Heterologous expression of neisseria proteins

FIELD: biotechnology, microbiology, molecular biology.

SUBSTANCE: invention relates to a method for the heterologous expression of proteins in Neisseria meningitides in E. coli cells. The protein to be expressed possesses the immunogenic activity with respect to the parent strain of Neisseria meniningitidis. The claimed invention provides the higher effectiveness in preparing immunogenic proteins.

EFFECT: improved method for preparing proteins.

6 cl, 40 dwg, 23 ex

 

The technical FIELD

This invention relates to the field of protein expression. In particular, it refers to the heterologous expression of proteins from Neisseria (e.g., N. gonorrhoeae, or preferably N. meningitidis).

BACKGROUND of the INVENTION

International patent application WO 99/24578, WO 99/36544, WO 99/57280 and WO 00/22430 describe proteins of Neisseria meningitidis and Neisseria gonorrhoeae. These proteins are usually described as expressed in E. coli (i.e. heterologous expression) in the form of either N-terminal GST-hybrids, or C-terminal His-tagged-hybrids, although described other expression systems, including expression in native Neisseria.

The purpose of this invention is to provide alternative and improved approaches for heterologous expression of these proteins. These approaches usually affect the level of expression, ease of cleaning, cellular localization, expression and/or immunological properties of the expressed protein.

The nomenclature used here

2166 sequences of proteins described in WO 99/24578, WO 99/36544 and WO 99/57280, called here the following SEQ ID NO:

ApplicationSequences of proteinsSEQ ID NO: here
WO 99/24578The even-numbered SEQ ID NO:2-892SEQ ID NO1-446
WO 99/36544The even-numbered SEQ ID NO:2-90
WO 99/57280The even-numbered SEQ ID NO:2-3020 Even-numbered SEQ ID NO:3040-3114 SEQ ID NO:3115-3241SEQ ID NO:492-2001

SEQ ID NO:2002-2039

SEQ ID NO:2040-2166

In addition to this SEQ ID NO: uses the standard names used in WO 99/24578, WO 99/36544 and WO 99/57280 (for example, 'ORF4', 'ORF40', 'ORF40-1', etc. that are used in WO 99/24578 and WO 99/36544; 'm919', 'g919' and 'a', etc. that are used in WO 99/57280).

2160 proteins NMB0001-NMB2160 of Tettelin et al. [Science (2000) 287:1809-1815] are referred to here as SEQ ID NO:2167-4326 [see also WO 00/66791].

The term "protein of this invention" as applied here refers to a protein containing

(a) one of the sequences SEQ ID NO:1-4326; or

(b) a sequence having sequence identity relative to one of SEQ ID NO:1-4326; or

(C) a fragment of one of SEQ ID NO:1-4326.

The degree of sequence identity"referred to in (b)is preferably higher than 50% (e.g., 60%, 70%, 80%, 90%, 95%, 99% or more). This includes mutants and allelic variants (for example, see WO 00/66741). The identity is preferably determined by the search algorithm homology Smith-Waterman available in the MPSRCH program (Oxford Molecular), using search affine gap with the parameters of the fine opening gap=12 and fine extension gap=1. Usually 50 %or higher identity between the two proteins is considered an indication of functional equivalence.

Fragment", referred to in (C), must contain at least n consecutive amino acids of one of SEQ ID NO:1-4326 and, depending on the particular sequence, n is 7 or more (e.g., 8, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100 or more). Preferably, the fragment contains the epitope of one of SEQ ID NO:1-4326. Preferred fragments are those fragments described in WO 00/71574 and WO 01/04316.

Preferred proteins of the present invention found in the serological group b N. meningitidis.

Preferred proteins for use in accordance with this invention are proteins of strain or strain 2996 394/98 (new Zealand strain) N. meningitidis sero-group C. If not otherwise mentioned herein proteins are proteins from strain 2996 N. meningitidis. However, it should be clear that this invention is not limited to the strain. References to specific protein (e.g., '287', '919', etc. can be aware of this protein from any strain.

Non-hybrid expression

In the first approach to a heterologous expression is not used hybrid partner and uses natural leader peptide (if present). Usually this will prevent "interference" from hybrid partners and may alter the cellular localization and/or post-translational modification and/or laying in a heterologous host.

So the m way this invention provides a method heterologous expression of the protein of the present invention, in which (a) is not used hybrid partner, and (b) uses a natural leader peptide (if present) of a given protein.

The method generally includes a step of obtaining a vector for expression of the protein of the present invention, so that the first expressed amino acid is the first amino acid (methionine) of the indicated protein, as expressed last amino acid is the last amino acid of the specified protein (i.e., the codon preceding the natural STOP codon).

This approach is preferably used for the expression of the following proteins using natural leader peptide: 111, 149, 206, 225-1, 235, 247-1, 274, 283, 286, 292, 401, 406, 502-1, 503, 519-1, 525-1, 552, 556, 557, 570, 576-1, 580, 583, 664, 759, 907, 913, 920-1, 936-1, 953, 961, 983, 989, Orf4, Orf7-1, Orf9-1, Orf23, Orf25, Orf37, Orf38, Orf40, Orf40.1, Orf40.2, Orf72-1, Orf76-1, Orf85-2, Orf91, Orf97-1, Orf119, Orf143.1, NMB0109 and NMB2050. The suffix "L"is used here in the name of the protein indicates that the expression is using natural leader peptide.

Proteins that are preferentially expressed using this approach, do not use hybrid partner, and which have no natural leader peptide, include: 008, 105, 117-1, 121-1, 122-1, 128-1, 148, 216, 243, 308, 593, 652, 726, 926, 982, Orf83-l and Orf143-1.

Mostly this method is used for the expression of ORF5 or ORF40, leading to the protein, which induces the best bactericidal antibodies than GST - or His-hybrids.

This approach is particularly suitable for the expression of lipoprotein.

Replacement leader peptide

The second approach to heterologous expression of natural leader peptide of the protein of the present invention replace the leader peptide of another protein. In addition, it is preferable not to use a hybrid partner. Although the use of native leader peptide of the protein in heterologous hosts can often localize this protein in its "natural" cell location, in some cases, this leader sequence is not recognized efficiently heterologous host. In such cases might be used instead of the leader peptide, which is known that it can effectively direct the targeting of the protein.

Thus, this invention provides a method heterologous expression of the protein of the present invention, in which (a) leader peptide of this protein replaced by a leader peptide of a different protein, and, optionally, (b) not used hybrid partner.

This method usually involves stages: obtaining a nucleic acid that encodes a protein of the present invention; manipulation of specified nucleic acid for the removal of nucleotides that encode the leader peptide of this be the ka, and introduction of nucleotides that encode the leader peptide of another protein. The obtained nucleic acid may be embedded in expressing vector, or it may already be part of an expressing vector. Expressed protein will consist of the replacement of the leader peptide at the N-end, followed by the protein of the present invention without its leader peptide.

Leader peptide is preferably a leader peptide of another protein of this invention (e.g., one of SEQ ID NO:1-4326), but may be, for example, also protein of E. coli (e.g., leader peptide OmpA) or protein of Erwinia carotovora (for example, a leader peptide PelB).

Especially applicable replacement leader peptide is a leader peptide ORF4. This leader is able to manage limitirovanie in E. coli, improving cellular localization, and is particularly applicable for protein expression 287, 919 and AG287. In particular, it is applicable also leader peptide and N-terminal domains 961.

Other applicable replacement leader peptide is a leader peptide OmpA of E. coli. This leader is able to manage the membrane localization of E. coli. It is particularly preferred for the expression of ORF1, leading to the protein, which induces the best bactericidal antibodies than hybrid proteins and the protein expressed from its native leader peptide.

Other applicable replacement leader is the first peptide is MKKYLFSAA. He can direct secretion into the culture medium and is very short and very active. The application of this leader peptide is not limited to the expression of proteins of Neisseria - it can be used for regulating the expression of any protein (in particular, bacterial proteins).

The deletion of the leader peptide

In the third approach to heterologous expression of natural leader peptide of the protein of the present invention is delegated. In addition, it is preferable not to use a hybrid partner.

Thus, this invention provides a method heterologous expression of the protein of the present invention, in which (a) leader peptide of this protein is delegated and, optionally, (b) not used hybrid partner.

This method usually involves stages: obtaining a nucleic acid that encodes a protein of the present invention; manipulation of specified nucleic acid for the removal of nucleotides that encode the leader peptide of this protein. The obtained nucleic acid may be embedded in expressing vector, or it may already be part of an expressing vector. The first amino acid expressed protein will be the first amino acid of the Mature natural protein.

This method can increase the levels of expression. For example, for protein 919 levels of expression of ve. coli are much higher when the deletion of the leader peptide. Increased expression may be due to altered localization in the absence of the leader peptide.

This method is preferably used for expression 919, ORF46, 961, 050-1, 760 and 287.

The expression of domain-based

In the fourth approach to heterologous expression of the protein is expressed in the form of domains. It can be used in connection with hybrid systems (for example, GST - or His-hybrids).

Thus, this invention provides a method heterologous expression of the protein of the present invention, in which (a) at least one domain in this protein delegated and, optionally, (b) not used hybrid partner.

This method usually involves stages: obtaining a nucleic acid that encodes a protein of the present invention; manipulation of specified nucleic acid to remove at least one domain of this protein. The obtained nucleic acid may be embedded in expressing vector, or it may already be part of an expressing vector. If you do not use hybrid partners, the first amino acid expressed protein will be the first amino acid domain of this protein.

Protein is usually divided into theoretical domains by comparing it with known sequences in databases with subsequent determination of sites of protein, which detect different from each other pattern matching.

This method is preferably used for the expression of protein 287. This protein can be theoretically divided into three domains, called a, b and C (see figure 5). Domain largely settled with the IgA-protease domain With substantially matched with transferentially proteins, and domain And does not detect a significant mapping with sequence databases. Mapping of polymorphic forms 287 described in WO 00/66741.

After separation of protein domains, they can (a) be expressed separately, (b) be delegated from this protein, for example, protein ABCD→ABD, ACD, BCD, etc. or (C) to regroup, for example, protein ABC→ASV, CAB, etc., These three strategies can be combined, if desired, with a hybrid partners.

ORF46 was also theoretically divided into two domains - the first domain (amino acids 1-433), which is highly conservative among species and serological groups, and a second domain (amino acids 433-608), which is largely conservative. This second domain is preferably delegate. Mapping of polymorphic forms ORF46 described in WO 00/66741.

Protein 564 was also divided into domains (figure 8), as well as protein 961 (figure 12) and protein 502 (amino acids 28-167 protein is C58).

Hybrid proteins

In the fifth approach to heterologous expression of two or more (for example, 3, 4, 5, 6 or more) proteins of this invention are expressed in the form of a single hybrid protein. It is preferable that was not used hybrid partner, not related to Neisseria (e.g., GST or poly-His).

This gives two advantages. First, a protein that may be unstable or poorly expressed separately, can overcome these shortcomings by adding a suitable hybrid partner, which overcomes this problem. Secondly, simplified commercial receipt must use only one expression and purification to obtain two separately applicable proteins.

Thus, this invention provides a method of simultaneous heterologous expression of two or more proteins of the present invention, which hybridize the two or more proteins of the present invention (i.e., they are translated as a single polypeptide chain).

The method usually involves the following stages: obtaining a first nucleic acid that encodes a first protein of the present invention; obtaining a second nucleic acid that encodes a second protein of the present invention; ligating the first and second nucleic acids. The obtained nucleic acid may be embedded in expressing vector or may be there is to be a part of expressing the vector.

Preferably, the components of proteins in the hybrid protein of the present invention are proteins from the same strain.

Hybrid proteins in the Chimera can be connected directly or can be linked via a linker peptide, for example, through polyglycine linker (i.e. Gnwhere n=3, 4, 5, 6, 7, 8, 9, 10 or more) or via a short peptide sequence that facilitates cloning. Obviously, it is preferable not to join ΔG-protein to the C-end polyglycine linker.

Hybrid proteins can be deprived of their natural leader peptides, or may include the sequence of the leader peptide N-terminal hybrid partner.

This method is convenient for the expression of protein orf1, orf4, orf25, orf40, Orf46/46.1, orf 83, 233, 287, 292L, 564, 687, 741, 907, 919, 953, 961 and 983.

Preferred are 42 hybrid specified "X" in the following table, the formula NH2-A-B-COOH:

↓And B→ORF46.1287741919953961983
ORF46.1XXXXXX
287XXXXXX
741XXXXXX
919XXXXXX
953XXXXXX
961XXXXXX
983XXXXXX

Thus, the preferred proteins for expression as hybrids are ORF46.1, 287, 741, 919, 953, 961 and 983. They can be used in their essentially full form or can be used to form polyglycerol deletion (Δ (G) (for example, ΔG-287, ΔGTbp2, ΔG741, ΔG983 etc) or can be used shortened forms (for example, Δ1-287, A2-287 and so on) or a version with delegated domains (for example, W, S, WS, ORF461-433, ORF46433-608, ORF46, s etc).

Especially preferred are: (a) a hybrid protein containing 919 287; (b) a hybrid protein containing 953 287; (C) a hybrid protein containing 287 and ORF46.1; (d) a hybrid protein containing the th ORF1 and ORF46.1; (e) a hybrid protein containing 919 and ORF46.1; (f) a hybrid protein containing ORF46.1 and 919; (g) a hybrid protein containing ORF46.1, 287 and 919; (h) a hybrid protein containing 919 and 519; and (i) a hybrid protein containing ORF97 and 225. Other options are shown in figure 14.

When applying 287 it is preferably located at the C-terminal side of the hybrid; if it should be used at the N end, it is preferable to use ΔG-form 287 (such as N-end hybrid with ORF46.1, 919, 953 or 961).

When applying 287 it is preferably from strain 2996 or from strain 394/98.

When applying 961 it is preferably at N-end. Can be used to form domains 961.

Mapping of polymorphic forms ORF46, 287, and 953 919 described in WO 00/66741. Any of these polymorphic forms can be used in accordance with this invention.

Temperature

In the sixth approach to heterologous expression of proteins of the present invention is expressed at a low temperature.

Expressed proteins of Neisseria (e.g., 919) can be toxic to E. coli, which can be avoided by the expression of the toxic protein at a temperature at which its toxicity does not occur.

Thus, this invention provides a method heterologous expression of the protein of the present invention, in which the expression of the protein of the present invention is carried out at temperature is re, when the toxic activity of the protein does not occur.

The preferred temperature is the temperature around 30°C. It is especially suitable for expression 919.

Mutations

As discussed above, the expressed proteins of Neisseria can be toxic to E. coli. This toxicity can be avoided by moderowaniem protein to reduce or eliminate toxic activity. In particular, to reduce or eliminate toxic enzymatic activity can be used mutation, preferably using site-directed mutagenesis.

Thus, in the seventh approach to heterologous expression expressed protein mutate to reduce or eliminate toxic activity.

Thus, this invention provides a method heterologous expression of the protein of the present invention, in which the protein mutate to reduce or eliminate toxic activity.

This method is preferably used for the expression of protein 907, 919 or 922. A preferred mutation in the 907 is a mutation at Glu-117 (for example, Glu→Gly); preferred mutations in 919 are mutations in Glu-255 (for example, Glu→Gly) and/or Glu-323 (for example, Glu→Gly); preferred mutations in 992 are mutations in Glu-164 (e.g., Glu→Gly), Ser-213 (e.g., Ser→Gly) and/or Asn-348 (e.g., Asn→Gly).

Alternate the vectors

In the eighth approach to heterologous gene expression to protein expression using alternative vector. This may be done, for example, to improve the outputs of expression or to use plasmids, already confirmed for GMP applications.

Thus, this invention provides a method heterologous expression of the protein of the present invention, in which use alternate vector. Alternative vector is preferably S214, without hybrid partners. Leader peptides can be included or may not be included.

This approach is applicable, in particular for protein 953. Expression and localization 953 with its natural leader peptide expressed from S214 is much better than from vector pet.

Vector S214 can also be used with: ΔG287, Δ2-287, Δ3-287, Δ4-287, Orf46.1, 961L, 961, 961(M), s, s-L, 919, 953 ΔG287-Orf46.1.

Other suitable vector is pET-24b (Novagen; uses resistance to kanamycin), also without the use of hybrid partners. pET-24b is preferred for use with: ΔG287K, Δ2-C, Δ3-C, Δ4-C, Orf46.1-K, Orf46A-K, 961 (M), a-961b-K, 961c-K, s-L-K, 961d-K ΔG287-919-K ΔG287-Orf46.1-ΔG287-961-K.

Multimeric form

In the ninth approach to heterologous protein expression Express or cleaned in such a way that it adopts spiral is ing a multimeric form.

This approach is particularly suitable for protein 953. Cleaning one specific multimeric forms 953 (Monomeric form) gives a protein with a higher bactericidal activity than other forms (dimeric form).

Protein 287 and protein 919 can be cleaned in dimeric forms.

Protein 961 can be cleaned in the form of oligomers 180 kDa (for example, in the form of a tetramer).

Limitirovanie

In the tenth approach to heterologous expression of the protein is expressed in the form limitirovannoe protein.

Thus, this invention provides a method heterologous expression of the protein of the present invention, in which this protein is expressed in the form limitirovannoe protein.

This method is applicable, in particular, for the expression 919, 287, ORF4, 406, 576-1 and ORF25. Polymorphic form 919, 287 and ORF4 are described in WO 00/66741.

This method usually involves the application of a suitable leader peptide without the use of N-terminal hybrid partner.

C-terminal deletions

In the eleventh approach to heterologous expression of the C-end of the protein of the present invention is mutated. In addition, it is preferable not to use a hybrid partner.

Thus, this invention provides a method heterologous expression of the protein of the present invention, in which (a) the C-terminal site is mutated and, optionally, (b) not use the is hybrid partner.

This method usually involves stages: obtaining a nucleic acid that encodes a protein of the present invention; manipulation of specified nucleic acid mutation engine nucleotides that encode the C-terminal part of this protein. The obtained nucleic acid may be embedded in expressing vector, or it may already be part of an expressing vector. The first amino acid expressed protein will be the first amino acid of the Mature natural protein.

The mutation may be a substitution, insertion or, preferably, by the deletion.

This method can increase the levels of expression, in particular for proteins 730, ORF29 and ORF46. For protein 730 may be deleterows C-terminal site of about 65 to about 214 amino acids; protein ORF46, may be delegated to the C-terminal site of about 175 amino acids; for ORF29 protein, can be deleterows-end, leaving about 230-370 N-terminal amino acids.

Mutation of the leader peptide

In the twelfth approach to heterologous expression of the leader peptide of the protein is mutated. This is especially applicable for the expression of protein 919.

Thus, this invention provides a method heterologous expression of the protein of the present invention, in which the leader peptide of the protein is mutated.

This method usually involves stages: obtaining the NUS is einevoll acid, encodes a protein of the present invention; and manipulating the specified nucleic acid mutation engine nucleotides in the leader peptide. The obtained nucleic acid may be embedded in expressing vector, or it may already be part of an expressing vector.

Deletion of polyglycine

In the thirteenth approach to heterologous expression polyglycine sites are mutated. This enhances the expression of the protein.

Polyglycidyl the plot is the sequence (Gly)nwhere n≥4 (e.g., 5, 6, 7, 8, 9 or more). This site mutate for the destruction or removal (Gly)n. This can be accomplished by deletion (for example, CGGGGS→CGGGS, CGGS, CGS or CS), replacement (for example, CGGGGS→CGXGGS, CGXXGS, CGXGXS etc) and/or by insertion (for example, CGGGGS→CGGXGGS, CGXGGGS etc).

This approach is not limited to proteins of Neisseria - it can be used for any protein (in particular, for bacterial proteins) to enhance heterologous expression. However, for proteins of Neisseria it is especially suitable for the expression of 287, 741, 983 and Tbp2. Mapping of polymorphic forms 287 described in WO 00/66741.

Thus, this invention provides a method heterologous expression of the protein of the present invention, in which (a) polyglycidyl plot in a given protein is mutated.

This method usually involves stages: obtaining kleinova acid, encodes a protein of the present invention; and manipulating the specified nucleic acid mutation engine nucleotides that encode polyglycidyl plot in the sequence of a given protein. The obtained nucleic acid may be embedded in expressing vector, or it may already be part of an expressing vector.

On the contrary, can be used the opposite approach (i.e. introduction polyglycine plots) to suppress or reduce the expression of specific heterologous protein.

Heterologous host

Although the expression of the proteins of this invention can occur in the natural host (i.e. in the organism in which the protein is expressed in nature), the invention uses a heterologous host. Heterologous host may be prokaryotic or eukaryotic. Preferably it is E. coli, but other suitable hosts include Bacillus subtilis. Vibrio cholerae, Salmonella typhi. Salmonella typhimurium, Neisseria meningitidis, Neisseria gonorrhoeae, Neisseria lactamica, Neisseria cinerea, Mycobacteria (e.g., M. tuberculosis), yeast, etc. Vectors etc.

In addition to the above-described methods, the invention provides (a) a nucleic acid and vectors applicable in these ways; (b) cell host containing these vectors; (C) proteins are expressed or can be expressed in these ways; (a) composition, with the holding of these proteins, which can be suitable, for example, as a vaccine or as a diagnostic reagents, or as immunogenic compositions; (e) the composition for use as a drug (such as vaccines) or as diagnostic reagents; (f) the use of these compositions for the production of: (1) drugs for treatment or prophylaxis of infections caused by bacteria Neisseria; (2) a diagnostic reagent for detecting the presence of bacteria Neisseria or antibodies induced against bacteria Neisseria, and/or (3) reagent, which can induce antibodies against bacteria Neisseria; and (g) a method of treating a patient comprising the administration to a patient a therapeutically effective amount of songs.

Sequence

This invention also provides a protein or nucleic acid having any of the sequences disclosed in the following examples. It also provides proteins and nucleic acids having sequence identity to these sequences. As described above, the degree of sequence identity" is preferably higher than 50% (e.g., 60%, 70%, 80%, 90%, 95%, 99% or more).

In addition, the invention provides nucleic acid which can gibridizatsiya with nuclein the second acid, described in the examples, preferably under conditions of "high stringency" (for example, at 65°in the solution of 0.1×SSC, 0.5% of LTOs).

The invention also provides nucleic acid encoding a protein in accordance with this invention.

It should be clear that this invention provides a nucleic acid containing a sequence complementary to the sequences described above (for example, for antisense purposes sensing).

Nucleic acids in accordance with this invention can be obtained, of course, in different ways (for example, by chemical synthesis, from the libraries of genomic DNA or cDNA, from the organism itself, and so on) and can be represented in different forms (for example, single-stranded, double-stranded, vectors, probes, etc).

In addition, the term "nucleic acid" includes DNA and RNA, as well as their analogues, such as containing modified skeletons, and peptidoglicanova acid (NCP), etc.

Brief description of drawings

Figures 1 and 2 show the design used for the expression of proteins using heterologous leader peptide.

Figure 3 shows the data expression for ORF1, and figure 4 shows similar data for protein 961.

Figure 5 shows the domains of the protein 287, and figures 6 and 7 show deletions in domain A.

Fig is RA 8 shows the domains of the protein 564.

Figure 9 shows the reporter gene PhoC, adjustable leader peptide 919, and figure 10 shows the results obtained with the use of mutants of this leader peptide.

Figure 11 shows insertional mutants of protein 730 (A:730-C1;: 730-C2).

Figure 12 shows the domains of the protein 961.

Figure 13 shows the electrophoresis of the LTO-PAG ΔG-proteins. Points indicate the main recombinant product.

Figure 14 shows 26 hybrid proteins of the present invention.

WAYS of CARRYING out the INVENTION

Example 1-919 and its leader peptide

Protein 919 from N. meningitidis (serological group b strain 2996) has the following sequence:

Leader peptide is underlined.

Sequence 919 from other strains shown in figures 7 and 18 WO 00/66741.

Example 2 WO 99/57280 describes the expression of a protein 919 in the form of His-hybrid in E. coli. This protein is a good exposed on the surface of the immunogen.

For 919 used three alternative strategies:

919 without its leader peptide (and without cysteine of the Mature N-Terminus) and without any hybrid partner ('919unlabeled,):

Leader peptide and the cysteine was removed by the construction of the 5'-end amplification primer during transcription (right) from the predicted leader consequently the property.

2) 919 with its own leader peptide, but without any hybrid partner ('919L'); and

919 with a leader peptide (MKTFFKTLSAAALALILAA) of ORF4 ('9190rf4').

To obtain this construction, the full sequence encoding a leader peptide ORF4, included in the 5'-primer in the form of the tail (primer 919Lorf4 For (direct)). The restriction site NdeI generated double substitution of nucleotides in the sequence encoding the leader of ORF4 (unchanged amino acids)to allow hybridization of different genes with the sequence of the leader peptide ORF4. A stop codon was included in all of the 3'end primernye sequence.

All three forms of this protein expressed, and they could be cleared.

Both expression product '919L' and '919LOrf4' was lidirovali, as shown by incorporation of [3H]-palmitate label. 919unlabelednot included3H-tag and was aquilizan intracellular.

919LOrf4 could be cleaned more easily than 919L. It was purified and used for immunization of mice. The obtained serum gave excellent results in tests FACS and ELISA, as well as in the bactericidal test. It was shown that this lipoprotein is localized in the outer membrane.

919unlabeledgave excellent ELISA titers and high serum bactericidal activity. Analysis of fluorescence excitation FACS is otverdel its localization on the cell surface.

Example 2 - 919 and the temperature of the expression

The growth of E. coli expressing the protein 919LOrf4 at 37°S, led to lysis of these bacteria. To overcome this problem, the recombinant bacteria were grown at 30°C. Lysis was prevented without preventing expression.

Example 3 - mutation 907, 919 and 922

It has been hypothesized that proteins 907, 919 and 922 are moreinitially and, more specifically, political transglycosylase. Moreinvites localized on the outer membrane and are involved in degradation of peptidoglycan.

Thus, the purified proteins 919unlabeled, 919LOrf4, 919-His (i.e., His-tag at the C-end) and 922-His had moreinvites activity [Ursinus and Holtje (1994) J. Bact. 176:338-343]. Used two different analyses, one that defines the degradation of insoluble moorainbow sacculi on soluble muropeptides, and the other measuring the destruction of the poly (MurNAc-GlcNAc)n>30-piganovich chains.

The first analysis uses murinova sacculi, radioactively labeled meso-2,6-diamino-3,4,5- [3H]pipelinewall acid as substrate. The enzyme (just 3-10 µg) were incubated for 45 minutes at 37°in a total volume of 100 μl containing 10 mm Tris-maleate (pH 5.5), 10 mm MgCl2, 0,2% vol./about. Triton X-100 and [3H]And2/min labeled marinovich saccol (about 10,000 pulses/min). The test mixture was placed on ice for 15 minutes with 100 μl of 1% vol./mass is N-acetyl-N,N,N-trimethylammonium for 15 minutes and the precipitated material was collected by centrifugation at 10000 g for 15 minutes. The radioactivity of the supernatant was measured by liquid scintillation counting. Soluble lytic transglycosylase Slt70 E. coli was used as a positive control for this assay; negative control consisted of the above test solution without enzyme.

All proteins, except 919-His gave positive results in the first analysis.

The second analysis governs the hydrolysis of poly(MurNAc-GlcNAc)-piganovich circuits. Cleaned the chain, poly (MurNAc-GlcNAc )n>30labeled N-acetyl-D-1- [3H]-glucosamine, incubated with 3 µg 919L in 10 mm Tris-maleate (pH 5.5), 10 mm MgCl2and 0.2% vol./about. The Triton X-100 for 30 minutes at 37°C. the Reaction was stopped by boiling for 5 minutes and the pH of the sample is brought up to approximately 3.5 by adding 10 ál of 20%.about. phosphoric acid. Substrate and product were separated by reversed-phase HPLC on a column of C18Nucleosil 300, as described Harz et al. [Anal. Biochem. (1990) 190:120-128]. Lytic transglycosylase MItA E. coli was used as positive control in this assay. Negative control was performed in the absence of the enzyme.

Using this assay was demonstrated ability 919LOrf4 to hydrolyze a dedicated circuit glican when amitotically subunit was separated from the oligosaccharide by HPLC.

Protein 919Lorf4 was chosen for kinetic analyses. Activity 919Lof4 increased 3.7 times the addition of 0.2%.about. Triton X-100 in test buffer. The presence of Triton X-100 had no effect on the activity 919unlabeled. The effect of pH on enzyme activity was determined in Tris-maleate buffer over the range of 5.0 to 8.0. It was determined that the optimum pH for this reaction was a 5.5. Over the temperature range 18-42°With maximum activity was observed at 37°C. the Effect of various ions on moreinvites activity was determined by carrying out the reaction in the presence of various ions at a final concentration of 10 mm. The maximum activity was detected Mg2+that stimulated activity 2.1 times. Mn2+and CA2+also stimulated the enzymatic activity to a similar extent, while Ni2+and EDTA had no significant action. In contrast, as Fe2+and Zn2+largely inhibited enzymatic activity.

The structure of the reaction products originating from the splitting of unlabeled moorainbow sacculi E. coli was analyzed by reversed-phase HPLC, as described Glauner [Anal. Biochem. (1988) 172:451-464]. Murinova sacculi, split muramidase Cellosyl, used for calibration and standardization column Hypersil ODS. The main reaction products were 1,6-anhydrobiotic-Tetra - and tri-peptides, demonstrating the formation of intramolecular communication from 1,6-ang is tomerarenai acid.

These results experimentally demonstrate that the 919 is oreingeali and, in particular, a member of the family of lytic enzymes transpires. In addition, the ability 922-His to hydrolyze murinova sacculi suggests that this protein is also political translocality.

This activity may explain the toxic effects 919 upon expression in E. coli.

To eliminate the enzymatic activity used rational mutagenesis. 907, 919 and 922 discover quite low homology with three membrane-bound limitirovanie lytic murein-transglycosylase from E. coli:

919 (441 amino acids) 27.3% identical over overlapping 440 amino acids from E. coli MLTA (P46885);

922 (369 amino acids) by 38.7% identical over 310 overlapping amino acids MLTB E. coli (P41052); and

907-2 (207 amino acids) 26.8% identical over 149 overlapping amino acids MLTC E. coli (P52066).

907-2 has homology with MLTD E. coli (P23931) and Slt70 (R), soluble political transglycosylases, which is localized in periplasmatic space. Failed to detect significant homology among 919, 922 and 907-2, and the same applies to the corresponding proteins of MLTA, MLTB and MLTC.

Crystal structure available for Slt70 [1QTEA; 1QTEB; Thunnissen et al. (1995) Biochemistry 34:12729-12737] and for Slt35 [1LTM; 1QUS; 1QUT; van Asselt et al. (1999) Structure Fold Des 7:1167-80], which are the two which is the soluble form of MLTB 40 kDa.

The catalytic residue (glutamic acid) was identified as for Slt70 and MLTB.

In the case of Slt70 studies using mutagenesis showed that even conservative replacement catalytic Glu505 by glutamine (Gln) causes a complete loss of enzyme activity. Although Slt35 has no obvious sequence similarity with Slt70, their catalytic domains find amazing similarities. The corresponding catalytic residue in MLTB is Glu162.

Another residue, which is thought to be playing an important role in the correct installation of the enzymatic cleft, is a very conservative glycine (Gly) to the right of glutamic acid. Recently Terrak et al. [Mol. Environ. (1999) 34:350-64] suggested the presence of another important residue, which is an aromatic amino acid, located at about 70-75 residues to the right of the catalytic glutamic acid. Comparison of sequences of Slt70 with 907-2 and MLTB with 922 performed in order to identify the appropriate catalytic residues in the MenB antigens.

Two mappings in the area of the catalytic domain are presented below:

907-2/Slt70:

922/MLTB

From these mappings, it follows that the corresponding catalytic glutamate in 907-2 is Glu117, whereas in 922 he is Gl164. Both antigen have also shared glycine to the right (in the direction of transcription), which could play a structural role in laying the enzymatic slit (bold), and 922 has a conservative aromatic residue at about 70 amino acids to the right (bold).

In the case of protein 919 structure 3D is not available for E. coli-homologous MLTA, and nothing is known about the possible catalytic residue. However, it is projected that three amino acids in 919 are catalytic residues, according to the mapping with MLTA:

919/MLTA

These three potential catalytic residue shown by the symbol ▾:

1) Glu255 (Asp MLTA), then three conserved glycine (Gly263, Gly265 and Gly272) and three conserved aromatic residue located at about 75-77 residues on the right. These are located to the right of the remains shows.

2) Glu323 (conservative in MLTA), then 2 conservative glycine (Gly347 and Gly355) and two conservative aromatic residue, located at 84-85 residues to the right (Tug or Phe407). These balances are shown on the right ⋄.

3) Asp362 (instead of the expected Glu), then one glycine (Gly369) and conservative aromatic residue (Thr). These residues during transcription (right) shows O.

Mapping of polymorphic forms 919 described in WO 00/66741.

On the basis of p is escasany catalytic residues were generated by three mutant 919 and one mutant 907, containing, each, only the replacement of amino acids. Glutamic acid at position 255 and 323 and aspartic acid at position 362 protein 919 and glutamic acid at position 117 protein 907 were replaced by glycine residues using SDM on the basis of PCR. For this purpose were designed internal primers containing the replaced codon Glu or Asp Gly:

The underlined nucleotides encode glycine; mutated nucleotides are shown in lowercase letters.

To obtain mutants 919-E, 919-A and 919-E PCR was performed using 20 ng DNA pET-919LOrf4 as template and the following primer pairs:

1) Orf4L direct/919-E reverse

2) 919-E direct/919L reverse

3) Orf4L direct/919-E reverse

4) 919-E direct/919L reverse

5) Orf4L direct/919-D362 reverse

6) 919-D362 direct/919L reverse

The second round PCR was performed using the PCR product 1-2, 3-4 or 5-6 as template and forward and reverse primers "Orf4L direct" and "919L reverse", respectively.

For mutant 907-E PCR was performed using 200 ng of chromosomal DNA of strain 2996 as template and the following primer pairs:

7) 907L direct/907-E reverse

8) 907-E direct/907b reverse

The second round PCR was performed using PCR products 7 and 8 as matrices and oligonucleotides "907L direct" and "907L reverse" as Primero is.

PCR fragments containing each mutation were treated in accordance with standard procedure, was digested with restrictase NdeI and XhoI and cloned into the vector pet-21b+. The presence of each mutation was confirmed by sequencing.

Mutation Glu117 in Gly in 907 conducted in a similar manner with a mutation of residues Glu164, and Ser213 Asn348 in 922.

Mutant E255G 919 detect 50%reduction of the activity;

mutant E323G detects 70% reduction in activity; mutant E362G does not detect a decrease in activity.

Example 4 - a multimeric form

287-GST, 919unlabeledand 953-His was subjected to gel filtration analysis of the Quaternary structure or for preparative purposes. The molecular weight of natural proteins was determined using gel-filtration columns Superose 12 (H/R 10/30) or Superdex 75 FPLC (liquid Express chromatography of proteins) (Pharmacia). The buffers used for chromatography for 287, 919 and 953 were 50 mm Tris-HCl (pH 8.0), 20 mm Bicin (pH 8.5) and 50 mm Bicin (pH 8.0), respectively.

Additionally, each buffer contained 150-200 mm NaCl and 10% vol./about. glycerol. Proteins were dialyzed against a suitable buffer and was applied in a volume of 200 µl. Gel filtration was performed with a low flow rate of 0.5-2.0 ml/min and the eluate was subjected to monitoring at 280 nm. Fractions were collected and analyzed by electrophoresis in LTO-PAG. Dye dextranase blue 2000 and the standards molecule the Noah mass of the ribonuclease A, chymotrypsin A, ovalbumin, albumin (Pharmacia) was used for calibration of the column. The molecular weight of the sample was determined from the calibration curve Kavagainst log Mrstandards. Before the gel filtration 287-GST were digested with thrombin for removal of GST-part.

Certain molecular weight to 287, and 953 919-His were equal to 73 kDa, 47 kDa and 43 kDa, respectively. These results suggest that the 919 is Monomeric, whereas 287 and 953, each, are dimeric in their nature. In the case of 953-His, during gel filtration was observed two peaks. The main peak (80%) were dimeric conformation 953, whereas the minor peak (20%) had the expected size of the monomer. It was found that the Monomeric form of the 953 has a higher bactericidal activity than the dimer.

Example 5 - vectors pSM214 to pet-24b

Protein 953 with its natural leader peptide and non-hybrid partners expressed from vector pet, as well as from pSM214 [Velati Bellini et al. (1991) J. Biotechnol. 18, 177-192].

The sequence 953 cloned as full-length gene in S214 using E. coli strain M-1 as master. For this the complete DNA sequence of a gene 953 (from the ATG to the STOP codon) amplified via PCR using the following primers:

953L direct./2 CCGGAATTCTTATGAAAAAAATCATCTTCGCCGC Eco RI

953L back./2 GCCCAAGCTTTTATTGTTTGGCTGCCTCGATT Hind III

which contain the website plays the guitar and sings the AI EcoRI and HindIII, respectively. Amplificatory fragment was digested EcoRI and HindIII and ligated with the vector S214 cleaved with the same two enzymes. Legirovannoi plasmid was transformed into cells of E. coli MM294-1 (by incubation on ice for 65 minutes at 37° (C) and bacterial cells were sown on LB-agar containing 20 μg/ml chloramphenicol.

Recombinant colonies were grown over night at 37°With 4 ml of LB-broth containing 20 μg/ml chloramphenicol;

bacterial cells were centrifuged and plasmid DNA was extracted and analyzed by restriction EcoRI and HindIII. For analysis of the ability of recombinant colonies to Express the protein they were inoculable in LB-broth containing 20 μg/ml of chloramphenicol, and let them grow for 16 hours at 37°C. the Bacterial cells were centrifuged and resuspendable in SFR. The expression of the protein was analyzed by electrophoresis in LTO-SDS page and staining Kumasi blue.

The levels of expression from plasmids S214 were unexpectedly high.

Oligonucleotides used for cloning sequences in the vectors S214, were as follows:

These sequences were subjected to manipulation, cloned and expressed as described for 953L.

For vector pet-24 sequence cloned and the protein expressed in the pet-24, ka is described below for RET. RET has the same sequence as the pet-21, but with the cartridge resistance to kanamycin instead of cassettes resistance to ampicillin.

Oligonucleotides used for cloning of the sequence into the vector pet-24b, were as follows:

* This primer was used as reverse primer for all forms 287.

§Direct primers used in combination with reverse primer ΔG278

Example 6 - ORF1 and its leader peptide

Predicted ORF1 from N. meningitidis (serological group b, the strain MS) is a protein of the outer membrane or secretively protein. It has the following sequence:

Leader peptide is underlined.

Polymorphic form ORF1 described in WO 99/55873.

Three strategies of expression used for ORF1:

1) ORF1 using His-tag, according to WO 99/24578 (ORF1-His);

2) ORF1 with its own leader peptide, but without any hybrid partner ('ORF1L'); and

ORF1 with the leader peptide (MKKTAIAIAVALAGFATVAQA) from E. coli OmpA ('OrflLOmpA'):

To obtain this design clone pET911LOmpA (see below) was digested with restrictase NheI and XhoI and the fragment corresponding to the vector bearing the leader sequence of the OmpA, was purified (pETLOmpA). Gene ORF1, encoding Mature the th protein, amplified using oligonucleotides ORF1-For (direct) and ORF1-Rev (reverse) (including the restriction sites NheI and XhoI, respectively), were digested Nhel and XhoI and ligated with the purified fragment pETOmpA (see figure 1). Using Nhel site has introduced additional dipeptide AS.

Expressed all three forms of this protein. His-tagged protein could be purified, and it was confirmed that it is exposed on the surface and is probably secretively (see figure 3). This protein was used for immunization of mice, and the resulting serum was given excellent results in bactericidal test.

ORF1LOmpA was purified in the form of total membranes, and it has been localized to both the internal and external membranes. Unexpectedly, serum, induced against ORF1LOmpA find even more good properties in ELISA and bactericidal properties than serum, induced against His-tagged protein.

ORF1L was purified in the form of outer membranes in which it is localized.

Example 7 protein 911 and its leader peptide

Protein 911 from N. meningitidis (serological group b, the strain MS) has the following sequence:

Leader peptide is underlined.

Three strategies of expression used for 911:

1) 911 with its own leader peptide, but without any hybrid partner ('911L');

2) 911 with learn the m peptide of the OmpA of E. coli ('911LOmpA').

To obtain this construction, the full sequence encoding a leader peptide OmpA included in the 5'-primer in the form of the tail (primer 911LOmpA direct). The restriction site NheI was built between sequence that encodes a leader peptide OmpA, and the gene encoding the predicted Mature protein (embedding one amino acid, serine), so this design could be used for cloning of various genes located to the right of the sequence of the leader peptide OmpA.

3) 911 with a leader peptide (MKYLLPTAAAGLLLAAQPAMA) from Erwinia carotovora PelB ('911LpelB').

To obtain this structure of the 5'-end PCR primer was designed to the right of the leader sequence and included the restriction site NcoI to have 911, heriditary directly with the leader of the PelB sequence; the 3'end of the primer included a STOP codon. Expressing vector was pET22b+ (Novagen), which carries the coding sequence for the leader peptide PelB. The NotI site introduces additional methionine after the PelB sequence.

Expressed all three forms of this protein. The ELISA titers were higher when using 911L, and 919LOmpA also gave good results.

Example 8 - ORF46

Complete protein ORF46 from N. meningitidis (serological group b strain 2996) has the following sequence:

Leader of pepti is underlined.

Sequence ORF46 from other strains predstaleny in WO 00/66741.

Three strategies of expression used for ORF46:

1) ORF46 with its own leader peptide, but without any hybrid partner ('ORF46-2L');

2) ORF46 without its leader peptide and without any hybrid partner ('ORF46-2'), and the leader peptide was excluded by the design of the 5'-end primer amplification to the right of the predicted leader sequence:

3) ORF46 in the form of a truncated protein consisting of the first 433 amino acids ('ORF46.1L'), designed by the formation of PCR primers for amplification of a partial sequence corresponding to amino acids 1-433. 3'-terminal sequence of the primer included a STOP codon.

ORF46-2L is expressed at very low levels in E. coli. Destruction of its leader peptide (ORF46-2) does not solve this problem. However, a shortened form ORF46.1L (first 433 amino acids that are conservative between serological groups and species) is expressed well and gives excellent results in the test, ELISA and bactericidal test.

ORF46.1 used also on the basis of hybrid proteins. His hybridized with 287, 919 and ORF1. Hybrid proteins were generally insoluble, but gave somewhat good results in ELISA and bactericidal test (against homologic the th strain 2996):

ProteinELISABactericidal Ab
Orf1-Orf46.1-His850256
919-Qrf46.1-His12900512
919-287-Orf46-Histhe concentration isthe concentration is
Qrf46.1-287His1508192
Orf46.1-919His28002048
Orf46.1-287-919His320016384

For comparison, designed "triple" hybrids ORF46.1, 287 (either in the form of GST-hybrid or in the form of ΔG287) and 919 and tested them against different strains (including the homologous strain 2996) compared with a simple mixture of these three antigens. FCA (full beta-blockers) was used as adjuvant:

2996BZ232MSNGH38F6124BZ133
Mixture81922565121024>2048>2048
ORF46.1-287-919his163842564096819281928192
ΔG287.919-ORF46.1his8192644096192 819216384
ΔG287-ORF46.1-919his409612825681925121024

And in this case, these hybrids find equivalent or superior immunological activity.

Hybrids of the two proteins (strain 2996) was compared with individual proteins against heterologous strains:

1000MSF6124 (MenA)
ORF46.1-His<44096<4
ORF1-His8256128
ORF1-ORF46.1-His10245121024

Again the hybrid detects equivalent or superior immunological activity.

Example 9 - protein 961

Complete protein 961 from N. meningitidis (serological group b, the strain MS) has the following sequence:

Leader peptide is underlined.

Used three approaches to expression 961:

1) 961 using GST-hybrid, according to WO 99/57280 ('GST961');

2) 961 with its own leader peptide, but without any hybrid partner ('961L'); and

3) 961 without its leader peptide and without any hybrid partner ('96 its'), and the leader peptide is removed by the construction of the 5'-end PCR primer to the right of the predicted leader sequence.

Expressibility all three forms of the protein. GST-hybrid protein could be purified, and with antibodies against him was confirmed that 961 exposed on the surface (figure 4). This protein was used for immunization of mice, and the serum gave excellent results in bactericidal test. 961L could also be cleaned up and gave a very high ELISA titers.

It turned out that the protein 961 is variable in relation to the phase. In addition, it is found in all strains of N. meningitidis.

Example 10 - protein 287

Protein 287 from N. meningitidis (serological group b strain 2996) has the following sequence:

Leader peptide is underlined.

Sequence 287 from other strains can be found in figures 5 and 15 WO 00/66741.

Example 9 WO 99/57280 describes the expression of 287 in the form of GST-hybrid in E. coli.

Used several complementary approaches to the expression of 287 in E. coli, including:

1) 287 in the form of His-tagged hybrid ('287-His');

2) 287 with its own leader peptide, but without any hybrid partner ('287L');

3) 287 with a leader peptide ORF4 and without any hybrid partner ('287LOrf4'); and

287 without its leader peptide and without any killed odnogo partner ('287 unlabeled'):

All of these proteins, it was possible to Express and purify. '2871' and '287LOrf4' were confirmed as lipoproteins.

As shown in figure 2, '287LOrf4'designed by splitting 919LOrf4 NheI and XhoI. Full leader peptide ORF4 was reduced by adding a DNA sequence that encodes the missing amino acids in the form of a tail at the 5'end primer (287LOrf4 direct), heriditary with coding 287 sequence. Gene 287 encoding the Mature protein, amplified using oligonucleotides 287LOrf4 (forward and reverse) (includes sites NheI and XhoI, respectively), were digested NheI and XhoI and ligated with the purified fragment pETOrf4.

Example 11 additional non-hybrid proteins with natural leader peptides or without natural leader peptides

A similar approach was used for expression in E. coli of additional proteins from WO 99/24578, WO 99/36544 and WO 99/57280.

These proteins are expressed without hybrid partner: 008, 105, 117-1, 121-1, 122-1, 128-1, 148, 216, 243, 308, 593, 652, 726, 982 and Orf143-1. Using FACS, it was confirmed that the protein 117-1 exposed on the surface, and he gave high titers in ELISA.

The following proteins expressed from natural leader peptide, but without hybrid partner: 111, 149, 206, 225-1, 235, 247-1, 274, 283, 286, 292, 401, 406, 502-1, 503, 519-1, 525-1, 552, 556, 557, 570, 576-1, 580, 583, 664, 759, 907, 913, 920-1, 926, 936-1, 53, 961, 983, 989, Orf4, Orf7-1, Orf9-1, Orf23, Orf25, Orf37, Orf38, Orf40, Orf40.1, Orf40.2, Orf72-1, Orf76-1, Orf85-2, Orf91, Orf97-1, Orf119, Orf143.1. These proteins have the suffix 'L'.

His-tagged protein 760 expressed its leader peptide and without its leader peptide. Deletion of the signal peptide significantly increased the levels of expression. This protein could be most easily cleaned using a 2 M urea for solubilization.

His-tagged protein 264 well expressively using its own signal peptide, and a protein of 30 kDa gave positive results in Western blot analysis.

All the proteins successfully expressibility.

Was confirmed localization 593, 121-1, 128-1, 593, 726 and 982 in the cytoplasm.

Was confirmed localization 920-1L, 953L, ORF9-1L, ORF85-2L, ORF97-1L, 570L, 580L and 664L in periplasm.

It was confirmed that ORF40L localized in the outer membrane, and 008 and 519-1L localized in the inner membrane. Proteins ORF25L, ORF4L, 406L, 576-1L, has been shown to be localized in the membrane.

It was found that protein 206 is not a lipoprotein.

ORF25 and ORF40, expressed with their natural leader peptides, but without hybrid partners, and protein 593, expressed without its natural leader peptide and non-hybrid partner, induced good bactericidal serum. Suddenly, forms ORF25 and ORF40, expressed without hybrid partners and using their own the military leader peptides (i.e. 'ORF25L' and 'ORF40'), give the best results in bactericidal test than hybrid proteins.

Proteins 920L and 953L were subjected to N-terminal sequencing of obtaining HRVWVETAH and ATYKVDEYHANARFAF, respectively. This sequencing confirms that the predicted leader peptide was tsapralis, and, when combined with periplasmatic localization, this confirms that these proteins accurately processionals and localized E. coli with the expression of their natural leader peptides.

N-terminal sequence of the protein 519.1L, localized in the inner membrane, was MEFFIILLA that indicates that the leader sequence is not split. Thus, it can function as neotdalennyh leader sequence and the transmembrane anchor, like a leader peptide RVR of N. gonorrhoeae [Ropp and Nicholas (1997) J. Bact. 179:2783-2787]. Indeed, the N-terminal site reveals a strong hydrophobic character and, as predicted by the Tmpred program., is a transmembrane.

Example 12 - lipoprotein

The incorporation of palmitate in recombinant lipoproteins demonstrated using the method of Kraft et al. [J. Bact. (1998) 180:3441-3447]. Separate colonies, bearing interest plasmid, were grown overnight at 37°With 20 ml liquid culture in LB/Amp (100 μg/ml). The culture was diluted to OD5500.1 to 5.0 ml of fresh LB medium/Amp containing 5 ICC is/ml [ 3H]palmitate (Amersham). When OD550this culture reached 0.4 to 0.8, recombinant lipoprotein induced within 1 hour IPTG (isopropylthioxanthone) (final concentration 1.0 mm). Bacteria were collected by centrifugation in a tabletop centrifuge at 2700 g for 15 minutes and washed twice with 1.0 ml of cold SPR. Cells resuspendable in 120 μl of 20 mm Tris-HCl (pH 8.0), 1 mm EDTA, 1.0% weight/volume LTOs and literally by boiling for 10 minutes. After centrifugation at 13,000 g for 10 minutes the supernatant was collected, and the proteins precipitated with addition of 1.2 ml of cold acetone and left for 1 hour at -20°C. Protein was besieged by centrifugation at 13000 g for 10 minutes and resuspendable in 20-50 µl (as calculated for the standardization of the application in respect of the final OD of the culture) 1.0% weight/volume ordinator. An aliquot 15 ál of boiled water with 5 μl of buffer for sample electrophoresis LTO-page and analyzed by electrophoresis in LTO-PAG. After electrophoresis the gels were fixed for 1 hour in 10% vol./about. acetic acid and soaked for 30 min in Amplify solution (Amersham). The gel was dried in a vacuum when heated and exposed on film Hyperfilm (Kodak) overnight at -80°C.

The inclusion of [3H] palmitate label confirming limitirovanie, was detected for the following proteins: Orf4L, Orf25L, 287L, 287LOrf4, 406L, 576L, 926L, 919L and 919LOrf4.

Example 13 - the domain is in 287

Based on the homology of the various sections 287 to proteins that belong to different Funktsionalnyi classes, it was divided into three "domain", as shown in figure 5. The second domain reveals homology with IgA protease, and a third domain reveals homology with transferentially proteins.

Each of the three "domains" finds varying degrees of conservatism sequence between strains of N. meningitidis - domain With the same 98%of the domain And is identical to 83%, while the domain is identical In only 71%. It should be noted that protein 287 in strain MS is a 61 amino acid longer than protein 287 strain 2996. The juxtaposition of these two sequences are shown in figure 7, and mappings for different strains described in WO 00/66741 (see figures 5 and 15 of the application).

These three domains expressed individually in the form of His-tagged at the C-end of the protein. This was performed for strains MS and 2996 using the following structures: a-MS (AA 1-202), 287b-MC58 (aa 203-288), s-MS (AA 311-488).

A-2996 (AA 1-139), 287b-2996 (AA 140-225), s-b (AA 250-427), (AA = amino acids).

To obtain these structures in the 3'end of the primer was removed, the sequence of the stop codon. the 5'primer included a Nhel restriction site and the 3'primers included a XhoI in the form of the tail to clone each of the amplified fragment in expressing vector 21b+ the use of the restriction sites NdeI-XhoI, NheI-XhoI or NdeI-HindIII.

All six designs could be expressed, but the design 287b-MC58 demanded denaturation and re-styling to solubilize.

Deletion of the domain As described below ('Δ4 287-His').

Immunological data (serum bactericidal assay) were also obtained using different domains from strain 2996 against homologous and heterologous strains of MenB and MenA (strain F6124) and MenC (strain BZ133):

2996BZ232MSNGH38394/98MenAMenC
287-His320001640964096512800016000
287(B)-His256----16-
287(C)-His256-32512322048>2048
287(B-C)-His6400012840966400010246400032000

Using domains strain MS received the following results:

MC582996BZ232NGH38394/98MenAMenC
287-His409632000164096512800016000
287(B)-His128128----128
287(C)-His-16-1024-512-
287(B-C)-His16000640001286400051264000>8000

Example 14 - deletions in 287

In addition to the expression of individual domains, 287 also expressed (as labeled on the end of His-tagged protein) with a progressive deletions in the first domain.

Used four deletion mutant protein 287 from strain 2996 (figure 6):

1) '287-His'consisting of amino acids 18-427 (i.e., delegated leader peptide);

2) 'Δ1 287-His'consisting of amino acids 26-427;

3) 'Δ2 287-His'consisting of amino acids 70-427;

4) 'Δ3 287-His'consisting of amino acids 107-427; and

5) 'Δ4 287-His'consisting of amino acids 140-427 (=287-bc).

Protein 'Δ4' received for strain MS ('Δ4 MS-His"; amino acids 203-488).

These con is e.g. received in the same way, as a/b/C, as described above.

All six designs could be expressed and the protein could be purified. However, the expression 287-His was very weak.

Expression was also high in the absence of C-terminal His-tags.

Immunological data (serum bactericidal assay) were also obtained with these deletion mutants against homologous (2996) and heterologous strains of MenB and MenA (strain F6124) and MenC (strain BZ133):

2996BZ232MSNGH38394/96MenAMenC
287-his320001640964096512800016000
Δ1 287-His16000128409640961024800016000
Δ2 287-His160001284096>204851216000>8000
Δ3287-His160001284096>204851216000>8000
Δ4287-His64000128409664000024 6400032000

The same high activity for Δ4-deletions were observed using the sequence from strain MS.

Thus, by detecting the superior characteristics of the expression of these mutants are also immunologically equivalent or superior.

Example 15 - polyglycine deletions

Design 'Δ1 287-His' previous example differs from 287-His and '287unlabeledonly a short N-terminal deletion (GGGGGGS). However, the use expressing vector, which replaces delegated the serine codon present in the cloning site NheI, leads to deletions only (Gly)6. Thus, it was shown that this (Gly)6sequence exerts a very strong effect on the expression of the protein.

Protein lacking N-terminal amino acids up to GGGGGG, called "ΔG287". In the strain MS its main sequence (leader peptide is underlined) below:

ΔG287, with His-tagged or without His-tag ('ΔG287-His' and 'ΔG287K', respectively), is expressed at very good levels in comparison with the '287-His' or '287unlabeled'.

On the basis of data on the variability of genes, variants ΔG287-His expressed in E. coli from a number of MenB strains, in particular from strain 2996, MS, 1000 and BZ232. The results of the s were also good.

An assumption was made that the poly-Gly-deletion can be a primary strategy for improving the expression. Thus, the identified other lipoproteins MenB containing (Gly)n-motives (near the N-Terminus, to the right of cysteine), namely Tbp2 (NMB0460), 741 (NMB1870) and 983 (NMB1969):

Tbp2 genes and 741 were from strain MS; 983 genes and 287 were from strain 2996. They were cloned into the vector pet and expressed in E. coli without sequence that encodes their leader peptides, or in the form "ΔG-form, in both cases hybridized with C-terminal His-tag. In each case observed the same effect - the expression was good in clones carrying a deletion polyglycidol plot, and weak or absent, if glycine was present in the expressed protein:

ORFExpressionCleanBactericidal activity
287-His2996)+/-++
'287unlabeled'(2996)+/-the concentration isthe concentration is
ΔG287-His(2996)+++
ΔG287(2996)+++
ΔG287-His(MC58)++ +
ΔG287-His(1000)+++
ΔG287-His(BZ232)+++
Tbp2-His(MC58)+/-the concentration isthe concentration is
ΔGTbp2-His(MC58)++
741-His(MS)+/-the concentration isthe concentration is
ΔG741-His(MC58)++
983-His (2996)
ΔG983-His(2996)++

Electrophoresis in LTO-page is shown in figure 13.

ΔG287 and hybrids

Squirrels ΔG287 received and cleared for strains MS, 1000 and BZ232. Each of them gave high titers in ELISA, and serum bactericidal titers >8192. ΔG287K expressed from pet-24b, gave excellent titers in ELISA and serum bactericidal test. ΔG287-ORF46.1 can also be expressed in the pet-24b.

ΔG287 hybridized in reading frame to the left (against the course of transcription) 919, 953, 961 (sequences shown below) and ORF46.1:

EUSABactericidal test
ΔG287-953-His383465536
ΔG287-961-His10862765536

Bactericidal efficiency (homologous strain) antibodies induced against hybrid proteins, compared with antibodies induced against simple mixtures of components antigens (using 287-GST) to 919 and ORF46.1:

The mixture 287Hybrid ΔG287
91932000128000
ORF46.112816000

Received data bactericidal activity against heterologous strains of MenB and against serotypes a and C:

512
919ORF46.1
StrainMixtureHybridMixtureHybrid
NGH38102432000-16384
MS5128192-512
BZ232512512--
MenA(F6124)32000-8192
MenC (C11)>2048>2048--
MenC(BZ133)>409664000-8192

Thus, the hybrid proteins with ΔG287 on the N-end outperform immunological simple mixture, and ΔG287-ORF46.1 is particularly effective, even against heterologous strains. ΔG287-ORF46.1 can be expressed in the pet-24b.

Such hybrid proteins were obtained using the new Zealand strain 394/98, not 2996:

ΔG983 and hybrids

Bactericidal titers obtained in response to ΔG983 (His-hybrid), was measured against various strains, including homologous strain 2996:

2996NGH38BZ133
ΔG983512128128

ΔG983 expressed also in the form of a hybrid with ORF46.1, 741, 961 or s on it-the end:

ΔG741 and hybrids

Bactericidal titers obtained in response to ΔG741 (His-hybrid), was measured against various strains, including homologous strain 2996:

2996MSNGH38F6124BZ133
ΔG741512131072>204816384>2048

As you can see, induced ΔG741 bactericidal titer is particularly high against the heterologous strain MS.

ΔG741 hybridized directly in the frame read from left to proteins 961, s, 983 and ORF46.1.

Example 16 - C-terminal hybrids ('merge') with 287/ΔG287

According to this study, hybrids of two proteins a and b can be either NH2-A-B-COOH or NH2-B-A-COOH. The effect of this difference was investigated using protein 287 or C-end (in the form of '287-His')or N-Terminus (in the form ΔG287 sequences shown above) 919, 953 and ORF46.1. Used a panel of strains, including a homologue of CNY strain 2996. FCA was used as adjuvant:

287 And 919287 and 953287 and ORF46.1
StrainΔG387-919919-287ΔG287-953953-287ΔG287-46.146.1-287
299612800016000655368192163848192
BZ232256128128<4<4<4
10002048<4<4<4<4<4
MS81921024163841024512128
NGH38320002048>20484096163844096
394/9840963225612812816
MenA(F6124)320002048>20483281921024
MenC(BZ133)64000>8192>8192<16 81922048

The best bactericidal titers usually observed with 287 N-end (ΔG-form).

When hybridization with protein 961 (NH2-ΔG287-961-COOH sequence shown above) obtained protein is insoluble and must denaturirate and reatuarants for cleaning. It was found that after renaturation about 50% of this protein remained insoluble. Soluble and insoluble proteins were compared and a much better bactericidal titers were obtained with soluble protein (using FCA adjuvant):

2996BZ232MSNGH38F6124BZ133
Instant655361284096>2048>20484096
Insoluble8192<4<416not ODA.not ODA.

However, the titles with an insoluble form was improved with the use of alum as adjuvant:

Insoluble327681284096>2048>20482048

The use of the 17 - N-terminal hybrids ('merge') with 287

Expression of protein 287 as full-length protein with C-terminal His-tag or without leader peptide, but with C-terminal His-tag gives a fairly low levels of expression. The best expression is achieved using N-terminal GST-hybrid.

As an alternative to using GST as N-terminal hybrid partner, 287 were placed on the C-end of the protein 919 ('919-287'), protein 953 ('953-287') and proteins ORF46.1 ('ORF46.1-287'). In both cases, the leader peptides were delegated and hybrids were direct hybrids in reading frame.

To generate hybrid 953-287 leader peptides of these two proteins were removed by constructing a direct primer during transcription (right) from the leader of each sequence; the sequence of the stop codon was removed in the reverse primer 953, but included in the reverse primer 287. For gene 953 5' and 3' primers used for amplification included the restriction sites NdeI and BamHI, respectively, while for amplification of gene 287 5' and 3' primers included the restriction sites BamHI and XhoI, respectively. This way could be achieved consistent directional cloning of these two genes in 21b+using NdeI-BamHI (for cloning of the first gene) and then BamHI-XhoI (for cloning of the second gene).

Hybrid 919-287 was obtained by cloning the sequence that encodes zrelo is part 287, in the XhoI site at the 3'-end 919-His-clone in 21b+. The primers used for amplification of gene 287, designed by the introduction of a restriction site SalI at the 5'- and XhoI site at the 3'end of the PCR fragment. Because the sticky ends produced by restrictase SalI and XhoI, are compatible PCR product 287, split SalI-XhoI, could be built into the clone 21b-919, split XhoI.

Hybrid ORF46.1-287 was obtained in a similar manner. Bactericidal activity against the homologous strain) antibodies induced against hybrid proteins, compared with antibodies induced against simple mixtures of components antigens:

The mixture 287Hybrid 287
9193200016000
95381928192
ORF46.11288192

Received data bactericidal activity against heterologous strains of MenB and against serotypes a and C for 919-287 and 953-287:

919953ORF46.1
StrainMixtureHybridMixtureHybridMixtureHybrid
MS51210245121024-1024
NGH381024204820484096-4096
BZ232512128102416--
MenA(F6124)5122048204832-1024
MenC(C11)>2048not ODA.>2048not ODA.-not ODA.
MenC(BZ133)>4096>8192>4096<16-2048

Designed hybrids ORF46.1 and 919. The best results (four times higher titers) were achieved with 919 N-end.

Experienced hybrids 919-519His, ORF97-225His and 225-ORF97His. They gave moderate titers of ELISA and moderate antibacterial humoral responses.

Example 18 - a leader peptide of OKF4

As shown above, the leader peptide ORF4 can be hybridized with Mature sequence of other proteins (e.g. proteins 287 and 919). He is able to adjust limitirovanie in E. coli.

Example 19 - domains in 564

Protein '564' is very large (2073 amino acids), and e is about difficult to clone and Express in its full form. To facilitate the expression of this protein was divided into four domains, as shown in figure 8 (in accordance with the sequence MS):

DomainAndInD
Amino acids79-360361-731732-20442045-2073

These domains find the following homologies:

Domain And reveals homology with other bacterial toxins:

gb|AAG03431.|AE estimated hemagglutinin [Pseudomonas aeruginosa] (38%)

gb|AAC31981.1I(139897) HecA [Pectobacterium chrysanthemi] 45% emb|CAA36409.1|(h) filamentous hemagglutinin [Bordetella pertussis] (31%)

gb|AAC79757.1|(AF057695) large protein 1 supernatant [Haemophilus ducreyi] (26%)

gb|AAA25657.1 I(M30186) predecessor HpmA [Proteus mirabilis] (29%)

Domain does not detect homology and is specific to 564.

Domain With homology detects with:

gb|AAF84995.1|AE ON-like secretory protein [Xylella of] (33%)

gb|AAG05850.1|AE004673 hypothetical protein [Pseudomonas aeruginosa] (27%)

gb|AAF68414.1 AF237928 prospective FHA [Pasteurella multocisida] (23%)

gb|AAC79757.1|(AF057695) large protein 1 supernatant [Haemophilus ducreyi] (23%)

pir||S21010 predecessor FHA In [Bordetella pertussis] (20%)

Domain D reveals homology with other bacterial toxins:

gb|AAF84995.1|AE 14-like secretory protein [Xylella of] (29%)

With what ispolzovaniem sequence of strain MS received good intracellular expression of protein 564b in the form of GST-hybrid (without cleaning) and His-tagged protein; this pair of domains expressives also in the form of lipoproteins, which showed moderate expression in a fraction of the outer membranes/supernatant.

Domain b has found moderate intracellular expression when the expression in the form of His-tagged product (without cleaning) and a good expression in the form of GST-hybrid.

Domain showed a good intracellular expression as GST-hybrid, but was insoluble. The domain d has found moderate intracellular expression in the form of His-tagged product (without treatment). A couple of cd domains found moderate intracellular expression (without treatment) in the form of GST-hybrid.

Good titles in the bactericidal assay was observed with the use of domain pairs and domains bc.

Example 20 - leader peptide 919

20-dimensional leader peptide from 919 discussed in example 1 above:

MKKYLFRAAL YGIAAAILAA

As shown in example 1, the deletion of this leader improves heterologous expression, and the replacement of the leader peptide ORF4. The influence of the leader 919 expression was investigated by hybridization of this coding sequence with a reporter gene PhoC from Morganella morganii [Thaller et al. (1994) Microbiology 140:1341-1350]. This design has cloned in plasmid RET-b between Sagami NdeI and XhoI (figure 9):

The level of expression of PhoC from this plasmid is more than 200 times lower than for the same is instrukcii, but containing natural signal peptide PhoC. The same result was obtained even after replacing the promoter T7 promoter Plac E. coli. This means that the influence of the leader sequence 919 expression is not dependent promoter.

For the study, determined whether the observed results of some feature of the nucleotide sequence of the signal peptide 919 (formation of secondary structure, sensitivity to RNase and so on) or instability of the protein induced by the presence of the signal peptide, has received a number of mutants. The used approach was to replace the nucleotide sequence of the signal peptide 919 cloning of synthetic linkers containing degenerate codons. In this way received mutants with substitutions of nucleotides and/or amino acids.

Used two different linker designed for producing mutations in two different regions of the sequence of the signal peptide 919, in the first 19 P.N. (L1) and between the bases 20-36 (S1).

Mapping some of the obtained mutants is given below.

L1 mutants:

S1-mutants:

As shown in the comparisons of these sequences, the majority of the analyzed mutants contain in the frame is cityware deletions, which unexpectedly produced by the cells of the host.

Selection of mutants was performed by transformation of cells of E. coli BL21(DE3) using DNA obtained from a mixture of mutated clones L1 and S1. Individual transformants were subjected to screening for high activity PhoC sowing their stroke on LB-cups containing 100 μg/ml ampicillin, 50 μg/ml methyl green, 1 mg/ml FDA (phenolphthaleine). In this environment, producing PhoC cells became green (figure 10).

Quantitative analysis of PhoC produced by these mutants was performed in liquid medium using pNPP as a substrate for activity PhoC. The specific activity measured in cell extracts and supernatant mutants, grown in liquid medium for 0, 30, 90, 180 minutes were as follows:

CELL EXTRACTS

SUPERNATANT

Some of these mutants produce high quantities of PhoC, and, in particular, the mutant 9L1a can secrete PhoC into the culture medium. This is noteworthy, as the sequence of the signal peptide of this mutant has a length of only 9 amino acids. This is the shortest signal peptide described to date.

Example 21 - C-terminal deletions Maf-related proteins

MafB-related proteins include 730, ORF46 and ORF29.

Protein 730 from MS has the following sequence:

Leader peptide is underlined.

730 detects properties similar to ORF46 (see example 8 above):

as for Orf46, conservative sequence 730 among MenB, MenA and gonococcus is high (>80%) only for N-terminal part. From the end, from ˜340, is vysokorelevatnym

its predicted secondary structure contains a hydrophobic segment, extending to the Central portion of the molecule (amino acids 227-247).

- the full expression of the gene in E. coli provides a very low outputs of the protein. Expression of labeled or unlabeled structures, where the sequence of the signal peptide is eliminated, has a toxic effect on cells of the host. In other words, the presence of a full-sized Mature protein in the cytoplasm is highly toxic for the host cell, whereas its translocation in preplasma (mediated signal peptide) has no detected effect on cell viability. This intracellular toxicity 730 is especially high, as the clones for the expression of asliding 730 can be obtained only at very low frequencies using genetic background recA (strains of E. coli: NV for cloning; HMS174(DE3) for expression).

To overcome this toxicity 730 used an approach similar to the approach described in PR the least 8 .RF46. Received four shorter-end of the form, each of which is well expressives. All of these forms were received from the intracellular expression of His-tagged asliding 730.

Form And consists of N-terminal hydrophilic site of the Mature protein (amino acids 28-226). It was purified in the form of soluble His-tagged product having a higher molecular weight than expected.

The form extends to the end of the segment, between conservative serological groups (amino acids 28-340). It was purified in the form of insoluble His-tagged product.

Shorter-end of the form, named C1 and C2, were obtained after screening for clones expressing high levels 730-His-clones in the strain HMS174(DE3). Briefly, plasmid 21b containing His-tagged sequence encoding a full-sized Mature protein 730, used to transform a recA strain HMS174(DE3). At low frequency was obtained transformants, which found two phenotype: large colonies and very small colonies. Several large and small colonies were analyzed for the expression clone 730-His. Only cells from large colonies were sverkhekspressiya protein recognized by antibodies against 730-A. However, protein sverkhekspressiya in different clones, found differences in molecular weight. Sequencing of two of these clones was found that in both cases occurred and the integration IS sequence E. coli in the sequence that encodes the C-terminal section 730. Two events integration has produced hybridization in reading frame with 1 extra codon in the case of C1 and 12 additional codons in the case of C2 (figure 11). Received "mutant" form 730 have the following sequence:

730-C1 (caused by insertion of IS1 - figure 11A)

Additional amino acid produced by this embedding, is underlined.

730-C2 (due to the insertion of IS5 - figure 11B)

Additional amino acids produced by insertion underlined.

In conclusion we can say that the form 730-C1 provides a very high level of protein and has no toxic effect on the cells of the host, whereas the presence of natural C-end is toxic. These data suggest that intracellular toxicity 730 is associated with the C-terminal 65 amino acids of this protein.

Spent the equivalent of shortening ORF29 to the first 231 or 368 amino acids using the expression with a leader peptide or without the leader peptide (amino acids 1-26; deletion gives cytoplasmic expression) and His-tagged or without His-tag.

Example 22 - domains in 961

As described in example 9 above, GST-hybrid 961 best expressively in E. coli. To improve the expression of the protein was divided into domain is (figure 12).

Domains 961 designed on the basis of YadA (adhesin produced by Yersinia, which, as shown, is adhesion localized on the bacterial surface, which forms oligomers, forming a protrusion on the surface [Hoiczyk et al. (2000) EMBO J. 19:5989-99]), and they are: leader peptide, domain head, supercoiled plot (stem) and membrane anchor domain.

These domains expressed with a leader peptide or without leader peptide and optionally hybridized either with C-terminal His-tag, or with N-terminal GST. The E. coli clones expressing different domains 961, were analyzed by electrophoresis in LTO-SDS page and Western blot testing on the production and localisation of the expressed protein of the night (o/n) culture or after 3 hours of induction by IPTG. The results were as follows:

Total lysate (Immunoblot)Periplasm (Immunoblot)The supernatant (Immunoblot)OMV electrolysis in LTO-PDAG
961 o/n

961 (IPTG)
-

+/-
-

-
-

-
961-L (o/n)

961-L (IPTG)
+

+
-

-
-

-
+

+
961c-L (o/n)

961C-L (IPTG)
-

+
-

+
-

+
961Δ1-L (o/n)

961Δ1-L (IPTG)
-

+
-

-
-

-
+

These results indicate that in E. coli:

- 961-L is vysokoagressivnyh and localized on the outer membrane. Through Western blot analysis were two specific bands: one at ˜45 kDa (predicted molecular weight) and one at ˜180 kDa, indicating that the 961-L can form oligomers. In addition, these units are largely expressed in the night culture (without IPTG induction). The OMV preparations (vesicles of outer membrane) of this clone was used for immunization of mice and received the serum. When using night culture (predominantly oligomeric forms) serum was bactericidal; IPTG-induced culture (predominantly Monomeric) was not bactericidal.

- 961Δ1-L (with a partial deletion in the anchorage area) is vysokoagressivnyh and localized on the outer membrane, but does not form oligomers;

- 961c-L (without anchor site) is produced in a soluble form and is exported to the supernatant.

Titers in ELISA and serum bactericidal test using His-hybrids were as follows:

ELISABactericidal test
A (amino acids 24-268)243974096
961b (amino acids 269-405)776364
961c-L297708192
S (2996)30774>65536
S (MS)3343716384
961d26069>65536

The E. coli clones expressing different forms 961 (961, 961-L, 961Δ1-L and 961c-L)was used to study whether 961-adhesion (c.f. YadA). Analysis of adhesion were performed using (a) epithelial human cells and (b) clones of E. coli or after a night of cultivation, or after three hours of induction with IPTG. 961-L grown over night (961Δ1-L)and IPTG-induced 961c-L (clones expressing the protein on the surface) are attached to the epithelial cells of the person.

S were also used in the hybrid proteins (see above). Because 961 and containing domains options direct efficient expression, they are ideally suitable as N-terminal part of the hybrid protein.

Example 23 - other hybrids

Other hybrid proteins of the present invention are shown below (see also figure 14). They have advantages in comparison the AI with individual proteins:

It should be clear that the invention was described only as examples, and can be produced modifications without deviating from the idea and scope of this invention. For example, assuming proteins from other strains (for example, see WO 00/66741 against polymorphic sequences for ORF4, ORF40, ORF46, 225, 235, 287, 519, 726, 919 and 953).

EXPERIMENTAL DETAILS

Purification of proteins by FPLC (liquid Express chromatography of proteins)

The following table summarises the FPLC purification of proteins used:

And
ProteinPIColumnThe bufferpHProtocol
121, 1millionunlabeled6,23Mono QTris8,0And
128,1unlabeled5,04Mono QBis-Tris-propane6,5And
406,1Lof 7.75Mono QDiethanolamin9,0In
576,1L5,63Mono QTris7,5In
593unlabeled8,79Mono SHEPES7,4And
726unlabeled4,95Hi-trap SBis-Tris6,0And
919unlabeled10,5 (leader)Mono SBitin8,5
919Lorf410,4 (leader)Mono STris8,0In
920L6,92 (leader)Mono QDiethanolamin8,5And
95 3L7,56 (leader)Mono SMES6,5D
982unlabeled4,73Mono QBis-Tris-propane6,5And
919-287to 6.58Hi-trap QTris8,0
953-2874,92Mono QBis-Tris-propane6,2And

Buffer solutions included 20-120 mm NaCl, 5.0 mg/ml CHAPS and 10% vol./about. glycerol. Dialysate centrifuged at 13,000 g for 20 minutes and put it either on Mono Q or Mono S FPLC-ion exchange resin. Buffer and ion-exchange resin was chosen in accordance with the pI protein of interest and with the recommendations of reference protocols FPLC [Pharmacia: FPLC Ion Exchange and Chromatofocussing; Principles and Methods, Pharmacia Publication]. Proteins were suirable using a stepwise gradient of NaCl. Purification was analyzed by electrophoresis in LTO-page and the protein concentration was determined by Bradford method.

The letter in the column "Protocol" refers to the following: FPLC: Clones 121.1, 128.1, 593, 726, 982, periplasmatic protein 920L and hybrid proteins 919-287, 953-287 was purified from the soluble fraction of E. coli obtained after cell disruption. Separate colonies, bearing interest plasmid, were grown overnight at 37°With 20 ml of a liquid culture of LB/Amp (100 μg/ml). Bacteria were diluted 1:30 in 1.0 l of fresh medium and grown at 30°37°up until OD550he reached 0.6 to 0.8. The expression of recombinant protein was induced IPTG at a final concentration of 1.0 mm. After incubation for 3 hours, the bacteria were collected by centrifugation at 8000 g in ECENA 15 minutes at 4° C. If necessary, the cells were stored at -20°C. All subsequent procedures were performed on ice or at 4°C. For cytosolic proteins (121.1, 128,1, 593, 726 and 982) and periplasmatic protein 920L bacteria resuspendable in 25 ml SPR containing full proteiny inhibitor (Boehringer Mannheim). Cells were literally by sonication using an ultrasonic disintegrator 450 Branson. Damaged cells were centrifuged at 8000 g for 30 minutes to precipitate intact cells and Taurus on and the supernatant was subjected to 35%.about. saturation by the addition of 3.9 M (NH4)2SO4. The precipitate was besieged at 8000 g for 30 minutes. The supernatant was subjected to 70%.about. saturation by the addition of 3.9 M (NH4)2SO4and the precipitate was collected, as described above. Precipitation containing protein of interest were identified by electrophoresis in LTO-page and were dialyzed against a suitable ion-exchange buffer (see below) for 6 hours or overnight. Periplasmatic fraction from E. coli expressing 953L received according to the Protocol Evans et al. [Infect. Iimmun. (1974) 10:1010-1017] and were dialyzed against a suitable ion-exchange buffer. Buffer and ion-exchange resin was chosen in accordance with the pI protein of interest and recommendations of the Handbook of protocols FPLC (Phamacia). The buffer solution consisted of 20 mm NaCl and 10% (vol./about.) glycerol. D is alizat centrifuged at 13,000 g for 20 minutes and put it either on Mono Q, or on a Mono S FPLC-ion exchange resin. Buffer and ion-exchange resin was chosen in accordance with the pI protein of interest and with the recommendations of reference protocols FPLC (Pharmacia). Proteins were suirable using a stepwise gradient of NaCl. Purification was analyzed by electrophoresis in LTO-page and the protein concentration was determined by Bradford method. Cleavage of the leader peptide periplasmatic proteins was demonstrated by sequencing NH2-the end (see below).

FPLC-B: These proteins were purified from the membrane fraction of E. coli. Separate colonies, bearing interest plasmid, were grown overnight at 37°With 20 ml of a liquid culture of LB/SLE (100 µg/ml). Bacteria were diluted 1:30 in 1.0 l of fresh medium. Clones 406.1L and 919LOrf4 were grown at 30°With a Orf25L and 576.1L at 37°up until OD550he reached 0.6 to 0.8. If 919LOrf4 growing at 30°it was important, as the expression of the recombinant protein at 37°resulted in lysis of these cells. The expression of recombinant protein was induced IPTG at a final concentration of 1.0 mm. After incubation for 3 hours, the bacteria were collected by centrifugation at 8000 g for 15 minutes at 4°C. If necessary, the cells were stored at -20°C. All subsequent procedures were performed at 4°C. Bacteria resuspendable in 25 ml SPR containing full proteiny inhibitor (Boehringer Mnnheim), and literally osmotic shock 2-3-deletions. through a French press. Intact cells were removed by centrifugation at 5000 g for 15 minutes and the membrane was besieged by centrifugation at 100000 g (Beckman Ti50, 38000 rpm) for 45 minutes. The homogenizer of the downs used to resuspendable sediment membranes 7.5 ml of 20 mm Tris-HCl (pH 8.0), 1.0 M NaCl and full proteases the inhibitor. The suspension was mixed for 2-4 hours, centrifuged at 100000 g for 45 minutes and the precipitate resuspendable 7.5 ml of 20 mm Tris-HCl (pH 8.0), 1.0 M NaCl, 5.0 mg/ml CHAPS, 10% (vol./about.) glycerin and full proteasome inhibitor. The solution was mixed overnight, centrifuged at 100000 g for 45 minutes and supernatant were dialyzed for 6 hours against appropriate selection buffer. If Orf25.L it was found that the precipitate obtained after extraction CHAPS, contained the recombinant protein. This fraction without additional purification was used for immunization of mice.

FPLC-C: Identical FPLC-A, but purification was performed from the soluble fraction obtained after reaching the permeability of E. coli by polymyxin b, but not after the destruction of the cells.

FPLC-D: a Separate colony, bearing interest plasmid, were grown overnight at 37°With 20 ml of a liquid culture of LB/Amp (100 μg/ml). Bacteria were diluted 1:30 in 1.0 l of fresh medium and grown at 30°until, by whom and OD 550he reached 0.6 to 0.8. The expression of recombinant protein was induced IPTG at a final concentration of 1.0 mm. After incubation for 3 hours, the bacteria were collected by centrifugation at 8000 g for 15 minutes at 4°C. If necessary, the cells were stored at -20°C. All subsequent procedures were performed on ice or at 4°C. Cells resuspendable 20 mm Bicine (pH 8.5), 20 mm NaCl, 10% (vol./about.) glycerin, full proteases the inhibitor (Boehringer Mannheim) and destroyed with ultrasonic desintegrator 450 Branson. Destroyed by ultrasound, the cells were centrifuged at 8000 g for 30 minutes to precipitate intact cells and Taurus inclusion. Recombinant protein was besieged from solution between 35% rpm and about 70% vol./about. saturation by the addition of 3.9 M (NH4)2SO4. The precipitate was besieged at 8000 g for 30 minutes, resuspendable 20 mm Bicine (pH 8.5), 20 mm Nad, 10% (vol./about.) glycerol and were dialyzed against this buffer for 6 hours or overnight. Dialysate centrifuged at 13,000 g for 20 minutes and was applied to a FPLC-resin. Protein was suirable from the column using a stepwise gradient of NaCl. Purification was analyzed by electrophoresis in LTO-page and the protein concentration was determined by Bradford method.

Strategy cloned and design of oligonucleotides

Genes encoding interest and tigani, amplified via PCR using oligonucleotides designed based on the genomic sequence of N. meningitidis IN MS. Genomic DNA from strain 2996 always used as template in PCR reactions, unless otherwise noted, and amplificatoare fragments cloned in expressing vector 21b+ (Novagen) for expression of the protein in the form of His-tagged at the C-end product or in pET-24b+ (Novagen) for expression "unlabeled" forms (for example, ΔG287K).

When the protein is expressed without hybrid partner and with its own leader peptide (if present)was performed to amplify open reading frame (ATG codon is a STOP codon).

When the protein is expressed in the "unlabeled" form, the leader peptide was removed by the construction of the 5'-end primer amplification to the right of the predicted leader sequence.

The melting temperature of the primers used in PCR, depended on the number and type of hybridization of nucleotides in the primer, and it was determined using the formula:

TPL=4(G+C)+2(A+T) (tail excluded)

TPT2=64,9+of 0.41 (%GC) - 600/N (full primer)

The melting temperature of the selected oligonucleotides were typically 65-70°for full of the oligonucleotide and 50-60°only for the site of hybridization.

Oligonucleotides were synthesized using a DNA/RNA-sintezatore. Elmer 394, suirable from the speakers in 2.0 ml of NH4OH and freed from the protective groups 5-hour incubation at 56°C. the Oligonucleotides were precipitated with addition of 0.3 M Na-acetate and 2 volumes of ethanol. Samples were centrifuged and precipitation resuspendable in the water.

* This primer was used as Reverse primer for all C-terminal hybridisable 287 with His-tag.

§Direct primers used in combination with Reverse primer 287-His.

NB - All PCR reactions used the strain 2996, if there are no other indications (for example, strain MS).

In all constructions, starting with ATG, not accompanied by a unique NheI site, codon ATG is part of the NdeI site used for cloning. Designs made with NheI as cloning site at the 5'-end (for example, all of the constructs containing 287 N-end), have two additional codon (GCT AGC), hybridization the x with the coding sequence of the antigen.

Obtaining matrices chromosomal DNA

Strains of N. meningitidis 2996, MS, 394.98, 1000 and BZ232 (and others) were grown to exponential phase in 100 ml of GC-medium, collected by centrifugation and resuspendable in 5 ml buffer (20% weight/volume sucrose, 50 mm Tris-HCl, 50 mm EDTA, pH 8). After 10 minutes incubation on ice, the bacteria were leinovalu by adding 10 ml lisanova solution (50 mm NaCl, 1% Na-sarkosyl, 50 µg/ml Proteinase K) and the suspension was incubated at 37°C for 2 hours. Had two extraction with phenol (balanced to pH 8) and extracted with a mixture of CHCl3/isoamyl alcohol (24:1). DNA precipitated with addition of 0.3 M sodium acetate and 2 volumes of ethanol and collected by centrifugation. The precipitate was washed once with 70% (vol./about.) ethanol and pererestorani 4.0 ml TE-buffer (10 mm Tris-HCl, 1 mm EDTA, pH 8.0). The DNA concentration was measured by OD reading260.

PCR amplification

The standard PCR Protocol was as follows: 200 ng of genomic DNA from strain 2996, MS, 1000 or BZ232 or 10 ng of the preparation of plasmid DNA from recombinant clones was used as matrix in the presence of 40 μm of each oligonucleotide primer, 400-800 μm dNTP solution, 1×PCR buffer (containing 1.5 mm MgCl2), 2.5 units of DNA polymerase TaqI (using a Perkin Elmer AmpliTaQ, Boehringer Mannheim ExpandTMLong Template).

After a preliminary 3-minute incubation of the whole mixture at 95°each sample is subjected to two-stage amplification: the first 5 cycles were performed using the hybridization temperature, which excluded the tail restrictase primer (TPL). Followed by 30 cycles in accordance with the temperature of hybridization, designed for full-length oligonucleotides (TPT2). Elongation time performed at 68°72°varied in accordance with the length of the Orf, subject to amplification. In the case of Orf1 elongation time, starting with 3 minutes, increased to 15 seconds with each cycle. Cycles ended a 10-minute stage of elongation at 72°C. Amplified DNA was applied directly on a 1% agarose gel. The DNA fragment corresponding to the band of the correct size were purified from the gel using a kit for the extraction of gels Qiagen Gel Extraction Kit according to the manufacturer's Protocol.

Cleavage of the PCR fragments and cloning vectors

Purified DNA corresponding to amplificatoare fragment was digested with suitable restrictable for cloning into pet-21b+, 22b+ or pet-24b+. Splintered fragments were purified using the cleaning kit QIAquick PCR purification kit according to the manufacturer's instructions) and suirable or H2O, or 10 mm Tris, pH 8.5. Plasmid vectors were digested with appropriate restrictase, inflicted by 1.0% agarose gel and the band corresponding to the cleaved vector was purified using a kit for the extraction of gels Qiagen QIAquick Gel Extraction kit.

Cloning

p> The fragments corresponding to each gene, previously cleaved and purified, ligated into pET21b+, pET22b+ or pet-24b+. Used a molar ratio of 3:1 fragment/vector with DNA ligase T4 buffer for ligation, supplied by the manufacturer.

The recombinant plasmid was transformed into competent cells of E. coli DH5 or NW incubation solution ligase reaction and bacteria for 40 minutes on ice, then at 37°C for 3 minutes. Followed by adding 800 ál of LB-broth and incubation at 37°C for 20 minutes. The cells were centrifuged at maximum speed in microfuge Eppendorf, resuspendable in approximately 200 μl of the supernatant and were sown on containing LB-ampicillin (100 mg/ml) agar.

Screening for recombinant clones was performed by growing randomly selected colonies overnight at 37°With 4.0 ml of a mixture of LB-broth + 100 μg/ml ampicillin. Cells were besieged and plasmid DNA was extracted using a kit Qiagen QIAprep Spin Miniprep Kit according to the manufacturer's instructions. Approximately 1 µg of each individual minipreparation were digested with appropriate restrictase and the cleavage product was applied at 1-1 .5% agarose gel (depending on the expected size of the insert) along with molecular weight marker (1 TPN DNA ladder, GIBCO). Positive clones were selected on the basis of the size of the inserts.

The expression

After cloning each gene in expressing vector recombinant plasmids were transformed into strains of E. coli, suitable for expression of the recombinant protein. 1 ál of each construct was used to transform E. coli BL21-DE3, as described above. Single recombinant colonies were inoculable in 2 ml of LB+Amp (100 μg/ml), incubated at 37°C overnight, then diluted 1:30 in 20 ml of LB+Amp (100 μg/ml) in flasks of 100 ml with obtaining OD600between 0.1 and 0.2. Flasks were incubated at 30°or at 37°a rotary shaker water bath up until OD600not indicated exponential growth, suitable for the induction of expression (0,4-0,8 OD). Expression of protein was induced by addition of 1.0 mm IPTG (isopropylthioxanthone). After 3 hours incubation at 30°or at 37°measured OD600and explored the expression. 1.0 ml of each sample was centrifuged in microfuge, sediment resuspendable in SFR and analyzed by electrophoresis in LTO-SDS page and staining Kumasi blue.

Gateway-cloning and expression

The sequence labeled GATE, cloned and expressed using the technology GATEWAY-cloning (Gibco-BRL). Recombinant cloning (RC) is based on the recombination reactions, which mediate the integration of the phage genome E. coli and cut phage from E. coli genome Integration involves the recombination site is attP DNA of phage in the attB site, located in the bacterial genome (BP reaction), and generates the integrated phage genome, flanked by sites attL and attR. Cut recombines into molecules sites attL and attR back to the site attP and attB (LR reaction). For the reaction of integration required two enzymes [phage protein Integrase (Int) and bacterial factor protein integration host (IHF)] (BP-clonase). For the reaction of cut required Int, IHF and additional phage enzyme, Excisions (Xis) (LR-clonase). Synthetic derivatives of bacterial recombination site attB 25 P.N., called B1 and B2, were added to the 5'-end of primers used in PCR reactions to amplify the ORF of Neisseria. The resulting products BP-cloned into the donor vector containing the complementary derivatives of the recombination site of the phage attP (P1 and P2)using BP-clonase. Received an "entry clone containing the ORF, flanked derived site attL (L1 and L2), and they were subcloned in expressing vectors of destiny", which contain derivatives of attL-compatible attR sites (R1 and R2), using LR-clonase. This resulted in the receipt of "expressing clones", in which the ORF is flanked B1 and B2 and hybridized in reading frame with N-terminal tags GST or His.

The E. coli strain used for GATEWAY-expression is BL21-SI. Cells of this strain were induced for the expression of RNA polymerase T7 you what asianism in the environment, containing salt (0.3 M NaCl).

It should be noted that this system gives N-terminal His-tag.

Obtaining membrane proteins

Fraction, consisting mainly of either internal, external, or total membranes were isolated to obtain recombinant proteins expressed by the leader sequences that determine membrane localization. A method of obtaining a preparation of membrane fractions enriched in recombinante proteins, was borrowed from Filip et al. [J. Bact. (1973) 115:717-722] and Davies et al. [J. Immunol. Meth. (1990) 143:215-225]. Separate colonies, bearing interest plasmid, were grown overnight at 37°With 20 ml of a liquid culture of LB/Amp (100 μg/ml). Bacteria were diluted 1:30 in 1.0 l of fresh medium and grown at 30°37°up until OD550he reached 0.6 to 0.8. The expression of recombinant protein was induced IPTG at a final concentration of 1.0 mm. After incubation for 3 hours, the bacteria were collected by centrifugation at 8000 g for 15 minutes at 4°and resuspendable in 20 ml of 20 mm Tris-HCl (pH 7.5) and full protease inhibitors (Boehringer Mannheim). All subsequent procedures were performed at 4°or on ice.

Cells were destroyed by sonication using an ultrasonic disintegrator 450 Branson and centrifuged at 5000 g for 20 minutes to precipitate intact cells and Taurus included who I am. The supernatant containing the membrane and the cell debris was centrifuged at 50000 g (Beckman Ti50, 29000 rpm) for 75 minutes, washed with 20 mm Bis-Tris-propane (pH 6.5), 1.0 M NaCl, 10% (vol./about.) glycerin and again besieged at 50000 g for 75 minutes. Sediment resuspendable in 20 mm Tris-HCl (pH 7.5), and 2.0% (vol./about.) Sarcosine, full proteases the inhibitor (1.0 mm EDTA, final concentration) and incubated for 20 minutes to dissolve the inner membrane. Cellular debris was besieged by centrifugation at 5000 g for 10 minutes and the supernatant was centrifuged at 75000 g for 75 minutes (Beckman Ti50, 33000 rpm). Proteins 008L and 519L were detected in the supernatant, suggesting their localization in the inner membrane. For these protein fractions as internal membranes and total membranes (washed with NaCl as described above) was used for immunization of mice. Vesicles of outer membrane derived from sediment 75000 g, washed with 20 mm Tris-HCl (pH 7.5) and centrifuged at 75000 g for 75 minutes or over night. Finally, OMV (vesicles of outer membrane) resuspendable in 500 μl of 20 mm Tris-HCl (pH 7.5), 10% vol./about. the glycerin. Orf1L and Orf40L, both were localized and enriched in a fraction of the outer membrane, which was used for immunization of mice. The protein concentration was determined by the standard Bradford method (Bio-Rad) whereas the concentration of the protein fraction inside them of the membranes was determined by the DC method of protein determination (Bio-Rad). The different fractions from the extraction procedure were analyzed by electrophoresis in LTO-PAG.

Purification of His-tagged proteins

Different forms 287 cloned from strain 2996 and MS. They were designed with His-tagged hybridization at the C-end and they included the Mature form (amino acids 18-427), designs with divisions (Δ1, Δ2, Δ3 and Δ4) and clones, consisting of either. In-or out-domains. For each clone, purified as His-hybrid, a single colony was planted by the bar and were grown overnight at 37°With the Cup with agar LB/Amp (100 μg/ml). An isolated colony from this Cup was inoculable in 20 ml of liquid LB/Amp (100 μg/ml) and grown overnight at 37°when shaken. Night culture was diluted 1:30 in 1.0 l of a liquid medium LB-Amp (100 μg/ml) and were grown at the optimal temperature (30 or 37° (C)until OD550he reached 0.6 to 0.8. The expression of recombinant protein was induced by adding IPTG (final concentration 1.0 mm) and the culture incubated for another 3 hours. Bacteria were collected by centrifugation at 8000 g for 15 minutes at 4°C. the Precipitate bacteria resuspendable 7.5 ml (i) of cold buffer A (300 mm NaCl, 50 mm phosphate buffer, 10 mm imidazole, pH 8.0) for soluble proteins, or (ii) buffer (10 mm Tris-model HC1, 100 mm phosphate buffer, pH 8.8, and, optionally, 8 M urea) for insoluble proteins. Proteins purified in soluble form, included 287-His, Δ1, Δ2, Δ3 and Δ4287-His, ΔS-His, 287c-His and 287cMC58-His. Protein 287bMC58-His was insoluble and was purified accordingly. Cells were destroyed by sonication on ice four times for 30 seconds at 40W using an ultrasonic disintegrator 450 Branson and centrifuged at 13,000×g for 30 minutes at 4°C. For insoluble protein precipitation resuspendable in 2.0 ml of buffer (6 M guanidine hydrochloride, 100 mm phosphate buffer, 10 mm Tris-HCl, pH 7.5) and treated with 10 activations homogenizer of downs. The homogenate was centrifuged at 13000 g for 30 minutes and the supernatant retained. Supernatant as soluble or insoluble drugs were mixed with 150 ál Ni2+-resin (pre-equilibrated with buffer a or buffer B, as required), and incubated at room temperature with careful stirring for 30 minutes. The Chelating resin was Sepharose Fast Flow (Pharmacia), obtained in accordance with the Protocol of the manufacturer. Received periodically, the preparation was centrifuged at 700 g for 5 minutes at 4°C and supernatant was discarded. The resin was washed twice (if periodic) 10 ml buffer a or b for 10 minutes, resuspendable in 1.0 ml of buffer a or b and put on a disposable column. The resin continued to wash either (i) buffer And PR is 4° With, or (ii) a buffer at room temperature until OD280flowing solution is not reached 0,02-0,01. The resin was further washed either (i) cold buffer (300 mm NaCl, 50 mm phosphate buffer, 20 mm imidazole, pH 8.0), or (ii) buffer D (10 mm Tris-HCl, 100 mm phosphate buffer, pH 6.3, and, optionally, 8 M urea), while OD280flowing through the column of solution is not reached 0,02-0,01. His hybrid protein was suirable by adding 700 μl of either (i) cold buffer for elution A (300 mm NaCl, 50 mm phosphate buffer, 250 mm imidazole, pH 8.0), or (ii) buffer for elution (10 mm Tris-HCl, 100 mm phosphate buffer, pH 4.5, and, optionally, 8 M urea) and fractions were collected until OD280did not show that received the recombinant protein. Aliquots of 20 μl of each elution fractions were analyzed by electrophoresis in LTO-PAG. The concentration of protein was determined by the method of Bradford.

Resaturate denaturirovannykh His hybrid proteins

Denaturation was required to solubilize 287b8, so before immunization was used stage renaturation. To denatured fractions obtained as described above was added glycerin to obtain a final concentration of 10% (vol./vol.). Proteins were diluted to 200 μg/ml using dialysis buffer I (10% vol./about. glycerol, 0.5 M arginine, 50 mm phosphate buffer, 5.0 mm restored glutathione, 0.5 mm oxidized glutathione, 2,0M urea, pH 8.8) and were dialyzed against the same buffer for 12-14 hours pre°C. Additional dialysis was performed with buffer II (10% vol./about. glycerol, 0.5 M arginine, 50 mm phosphate buffer, 5.0 mm restored glutathione, 0.5 mm oxidized glutathione, pH 8.8) for 12-14 hours at 4°C. the protein Concentration was determined using the formula:

Protein (mg/ml)=(1,55×OD280)-(0,76×OD260)

Amino acid analysis

Automatic sequencing of NH2-end of proteins was performed at the sequencing machine Beckmann (LF 3000)with the connected analyzer phenylthiohydantoin-amino acids (System Gold)according to the manufacturer's recommendations.

Immunization

BALB/c mice were immunized with antigen on day 0, 21 and 35 and the serum was analyzed at day 49.

Analysis of serum - ELISA

Devoid of capsules MenB M7 and encapsulated strains were sown in a Cup with chocolate agar and incubated overnight at 37°With 5% CO2. Bacterial colonies were collected from cups with the agar using a sterile swab (dracon swab) and inoculable in broth Mueller-Hinton (Difco)containing 0.25% glucose. Bacterial growth was monitored every 30 minutes by definition OD620Bacteria were grown until OD reached a value of 0.4-0.5. The culture was centrifuged for 10 minutes at 4000 rpm, the Supernatant was discarded and the bacteria were washed twice SFR, resuspen Aravali in SFR, containing 0.025% formaldehyde, and incubated for 1 hour at 37°and then overnight at 4°under stirring. 100 µl of the bacterial cells was added to each well of 96-hole tablet Greiner and incubated over night at 4°C. Then the wells were washed three times SFR-buffer washes (0.1% tween-20 in SFR). 200 ál of buffer saturation (2,7% polyvinylpyrrolidone 10 in water) was added to each well and the plates were incubated for 2 hours at 37°C. the Wells were washed three times SFR. 200 ál of diluted sera (the dilution buffer: 1% BSA, 0.1% tween-20, 0.1% of NaN3in SFR) was added to each well and the plates were incubated for 2 hours at 37°C. the Wells were washed three times SFR. 100 μl of HRP-conjugated rabbit antimachine serum (Dako)diluted 1:2000 in buffer for dilution was added to each well and the plates were incubated for 90 minutes at 37°C. the Wells were washed three times SFR-buffer. 100 μl of substrate buffer for HRP (25 ml nitrate buffer pH 5, 10 mg O-phenyldiamine and 10 μl of N2About2) was added to each well and the tablets were left at room temperature for 20 minutes. 100 μl of 12.5% H2SO4was added in each well was determined by OD490. The ELISA titers were calculated in relative units in the form of dilution of serum that gave the OD490 value of 0.4 above pridumannyh sera. Anal is C ELISA was positive, when the dilution of sera with OD4900,4 had more than 1:400.

Analysis of sera - FACS-Scan analysis of the binding of bacteria

Devoid of capsules MenB strain M7 were sown in a Cup with chocolate agar and incubated overnight at 37°With 5% CO2. Bacterial colonies were collected from cups with the agar using a sterile swab (dracon swab) and inoculable in 4 test tubes, each containing 8 ml of broth Mueller-Hinton (Difco)containing 0.25% glucose. Bacterial growth was monitored every 30 minutes by definition OD620. Bacteria were grown until OD reached a value of 0.35 to 0.5. The culture was centrifuged for 10 minutes at 4000 rpm, the Supernatant was discarded and the precipitate resuspendable in blocking buffer (1% BSA in STR, 0,4% NaN3) and centrifuged for 5 minutes at 4000 rpm Cells resuspendable in blocking buffer with obtaining OD6200,05. 100 µl of the bacterial cells was added to each well of 96-hole tablet Costar. 100 μl of the diluted(1:100, 1:200, 1:400) serum (blocking buffer) was added to each well and the plates were incubated for 2 hours at 4°C. the Cells were centrifuged for 5 minutes at 4000 rpm, the supernatant was aspirated and cells were washed by adding 200 μl per well of blocking buffer to each well. To each well was added 100 μl anywhereand with R-phycoerythrin goat F(ab)2in the mouse antibodies diluted 1:100, and the plates were incubated for 1 hour at 4°C. the Cells were unscrewed by centrifugation at 4000 rpm for 5 minutes and washed by adding 200 μl per well of blocking buffer. The supernatant was aspirated and the cells resuspendable 200 µl per well SFR, 0.25% formaldehyde. The sample was transferred into a test tube FACScan and read performance. Conditions for installation FACScan (laser power of 15 mW) were as follows: FL2 incl.; the threshold FSC-H: 92; voltage FSC RMT: E 01; SSC RMT: 474; a gain of 6.1; FL-2 RMT: 586; the magnitude of compensation: 0.

Analysis of sera - bactericidal analysis

The N. meningitidis strain 2996 were grown over night at 37°on cups with chocolate agar (source material was taken from the frozen initial solution) with 5% CO2. Bacterial colonies were collected and used for inoculation of 7 ml of broth Mueller-Hinton containing 0.25% glucose, to obtain OD620of 0.05-0.08. The cultures were incubated for approximately 1.5 hours at 37°With shaking until the OD value620he reached 0,23-0,24. Bacteria were diluted in 50 mm phosphate buffer, pH of 7.2, containing 10 mm MgCl2, 10 mm CaCl2and 0.5% (weight/volume) BSA (buffer for analysis), at a working dilution 105CFU (colony forming units) per ml of Total reaction mixture was 50 μl with 25 μl of serial 2-fold dilution of the test serum, and 12.5 µl of bacteria etc is working dilution, a 12.5 μl of the complement of a baby rabbit (final concentration 25%).

Controls included bacteria, incubated with serum complement, immune serum, incubated with bacteria and complement inactivated by heating at 56°C for 30 minutes. Immediately after adding the complement of baby rabbit 10 µl controls were sown on plates with agar Mueller-Hinton method with slope (time 0). 96-well plate were incubated for 1 hour at 37°C with rotation. 7 μl of each sample were sown on plates with agar Mueller-Hinton in the form of spots, while 10 μl of controls were sown on plates with agar Mueller-Hinton method with slope (1). Cups with agar were incubated for 18 hours at 37°and believed the colonies corresponding to the time 0 and time 1.

Analysis of sera in Western blots

Purified proteins (500 ng per track), vesicles of outer membrane (5 g) and total cell extracts (25 μg)derived from MenB strain 2996, were applied to 12% of the LTO-polyacrylamide gel and transferred to nitrocellulose membrane. The transfer was performed for 2 hours at 150 mA at 4°using buffer for transfer (0,3% Tris-base, 1.44% glycine, 20% (vol./about.) methanol). The membrane was saturated by overnight incubation at 4°buffer for saturation (10% skimmed milk, 0.1% Triton X-100 in SFR). The membrane industry is Ali twice with wash buffer (3% skimmed milk, 0.1% Triton X-100 in SFR) and incubated for 2 hours at 37°With mouse sera diluted 1:200 in wash buffer. The membrane was washed twice and incubated for 90 minutes at a dilution of 1:2000 labeled with horseradish peroxidase antimisting Ig. The membrane was washed twice with 0.1% Triton X-100 in SFR and showed with the use of substrate kit Opti-4CN Substrate Kit (Bio-Rad). The reaction was stopped by adding water.

OMV (vesicles of outer membrane) was prepared as follows: N. meningitidis strain 2996 were grown over night at 37°With 5% CO2on GC-cups, gathered loop and resuspendable in 10 ml of 20 mm Tris-HCl pH 7.5, 2 mm EDTA. Inactivation by heating was performed at 56°C for 45 minutes and the bacteria was destroyed by sonication for 5 minutes on ice (50% duty cycle, 50% yield, microeconomic 3 mm ultrasonic disintegrator Branson). Intact cells were removed by centrifugation at 5000 g for 10 minutes, the supernatant containing the total fraction of cell membranes, were removed and additionally centrifuged overnight at 50000 g at a temperature of 4°C. the Precipitate containing membranes, resuspendable 2% sarkosyl, 20 mm Tris-HCl pH 7.5, 2 mm EDTA, and incubated at room temperature for 20 minutes to solubilize the inner membrane. The suspension was centrifuged at 10000 g for 10 minutes to DL the removal of aggregates, the supernatant was additionally centrifuged at 50000 g for 3 hours. The precipitate containing the outer membrane was washed in SFR and resuspendable in the same buffer. The protein concentration was measured according to the method of D.C. Bio-Rad Protein assay (modified Lowry method) using BSA as a standard.

Total cell extracts were obtained as follows: N. meningitidis strain 2996 were grown overnight on GC-Cup, collected by loop and resuspendable in 1 ml of 20 mm Tris-HCl. Inactivation by heating was performed at 56°C for 30 minutes.

Research domains 961

Obtaining cellular fractions. The total lysate, periplasm, supernatant and OMV. E. coli expressing different domains 961, obtained using bacteria from overnight culture or after 3 hours of IPTG induction. Briefly, periplasm received by suspendirovanie bacteria in 25% sucrose and 50 mm Tris (pH 8) with polymyxin (100 µg/ml). After 1 hour at room temperature, the bacteria were centrifuged at 13,000 rpm and the supernatant was collected. Culture supernatant was filtered through a 0.2 μm filter and was besieged by 50% THU on ice for two hours. After centrifugation (30 minutes at 13000 rpm) precipitation was washed twice with 70% ethanol and suspended in SFR. Getting OMV was performed as described previously. Each cell fraction was analyzed by electrophoresis in LTO-PDAG or Western-band using polyclonal antisera, induced against GST-961.

Test adhesion. Epithelial cells Chang (derived Wong-Kilbourne, clone 1-5C-4, conjunctiva) was maintained in DMEM (Gibco), supplemented with 10% V / V heat inactivated FCS, 15 mm L-glutamine and antibiotics.

For analysis of adhesion subconfluent culture of epithelial cells Chang washed SFR and treated with a mixture of trypsin-EDTA (Gibco) to release them from the plastic carrier. Then these cells suspended in SFR, counted and diluted in SFR to 5×105cells/ml

Bacteria from overnight culture or after IPTG induction was besieged and washed twice SFR by centrifugation at 13000 rpm for 5 minutes. Approximately 2-3×108(CFU) were incubated with 0.5 mg/ml FITC (fluoresceinisothiocyanate, FITZ) (Sigma) in 1 ml of buffer containing 50 mm NaHCO3and 100 mm NaCI, pH 8, for 30 minutes at room temperature in the dark. FITZ-labeled bacteria were washed 2-3 times and suspended in SFR at 1-1, 5×109/ml 200 µl of this suspension (2-3×108) were incubated with 200 ál (1×105) epithelial cells for 30 min at 37°C. the cells are Then centrifuged at 2000 rpm for 5 minutes to remove reprecipitate bacteria, suspended in 200 µl SFR, was transferred to a test tube FACScan and read performance.

1. The way heterologous expression of the protein '961' Neisseria meningitidis, where

(a) protein 961 has the amino acid sequence '961' strain MS:

MSMKHFPAKV LTTAILATFC SGALAATSDD DVKKAATVAI

VAAYNNGQEI NGFKAGETIY DIGEDGTITQ KDATAADVEA

DDFKGLGLKK VVTNLTKTVN ENKQNVDAKV KAAESEIEKL

TTKLADTDAA LADTDAALDE TTNALNKLGE NITTFAEETK

TNIVKIDEKL EAVADTVDKH AEAFNDIADS LDETNTKADE

AVKTANEAKQ TAEETKQNVD AKVKAAETAA GKAEAAAGTA

NTAADKAEAV AAKVTDIKAD IATNKADIAK NSARIDSLDK

NVANLRKETR QGLAEQAALS GLFQPYNVGR FNVTAAVGGY

KSESAVAIGT GFRFTENFAA KAGVAVGTSS GSSAAYHVGV

NYEW

and where

(b) at least one domain of the protein deleterows, where the domains '961' strain MS the following: (1) amino acids 1-23; (2) amino acids 24-268; (3) amino acids 269-307; and (4) amino acids 308-364, and where protein '961' is expressed in E. coli.

2. The method according to claim 1, where the expression of the protein is not used hybrid partner.

3. The method according to claim 1, where the protein contains a His-tag at the C-end.

4. The method according to claim 1, where the protein contains GST at the N-end.

5. The method according to claim 1, where the protein '961' represents the N-terminal part of the hybrid protein.

6. The protein having immunogenic activity against Neisseria meningitidis expressing method according to any one of the preceding paragraphs.



 

Same patents:

FIELD: biotechnology, gene engineering, ecology.

SUBSTANCE: Escherichia coli cells containing plasmides with luxCDABE-genes are produced by recombinant DNA method under control of PkatG, PsoxS, PrecA, PgrpE inducible stress promoters. On the base of the same kit of Escherichia coli bacterial cells is developed for heptyl detection in environment medium.

EFFECT: accelerated method for heptyl detection.

1 tbl, 4 dwg

FIELD: biotechnology, gene engineering, medicine, pharmaceutical industry.

SUBSTANCE: plasmide pBSH2EGF DNA providing expression of human epidermal growth factor (hEGF) in E.coli strains, containing polymerase T7 gene, under controlling of t7 promoter, associated with seeding site of lac-repressor, is synthesized. Also disclosed is method for production of human epidermal growth factor including inducible expression thereof in cells of Escherichia coli strain BL21(DE3) transformed with plasmide pBSH2EGF DNA followed by isolation of target product from inclusion bodies.

EFFECT: effective agent for gene engineering, medicine, pharmaceutical industry, etc.

2 cl, 3 ex, 4 dwg

FIELD: molecular biology, biochemistry, medicine, oncology.

SUBSTANCE: invention relates to DNA sequences found in analysis of mDNA from squamous carcinoma cellular lines of different origin wherein these DNA sequences represent transcripts from rearranged genes SCCA1 and SCCA2. Result of rearrangement is formation of fused gene consisting of exon 2-7 of gene SCCA1 and exon 8 of gene SCCA2, or exons 2-7 of gene SCCA2 and exon 8 of gene SCCA1. Prepared expressing vectors comprising above said combinations of exons of two genes provide synthesis of corresponding fused protein in host-cell. Proposed sequences of nucleic acids and genetic constructions based on thereof represent novel agents for diagnosis squamous carcinomas.

EFFECT: valuable biological and medicinal properties of transcripts.

8 cl, 9 dwg, 1 tbl, 5 ex

FIELD: genetic engineering, biochemistry, virology.

SUBSTANCE: invention proposes recombinant plasmid pCI-neo-ODC-nsP1 and its variants pCI-neo-ODC-E2-L and pCI-neo-ODC-E2-M encoding proteins of Venezuelan equine encephalomyelitis (VEE) and ornithine decarboxylase protein. Plasmids are prepared by the sequential cloning gene-equivalent of non-structural protein nsP1 (fragments of L,M of the structural protein E2) of VEE virus as component of gene encoding enzyme ornithine decarboxylase being firstly into prokaryotic plasmid vector pET-23b and then into eucaryotic plasmid vector pCI-neo. Prepared plasmids can be used in the development of protective preparations used against Venezuelan equine encephalomyelitis virus as a prophylactic agent with respect of this pathogen.

EFFECT: valuable biological and medicinal properties of plasmid and agents.

3 cl, 2 tbl, 6 dwg

FIELD: microbiology, molecular biology, genetic engineering.

SUBSTANCE: invention relates to designing recombinant strains of E. coli carrying the cloned sequences of genome of meliodosis pathogen, B. pseudomallei, and determining different spectra of the medicinal resistance. Method involves transformation of E. coli JM107 competent cells with Kpn I-fragments of chromosomal DNA of the strain B. pseudomallei 56770 SMR2 ligated with Kpn I-restricts of vector pUC19 followed by selection of clones showing the combined resistance to antibacterial preparations of different classes. Then method involves carrying out the plasmid screening of the recombinant clones and hybridization analysis for detection of chromosomal DNA fragment by using B. pseudomallei chromosome sequences as a probe. Then method involves assay of the presence of the expression product of chromosomal DNA cloned sequence by immunoblotting method with immunoglobulins of specific meliodosis antsera. The prepared recombinant strain ZV1 is deposited in the State Collection of pathogenic microorganisms "Mikrob" at number KM167 and it shows resistance to pefloxacin and streptomycin. Use of the invention provides carrying out investigations of molecular-genetic bases of the multiple medicinal resistance of B. pseudomallei and to study the functional role of separate proteins in formation of the polyresistance in the meliodosis pathogen.

EFFECT: valuable properties of strain.

1 dwg, 1 tbl, 2 ex

FIELD: biotechnology, molecular biology, microbiology, genetic engineering.

SUBSTANCE: invention relates to a method for preparing an immunogenic polypeptide inducing immune response that represents the protective response against infection with Bacillus anthracis. Proposed immunogenic polypeptide comprises from one to three domains of the full-scale Protective Antigen (PA) from B. anthracis or their variants and at least one of indicated domains represents domain 1 or domain 4 from PA or its variant. These variants of immunogenic polypeptide and full-scale PA are produced as result of expression in E. coli. Also, invention proposes a vector for expression in bacterial cells that comprises nucleic acid encoding abovementioned immunogenic polypeptide. Also, invention the developed method for prophylaxis of infection caused by B. anthracis based on administration of sufficient amount of immunogenic polypeptide. Also, invention proposes a vaccine for prophylaxis of infection caused by B. anthracis that comprises the effective amount of immunogenic polypeptide and a suitable carrier. Invention provides preparing the effective agent used for prophylaxis of infection caused by B. anthracis.

EFFECT: improved preparing method and valuable properties of polypeptide and vaccine.

22 cl, 5 dwg, 3 tbl, 6 ex

FIELD: biotechnology, in particular gene engineering, pharmaceutical and food processing industry.

SUBSTANCE: DNA sequence (1341 n.p.) encoding fatty acid -desaturase (447 amino acid residue, 57 kD) of nematode Caenorhabditis elegants is isolated and characterized. Obtained DNA-sequence is expressed in bacterium and yeast cells to produce Biologically active enzyme recombinant form. Said recombinant form is capable to catalyze conversion of dihomo-γ-linolenic acid to arachidonic acid and eicosatetraenoate to eicosapentaenoate.

EFFECT: method for large-scale production of polyunsaturated fatty acid.

15 cl, 4 dwg, 1 ex

FIELD: biotechnology, microbiology, genetic engineering.

SUBSTANCE: invention proposes a new recombinant plasmid pR752 (5269 pair bases) comprising genetic construction under control of bacteriophage T5 promoter and encoding a module polypeptide consisting of 6 histidine residues, hemoglobin-like protein of E. coli, modified fragment of large T-antigen SV-40, translocation domain of diphtheria toxin, spacer sequence (Gly-Ser)5 and human epidermal growth factor (6 His-HMP-NLS-Dtox-(Gly-Ser)5-EGF) and designated for the directed transfer of photosensitizers into target-cell nuclei. By transformation of the strain E. coli M15 (rep 4) with plasmid pR752 the recombinant strain E. coli VKPM B-8356 as a producer of new polypeptide vector is prepared. The usage of this new strain is able to enhance the effectiveness of effect of photosensitizers by some orders. Invention can be used in medicinal-biological industry in preparing agents providing the directed transport of photosensitizing agents into tumor cell nuclei.

EFFECT: valuable biological and medicinal properties of polypeptide.

3 dwg, 4 ex

FIELD: biotechnology, genetic and protein engineering.

SUBSTANCE: invention reports construction of plasmid DNA pES6-1 based on plasmid pET22b(+) and DNA fragment comprising a sequence of artificial gene encoding human interferon β-1b providing expression of human recombinant interferon β-1b. Also, the strain Escherichia coli BDEES6 (BL21(DE3)/pES6-1) as producer of human recombinant interferonβ-1b is prepared. Invention provides enhancing yield of human recombinant interferon β-1b. Invention can be used in medicine and pharmaceutical industry.

EFFECT: valuable biological and medicinal properties of strain.

2 cl, 2 dwg, 2 ex

FIELD: genetic engineering, molecular biology, biochemistry.

SUBSTANCE: recombinant plasmid DNA pTES-His-OPH is constructed for expression of polypeptide eliciting properties of organophosphate hydrolase comprising Cla I/Hind III fragment of plasmid pTrcTEGF, fragment of plasmid pTES-OPH with nucleotide sequence that encodes amino acid sequence of the matured form of organophosphate hydrolase, and nucleotide sequence encoding 6 histidine residues that is located by 5'-end of nucleotide sequence encoding organophosphate hydrolase. Based on indicated plasmid the strain Escherichia coli TSKMIBKH-29 - a producer of polypeptide eliciting properties of organophosphate hydrolase is obtained. Applying the invention provides preparing polypeptide with properties of organophosphate hydrolase by simplified technology and this polypeptide elicits the improved catalytic effectiveness of action with respect to thio-containing phosphoric acid triesters. Invention can be used for carrying out hydrolysis of organophosphate compounds.

EFFECT: valuable biochemical properties of producer.

2 cl, 4 dwg, 2 tbl, 4 ex

FIELD: genetic and tissue engineering, biotechnology, medicine, agriculture.

SUBSTANCE: invention relates to the development of simple with constructive relation peptide vector (PGE-κ) consisting of polypeptide sequence of epidermal growth factor (EGF) and modified sequence of signal peptide T-antigen SV-40. New vector PGE-κ is able to provide the selective delivery of genetic material in target-cell cytoplasm carrying external receptors to EGF and the following its transport across nuclear membrane. Also, invention proposes a method for preparing peptide vector PGE-κ involving its expression as a fused protein "mutant thioredoxine-linker-vector" and cleavage of product expressed in E. coli in the linker region with specific protease. Invention provides preparing the recombinant strain E. coli B-8389 VKPM as a producer of the fused protein comprising PGE-κ. Proposed vector shows simple structure, absence of toxicity and immunogenicity and these properties provide its usefulness for the directed genetic modification of epithelial, embryonic and tumor cells in vivo.

EFFECT: improved preparing method, valuable medicinal properties of vector, improved genetic modification.

7 cl, 12 dwg, 4 tbl, 16 ex

FIELD: biotechnology, genetic engineering, pharmaceutical industry.

SUBSTANCE: plasmid DNA pET23-a(+)/PrxVIhumΔ178 with molecular weight of 19691.61 Da is constructed. DNA contains RNA-polymerase T7 promoter; replication initiation site; genetic marker which determinates resistance of cells transformed by said plasmid to ampicillin; and nucleotide sequence encoding N-terminal fragment of human peroxiredoxine VI containing 177 of amino acid residues. E.coli strain BL21/DE3/pET23-a(+)/PrxVIhumΔ178 being producer of N-terminal fragment of human peroxiredoxine VI is obtained by transformation of E.coli cells with plasmid DNA pET23-a(+)/PrxVIhumΔ178. Method of present invention makes it possible to obtain human peroxiredoxine VI fragment having reduced molecular weight, improved tissue permeability, and antioxidant activity of full-scale peroxiredoxine.

EFFECT: human peroxiredoxine VI fragment with improved tissue permeability.

2 cl, 3 dwg, 4 ex

FIELD: genetic engineering, molecular biology, biochemistry.

SUBSTANCE: recombinant plasmid DNA pTES-His-OPH is constructed for expression of polypeptide eliciting properties of organophosphate hydrolase comprising Cla I/Hind III fragment of plasmid pTrcTEGF, fragment of plasmid pTES-OPH with nucleotide sequence that encodes amino acid sequence of the matured form of organophosphate hydrolase, and nucleotide sequence encoding 6 histidine residues that is located by 5'-end of nucleotide sequence encoding organophosphate hydrolase. Based on indicated plasmid the strain Escherichia coli TSKMIBKH-29 - a producer of polypeptide eliciting properties of organophosphate hydrolase is obtained. Applying the invention provides preparing polypeptide with properties of organophosphate hydrolase by simplified technology and this polypeptide elicits the improved catalytic effectiveness of action with respect to thio-containing phosphoric acid triesters. Invention can be used for carrying out hydrolysis of organophosphate compounds.

EFFECT: valuable biochemical properties of producer.

2 cl, 4 dwg, 2 tbl, 4 ex

FIELD: biotechnology, genetic and protein engineering.

SUBSTANCE: invention reports construction of plasmid DNA pES6-1 based on plasmid pET22b(+) and DNA fragment comprising a sequence of artificial gene encoding human interferon β-1b providing expression of human recombinant interferon β-1b. Also, the strain Escherichia coli BDEES6 (BL21(DE3)/pES6-1) as producer of human recombinant interferonβ-1b is prepared. Invention provides enhancing yield of human recombinant interferon β-1b. Invention can be used in medicine and pharmaceutical industry.

EFFECT: valuable biological and medicinal properties of strain.

2 cl, 2 dwg, 2 ex

FIELD: biotechnology, microbiology, genetic engineering.

SUBSTANCE: invention proposes a new recombinant plasmid pR752 (5269 pair bases) comprising genetic construction under control of bacteriophage T5 promoter and encoding a module polypeptide consisting of 6 histidine residues, hemoglobin-like protein of E. coli, modified fragment of large T-antigen SV-40, translocation domain of diphtheria toxin, spacer sequence (Gly-Ser)5 and human epidermal growth factor (6 His-HMP-NLS-Dtox-(Gly-Ser)5-EGF) and designated for the directed transfer of photosensitizers into target-cell nuclei. By transformation of the strain E. coli M15 (rep 4) with plasmid pR752 the recombinant strain E. coli VKPM B-8356 as a producer of new polypeptide vector is prepared. The usage of this new strain is able to enhance the effectiveness of effect of photosensitizers by some orders. Invention can be used in medicinal-biological industry in preparing agents providing the directed transport of photosensitizing agents into tumor cell nuclei.

EFFECT: valuable biological and medicinal properties of polypeptide.

3 dwg, 4 ex

FIELD: biotechnology, in particular gene engineering, pharmaceutical and food processing industry.

SUBSTANCE: DNA sequence (1341 n.p.) encoding fatty acid -desaturase (447 amino acid residue, 57 kD) of nematode Caenorhabditis elegants is isolated and characterized. Obtained DNA-sequence is expressed in bacterium and yeast cells to produce Biologically active enzyme recombinant form. Said recombinant form is capable to catalyze conversion of dihomo-γ-linolenic acid to arachidonic acid and eicosatetraenoate to eicosapentaenoate.

EFFECT: method for large-scale production of polyunsaturated fatty acid.

15 cl, 4 dwg, 1 ex

FIELD: biotechnology, molecular biology, microbiology, genetic engineering.

SUBSTANCE: invention relates to a method for preparing an immunogenic polypeptide inducing immune response that represents the protective response against infection with Bacillus anthracis. Proposed immunogenic polypeptide comprises from one to three domains of the full-scale Protective Antigen (PA) from B. anthracis or their variants and at least one of indicated domains represents domain 1 or domain 4 from PA or its variant. These variants of immunogenic polypeptide and full-scale PA are produced as result of expression in E. coli. Also, invention proposes a vector for expression in bacterial cells that comprises nucleic acid encoding abovementioned immunogenic polypeptide. Also, invention the developed method for prophylaxis of infection caused by B. anthracis based on administration of sufficient amount of immunogenic polypeptide. Also, invention proposes a vaccine for prophylaxis of infection caused by B. anthracis that comprises the effective amount of immunogenic polypeptide and a suitable carrier. Invention provides preparing the effective agent used for prophylaxis of infection caused by B. anthracis.

EFFECT: improved preparing method and valuable properties of polypeptide and vaccine.

22 cl, 5 dwg, 3 tbl, 6 ex

FIELD: microbiology, molecular biology, genetic engineering.

SUBSTANCE: invention relates to designing recombinant strains of E. coli carrying the cloned sequences of genome of meliodosis pathogen, B. pseudomallei, and determining different spectra of the medicinal resistance. Method involves transformation of E. coli JM107 competent cells with Kpn I-fragments of chromosomal DNA of the strain B. pseudomallei 56770 SMR2 ligated with Kpn I-restricts of vector pUC19 followed by selection of clones showing the combined resistance to antibacterial preparations of different classes. Then method involves carrying out the plasmid screening of the recombinant clones and hybridization analysis for detection of chromosomal DNA fragment by using B. pseudomallei chromosome sequences as a probe. Then method involves assay of the presence of the expression product of chromosomal DNA cloned sequence by immunoblotting method with immunoglobulins of specific meliodosis antsera. The prepared recombinant strain ZV1 is deposited in the State Collection of pathogenic microorganisms "Mikrob" at number KM167 and it shows resistance to pefloxacin and streptomycin. Use of the invention provides carrying out investigations of molecular-genetic bases of the multiple medicinal resistance of B. pseudomallei and to study the functional role of separate proteins in formation of the polyresistance in the meliodosis pathogen.

EFFECT: valuable properties of strain.

1 dwg, 1 tbl, 2 ex

FIELD: genetic engineering, biochemistry, virology.

SUBSTANCE: invention proposes recombinant plasmid pCI-neo-ODC-nsP1 and its variants pCI-neo-ODC-E2-L and pCI-neo-ODC-E2-M encoding proteins of Venezuelan equine encephalomyelitis (VEE) and ornithine decarboxylase protein. Plasmids are prepared by the sequential cloning gene-equivalent of non-structural protein nsP1 (fragments of L,M of the structural protein E2) of VEE virus as component of gene encoding enzyme ornithine decarboxylase being firstly into prokaryotic plasmid vector pET-23b and then into eucaryotic plasmid vector pCI-neo. Prepared plasmids can be used in the development of protective preparations used against Venezuelan equine encephalomyelitis virus as a prophylactic agent with respect of this pathogen.

EFFECT: valuable biological and medicinal properties of plasmid and agents.

3 cl, 2 tbl, 6 dwg

FIELD: molecular biology, biochemistry, medicine, oncology.

SUBSTANCE: invention relates to DNA sequences found in analysis of mDNA from squamous carcinoma cellular lines of different origin wherein these DNA sequences represent transcripts from rearranged genes SCCA1 and SCCA2. Result of rearrangement is formation of fused gene consisting of exon 2-7 of gene SCCA1 and exon 8 of gene SCCA2, or exons 2-7 of gene SCCA2 and exon 8 of gene SCCA1. Prepared expressing vectors comprising above said combinations of exons of two genes provide synthesis of corresponding fused protein in host-cell. Proposed sequences of nucleic acids and genetic constructions based on thereof represent novel agents for diagnosis squamous carcinomas.

EFFECT: valuable biological and medicinal properties of transcripts.

8 cl, 9 dwg, 1 tbl, 5 ex

Up!