNW278 as a matrix and subjected to the action of restricts BstXI and Xhol. In parallel, the plasmid JNW319 subjected to the action of restricts BstXI and Xhol. The cleaned skeleton vector ligated with PCR-fragment, generating plasmid JNW622. Restriction Ana is from and fluorescent sequencing confirmed the presence of the correct fragment.

The next phase of the clone was subjected JNW294 restriction when using BsaMI, releasing two fragments (approximately 2.3 thousand base pairs and 3.2 thousand base pairs). The larger of the two fragments (Fragment A) was isolated and purified. In parallel subjected JNW622 action restrictase BsaMI and the larger of the two fragments (Fragment With a size of approximately 4 thousand base pairs), isolated and purified. Fragments and ligated together, generating plasmid JNW640. Correct orientation confirmed by restriction mapping using Xbal and fluorescent sequencing. At the final stage of the cloning cassette of MUC1 JNW640 insulated with subsequent processing restrictase Nhel and Xhol and ligated with pVAC (also linearized by restrictase Nhel and Xhol), generating plasmid JNW656. The sequence of the cassette for the expression of MUC1 confirmed fluorescent sequencing, and it is shown in Fig.6.

1.7 Cleaning VNTR-blocks

After splitting JNW278 (FL-MUC1) restriction enzyme Fsel released a series of VNTR in the range from 60 base pairs (the equivalent of one VNTR-block) to 420 base pairs (equivalent to seven VNTR-blocks). After electrophoresis insulated these fragments from agarose gel and purified them. Fig shows two series of VNTR-blocks. DNA markers are shown in lanes a and D. the Track shows a series representing VNTR-nl the Ki in the range of 60-240 base pairs. The track shows a series representing VNTR-blocks in the range of 180-420 base pairs. These fragments are then ligated into Fsel-linearized JNW283 to build gene MUC1 containing 2 and 7 VNTR-blocks. Similarly you can get other constructs containing 3, 4, 5 or 6 VNTR-blocks (see Fig.7).

2. Getting constructs for cutaneous immunization gene gun

Plasmid DNA precipitiously granules of gold with a diameter of 2 μm with the use of calcium chloride and spermidine. Loaded pellets were applied to the Tefzel tubing, as described (Eisenbraum et al., 1993; Pertmer et al., 1996). The bombardment of the particles was performed using the Accell gene delivery (PCT WO 95/19799). In the case of each plasmid were immunized female mice SW 1/6 3-fold by the introduction of plasmids on day 0, 21 and 42. Each injection consisted of two bombing DNA on gold, which gave a total dose of approximately 4-5 µg plasmid.

2.1 Intramuscular (i.m.) DNA immunization

Female mice C57B1/6 were immunized intramuscularly in the hind leg dose of 50 μg DNA in PBS on days 0, 21 and 42.

2.2 Injection of tumor cells

Performed two series of experiments regression of the tumor, in which, in the first experiment, were injected with a 0.5×106tumor cells subcutaneously into the right side shot mouse two weeks after the last immunization. In the second experiment used isovale much more aggressive model, in which the animal received 1,0×106tumor cells. Tumor growth monitorrole twice a week using a caliper in two dimensions. The tumor volumes were calculated as (a×b2)/2, where a is of larger diameter, and b is of less diameter. The endpoint of the experiment (death) was defined as the time when the tumor diameter reaches 15 mm

3. Testing constructs

3.1.1 Materials and methods

Tumor cells B16FO and B16FO-MUC1

B16FO (murine metastatic melanoma), transfetsirovannyh expression vector for cDNA MUC1 man, received from GlaxoWellcome U.S. granulosa Cells in the form of adhesive monolayers in DMEM enriched with 10%heat-inactivated fetal calf serum (FCS), 2 mm L-glutamine, 100 u/ml penicillin, 100 u/ml streptomycin and 1 mg/ml of the antibiotic neomycin (G148). For use in assays, ELISPOT remove cells from flasks using Versene and irradiated (16000 rad).

3.1.2 Design of EL4 tumor cells expressing MUC1

Cultured EL4 cells in complete RPMI medium containing 10%FCS, 100 u/ml penicillin, 100 μg/ml streptomycin, 2 mm L-glutamine, 50 μm 2-mercaptoethanol. JNW278 (full-MUC1) was linearisable the restriction enzyme Fspl, was purified by extraction with a mixture of phenol:chloroform:isoamyl alcohol (25:24:1) followed the precipitation with ethanol. 2×107cells in 0.5 ml complete RPMI medium were mixed with 20 μg of linearized DNA in the cell BIORAD 0.4 mm Cells were transfusional by electroporation at 320, 960 μf. After electroporation the cell suspension was transferred into 30 ml of pre-warmed complete medium RPMI, and incubated 24 hours to restore state. The cells were placed in conditions of selection in complete RPMI medium containing 500 μg/ml of hygromycin, and incubated for 7-10 days. Surviving cells were diluted in tablets, 96-well U-shaped bottom to 0.5 cells/well in 200 μl of complete RPMI medium containing 500 μg/ml of hygromycin. 8-10 days later transferred clones in 24-well plates. At this stage tested flow cytometry profile of expression of MUC1 and maintained positive homogeneous clones for further analysis.

3.2 Analyses of T-cell responses to MUC1 gene product by the Elispot method

3.2.1 Receiving splenocytes

Received the spleen of the immunized animals on day 7 after supporting immunization, what was going on either day 28 or day 49. Treated spleen crushed between glass slides and received cell suspension. Was literally red blood cells with ammonium chloride and removed debris from obtaining pure suspensions of splenocytes. Cells are re-suspended at a concentration of 8×106/ml in complete RPMI medium for use in the analysis of the x ELISPOT method.

3.3 Screening of peptide libraries

The peptide library covering the full sequence of MUC1, were obtained from Mimotopes. The library contained 116 15-dimensional peptides, overlapping peptide of 11 amino acids that covered the entire sequence of MUC1 (includes 1 copy of a region of tandem repeats). The peptides are represented by numbers from 184 to 299. For this screening a peptide library with IFN ELISPOTγ and IL-2 used the peptides at a final concentration of 10 μm, using the Protocol described below. For ELISPOTS on IFNγ to the analysis of added IL-2 at 10 ng/ml Splenocytes used in the screening process took a day 49 from mice C57BL/6 or CBA mice immunized using FL MUC1 on days 0, 21 and 42.

3.4 Mapping of the epitope

For the study chose two areas MUC1, demonstrating a good reactivity in C57BL/6 mice. These were the areas covered by peptides 222-225 and 238-239. Flow cytometry Protocol (described below) showed that cells producing IFNγ in response to these peptides were CDS cells. For further mapping of these epitopes were ordered from Mimotopes 8 - and 9-dimensional peptides, overlapping by 7 or 8 amino acids, respectively. They were tested in ELISPOT with IFNγ when using splenocytes from animals immunized as detailed above. Identified two immunodominant is eptide:

SAPDNRPAL and PTTLASHS.

3.5 Analysis of the ELISPOT method

Coated tablets rat antibody against mouse IFNγ or murine IL-2 (Phamingen, 15 μg/ml in PBS) overnight at +4°C. Before use washed tablets three times in PBS. Add to tablets splenocytes at 4×105cells/well. Peptide SAPDNKPAL used in assays at a final concentration of 10 ng/ml Peptide PAHGVTSAPDTRPAPGSTAPPAHGV (25-dimensional peptide) was used at a final concentration of 25 μm. These peptides were obtained from Genemed Synthesis. Also in the analysis of the ELISPOT method used peptides identified in the screening library and research mapping of epitopes: 203 (DVTLAPATEPATEPA) at a concentration of 10 μm, 299 (LSYTNPAVAATSANL) at a concentration of 10 μm, PTTLASHS at a concentration of 1 μm (Mimotopes). Irradiated tumor cells B16, B16-MUC1, EL4 and EL4-278 used at a ratio of tumor cells:effector of 1:4. The analysis method ELISPOT was performed in the presence of IL-2 (10 ng/ml) or IL-7 (10 ng/ml) or without cytokine. The total volume in each well was 200 μl. Tablets containing cells stimulated with peptide, incubated for 16 hours in a humidified incubator at 37°whereas the tablets, which contain as promoters of tumor cells, incubated for 40 hours.

3.5.1 the Manifestation of tablets for analysis ELISPOT

Cells were removed from the tablets with a single washing in water (submersible is of 1 minute to ensure lysis of the cells) and three times washing in PBS. Conjugated with Biotin rat antibody against mouse IFNγ or IL-2 (Phamingen) was added to 1 μg/ml in PBS. The plates were incubated with shaking for 2 hours at room temperature. Then washed tablets three times in PBS before adding the complex with streptavidin alkaline phosphatase (Caltag) at a dilution of 1/1000. After three washes in PBS revealed spots incubation with BCICP (Biorad) as a substrate for 15-45 minutes. The substrate was washed with water and the tablets were allowed to dry. Spots were counted using image analysis, which was developed by Brian Hayes from Asthma Cell Biology unit, GSK.

3.6 Flow cytometry for detection of IFN productionγ of T cells in response to stimulation by peptide

Re-suspended splenocytes at a concentration of 4×106/ml peptide was Added to a final concentration of 10 μm and IL-2 to a final concentration of 10 ng/ml Cells were incubated at 37°3 hours was Added brefeldin And at a concentration of 10 μg/ml and continued incubation over night. Cells were washed with FACS buffer (PBS+2,5%FCS+0,1%azide) and stained with caroma with antibodies against CD4 and FITC with antibodies against CDS (Pharmingen). Washed cells and recorded Environment And from a set of Fix and Perm (Caltag) for 15 minutes followed by washing and addition of antibodies against IFNγ PE (Pharmingen), diluted in the Environment from a set of Fix and Perm. After 30 minutes the incubation of washed cells and analyzed using FACSCAN. The amount collected 500,000 cells from the sample and then divided CD4 and CDS cells to identify populations of cells secreting IFNγ in response to each peptide.

3.7 Analysis on antibodies to MUC1 gene product by the method of ELISA

Received serum samples from the animals by puncture of the vein at days 1, 21, 49 and 56 and analyzed for the presence of antibodies against MUC1. ELISA was performed using tablets Nunc Maxisorp, which covered over night at 4°With 3 μg/ml of peptide sequence MUC-01 wild type (40-dimensional, the corresponding sequence 2 tandem repeats, PAHGVTSAPDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAP). After washing when using TBS-Tween (buffered by Tricom saline, pH 7.4, containing Tween 20, 0.05%) of the tablets was blocked by 3%bovine serum albumin (BSA) in buffer TBS-Tween for 2 h at room temperature. All sera were incubated at a dilution of 1:100 for 1 h at room temperature in buffer TBS-Tween. Antibody binding was detected using conjugated with horseradish peroxidase protivorechivyh rabbit immunoglobulins (No. R, Dako) at a dilution of 1:2000 in buffer TBS-Tween. The tablets were washed again and the bound conjugate was detected using color reagents Fast OPD (Sigma, UK). Stopped the reaction by adding 3 M sulfuric acid and determined the product OPD quantified by measuring absorption at 40 nm.

3.8 Analysis of sera from immunized mice, flow cytometry

In order to demonstrate that antibodies induced by these vaccines are able to recognize tumor cells, samples of antisera from PMID-immunized mice were used to mark the various lines of tumor cells, and label visualized flow cytometry. Cells (T47-D, MCF-7, EL4, EL4-278, B16FO and B16FOMUC1; 1x106) were washed in PBS buffer, enriched with 5%FCS, and incubated at 4°C for 15 min with mouse sera at a dilution of 1:100. After washing the incubated cells with a second antibody (sheep protivomaskitnye IgG, Dako, Denmark, dilution 1:50) in the same conditions. Control cells were incubated with FACS buffer instead of the antibodies of the first stage before painting a second stage reagent. FACS analysis was performed using FACScan (Becton Dickinson). 1000-10000 cells in the sample simultaneously primeraly on predneprovie light scattering, integral scattering, as well as on the green (FL1) fluorescence (expressed as the logarithm of the integral fluorescent light). The recording was made, excluding aggregates, whose predneprovie light dispersion was strong. Data were expressed as histograms of the number of cells (Y-axis) versus fluorescence intensity (X-axis) for different types of mouse sera associated with the surface of tumor CL is current.

3.9 Analysis method transient transfection

The expression of MUC1 with different DNA constructs were analyzed by the method of transient transfection of plasmids into cells Cho (Chinese hamster ovary) with subsequent Western blotting with total protein of cells or analysis of MUC1 expressed on cell membranes, running cytofluorometry. Transient transfection was performed with Transfectam reagent (Promega) according to the manufacturer's instructions. Briefly, 24-well plates to tissue culture were sown 5×104cells SNO per well in 1 ml complete DMEM medium (DMEM, 10%FCS, 2 mm L-glutamine, 100 IU/ml penicillin, 100 μg/ml streptomycin) and incubated 16 hours at 37°C. was Added 0.5 μg DNA 25 ál of 0.3 M NaCl (enough for one hole) and added Transfectam (2 ál) 25 ál of Milli-q Solutions of DNA and Transfectam gently mixed and incubated at room temperature for 15 minutes. During this stage of incubation the cells were washed once in PBS and covered serum-free medium (150 μl, DMEM, 2 mm L-glutamine). The solution with DNA and Transfectam was added in drops to the cells, the tablets were gently shaken and incubated for 4-6 hours at 37°C. was Added 500 μl of complete DMEM medium and incubated the cells for another 48-72 hours at 37°C.

3.10 Analysis of cells SNO, short-transfected with plasmids MUC1, flow cytometry

After times the modern transfection were washed cells SNO once in PBS and treated with a mixture of Verse (1:5000)/0,025%trypsin solution for transferring the cells into suspension. After trypsinization besieged cells SNO and again suspended in FACS buffer (PBS, 4%PCS, in 0.01%sodium azide). Primary antibodies, ATR1, was added to a final concentration of 15 μg/ml and samples were incubated on ice for 15 minutes. Control cells were incubated with FACS buffer in the absence of ATR1. Cells were washed three times in FACS buffer, again suspended in 100 μl FACS buffer containing 10 μl of the secondary antibody, representing goat protivomaskitnye immunoglobulins conjugated with FITC, F(ab')2(Dako, F0479), and incubated on ice for 15 minutes. After staining, the secondary antibody was washed the cells three times in the buffer for FACS. FACS analysis was performed using FACScan (Becton Dickinson), 1000-10000 cells in the sample simultaneously primeraly on predneprovie light scattering, on the integral scattering, as well as on the green (FL1) fluorescence (expressed as the logarithm of the integral fluorescent light). The recording was made, excluding aggregates, whose predneprovie light dispersion was strong. Data were expressed as histograms of the number of cells (Y-axis) versus fluorescence intensity (X-axis).

3.11 Analysis of cells SNO, short-transfected with plasmids MUC1, Western blot testing

Short transfetsirovannyh cells SNO washed in PBS and treated with a mixture of Verse (1:5000)/0,025%trypsin solution for prevedeyelet in suspension. After trypsinization besieged cells SNO and again suspended in 50 μl PBS. Added an equal volume of buffer for samples representing 2×trisglycine with sodium dodecyl sulfate (Invitrogen)containing 50 mm dithiothreitol, and heated the solution to 95°C for 5 minutes. 1-20 µl of sample was applied to a 4-20% trisglycine gel (1.5 mm thick) (Invitrogen) and subjected to electrophoresis at a constant voltage (125 V) for 90 min in a single trisglycine buffer (Invitrogen). For scaling of the samples used pre-stained marker, broad range (New England Biolabs, #P7708S). After electrophoresis, transferred samples to PVDF-membrane Immobilon-P (Millipore)pre-wetted with methanol, using the module Xcell III Blot (Invitrogen), single Transfer buffer (Invitrogen)containing 20% methanol, a constant voltage of 25 V for 90 minutes. The membrane was blocked overnight at 4°in TBS-Tween (buffered by Tricom saline, pH 7.4, containing 0.05%Tween 20)containing 3% skimmed milk powder (Marvel). Primary antibodies (ATR1) was diluted to 1:100 and incubated with the membrane for 1 hour at room temperature. After an extensive washing in TBS-Tween the secondary antibody was diluted to 1:2000 in TBS-Tween containing 3% skimmed milk powder, and incubated with the membrane for one hour at room temperature. After abundant about Yuki the membrane was incubated with the substrate Supersignal West Pico Chemiluminescent (Pierce) for 5 minutes. The excess liquid was removed and the membrane was sealed between two sheets of cling film and exposed film Hyperfilm ECL (AmershamPharmaciaBiotech) for 1-30 minutes

4. Results

4.1 Comparison of gene gun and intramuscular injection

The cassette for the expression of FL-MUC1 plasmid pcDNA3-FL-MUC1 was administered to mice using a PMID and intramuscular injection.

4.2 Comparison or antibody-based test answers

Answers for antibodies against MUC1 after immunization by intramuscular injection (mouse a-C), PMID (mouse D-F) are shown in Fig.9. The results show that the introduction using PMID induces more sustainable or antibody-based test response with faster kinetics, and 3 of 3 mice respond in day 41. In contrast, only one mouse immunized by intramuscular, showed good or antibody-based test responses at day 41. Even after additional supporting immunization at day 42 only 2 of the 3 mice showed levels of antibodies against MUC1, comparable to those PMID-immunized mice.

4.3 Comparison of cellular responses

Cellular responses after PMID or intramuscular (IM) immunization with plasmid pcDNA3 (empty vector) or pcDNA3-FL-MUC1 were analyzed by ELISPOT method after primary immunization at day 0 and two supporting immunization at day 21 and day 42. The analysis was performed at day 13 after the 2nd supporting immunization. Splenocytes stimulated PEP is the home SAPDTRPAP (9.1), which was previously described in the literature as a good epitope N-2b. Concerning the answers on IFNy, Figure 10 shows that 100% PMID-immunized mice is detected responses to the peptide, whereas mice immunized intramuscularly, the answers are not revealed.

4.4 Expression constructs MUC1 in vitro Western blot

11 shows the results of Western blotting for MUC1 with a total protein of the cells after transient transfection of various constructs MUC1 cells SNO. These data show that the construct of FL-MUC1 (JNW358) generates a blur when 83-175 kDa, which corresponds to the predicted molecular mass of 108 kDa and heterogeneous, but abundant glycosylation patterns VNTR. Construct 7×VNTR-MUC1 (JNW656) produces a more focused spot is centered around ˜65 kDa, which corresponds to the predicted molecular mass of 61 kDa) and heterogeneous glycosylation patterns VNTR. Construct 1×VNTR-MUC1 (JNW332) produces only a pale band of 40 kDa, which corresponds to the presence of only one VNTR-block.

4.5 Expression constructs MUC1 in vitro flow cytometry

After transient transfection of constructs MUC1 cells SNO expression of MUC1 on the surface of cells was checked by flow cytometry using specific antibodies ATR1 against VNTR in MUC1. The percentage of cells positive for MUC1, was 9.6 percent for the, transfected using FL-MUC1 (JNW358), 8.8% of the sample, transfected using 7×VNTR-MUC1, and 9.8% for samples transfected using 1×VNTR-MUC1 (JNW332). From these data it follows that the number of VNTR does not affect the ability of MUC1 to move to the cell surface and detection antibodies ATR1

4.6 or antibody-based test answers to FL-MUC1, 7×VNTR-MUC1 and 1×VNTR-MUC1 after PMID-immunization

Or antibody-based test responses after immunization with plasmid pVAC (empty vector), JNW358 (FL-MUC1), JNW656 (7×VNTR-MUC1) and JNW332 (1×VNTR-MUC1) were analyzed using ELISA method after the initial PMID-immunization on day 0 and two supporting immunization at day 21 and day 42. Fig shows or antibody-based test responses in sera taken at day 56. While on an empty vector MUC1-specific responses were, construct FL-MUC1 and construct 7×VNTR-MUC1 was produced sustainable and comparable titles MUC1-specific antibodies, and, on the contrary, construct 1×VNTR-MUC1 induced lower titer or antibody-based test response. Fig.12b shows that the kinetics or antibody-based test response to FL-MUC1 and 7×VNTR-MUC1 also very similar, while the answer to 1×VNTR-MUC1 develops more slowly and to achieve a plateau requires a second supporting immunization at day 42. These data confirm that the deletion of the majority of VNTR-blocks is not detrimental to the induction of strong or antibody-based test response specification is knogo to MUC1. However, or antibody-based test response to 1×VNTR-MUC1 is suboptimal in the sense of his power and the kinetics of its beginning.

4.7 Recognition of tumor cells expressing MUC1, sera from mice immunized using MUC1

To confirm that the antibodies induced FL-MUC1, 7×VNTR-MUC1 and 1×VNTR-MUC1 able to recognize the forms of human MUC1, which is expressed on tumor cells, serum from immunized mice was tested flow cytometry. Target cells were B16FOMUC1 line of tumor cells, deliberately modified so that they Express human MUC1. The results shown Fig confirm that serum from mice immunized using FL-MUC1 (JNW358), mice immunized with a 7×VNTR-MUC1 (JNW656), and mice immunized using 1×VNTR-MUC1 (JNW332), are equivalent in their ability to recognize MUC1 expressed on B16FOMUC1, which implies the assumption that the destruction of a large number of VNTR-blocks is not detrimental to the induction physiologically wealthy or antibody-based test response.

4.8 Identification of new T-cell epitopes of MUC1 in C57BL/6 mice by screening libraries of peptides MUC1

After PMID-immunization using JNW358 (FL-MUC1) on day 0 and two supporting immunization at day 21 and day 42 tested method is m ELISPOT at day 49. Peptides from the library FL-MUC1 tested at a final concentration of 10 μm. The original screening was found that several groups of 15-dimensional peptides stimulate the secretion of IFNγ or IL-2. Region of interest marked on Fig.14b, c. Peptides that stimulate the secretion of IFNγ, were studied further by intracellular cytokine staining and flow cytometry to determine whether these areas CD4 - or CD8-epitopes. It was found that peptides 223, 224, 225, 238 and 239 induce a good secretion of IFNγ CD8-cells. In order to map CD8-epitopes further, the received 8 - and 9-dimensional peptides, overlapping by 7 or 8 amino acids. They were tested in the analysis of IFNy ELISPOT method and then a few of them, demonstrating the reactivity tested flow cytometry. Region 223-225 contained clusters CD8-epitopes. Titration showed that the dominant peptide was SAPDNRPAL, peptide, which is already used by other authors to measure responses specific to MUC1. However, in this area has identified several new peptides that induced the secretion of IFNγ CD8-cells at 10 μm and lower concentrations. We showed that one of them, TSAPDNRPA capable of inducing cytotoxic T cells in vitro (data not shown). It is shown that the region 238-239 contains one strong CD8-epitope PTTLASHS, which we used for sleduyushij analyses MUC1, as well as several weaker CD8-epitopes.

4.9 Cellular responses to FL-MUC1, 7×VNTR-MUC1 and 1×VNTR-MUC1 after PMID-immunization

Cellular responses after immunization with plasmid pVAC (empty vector), JNW358 (FL-MUC1), JNW656 (7×VNTR-MUC1) and JNW332 (1×VNTR-MUC1) were analyzed by ELISPOT method after the initial PMID-immunization on day 0 and two supporting immunization at day 21 and day 42. Analyses were performed 7 days after supporting immunization. Used three variants of analysis: 1) tumor cells B16-MUC1 and EL4-MUC1 expressing MUC1, which was used to demonstrate a broad antitumor cell response, 2) high-affinity peptide SAPDNRJPAL out VNTR-region of MUC1 (presented once all constructs used), 3) 25-dimensional peptide encoding sequence, which includes a repeat of the VNTR region and an additional 5 amino acids of the adjacent loop. This peptide induces mainly the production of IL-2 from immunized splenocytes. Constructs FL-MUC1, 7×VNTR-MUC1 and 1×VNTR-MUC1 was produced sustainable and comparable cellular responses specific to MUC1, all tested stimuli (Fig). In the case of peptide SAPDNRPAL we showed that IFNγ produced by CD8 cells, while the production of IFNγ in response to tumor cells and IL-2 production in response to 25-dimensional peptides from CD4 - or CD8-cells. These data confirm that th is a deletion of most of the VNTR-blocks is not detrimental to the induction of strong cellular response, specific for MUC1, epitopes, both inside and outside of the VNTR region.

4.10 Comparison protection (PMID compared to IM) after tumor effects

After three injections of the plasmid pcDNA3-FL-MUC1 expressing MUC1, or the empty vector pcDNA3.1 when using the PMID or intramuscular injection in mice affected cancer cells expressing MUC1 (B16FOMUC1). The percentage of mice without tumors shows Fig, clearly demonstrating that PMID induces protection against subsequent tumor effects in a larger number of mice when compared with delivery of the same plasmid by intramuscular injection. From these data, in combination with or antibody-based test and cellular responses detailed above, it follows that PMID when compared with intramuscular delivery induces a more sustainable cell or antibody-based test and answers, which correlates with improved protection profile of the tumor.

4.11 the Efficiency of cDNA constructs MUC1 (F/L MUC1 and 7 VNTR) in the antitumoral protection

Mice were immunized three times as described in materials and methods with empty vector (pVAC empty) or a vector encoding full-MUC1 (JNW358). Two weeks after the last supporting immunization mice were subjected to tumor effect cells B16FOMUC1 and monitorrole tumor growth. If there are tumors, they were approximately 10-15 days after tumor environmenta what I was in the band, subjected empty vaccination, and approximately 22 days in the group vaccinated when using FL-MUC1. Figa maps the survival of mice immunized with either empty vector or vector encoding full-MUC1, in both groups. Is significantly better survival in mice immunized using FL-MUC1 (60% without tumors)compared with those in mice immunized with the empty vector (20% of tumors). Figv shows antitumor protection, comparing groups with FL-MUC1 and 7×VNTR and the control group at two times the number of tumor cells (1,0×106in comparison with the previous experiments. Both MUC1 construct cause significant and comparable to the delay of tumor growth relative to the control and vaccinated groups of up to approximately day 25. Later, this effect was reduced, possibly due to depletion of immune response to tumor antigen.

In conclusion, the construct 7×VNTR-MUC1 was given the same protective antitumor response, as FL-MUC1, even in very harsh conditions.

4.12 FL-MUC1 compared with 7×VNTR-MUC1: stability in the system, representing a recombinant vaccinia virus

A full-sized human MUC1 was inserted into the vector pSClinker in the form of a BamHI fragment. This construct was used to generate recombinant vaccinia virus homologous what combinatie vector in gene TK (timedancing) of the genome of the vaccinia virus.

Inflicted recombinant virus at the cellular layer NTC-cells and analyzed plaques on the beta galactosidase activity way bluo-gal. Gene beta-galactosidase is carried by the vector and, thus, the blue plaques indicate the presence of recombinant virus. Selected and cloned many blue plaques before 100% of the plaques began to produce a blue coloration when performing analysis bluo-gal.

6 of these clones was used to infect NTC-cells at a multiplicity of infection of 10, and collected cells after 6 h, 24 h and 32 h after infection. Again these cells suspended in 200 μl of medium was removed and 40 µl was mixed with buffer for drawing samples during electrophoresis in polyacrylamide gel with sodium dodecyl sulphate.

These cell extracts were subjected to electrophoresis in polyacrylamide gel with sodium dodecyl sulphate and were analyzed by Western blotting using monoclonal antibodies ATR1 and HMPG1, and they both recognize epitopes within the VNTR-region of MUC1. None of the samples infected with recombinant virus did not give any staining with these antibodies. The control cell extract of cells transfected with plasmid pVAC-7VNTRMUC1, stained with getting bright bands, indicating the presence of TR-epitopes.

Staining with antibodies against beta-galactosidase of the criminal code which indicates the expression of beta-galactosidase in all samples, infected with recombinant virus, but not the wild-type virus, or cell control.

Molecular analysis of the collected samples of infected cells was performed by PCR. Selected pairs of primers, which should indicate the presence of various parts of the construct pSCHnuHKep-FLMUCI in the genome of the recombinant virus. Chose the following pairs of primers:

FMC101+2014MUC1 - the connection vector and the 5'-end of MUC1

2008MUC1+FMC102 - the connection vector and the 3'-end of MUC1

2004MUC1+2014MUC1 is part of MUC1 with 5'-side of VNTR-area

2007MUC1+2009MUC1 is part of MUC1 with 3'-side of VNTR-area

FMC101 and FMC102 represent the primers in the vector sequence from the 5'-side and 3'side, respectively, of the linker sequence.

FMC101: - CATAAATAATAAATACAATAATTAATTTCTCG

FMC102: - GCCTCCTTAAAGCATTTCATACACACAGC

Carried out shown above 4 PCR using 1 μl of the collected cells infected with recombinant virus (32 h after infection) after heating up to 80°C for 10 min. the Reaction was also conducted on samples of cells infected with wild-type virus and uninfected cells. Here included a positive control, representing 1 gdnc plasmids pS-FLMUC1.

The positive control was produced amplificatoare fragments of the correct size during electrophoresis on agarose gel. None of the other samples do not sell what provoked specific products, from which it follows that in the viral genome construct was no longer intact.

Then likewise have produced recombinant virus containing UMTK-variant human MUC1, and after ensuring clonal populations used it to infect NTC-cells, which were collected as before. Cell extracts of these infected cells clearly demonstrated the expression of MUC1 in Western-blotting with ATR1 and FACS analysis of infected cells two days after infection. Mouse NS cells infected with the virus, recombinant with 7VNTR used for stimulation of spleen cells from mice that were vaccinated using MUC1, ELISPOT analysis. It was shown that after incubation overnight spleen cells secrete IL-2 in response to cells infected 7VNTR-BnpycoM ospowiki, but not in cells infected with vaccinia virus wild-type.

From these results it follows that the use of MUC1 construct 7 tandem repeats improves the stability of the construct. From the fact that the vaccinia virus, with a full-size recombinant MUC1, was unable to induce the expression of MUC1 in infected cells, clearly shows that this construct is unstable in these highly recombinogenic conditions. None of the 6 viral clones not expressed MUC1, and they, apparently, did not contain the Yong MUC1, however, they all expressed beta-galactosidase, which bore the same vector. However, 7×MTP-variant with fewer replays clearly showed the expression of 3 different tests, indicating a higher stability without loss of recognition by antibodies, and antigen-specific T cells.

5. The stability of the FL - MUC1, 7VNTR and 1VNTR when grown in E.Coli DH1

To transform E. coli DH1 used the appropriate vector. To control also transformed with empty vector.

In order to determine whether the number of repeats in the VNTR region of stability, carried out a stability analysis in shake flask using plasmids FL-MUC1, 7×VNTR-MUC1 and 1×VNTR-MUC1.

In the stability studies observed the growth, production plasmids and retention of plasmids for each of the constructs in the culture in shake flask for 9 subcultures, each lasting between 10 and 14 hours

The stability studies are used to determine whether changes products and the quality of the plasmid with repeated subcultures of cells in shake flasks. Because the conditions in shake flasks are uncontrolled (for example, pH, aeration), maintaining quality and production plasmids for research is a good indicator of what this feature is and should remain stable.

5. RESULTS

5.2.1. Growth of cultures

Although there was some variation between the final optical density at 600 nm reached the cells from each subculture, due to slight variations in the volume of inoculum, in General no significant differences in the rates of growth during analysis, and between different constructs MUC1.

5.2.2. Products plasmids

The magnitude of copy number plasmids (CCP) received on the 1st, 5th and 9th (final) the subculture. In the case of a full-sized construct CCP was decreased by 54% during this period, whereas in the cases of the other three constructs, it was increased by ˜40%. Volume yield (mg plasmid/l culture) remained stable throughout the study in case 7VNTR, whereas in the case of a full-sized construct it decreased by 64%. A small decrease in volume of output observed in the case of an empty vector (21%) and construct with a single VNTR (24%), although this in no way been so visible as in the case of a full-sized construct.

5.2.3. Retention of the plasmid

Retention of the plasmid was measured using analysis sowing replica, and it is during stability studies remained all constructs between 80% and 100%. Moreover, no significant differences between the constructs.

5.2.4. The stability of plasmids

To study the stability of plasmids should the duration of this study using rotational columns Qiagen Mini-prep, Plasmide Extraction was obtained extracts plasmids as the starting point (collected on day 0)and end point (collected on day 5). These extracts were then analyzed by electrophoretic separation on an agarose gel prior to staining using Sybr-Gold. This method of painting based on Sybr-Gold, considered particularly suitable for analyzing the stability of the plasmid due to previous work that has demonstrated that it is able to detect 1 ng "peak" recombinant 1000 ng samples. The results of this study are shown below (see Fig.6), and from these results, three conclusions:

1. Constructs with 7×VNTR and 1×VNTR contain the expected number of VNTR repeats throughout the experiment in the absence of evidence of instability identified either in the skeleton plasmids or in the structure of the VNTR-repeat at any time.

2. An empty vector R used in the analysis of stability, does not have the expected profile and differs from the standard plasmids R.

3. Sample full-sized Mud, taken at an endpoint time (day 5; 9th reseeding) contain traces of plasmids of unknown origin.

Due to uncertainties regarding profile R, and also because of the identification of trace species of plasmids in the case of construct FL-U1 in day 5 we performed additional research.

For the surveys of the observed differences between empty vector R, used in the stability studies, and standard plasmid R analyzed with restriction enzymes. The results of this analysis showed that the area in ˜800 base pairs construct R containing restriction sites for BamHI (1926 base pairs) and Sapl (2422 base pairs)was lost. Then developed primers flanking this region, and then sequenced plasmid. The resulting sequence data confirmed that the area between 1866 and 2589 was lost. This area plasmid contains Cer sequence. Due to the fact that these Cer-sequence help to divide concatemer, their absence may explain the multiplicity of strips of varieties plasmids R, which was observed in stability studies.

Additional research: aalis trace of plasmids in samples with FL-MUC1

Trace plasmids, which were observed only at the endpoint in samples with FL-Mud, were analyzed separately. This analysis found that these traces could not be identified until day 4. Along with this discovery, these trace plasmids another and conducted clearing gel, re-transformation, re-purification and sequencing. This analysis then identified these plasmids as impurity, but not recombinant, and they were exactly 7×VNTR, which use is in the analysis of stability (R), R with a deletion in Cer-region (outlined above), as well as estimated concatemer this Cer-deletions in R.

From these results he concluded that samples with FL-MUC1 had impurities in the form of empty vector R and constructs 7xVNTR (R) and that the recombinants at the end point in trials with FL-no Mud. It is believed that these impurities are trapped in part E. coli DH1 with FL-Mud during the initial transformation of plasmids. Due to the fact that these trace plasmids do not appear on agarose gels prior to day 4, one possibility is that they were breeding within the study due to their smaller size relative to the plasmid FL-Mud.

3. CONCLUSION

These stability studies showed that plasmid 7×VNTR-MUC1 stable in terms of growth characteristics, retention plasmids and quality of the plasmid. In terms of growth characteristics, retention plasmids and quality plasmid was no significant difference between the vectors 1×VNTR, 7×VNTR and FL-MUC1. However, data on the number of copies has highlighted significant differences between these constructs. The full-length construct when compared with 7×VNTR within research stabilnosti decreased significantly and the number of copies of the plasmid, and volume output. Although retention of the plasmid, as can be seen, remained at 100% throughout the experiment with a full-size construct, it only indicates that all cells of populatie still contain enough plasmid for imparting resistance to kanamycin. If this experiment lasted longer, it is possible that the number of copies could be reduced to such a level that the resistance to kanamycin would be insufficient to allow for growth on selective tablets that would decrease the observed retention of the plasmid. These data suggest that the construct of 7×VNTR may have significant advantages in terms of favorable developmental profile, since the content of the plasmids may affect the clearance of cell mass. With these differences between the constructs 7VNTR and FL-MUC1 likely that 7VNTR will be easier to clean and to get higher output.

1. Nukleinovokisly construct encoding the antigen MUC-1, chosen from:

(a) 7 VNTR MUC-1 (i.e. full MUC-1 with only 7 full repetitions);

(b) 7 VNTR MUC-1 Δss (same as (a), but without the signal sequence);

(in) 7 VNTR MUC-1 ΔTM ΔCYT (same as (a)but lacking the transmembrane and cytoplasmic domains); or

(g) 7 VNTR MUC-1 Δss ΔTM ΔCYT (same as (b)but without the signal sequence).

2. Nukleinovokisly construct according to claim 1, which comprises a sequence encoding the epitope selected from the group FLSFHISNL, NSSLEDPSTDYYQELQRDISE or NLTISDVSV.

3. Nukleinovokisly construct according to claim 1, where the construct is a mole who Kullu DNA.

4. Nukleinovokisly construct according to claim 1 for use for the treatment or prevention of tumors expressing MUC-1.

5. Nukleinovokisly construct encoding the antigen MUC-1, chosen from:

(a) 7 VNTR MUC-1 (i.e. full MUC-1 with only 7 full repetitions);

(b) 7 VNTR MUC-1 Δss (same as (a), but without the signal sequence);

(in) 7 VNTR MUC-1 ΔTM ΔCYT (same as (a)but lacking the transmembrane and cytoplasmic domains); or

(g) 7 VNTR MUC-1 Δss ΔTM ΔCYT (same as (b)but without the signal sequence),

where at least one VNTR mutated to reduce potential glycosylation.

6. Nukleinovokisly construct according to claim 5, which comprises a sequence encoding the epitope selected from the group FLSFHISNL, NSSLEDPSTDYYQELQRDISE or NLTISDVSV.

7. Nukleinovokisly construct according to claim 5, where the construct is a DNA molecule.

8. Nukleinovokisly construct according to claim 5 for use for the treatment or prevention of tumors expressing MUC-1.

9. Expressing a plasmid containing a DNA molecule according to claim 3 or 7.

10. Plasmid according to claim 9 for use for the treatment or prevention of tumors expressing MUC-1.

11. Protein having antitumor activity, encoded nukleinovokisly construct according to any of the at one of claims 1 to 3 and 5-7.

12. The protein according to claim 11 for use for the treatment or prevention of tumors expressing MUC-1.

13. Pharmaceutical composition having antitumor activity, containing an effective amount nukleinovokisly construct according to any one of claims 1 to 3 and 5-7, the plasmid according to claim 9 or protein according to claim 11 and a pharmaceutical acceptable excipient, diluent or carrier.

14. The pharmaceutical composition according to item 13, where the carrier is a microparticle.

15. The pharmaceutical composition according to 14, where the microparticle is Golden.

16. The pharmaceutical composition according to any one of p-15 containing adjuvant.

17. The pharmaceutical composition according to item 13 for use for the treatment or prevention of tumors expressing MUC-1.

18. Application nukleinovokisly construct according to any one of claims 1 to 3 and 5 to 7 in the manufacture of medicaments for the treatment or prevention of tumors expressing MUC-1.

19. The use of the protein according to claim 11 in the manufacture of medicaments for the treatment or prevention of tumors expressing MUC-1.

20. Method for the treatment or prevention of tumors or metastases, which impose a safe and effective amount nukleinovokisly construct according to any one of claims 1 to 3 and 5-7, the plasmid according to claim 9 or protein according to item 11.



 

Same patents:

FIELD: gene engineering.

SUBSTANCE: the present innovation deals with the ways for obtaining transgenic poultry due to introducing retroviral vectors into blastodermal cells through the fissure in the shell of nonhatching egg from the side of its blunt end. With the help of insulin syringe one should introduce gene constructions for the depth of about 2-3 cm near a germinal disk. The innovation enables to simplify the procedure of introducing gene constructions into target cells at maintaining general efficiency of transgenesis that leads to the decrease of embryonic lethality.

EFFECT: higher efficiency.

FIELD: genetic engineering.

SUBSTANCE: invention relates to vectors used in genetic engineering. Invention proposes a lentiviral vector with condition-dependent replication that comprises two nucleotide sequences. The first nucleotide sequence reduces probability for formation of lentiviral vector able for replication. The second nucleotide sequence inhibits replication of lentivirus of wild type, helper virus or helper vector but it doesn't inhibit replication of dependent vectors, or it encodes proteins showing the same properties. Also, invention discloses these nucleotide sequences, method for preparing such vectors and their using. Invention can be used in medicine in prophylaxis and therapeutic treatment of viral diseases, in particular, HIV infection.

EFFECT: valuable biological properties of vectors.

45 cl, 53 dwg, 12 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to water soluble polypeptides (SEQ ID NO.12) and (SEQ ID NO.7), derived from full-length tryptophanyl-tRNA-synthetase and having angiostatic activity in relation to eye neovasculatisation. Also disclosed are polynucleotides, encoding truncated polypeptide forms (SEQ ID NO.12) and (SEQ ID NO.7), and E.coli cell, expressing abovementioned polypeptides. Said polypeptides are useful in injecting angiostatic composition and kit for inhibiting of eye neovasculatisation.

EFFECT: polypeptides having non-immunogenic angiogenic properties.

22 cl, 5 dwg, 2 tbl, 5 ex

FIELD: biotechnological methods.

SUBSTANCE: invention concerns new polynucleotides, which encode polypeptide having tripeptidylpentidase activity. To produce this polypeptide, host cell is transformed with polynucleotide or polynucleotide-containing vector and then cultured under suitable polynucleotide expression conditions.

EFFECT: enabled production of new protease from thread fungi.

14 cl, 3 tbl, 11 ex

FIELD: medicine, gene engineering, in particular production of new variants of gamma-interferon polypeptide having gamma-interferon activity.

SUBSTANCE: new polypeptide variants include S99T replacement in contrast with huIFNG amino acid sequence, may be shortened on C-end and are capable of enhancing utilization of natural N-glycosilation site in 97 place. Mutant forms of gamma-interferon containing threonine in 99 place may include from 1 to 10 modifications without losses polypeptide activity. Polypeptide is obtained by expression in host cells transformed with vector including nucleic acid encoding mutant IFNG. Conjugant of mutant with PEG is obtained by pegilation, wherein said conjugant has increased half-life time in serum and reduced immunogenicity. Obtained IFNG polypeptide is useful in pharmaceutical composition for treatment and prevention of interstitial pulmonary diseases.

EFFECT: mutant gamma-interferon with enhanced utilization of natural N-glycosilation site in 97 place in contrast with natural form of huIFNG.

43 cl, 3 dwg, 4 tbl, 11 ex

FIELD: microbiological and medicine industry, gene and protein engineering.

SUBSTANCE: disclosed is recombinant plasmide DNA pU8HBc-preS1. Said plasmide encodes chimerical protein gene of hepatitis B virus core antigen bearing pre-S1 region (27-37 a.b.) epitope of hepatitis B virus surface protein. Also disclosed is bacterium strain Escherichia coli DH5αF'/pU8HBc-preS1, bearing of such plasmide and producing hybrid protein HBc-preS1.

EFFECT: invention useful in medicine.

2 cl, 8 dwg, 3 ex

FIELD: immunotherapy, medicine.

SUBSTANCE: disclosed is fusion protein, including stress protein and HBV protein. Said protein after administration to patient indices or enhances of immune response against HBV protein. Also disclosed are nucleic acids containing such protein, pharmaceutical composition, vectors and method for protein production. Moreover disclosed are methods for inducing or enhancing of immune response against HBV protein.

EFFECT: improved composition for immune response against HBV protein.

46 cl, 17 dwg, 3 ex

FIELD: biotechnology, in particular tumor immunotherapy.

SUBSTANCE: invention relates to monovalent and divalent single-stranded (diantibody) Fv-fragments (scFv) of antibodies obtained by using of extracted RNA producing of hybridoma Mab CB/ior-CEA.1. Antibodies fragments according to the invention have predetermined amino acid sequence (such as defined in sequence list), are specific to human CEA, have CEA affinity constant of (5.0±0.4)x10-9 l/mol for monovalent fragment and (2.8±0.3)x10-10 l/mol for diantibody. Disclosed is application of abovementioned fragments in pharmaceutical compositions for treatment of human CEA-expressing tumors and determination of tumor localization in vivo. Described is modified cell expressing said antibody fragment, as well as multicellular genetically modified organism such as transgenic plant. ScFv fragments of monovalent antibody and diantibody have no Fc-domains and have smaller molecule size than mice Mab and as a result fragments are better penetrate in tissue in vivo and have less immunogenic action in living body.

EFFECT: antibody fragments with improved specificity to human cancer-embryonic antigen.

12 cl, 6 dwg, 8 tbl, 9 ex

FIELD: medicine; biology.

SUBSTANCE: method involves introducing vector containing DNA-sequence into area under protection encoding T-cadgerin and being capable of providing its expression in target tissue or cells compatible with target tissue cells transected with said vector in advance and selected with respect to T-cadgerin expression level. The method has been tested on model system by implanting Matrigel to mice. Reliable implant mass-, implant hemoglobin contents- and capillary and medium-sized blood vessel number reduction has been observed in experimental animals, receiving cells L929 (clone TC3) expressing T-cadgerin, in two weeks after the injection.

EFFECT: enhanced effectiveness in treating pathological states with new blood vessel formation being suppressed.

7 cl, 8 dwg

FIELD: immunology, biotechnology.

SUBSTANCE: described are rabies virus-neutralizing antibody and fragments thereof; method for treatment of subject being affected by rabies virus using said antibody and fragments thereof. Disclosed are variants of isolated nucleic acids, encoding polypeptides bearing light and/or heavy antibody strain, respectively. Disclosed is expression vector bearing at least one from abovementioned nucleic acids. The invention makes it possible to increase subject survival after rabies virus attack.

EFFECT: method for prophylaxis and treatment of rabies virus infections.

14 cl, 1 tbl, 5 ex

FIELD: biotechnology.

SUBSTANCE: the present innovation deals with amplifying (PCR-assay) the fragment of ovine prion protein gene that includes 3 main informative codons - 136, 154, 171. On finishing PSR-assay the amplicons prepared should be hybridized with sequencing primers to diagnose gene nucleotide sequence in 3 most informative codons (136, 154 and 171) in on-line mode at simultaneous detection of 7 amino acids (A, R, Q, H, V, T and K) due to applying the technology of pyrosequencing. It is important to detect the genotype the type of which helps to conclude upon ovine resistance to scrapie based upon pre-established classes of genetic resistance G1-G5. The innovation enables to carry out diagnostics of ovine resistance to a pathogenic prion at a genotype level at high accuracy and at lower labor intensity.

EFFECT: higher accuracy and efficiency of genodiagnostics.

2 dwg, 3 tbl

FIELD: biotechnology, gene engineering, pharmaceutical industry, medicine.

SUBSTANCE: method for production of recombinant placental growth factor (PLGF) includes culturing of modified prokaryotic cells containing inducible expression system of PLGF to produce OD600 of 14-50, followed by expression inducing, extraction, purification and solubilizing of inclusion bodies; enriching of obtained mixture with dimer a multimer form of expressed protein by anion exchange chromatography and isolation of PLGF preferably in dimmer form by reversed-phase chromatography.

EFFECT: method for PLGF production with high specific activity and high yield.

27 cl, 5 dwg, 5 ex

FIELD: chemical-pharmaceutical industry, biochemistry, medicine.

SUBSTANCE: invention relates to a liposome directly effecting on αvβ3-integrin receptors and comprising cationic amphiphilic substance including 1,2-dioleoyloxy-3-(N,N,N-trimethylammonium)propane chloride, neutral lipid, lipid with a direct effect having domain with a direct effect and hydrophobic domain bound with domain of a direct effect, and nucleic acid forming complex with cationic lipid. Cationic lipid presents in the amount from about 1 to about 50 molar % and indicated lipid with a direct effect presents in the amount from about 1 to about 20 molar % wherein molar percents are calculated as measured for the total number of lipid moles in liposome. Domain with a direct effect comprises a nonpeptide antagonist of αvβ3-integrin comprising 4-[2-(3,4,5,6-tetrahydropyrimidin-2-ylamino)ethyloxy]-benzoyl-2-(S)-aminoethylsulfonamino-β-alanine (compound 10) bound covalently with hydrophilic domain by amide bond. Also, invention relates to a method for inhibition of angiogenesis and involving administration to a patient needing in inhibition of angiogenesis a liposome in the therapeutically effective dose that directly effects on αvβ3-integrin receptors and comprising nucleic acid that is able to express a protein or peptide suppressing angiogenesis.

EFFECT: valuable properties of system.

27 cl, 2 tbl, 18 dwg, 8 ex

FIELD: medicine; biology.

SUBSTANCE: method involves introducing vector containing DNA-sequence into area under protection encoding T-cadgerin and being capable of providing its expression in target tissue or cells compatible with target tissue cells transected with said vector in advance and selected with respect to T-cadgerin expression level. The method has been tested on model system by implanting Matrigel to mice. Reliable implant mass-, implant hemoglobin contents- and capillary and medium-sized blood vessel number reduction has been observed in experimental animals, receiving cells L929 (clone TC3) expressing T-cadgerin, in two weeks after the injection.

EFFECT: enhanced effectiveness in treating pathological states with new blood vessel formation being suppressed.

7 cl, 8 dwg

FIELD: biochemistry, biotechnology, peptides.

SUBSTANCE: invention relates to protein of molecular mass 12000 Da isolated from medicinal leech saliva (Hirudo medicinalis) comprising 6 cysteine residues able to form bonds -S-S-, and pI value about 3.7. The novel protein possesses ability to block platelets adhesion induced by collagen. As result of screening cDNA library of H. medicinalis a novel gene of new inhibitor of adhesion is identified and its nucleotide sequence is determined. Invention describes a method for preparing recombinant form of protein involving transformation of suitable cells with vector comprising DNA sequence encoding inhibitor, culturing cells under condition providing its expression and isolation of expressed protein. Invention proposes using natural and recombinant forms of inhibitor in therapy states associated with vessels congestion and diseases of circulatory system, and for treatment of articles surface made of natural and artificial collagen.

EFFECT: valuable biological and medicinal properties of polypeptide.

17 cl, 10 dwg, 13 ex

FIELD: pharmaceuticals.

SUBSTANCE: claimed method includes composition containing mannan-binding lectin and treatment of conditions associated with deficit of mannan-binding lectin, causing susceptibility to infective disorders. Also disclosed is method for production of new expression structure encoding human mannan-binding lectin.

EFFECT: method for production of new human mannan-binding lectin.

47 cl, 8 ex, 5 dwg

FIELD: gene engineering, in particular preparation based on PDGF-BB, useful in therapy, veterinary, diagnosis, tissue culturing.

SUBSTANCE: invention relates to PDGF-BB production using Pichia pastoris 2-2 strain as producer of human platelet growth factor. Produced two-dimensional PDGF-BB form is characterized with purity of 95 %, specific activity of 3-5 ED50/ng, and expression level in yeast up to 0.1 g/l of culture.

EFFECT: two-dimensional PDGF-BB form with high purity, specific activity and expression level in yeast.

5 cl, 11 dwg, 5 ex

FIELD: genetic engineering, biotechnology, biochemistry, medicine, pharmacy.

SUBSTANCE: invention relates to DNA encoding glycoprotein VI (GP VI) used as a base for synthesis of recombinant GP VI by method of recombinant DNAs followed by its using for the development of pharmaceutical compositions possessing with capacity for inhibiting or blocking interaction of platelets with collagen. Using the invention provides preparing GP VI in the recombinant form and using this agent for therapeutic aims.

EFFECT: valuable medicinal properties of glycoprotein VI.

6 cl, 4 dwg, 6 ex

FIELD: biotechnology, gene engineering, medicine.

SUBSTANCE: polypeptide (IL-li) is obtained by recombinant DNA technology having activity of interleukin-1-alpha and interleukin-1-beta inhibitor. Disclosed is DNA sequences encoding inhibitor precursor and maturated form thereof. Described is method for production of vector constructs containing said DNA sequences, as well as transformed cells producing of recombinant IL-li.

EFFECT: method for large-scale production of interleukin-1-beta inhibitor, useful in medicine.

21 cl, 26 dwg, 11 ex

FIELD: biotechnology, in particular production of modified swine factor VIII (POL1212).

SUBSTANCE: DNA molecule encoding of modified swine factor VIII is cloned in expression vector, having functionality in mammalian cells. Modified swine factor VIII protein is obtained by cultivation of mammalian cell line BHK CRL-1632 (ATCC), BHK 1632, or CHO-K1, transfected with vector. Therapeutic composition for treatment of subjects suffering from deficit of factor VIII, such as haemophilia, contains effective amount of swine factor VIII protein.

EFFECT: effective agent for treatment of factor VIII deficit.

13 cl, 8 dwg, 7 ex

FIELD: medicine, biotechnology, pharmacy.

SUBSTANCE: invention relates to exchangers of ligand/receptor specificity delivering antibodies to receptors on pathogen. In particular, invention describes variants related to manufacturing and using exchangers of ligand/receptor specificity. Exchangers comprise at least one specificity domain containing ligand for receptor wherein ligand is not antibody or its part, and at least one antigenic domain combined with abovementioned specificity domain wherein antigenic domain comprises epitope of pathogen or toxin. Advantage of the invention involves enhanced specificity in delivery of drug.

EFFECT: improved and valuable properties of exchangers.

30 cl, 5 tbl, 6 ex

Up!