Method for treating resistant human tumors with epidermis growth factor receptors antagonists

FIELD: medicine.

SUBSTANCE: method involves applying effective doses of epidermis growth factor receptors antagonists being active ingredient in drug for inhibiting various types of resistant human tumors. The epidermis growth factor receptor antagonists are combined with other chemotherapeutic agents like Cisplatin, Irinotecan or ionizing radiation.

EFFECT: enhanced effectiveness of treatment.

50 cl, 2 tbl

 

Cancer is the second leading cause of death after heart attacks in the United States. There was significant progress in the development of new therapies in the treatment of this devastating disease. A significant part of the progress is due to a better understanding of cell proliferation of both normal and cancer cells.

Normal cells proliferate with a highly regulated activation of receptors growth factor relevant ligands. Examples of such receptors are tyrosinekinase receptors growth factor.

Cancer cells also proliferate through activation of receptors growth factor, but lose the precise regulation of normal cell proliferation. Loss of regulation can be caused by numerous factors, such as the overexpression of growth factors and/or receptors and Autonomous activation of biochemical pathways regulated by growth factors.

Some examples of receptors involved in oncogenesis, are the receptors of the factor of growth of the epidermis (epidermal growth factor receptor, EGFR) growth factor derived from platelets (platelet-derived growth factor receptor, DERIVED); insulin-like growth factor (insulin-like growth factor receptor, IGFR); nerve growth factor tissue (nerve growth factor receptor, NGFR) and growth factor fibroblast (fibroblast growth factor receptor, FGFR).

Members of the family of receptors growth factor epidermal (EGF) are especially important the s tyrosinekinase receptors growth factor, associated with oncogenesis epidermal cells. The first described member of the family of EGF receptors was a glycoprotein with an apparent molecular weight of about 165 kD. This glycoprotein, which is described Mendelsohn et al. in U.S. patent No. 4943533 known as EGF receptor (EGFR) and also known as EGF receptor-1 person (HER1).

EGFR sverkhekspressiya on many types of tumor cells, resembling the epidermis. EGF and α-transforming growth factor (transforming growth factor-alpha, TGF-alpha) are two known ligands of EGFR. Examples of tumors that Express EGF receptors include glioblastoma, and lung cancer, breast cancer, head and neck and bladder. Amplification and/or overexpression of EGF receptors on the membranes of tumor cells is associated with poor prognosis.

Cancer treatment traditionally involves chemotherapy and radiation therapy. Some examples of chemotherapeutic agents include doxorubicin, this drug called cisplatin and Taxol. Ionizing radiation can be either from an external source or from a source located inside the patient, i.e. the implant (brachytherapy).

Another treatment includes antagonists of growth factors or receptors of growth factors involved in cell proliferation. Such antagonists neutralize the activity of the growth factor or receptor and inhibit the growth of tumors that expre serout receptor.

For example, U.S. patent No. 4943533 describes monoclonal antibodies of mice, called 225 associated with the EGF receptor. The patent granted to the University of California, and the license is granted solely ImClone Systems Incorporated. Antibody 225 is able to inhibit the growth of cultured EGFR-expressing tumor lines, as well as the growth of these tumors in vivo, when growing as xenografts in deprived hair (fur) mice. Cm. Masui et al., Cancer Res. 44, 5592-5598 (1986).

The disadvantage of the use of monoclonal antibodies, mice in the treatment of people is the possibility of reaction of human antibodies against mouse (human anti-mouse antibody, HAMA) due to the presence of Ig sequences of the mouse. This disadvantage can be minimized when replacing the entire constant region of the antibodies of mice (or other non-human mammal) a constant region of a human. Replacing the constant regions of the antibodies of mice with sequences related to the person, usually called hemeroteca.

The process of chimerization you can make even more effective when replacing and also the skeleton of the variable regions of the antibodies of mice corresponding sequences of a human. The skeleton of variable fields is a variable regions of the antibodies except hypervariable regions. Hypervariable region also known as kom is elementare-determining region (complementary-determining regions, CDRs).

The replacement of the constant regions and the skeleton of the variable regions sequences related to the person, usually called beautification (humanization). Purified antibodies are less immunogenic (i.e. identify less HAMA response), the more sequences related to mice, replace sequences related to the person. Unfortunately, the cost and complexity increase, the more regions of antibodies, mice are replaced by sequences of human rights.

Replacement of the constant regions, non-human, for a constant area relating to the person obviously does not affect the activity of the antibody. For example, Prewett et al. reported ingibirovanii of tumor growth of established xenografts of prostate tumor in mice chimeric form of the anti-EGFR 225 monoclonal antibodies, which have been discussed above. Chimeric form is called C225. Journal of Immunotherapy 19, 419-427 (1997).

Another approach for reducing the immunogenicity of antibodies is the use of fragments of antibodies. For example, in the publication Aboud-Pirak et al., Journal of the National Cancer Institute 80, 1605-1611 (1988) compared the antitumor activity of antibodies anti-EGF receptor, called 108,4, with fragments of antibodies. Tumor model based on KB cells as xenografts in deprived hair (fur) mice. KB cells obtained from ora is inogo squamous cell carcinoma of the person and Express elevated levels of EGF receptors.

Aboud-Pirak et al. they found that the antibody and the bivalent F(ab')2fragment slow down tumor growth in vivo, although the F(ab')2the fragment is less efficient. Monovalent Fab fragment of the antibody whose ability to bind cell-associated receptors saved, however, does not slow down tumor growth.

Also, attempts were made to improve the treatment of malignant tumors by combining some of the ways mentioned above. For example, Baselga et al. reported antitumor effects of chemotherapeutic agent doxorubicin with anti-EGFR monoclonal antibodies in the Journal of the National Cancer Institute 85, 1327-1333 (1993).

Other attempts to increase the sensitivity of cancer cells to ionizing radiation by combining ionizing radiation with adjuvants. For example, Bonnen in U.S. patent No. 4846782 reported increased sensitivity of malignant human tumors to ionizing radiation when ionizing radiation is combined with interferon. Snelling et al. reported a slight improvement in the treatment of ionizing radiation patients with anaplastic astrocytomas foci when ionizing radiation combined with anti-EGFR monoclonal antibody labeled with iodine-125 in phase II clinical trials. Cm. Hybridoma 14, 111-114 (1995).

Similarly, Balaban et al. reported the ability of anti-EGFR monoclinic crystal the national antibodies to increase the sensitivity of squamous cell carcinoma xenografts human cancer in mice to ionizing radiation, when treatment with ionizing radiation was preceded by the introduction of anti-EGFR antibodies, called LA22. Cm. Biochimica et Biophysica Acta 1314, 147-156 (1996). Saleh et al. also reported better tumor control (regulation) in vitro and in mice, when radiation therapy was intensified anti-EGFR monoclonal antibodies. Saleh et al. concluded that "Further research may lead to a new combined method impact RT/Mab therapy. Cm. the report 4197 in proceedings of the Proceedings of the American Association for Cancer Research 37, 612 (1996).

Despite the above treatment for cancer, nothing was directed specifically to the treatment of malignant tumors that are resistant to conventional chemotherapy and ionizing radiation. Resistant malignant tumors lead to rapid progression of disease, usually with a poor prognosis. Currently little that can be done for patients with malignant tumors that are resistant to conventional cancer treatment.

Based on the foregoing, there is a need for an improved method of treatment of resistant malignant tumors in humans.

The invention

This and other goals, as clearly professionals, are achieved by providing method of inhibiting the growth of drug-resistant malignant tumors that are stimulated by a ligand of the growth factor receptor epidermal (EGFR) in patients with people. The way is before treatment an effective amount of the EGFR/HER1 antagonist.

In another embodiment, the method described in this invention includes the treatment of people with a combination of effective amounts of EGFR/HER1 antagonist and a chemotherapeutic agent.

In another embodiment, the method described in this invention includes the treatment of people with a combination of effective amounts of EGFR/HER1 antagonist and ionizing radiation.

Detailed description of the invention

This invention relates to an improved method for the treatment of resistant tumors, in particular drug-resistant malignant tumors in human patients who have drug-resistant cancer.

Resistant tumors

Resistant tumors include tumors that are not able or is not amenable to treatment only to chemotherapeutic agents, only ionizing radiation or a combination of these methods. In this description of resistant tumors include tumors that apparently inhibited in the treatment of chemotherapy agents and/or radiation, but give recurrences after 5 years, sometimes up to 10 years or longer after treatment is terminated.

Types of drug-resistant tumors that can be treated in accordance with this invention are any of resistant tumors that are stimulated by a ligand of EGFR. Some examples of ligands that stimulate EGFR, clucalc EGF and TGF-α .

EGFR family of receptors includes EGFR, which in the literature is called HER1. In this description of EGFR refers to a specific member of the EGFR family of receptor called EGFR/HER1.

Resistant tumors treatable by the method described in this invention, are endogenous tumors inherent in sick people. These tumors are more difficult to treat than exogenous xenografts of human tumor who were treated animals. See, for example, Prewett et al., Journal of Immunotherapy 19, 419-427 (1997).

Some examples of drug-resistant tumors include carcinoma, glioma, sarcoma, adenocarcinoma, adenosarcoma and adenomas. These tumors can actually occur in all parts of the body, including every organ. Tumors can for example be present in the breast, heart, lung, small intestine, colon, spleen, kidney, bladder, head and neck, ovary, prostate, brain, pancreas, skin, bone, bone marrow, blood, thymus, uterus, testicles, neck and liver.

Tumors can Express EGFR at normal levels, or they may sverkhekspressiya EGFR when urovnya, which, for example, 10, 100 or 1000 times above normal levels. Some tumors that sverkhekspressiya EGFR include breast, lung, colon, kidney, bladder, head and neck, the OS is especially squamous cell carcinoma of the head and neck, ovarian, prostate and brain.

EGFR/HER1 antagonist

Resistant tumors described in this invention can be treated EGFR/HER1 antagonist. In this description of EGFR/HER1 antagonist is a substance that inhibits the stimulation of EGFR/HER1 using EGFR/HER1 ligand. This inhibition stimulation inhibits the growth of cells that Express EGFR/HER1.

The growth of resistant tumors sufficiently inhibit patients to prevent or reduce the progression of malignant tumors (i.e. growth, invasiveness, metastasis and/or recurrence). EGFR antagonists described in this invention, can be cytotoxic or to inhibit the growth of resistant tumors. Preferably, when EGFR antagonist destroys cells or destroys the tumor.

This mechanism of inhibition is not expected as applicable in this invention. However, EGFR tyrosine kinase normally activated by phosphorylation. Thus, phosphorylation is useful for predicting the suitability of the antagonists described in this invention. Some acceptable verification activity of EGFR tyrosine kinase described in publications Panek et al., Journal of Pharmacology and Experimental Therapeutics 283, 1433-1444 (1997) and Batley et al., Life Sciences 62, 143-150 (1998). Description these checks described in this invention as the Ref is K.

EGFR/HER1 antagonist include biological molecules or small molecules. Biological molecules include all lipids and polymers of monosaccharides, amino acids and nucleotides with a molecular weight of more than 450. Thus, biological molecules include, for example, oligosaccharides and polysaccharides; oligopeptides, polypeptides, peptides, and proteins; and oligonucleotides and polynucleotide. Oligonucleotides and polynucleotide include, for example, DNA and RNA.

Biological molecules include derivatives of any of the above molecules. For example, derivatives of biological molecules include lipid and glycosylated derivatives of oligopeptides, polypeptides, peptides, and proteins. Derivatives of biological molecules further include lipid derivatives of oligosaccharides and polysaccharides, i.e. lipopolysaccharides. Most typically, when biological molecules are antibodies or functional equivalents of antibodies.

Functional equivalents of antibodies have binding properties comparable to the binding properties of antibodies and inhibit the growth of cells that Express EGFR. Such functional equivalents include, for example, hyperserotonemia, ennobled (humanized) and single-chain antibodies, and fragments thereof.

Functional equivalents of antibodies in luchot polypeptides with amino acid sequences, almost the same as the amino acid sequence of the variable or hypervariable regions of the antibodies described in this invention. Amino acid sequence, which is almost the same as another sequence, but which differs from another sequence by one or more substitutions, additions and/or divisions (deletions), are considered equivalent to the sequence. Preferably, when less than 50%, more preferably less than 25% and even more preferably less than 10% of amino acid residues in the sequence are substituted, added or deleted from the protein.

Functional equivalent of an antibody preferably is chimericyoboy or refined (humanized) antibody. Hyperserotonemia antibody comprises the variable region of the antibody, notecases to man, and the constant region of antibodies specific to the person. Purified antibody comprises a hypervariable region (CDRs) of antibodies, notecases to person. Variable area and not the hypervariable region, i.e. the skeleton of a variable region and a constant region ennobled (gumanitarnogo) antibodies are the antibodies for 1 person.

In this application suitable variable and hypervariable region of the antibody, neoclassica to man, may be antibodies produced by any mammal besides humans, which receive monoclonal antibodies. Suitable examples of mammals in addition to humans include, for example, rabbits, rats, mice, horses, goats or primates. Preferred are the mouse.

Functional equivalents will further include fragments of antibodies that have binding properties that are the same as or comparable with the properties of the whole antibody. Suitable fragments of antibodies include any fragment that includes a sufficient portion of the hypervariable (i.e. complementary-determining region), which specifically and with sufficient affinity (affinity) binds to EGFR tyrosine kinase to inhibit the growth of cells that Express such receptors.

Such fragments can, for example, contain one or both of the Fab fragment or F(ab')2the fragment. Preferably, when the fragments of the antibodies contain all six of the complementary-determining regions of the whole antibody, although also includes functional fragments containing fewer of these areas, as for example three, four or five CDRs.

Preferred fragments are single-chain antibodies or Fv fragments. Single-chain antibodies are polypeptides that include, for Raina least variable region of the heavy chain of the antibody associated with the variable region of the light chain with a connecting linker or without him. Thus, Fv fragment includes the binding site of the whole antibody. These chains can be produced in bacteria or eukaryotic cells.

Antibodies and functional equivalents can be members of any class of immunoglobulins, such as IgG, IgM, IgA, IgD or IgE, and their subclasses. Preferred antibodies are members of the IgG1 subclass. Functional equivalents may also be equivalent combinations of any of the above classes and subclasses.

Antibodies can be produced from the desired receptor in ways that are well known. Receptors or commercially available, or can be allocated to well-known methods. For example, methods of isolation and purification of EGFR have Spada, US patent 5646153, starting with column 41 line 55. Methods of isolation and purification of EGFR, described in the patent Spada, described in this invention as a reference.

Methods for obtaining monoclonal antibodies include the immunological method described by Kohler and Milstein in Nature 256, 495-497 (1975) and Campbell in "Monoclonal Antibody Technology, The Production and Characterization of Rodent and Human Hybridomas" in Burdon et al., Eds, Laboratory Techniques in Biochemistry and Molecular Biology, Volume 13, Elsevier Science Publishers, Amsterdam (1985). Also suitable recombinant DNA described by Huse et al. in Science 246, 1275-1281 (1989).

Briefly, for producing monoclonal antibodies, the mammal is a master inoculant with the receptor or a fragment of the receptor, as described above, and then possibly re-subjected to immunization. To be suitable, a fragment of the receptor must contain sufficient amino acid residues to define the epitope detectable molecule. If the fragment is too short to be immunogenic, it can conjugates with media molecule. Some suitable molecules carriers include hemocyanin lymph snails and bovine serum albumin. Conjugation can be carried out by known methods. One such way is to connect the cysteine residue of the fragment of the cysteine residue in the molecule of the media.

The spleen is harvested from the inoculated mammal a few days after the last re-immunization. Cell suspensions from spleens are merging with a tumor cell. Received hybridoma that Express antibodies that identify, cultivate and maintain in culture.

Suitable monoclonal antibodies, as well as tyrosinekinase receptors growth factor for their production are also available from commercial sources, for example from Upstate Biotechnology, Santa Cruz Biotechnology of Santa Cruz, California. Transduction Laboratories of Lexington, Kentucky, R&D Systems Inc of Minneapolis, Minnesota, and Dako Corporation of Carpinteria, California.

T is the train known methods for producing chimeric and refined (humanized) antibodies. For example, methods of obtaining chimeric antibodies include the methods described in U.S. patents Boss (Celltech) and Cabilly (Genentech). Cm. US Patent No. 4816397 and 4816567, respectively. Methods of obtaining chimeric and refined (humanized) antibodies are described, for example, in Winter, US Patent No. 5225539.

The preferred method of finishing antibodies called CDR-grafting. In CDR-transplantation, the field of mouse antibodies that are directly involved in binding to antigen, complementary-determining region or CDRs transplanted in the variable regions of a person to create a variable regions "reconstructed human" ("reshaped human"). These fully sublimated variable regions then join to the constant regions of a human to create a complete "fully refined" antibodies.

To create a completely purified antibodies, which are well linked to the antigen, it is advantageous to carefully model the variable regions "reconstructed human" ("reshaped human"). Variable regions of human rights, which will come CDRs should be carefully selected and usually need to make several amino acid substitutions at critical positions within spanning regions (FRs) of the variable regions of a human.

For example, variable regions "reconstructed human" ("reshaped human") mo is ut to include up to ten amino acid substitutions in the FRs selected variable region of the light chain of human and up to 12 amino acid substitutions in the FRs selected variable regions of the heavy chain of a human. DNA sequences encoding genes of these heavy and light chain variable regions "reconstructed human" ("reshaped human"), attached to DNA sequences, genes encoding heavy and light chain constant region, preferably γ1 and I, respectively. "Reconstructed" ("reshaped") purified antibodies further Express in mammalian cells and their affinity (affinity) for their targets compared with those for the corresponding antibodies of mice and chimeric antibodies.

Methods of selection residues substituted purified antibodies and obtain substitutions are well known. See, for example, el al., Nature 351, 501-502 (1992); Queen et ul., Proc. Natl. Acad. Sci. 86, 10029-1003 (1989) and Rodrigues et al., Int. J. Cancer, Supplement 7, 45-50 (1992). The method of quality improvement and "reverse engineering" 225 anti-EGFR monoclonal antibodies described by Goldstein et al. in PCT application WO 96/40210. This method can be adapted for refined and "reconstructed" antibodies relative to other tyrosinekinase receptor growth factor.

Also known methods for producing single-chain antibodies. Some suitable examples include the examples described Wels et al. in European Patent Application 502812 and Int. J. Cancer 60, 137-144 (1995).

Other methods of producing functional equivalents described above, are presented in PCT application WO 93/21319, European Patent Application 239400, PCT application WO 89/09622, European Patent Application 33845, US Patent No. 5658570, US Patent No. 5693780 and European Patent Application EP 332424.

Preferred EGFR antibodies are hyperserotonemia, ennobled (humanized) and single-chain antibodies derived from antibodies of mice, called 225, which is described in US Patent No. 4943533. The patent granted to the University of California, and the license is granted solely ImClone Systems Incorporated.

Antibody 225 is able to inhibit the growth of cultured EGFR/HER1-expressing tumor cells in vitro and in vivo, when grown as xenografts in deprived hair (fur) mice. Cm. Masui et al., Cancer Res. 44, 5592-5598 (1986). Later, the treatment regimen combining 225 plus doxorubicin or this drug called cisplatin, showed therapeutic synergism relatively few General models xenografts person in mice. Basalga et al., J. Natl. Cancer Inst. 81, 1327-1333 (1993).

In one embodiment of the present invention sick people with refractory squamous cell carcinoma of the head and neck were treated by a combination of EGFR/HER1 antagonist (chimeric anti-EGFR monoclonal antibody, S) and cisplatin. These patients had not previously been treated only with ionizing radiation, one chemotherapy or a combination of these methods. EGFR/HER1 antagonist inhibited the growth of resistant tumors.

Hyperserotonemia, ennobled (humanized) and single-chain antibodies derived from antibodies 22 mice, can be obtained from the 225 antibody, which is available from ATS. On the contrary, various fragments required to obtain hyperserotonemia, ennobled (humanized) and 225 single-stranded antibodies, can be synthesized from the sequence presented in the work of the Wels et al. in Int. J. Cancer 60, 137-144 (1995). Hyperserotonemia 225 antibody (C225) can be obtained according to methods described above. Refined (humanitariannet) 225 antibody can be obtained according to the method described in example IV of the PCT application WO 96/40210, which is described in this invention as a reference. Single-stranded 225 antibody (Fv225) can be obtained according to methods described Wels et al. in Int. J. Cancer 60, 137-144 (1995) and in European Patent Application 502812.

Sequence hypervariable (CDR) regions of the light and heavy chains is reproduced below. Amino acid sequence indicates below the nucleotide sequence.

HEAVY CHAIN HYPERVARIABLE REGIONS (VH):

CDR1

AACTATGG TGTACAC (SEQ ID 1)

N Y G V N (SEQ ID 2)

CDR2

GTGATATGGAGTGGTGGAAACACAGACTATAATACACCTTTCACATCC

(SEQ ID 3)

V I W S G G N T D Y N T P F T S (SEQ ID 4)

CDR3

GCCCTCACCTACTATGATTACGAGTTTGCTTAC (SEQ ID 5)

A L T Y Y D Y E F A Y (SEQ ID 6)

LIGHT CHAIN HYPERVARIABLE REGIONS (VL):

CDR1

AGGGCCAGTCAGAGTATTGGCACAAACATACAC (SEQ ID 7)

R A S Q S I G N I I H (SEQ ID 8)

CDR2

GCTTCTGAGTCTATCTCT (SEQ ID 9)

A S E S I S (SEQ ID 10)

CDR3

CAACAAAATAATAACTGGCCAACCACG (SEQ ID 11)

Q Q N N N W P T T (SEQ ID 12)

Chrome is biological molecules, as was discussed above, the antagonists described in this invention can also be small molecules. Any molecule that is not the biological molecule, consider this description as small molecules. Some examples of small molecules include organic compounds, ORGANOMETALLIC compounds, salts of organic and ORGANOMETALLIC compounds, sugars, amino acids and nucleotides. Small molecules include molecules that in other cases should be considered as biological molecules, except for their molecular weight which is not more than 450. Thus, small molecules can be lipids, oligosaccharides, oligopeptides, and oligonucleotide and their derivatives with a molecular weight of 450 or less.

It should be emphasized that small molecules can be of any molecular weight. They just called small molecules, because they usually have a molecular weight less than 450. Small molecules include compounds that occur in nature, as well as synthetic compounds. Preferably, when small molecules inhibit the growth of drug-resistant tumor cells that Express EGFR/HER1 tyrosine kinase.

Described by many small molecules that are suitable for the inhibition of EGFR. For example, Spada et al., U.S. patent No. 5656655 describe sterilzation GE is urokinasetype, which inhibit EGFR. Heteroaryl represents a monocyclic ring with one or two heteroatoms or bicyclic ring heteroatoms from one to four, and can connect substituted or polyamidine. Compounds described in U.S. patent No. 5656655 described in this invention as a reference.

Spada et al., U.S. patent No. 5646153 describe bisono and/or bicycloalkyl, heteroaryl-, carbocyclic and heterocorallia compounds that inhibit EGFR. Compounds described in U.S. patent No. 5646153 described in this invention as a reference.

Bridges et al., U.S. patent No. 5679683 describe tricyclic pyrimidine compounds that inhibit EGFR. Compounds are condensed heterocyclic pyrimidine derivatives described from column 3 line 35 to column 5 line 6. Descriptions of these compounds from column 3 line 35 to column 5 line 6 shows the present invention as a reference.

Barker, U.S. patent No. 5616582 describes derivatives of hintline that have tyrosinekinase receptor inhibitory activity. Compounds described in U.S. patent No. 5616582 described in this invention as a reference.

Fry et al., Science 265, 1093-1095 (1994) describe compounds with a structure that inhibits EGFR. The structure is shown in figure 1. The connection is asanee figure 1 in publication Fry et al., described in this invention as a reference.

Osherov et al. describes tyrphostin that inhibit EGFR/HER1 and HER2. Compounds described in the publication Osherov et al., and especially compounds in tables I, II, III and IV described in this invention as a reference.

Levitzki et al., U.S. patent No. 5196446 describe heterokedasticity or heteroarylenevinylenes compounds that inhibit EGFR. Compounds described in U.S. patent No. 5196446 from column 2 line 42 to column 3 line 40, described in this invention as a reference.

Panek et al., Journal of Pharmacology and Experimental Therapeutics 283, 1433-1444 (1997) describe the connection identified as PD 166285, which inhibits EGFR, DERIVED and FGFR family of receptors. PD 166285 identified as 6-(2,6-dichlorophenyl)-2-(4-(2-diethylaminoethoxy)phenyl-amino)-8-methyl-8H-pyrido(2,3-d) pyrimidine-7-he with the structure shown in figure 1 on str. The connection described in figure 1 on str in the publication Panek et al., described in this invention as a reference.

The introduction of EGFR/HER1 antagonist

This invention includes the introduction of an effective amount of EGFR/R1 antagonist sick people. The introduction of EGFR/HER1 antagonist can be achieved in various ways, including the systematic introduction of parenteral and enteral methods. For example, EGFR/HER1 antagonist described in this invention can easily be entered in otrivine (for example, intravenous injection), which is the preferred method of administration. Intravenous administration can be achieved by contacting EGFR/HER1 antagonist with an appropriate pharmaceutical carrier (filler or filler, as clearly professionals. EGFR/HER1 antagonist can be administered with adjuvants, such as, for example, BCG, stimulants of the immune system and chemotherapeutic agents.

EGFR/HER1 antagonist, which represent a small molecule or biological drugs, can be entered as described in Spada, US Patent No. 5646153 with column 57 line 47 to column line 59 67. This description introduction small molecules described in this invention as a reference.

EGFR/HER1 antagonist described in this invention significantly inhibit the growth of drug-resistant tumor cells with the introduction of the patient an effective amount of them. As defined in this invention, the effective amount is such an amount which is effective to achieve a specific result of inhibiting the growth of resistant tumors.

Preferably, when EGFR/HER1 antagonist is provided in the tumor in an amount that inhibits tumor growth without disrupting the growth of normal tissue. Most preferably, when EGFR/HER1 antagonist inhibits tumor growth without serious side effe is tov. Some serious side effects include inhibition (suppression) of the bone marrow, anemia and infection.

The optimal dose of EGFR/HER1 antagonist, which are antibodies and functional equivalents of antibodies can be determined by doctors on the basis of a number of indications, including, for example, age, sex, weight, severity of condition, which are treated, injected antibodies and by way of introduction. Usually, the desired concentration of the polypeptide and antibodies in the serum, which allows the saturation of the target receptor (receptor-target). For example, excessive concentration of approximately 0.1 nm is usually sufficient. For example, a dose of 100 mg/m2C is the concentration in the serum of approximately 20 nm and approximately 8 days.

As rough guidelines, the dose of the antibody may be given weekly in the amount of 10-300 mg/m2. Dose equivalent fragments of antibodies should be used through more frequent intervals, in order to maintain the level of serum concentration, which leads to saturation of the receptors.

Combinational therapy

In a preferred embodiment, the resistant tumor can be treated with an effective amount of the EGFR/HER1 antagonist with chemotherapeutic agents, ionizing radiation, or a combination.

Examples of chemotherapeutic agents or chemotherapy involves and what caliraya agents, for example, mustard gas (nitrogen mustard), compounds etilenimina, alkyl sulphonates and other compounds with an alkylating actions, such as nitrosamine, cisplatin and dacarbazine; antimetabolites, such as folic acid, purine or pyrimidinone antagonists; mitotic inhibitors, for example, Vinca alkaloids and derivatives podofillotoksina; cytotoxic antibiotics and derivatives camptothecin.

Derivatives camptothecin include, for example, camptothecin, 7-Etiketten, 10-hydroxy-7-Etiketten (SN38), 9-aminocamptothecin, 10,1-methylenedioxyamphetamine (10,1-methylenedioxycamptothecin, MDCPT) and topotecan. Such derivatives camptothecin also include lactosidase stable composition 7-etikettering described in U.S. patent No. 5604233, and a full description is provided in this invention by reference.

The invention includes vysokopitatelny derivatives camptothecin, such as, for example, 10,11-methylenedioxyamphetamine, 10,11-etilendioksitiofen, 9-Etiketten, 7-ethyl-10-hydroxycamptothecin, 9-metalcontaining, 9-chloro-10, 11-methylenedioxyamphetamine, 9-Chloromycetin, 10-hydroxycamptothecin, 9,10-dichloroanthracene, 10-bromination, 10-Chloromycetin, 9-forcompetition, 10-metalcontaining, 10-forcompetition, 9-methoxycoumarin, 9-chloro-7-Etiketten and 11-forcompetition. So the e vysokopitatelny derivatives camptothecin described in U.S. patent No. 5880133, and a full description is provided in this invention by reference.

Water-soluble derivatives of camptothecin include, for example, water-soluble analogue of camptothecin, known as CPT-11, 11-hydroxy-7-alkoxycarbonyl,11-hydroxy-7-methoxycoumarin (11-hydroxy-7-metoxycamptothecin,11,7-HMCPT) and 11-hydroxy-7-Etiketten (11-hydroxy-7-ethylcamptothecin,11,7-NEST), 7-dimethylaminomethylene-10,11-methylenedioxy-20(R,S)-camptothecin, 7-dimethylaminomethylene-10,11-methylenedioxy-20(S)-camptothecin, 7-dimethylaminomethylene-10,11-Ethylenedioxy-20(R,S)-camptothecin and 7-morpholinomethyl-10,11-Ethylenedioxy-20(S)-camptothecin. Such water-soluble derivatives of camptothecin described in U.S. patent No. 5559235 and 5468754, and a full description is provided in this invention by reference.

Preferred chemotherapeutic agents or chemotherapy involves amifostine (ethyol), this drug called cisplatin, dacarbazine (DTIC), dactinomycin, mechlorethamine (mustard gas), streptozocin, cyclophosphamide, carmustine (BCNU), lomustin (CCNU), doxorubicin (adriamycin), doxorubicin lipo (doxil), gemcitabine (Gemzar), daunorubicin, daunorubicin lipo (daunoxome), procarbazine, mitomycin, cytarabine, etoposide, methotrexate, 5-fluorouracil, vinblastine, vincristine, bleomycin, paclitaxel (Taxol), docetaxel (Taxotere), aldesleukin, asparaginase, busulfan, carboplatin, cladribine, camptothecin, CPT-11, 10-hydroxy-7-ethyl shall camptothecin (SN38), the dacarbazine, floxuridine, fludarabine, hydroxyurea, ifosfamide, idarubitsin, meso, α-interferon, β-interferon, irinotecan, mitoxantrone, topotecan, leuprolide, megestrol, melphalan, mercaptopurine, plicamycin, mitotane, pegaspargase, pentostatin, pipobroman, plicamycin, streptozocin, tamoxifen, teniposide, testolactone, tioguanin, thiotepa, urallestorg, vinorelbine, chlorambucil, and combinations thereof.

The introduction of chemotherapeutic agents can be achieved in various ways, including the systematic introduction of parenteral and enteral methods. Preferably the chemotherapeutic agent is administered intravenously by contacting chemotherapeutic agent with an appropriate pharmaceutical carrier or excipient, as clearly professionals. The dose of chemotherapeutic agent depends on several known factors. Such factors include age, sex, weight, severity of condition, which are treated, the nature of the input agent and route of administration. For example, this drug called cisplatin is convenient to introduce a dose of about 100 mg/m2. It should be emphasized, however, that the invention is not limited to any particular dose.

In another embodiment, resistant tumors can be treated with an effective amount of the EGFR/HER1 antagonist in combination with ionizing radiation. A source of ionizing and the radiation can be either external, or internal to the patient, where they treat. If the source is external in relation to the patient, therapy is known as remote outer radiation therapy (external beam radiation therapy (EBRT). If a source of ionizing radiation is internal to the patient, a treatment called brachytherapy (brachytherapy, W).

Ionizing radiation is administered in accordance with known standard method standard equipment for these purposes, such as AECL Theratron and Varian Clinac. The dose depends on many well-known factors. Such factors include the body, which treats; healthy bodies on the path of ionizing radiation, which may unintentionally be subjected to adverse effects; the tolerance of the patient to radiation therapy and the surface of the body, necessary for treatment. The usual dose is from 1 to 100 Gy and most preferably from 2 to 80 Gy. Some doses reported, amounts to 35 Gy for the spinal cord, 15 Gy to the kidneys, 20 Gy to the liver and 65-80 Gy for prostate cancer. However, it should be emphasized that the invention is not limited to any particular dose. The dose should be determined by the attending physician in accordance with the specific factors in a given situation, including the factors mentioned above.

The distance between the source of external ioniziruushei what about the radiation and the point of penetration in the patient can be any distance, which represents an acceptable balance between the killing of target cells and minimizing side effects. Typically, the external source of ionizing radiation is at a distance of from 70 to 100 cm from the point of penetration in the patient.

Brachytherapy is usually performed at the location of the source of ionizing radiation to the patient. Typically, the source of ionizing radiation is placed approximately 0-3 cm from the fabric, which is treated. Known techniques include interstitial, intercavitary and superficial brachytherapy. Radioactive capsules can be implanted permanently or temporarily. Some typical radioactive atoms that are used in permanent implants, include iodine-125 and radon. Some typical radioactive atoms that are used in temporary implants include radium, cesium-137 and iridium-192. Some additional radioactive atoms that were used in brachytherapy include americium-241 and gold-198.

The dose of ionizing radiation brachytherapy may be the same as mentioned above for external remote radiation therapy. In addition to the factors mentioned above to determine the dose of external remote radiation therapy should take into account the nature of the used radioactive atom when determining dose rate brachytherapy.

In preference the equipment variant, synergies, when the resistant tumor in patients treated with EGFR/HER1 antagonist and chemotherapeutic agents or ionizing radiation, or a combination of both. In other words, the inhibition of tumor growth EGFR/HER1 antagonist increases in combination with chemotherapeutic agents or ionizing radiation, or a combination of both. Synergies can be demonstrated, for example, a large inhibition of the growth of resistant tumors in the combined treatment than what you'd expect only from treatment or EGFR/HER1 antagonist, a chemotherapeutic agent or ionizing radiation. Preferably, when the synergy demonstrated by the remission of malignant tumors, where remission is not expected from treatment only EGFR/HER1 antagonist, a chemotherapeutic agent or ionizing radiation.

EGFR/HER1 antagonist is administered before, during or after the beginning of the introduction of the chemotherapeutic agent or ionizing radiation, or any combination thereof, i.e. before and during, before and after, during and after, or before, during, and after the beginning of the introduction of the chemotherapeutic agent and/or ionizing radiation. For example, if EGFR/HER1 antagonist is an antibody, it is usually administered from 1 to 30 days, preferably from 3 to 20 days, more preferably from 5 to 12 days before the start of radiation therapy and/or administration of tuberculosis treatment is efticiency agents.

Example 1. Clinical study

In a clinical study of patients with refractory squamous cell carcinoma of the head and neck were treated by a combination of EGFR/HER1 antagonist (chimeric anti-EGFR monoclonal antibody, S) and cisplatin. Patients received weekly infusions S with shock/dose 100/100, 400/250 or 500/250 mg/m2in combination with 100 mg/m2cisplatine all three weeks. Tumor samples were obtained at zero time, 24 hours after the initial infusion, 24 hours after the third infusion for determination of EGFR saturation and functions. EGFR saturation of the tumor was determined immunohistochemically (immunohistochemistry, IHC), using M (murine analogue S) as primary antibodies, antimist IgG (IgG against mouse) as secondary antibodies for the detection of EGFR free. EGFR function was determined by IHC using an antibody specific for activated EGFR (Transduction Labs), and measurement of EGFR tyrosinekinase activity on tumor lysates after enlightenment C225-EGFR complexes. Increasing the saturation of the receptor depending on the dose were observed at more than 70% of the saturation of the receptor with 500/250/100 mg/m2the dose levels. Similarly, a significant decrease in EGFR-tyrosinekinase activity was noted when netdetective activity in 67% of patients at doses 100/100 mg/m2assuming the function is optional saturation. Negative cases were fever, allergic reactions and percutaneous toxicity, manifested in the form of a follicular rash or changes in the nail bed, which completely resolved after discontinuation of treatment. Seven assessable patients had a minimum one, five partial and one complete response as defined under medical examination of laboratory data. The complete reaction was observed in one patient who was previously treated cisplatino. Partial response was observed in five patients, four had previously received chemotherapy and one or radiation therapy. The minimum response was observed in one patient with previous radiation therapy. The results are shown in the table, where CR indicates complete response, PR means a partial response, and MR represents the minimum response.

Table 1
Clinical research
SickThe pre-treatmentThe overall reaction
1CisplatinCR
2Ad p53PR
3CisplatinPR
4CisplatinPR
5Only the irradiationPR
6ChemotherapyPR
7Only the irradiationMR

Example 2. Clinical study

In a clinical study of a patient with resistant colon cancer treated with combination of EGFR/HER1 antagonist (chimeric anti-EGFR monoclonal antibody, S) and CPT-11. The patient received weekly injections S with a loading dose of 400 mg/m2in combination with 125 mg/m2CPT-11. Maintenance dose of 250 mg/m2S in combination with 69-125 mg/m2CPT-11 was administered on a weekly basis. Clinically the patient had a complete response. The implementation scheme is shown below in table 2.

Table 2
Clinical research
C/CPT-11 weekly dose in mg/m2C/CPT-11 (actual dose in mg)The duration of infusion S (minutes)The duration of infusion of CPT-11 (min)
400/125576/18012090
250/125360/1806090
250/CPT-11 supported360/060N/A
360/1355075
250/69360/1006085
250/69360/1006075

1. Applying an effective amount of an antagonist of the growth factor receptor epidermal (EGFR) as an active ingredient in the manufacture of medicaments for inhibiting the growth of drug-resistant tumor in a patient.

2. Applying an effective amount of EGFR antagonist and a chemotherapeutic agent as active ingredients in the manufacture of medicaments for inhibiting the growth of drug-resistant tumor in a patient.

3. Applying an effective amount of EGFR antagonist as an active ingredient in the manufacture of medicaments for inhibiting the growth of drug-resistant tumor in a patient, and together with drug use ionizing radiation.

4. The use according to any one of claims 1 to 3, characterized in that the resistant tumor sverkhekspressiya EGFR.

5. The use according to any one of claims 1 to 4, characterized in that the resistant tumor is resistant tumor of the breast, heart, lung, small intestine, colon, spleen, kidney, bladder, head and neck, ovary, prostate, brain, pancreas, skin, bone, bone marrow, blood, milocco the second gland, uterus, testicles, neck or liver.

6. The use according to any one of claims 1 to 5, characterized in that the resistant tumor cannot be treated or it does not respond to treatment.

7. The use according to any one of claims 1 to 6, characterized in that the resistant tumor is resistant tumor of the colon or head and neck.

8. The use according to any one of claims 1 to 7, characterized in that the resistant tumor is resistant tumor of squamous cell carcinoma.

9. The use according to any one of claims 1 to 8, wherein the EGFR antagonist is administered intravenously.

10. The use according to any one of claims 1 to 9, wherein the EGFR antagonist is administered orally.

11. The use according to any one of claim 2 to 10, wherein the EGFR antagonist is administered before the introduction of the chemotherapeutic agent.

12. The use according to any one of claims 1 to 11, wherein the EGFR antagonist is administered in a dose of from 10 to 500 mg/m2weekly.

13. The use according to claims 1-12, wherein the EGFR antagonist inhibits the stimulation of EGFR by its ligand.

14. The application of item 13, wherein the EGFR antagonist inhibits the binding of EGFR with its ligand.

15. Use item 13 or 14, wherein the EGFR antagonist binds EGFR externally.

16. The use according to any one of p-15, wherein the EGFR antagonist binds EGFR internally.

17. The use according to any one of p-16, characterized in that the EFR antagonist inhibits the binding of adenosine triphosphate with EGFR.

18. The use according to any one of p-17, wherein the EGFR antagonist competes with ATP for EGFR.

19. The use according to any one of p-18, wherein the EGFR antagonist inhibits EGFR phosphorylation.

20. The use according to any one of PP-19, wherein the EGFR antagonist inhibits EGFR tyrosinekinase activity.

21. The use according to any one of claims 1 to 20, wherein the EGFR antagonist comprises an antibody or functional equivalent of its specific for EGFR.

22. The application of item 21, wherein the antibody comprises a constant region of human antibodies.

23. The application of item 21 or 22, characterized in that the antibody is a chimeric antibody comprising the variable region of the antibodies of the mouse.

24. The use according to any one of p-23, characterized in that the antibody is purified (humanitarianism) an antibody comprising the variable region hypervariable sites of antibodies mouse and spanning regions of human antibodies.

25. The use according to any one of p-24, characterized in that the antibody is a human antibody comprising the variable region of the antibody is human.

26. The use according to any one of claims 1 to 25, characterized in that the antibody is administered at a dose sufficient for saturation of EGFR.

27. The use according to any one of claims 1 to 26, wherein the EGFR antagonist R is t small molecule.

28. The application of item 27, wherein the small molecule comprises a connection PD 153035 the following structure:

29. The application of item 27, wherein the small molecule comprises a compound benzylidenemalononitrile or tyrphostin.

30. The application of item 27, wherein the small molecule comprises sterilzation heteroderidae connection.

31. The application of item 30, wherein sterilzation heteroderidae connection includes monocyclic ring with 1 or 2 heteroatoms or bicyclic ring with 1-4 heteroatoms, which may be replaced or polygamists.

32. The application of article 30 or 31, characterized in that sterilzation heteroderidae compound comprises the following structure:

where R1- accelgroup, a hydrogen atom, a CN group, IT group, COOR group, CONRR - group or CSNRR-group

R2- 8-12-membered bicyclic aryl ring including 1 to 4 nitrogen atoms, oxygen, or sulfur, or 1-4 N-oxide group, and the ring may be substituted with 1-3 R9-substituents that do not have a common connection points to the ring,

R3- accelgroup, a hydrogen atom, a CN group, IT group, COOR group, CONRR - group, CSNRR-group or-CH2CN-group,

each R45, R6, R7and R8independently represents a hydrogen atom, a CN group, accelgroup, halogen atom, -OR,-group, -Cho group, a-COOH group, -NRR-group or its N-oxide, -NO2group, -NHCOCH3group-SR-group - CF3group, -CH=SSOON-group-NHCO(CH2)2COOH-group, heterocyclic group, heteroaryl,

each R9independently represents accelgroup, CN group, halogen atom, -OR,-group, -Cho group, a-COOH group, -NRR-group or its N-oxide, -NO2group, -NHCOCH3group-SR-group-CF3group, -CH=SSOON-group-NHCO(CH2)2COOH-group, heterocyclic group, heteroaryl

R is a hydrogen atom, accelgroup or kalkilya and

R3and R7together can be-CH2CH2group, -CH2CH2CH2group or on the basis of R3, CONH group,

or pharmaceutically acceptable salt of this compound.

33. The application of item 27, wherein the small molecule comprises a tricyclic pyrimidine connection.

34. Use p, wherein the tricyclic pyrimidine compound includes

4-(3-bromoaniline)benzothieno[3,2-d]pyrimidine;

4-(3-bromoaniline)-8-nitrobenzoate [3,2-d]pyrimidine;

8-amino-4-(3-bromoaniline)Ben is Otieno[3,2-d]pyrimidine or

4-(3-bromoaniline)-8-methoxybenzamido[3,2-d] pyrimidine.

35. The application of item 27, wherein the small molecule comprises bis-, mono - or bicyclic aryl-, heteroaryl-, carbocyclic or heteroeroticism connection.

36. The application of item 27, wherein the small molecule comprises a compound of the following structure:

where ArI and ArII independently represent a substituted or unsubstituted mono - or bicyclic ring, this ring may substituted 0-3 R-groups;

X - (CHR1)0-4group or a (CHR-1)m-Z-(CHR1)ngroup, where Z is an oxygen atom, NR'-group, a sulfur atom, a SO group or SO2group; m and n = 0-3 and m+n=0-3 and R1and R' independently are a hydrogen atom or accelgroup, or pharmaceutically acceptable salt of this compound, and

R is a hydrogen atom, accelgroup, altergroup, failgroup, kalkilya, arancelaria, the hydroxy-group, hydroxyalkyl, alkoxygroup, alkoxyalkyl, urlcategory, alloctype, halogen atom, kaleidoscope, the nitro-group, amino group, mono - and dialkylamino, alluminare, carboxypropyl, carboxyaldehyde, carbalkoxy, carbalkoxy, carbalkoxy, carboncontaining, cycloalkylation, 'is group or benzoylurea; and where R and R together can form Citigroup.

37. The application of item 27, wherein the small molecule comprises a derivative of hintline.

38. The application of clause 37, wherein the derived hintline includes a compound of the following structure:

where m = 1, 2, or 3 and each R1includes a hydroxy-group, amino group, carboxypropyl, carbamoyl, raidgroup, (1-4C)alkoxycarbonyl, N-(1-4C)allylcarbamate, N,N-di-[(1-4C)alkyl] carbamoyl, hydroxyamino group, (1-4C)alkoxyamino, (2-4C)alkanolamines, cryptometer, (1-4C)accelgroup, (1-4C)alkoxygroup and (1-3C)alkylenedioxy and n is 1 or 2 and each R2includes a hydrogen atom, a hydroxy-group, halogen atom, triptoreline, an amino group, a nitrogroup, langroup and (1-4C)accelgroup, or pharmaceutically acceptable salt of this compound.

39. The application of item 27, wherein the small molecule comprises a connection PD 166285 the following structure:

40. The use according to any one of claim 2 or 4-39, wherein the application further includes the appointment of ionizing radiation.

41. The use according to any one of p-39, wherein applying further includes the introduction of the chemotherapeutic agent is.

42. The use according to any one of claim 2 or 4-41, wherein the chemotherapeutic agent comprises amifostine, this drug called cisplatin, dactinomycin, mechlorethamine, cyclophosphamide, carmustin, lomustin, doxorubicin, doxorubicin lipo, gemcitabine, daunorubicin, procarbazine, mitomycin, cytarabine, etoposide, methotrexate, 5-fluorouracil, vinblastine, vincristine, bleomycin, paclitaxel, docetaxel, aldesleukin, asparaginase, busulfan, carboplatin, cladribine, camptothecin, 10-hydroxy-7-ethyl-camptothecin (SN38), dacarbazine, floxuridine, fludarabine, hydroxyurea, ifosfamide, idarubitsin, mesna that α-interferon, β-interferon, irinotecan, mitoxantrone, topotecan, leuprolide, megestrol, melphalan, mercaptopurine, plicamycin, mitotane, pegaspargase, pentostatin, pipobroman, plicamycin, streptozocin, tamoxifen, teniposide, testolactone, tioguanin, thiotepa, urallestorg, vinorelbine or chlorambucil, or a combination of these compounds.

43. The use according to any one of claim 2 or 4-41, wherein the chemotherapeutic agent includes this drug called cisplatin, doxorubicin, paclitaxel, irinotecan or topotecan, or a combination of these chemotherapeutic agents.

44. The use according to claim 2 or any of claims 4 to 43, wherein the chemotherapeutic agent is irinotecan or cisplatin and injected at a dose of 69-125 mg/m2weekly.

5. The use according to any one of p-44, characterized in that the source of ionizing radiation is internal to the person.

46. The use according to any one of p-44, characterized in that the source of ionizing radiation is external to the person.

47. The use according to any one of p-46, characterized in that the ionizing radiation is from 2 to 80 Gy.

48. The use according to any one of claims 1 to 47, wherein the application further includes the introduction of adjuvant.

49. Applying an effective amount of a chimeric antibody, which is specific for EGFR, along with cisplatine in the manufacture of medicaments for inhibiting the growth of resistant tumors squamous cell cancer of the head and neck.

50. Applying an effective amount of a chimeric antibody, which is specific for EGFR, together with irinotecan in the manufacture of medicaments for inhibiting the growth of resistant tumors of the colon.



 

Same patents:

FIELD: medicine, oncology.

SUBSTANCE: the present innovation deals with adjuvant chemoradiation therapy of malignant cerebral meningiomas. In postsurgical period it is necessary to carry out lumbar puncture, catheterize subarachnoid space, sample 5 ml liquor, incubate liquor with cisplatin at the quantity of 0.1 mg in vitro at 38°C for 30 min to introduce it through a catheter into subarachnoid space. The procedure should be carried out twice at a 7-d-long interval, since the 2nd d of the beginning of this procedure it is necessary to conduct distance gamma-therapy at the bottom of removed tumor daily for 20 d up to total focal dosage being 60 Gy. The innovation enables to achieve stable remission, decrease toxicity of chemopreparation and frequency of side effects at considerable decrease of its cost price.

EFFECT: higher efficiency of therapy.

1 ex

FIELD: organic chemistry, medicine, pharmacy.

SUBSTANCE: invention relates to geranyl compounds represented by the following formulas (I-1) , (I-2) or (I-3) wherein R1 means compounds of the following formulas: or R2 means a group remaining after removing all carboxyl groups presenting in carboxylic acid chosen from group consisting of malic acid, citric acid, succinic acid, fumaric acid and others; m = 1, 2 or 3; n = 0, 1 or 2, and m + n represent a number of carboxylic groups presenting in indicated carboxylic acid; R3 means p-hydroxyphenyl or mercapto-group. Also, invention relates to derivatives of mevalonic acid represented by the following formula (I-4): wherein R means -CH2OH or CH3. Also, invention to an antitumor agent comprising as an active component geranyl compound of formulas (I-1), (I-2) or (I-3) or derivative of mevalonic acid of the formula (I-4), and optionally a pharmaceutically acceptable carrier or solvent. Also, invention relates to a method for treatment of liver cancer based on using geranyl compound of formulas (I-1), (I-2) or (I-3), or derivative of mevalonic acid of the formula (I-4) and using proposed compounds in manufacturing an antitumor agent. Invention provides using geranyl compounds or derivatives of mevalonic acid as antitumor agents.

EFFECT: valuable medicinal properties of compounds and pharmaceutical composition.

7 cl, 3 tbl, 17 ex

FIELD: medicine, therapy.

SUBSTANCE: as a sclerotherapeutic preparation one should choose ethoxysclerol to carry out 1-2 courses of therapy at intervals between the courses being 14-21 d. Preparation should be introduced under ultrasound control by introducing 0.5-4%-ethoxysclerol solution at the quantity of 0.5-1 ml/ml nodal volume in case of nodal-type neoplasm. In case of cystic neoplasm - at the quantity of 3-5 ml. Introduction should be fulfilled after liquid aspiration only. One day before the onset of every course of sclerotherapy Movalis 7.5 mg should be prescribed once daily after meals for 5-10 d. The innovation enables to avoid surgical therapy, and, also, increase patients' quality of life due to carrying out sclerosing along with interrupting the pronounced pain syndrome and in some cases heal the disease mentioned.

EFFECT: higher efficiency of therapy.

2 cl, 4 ex

FIELD: chemical-pharmaceutical industry, biochemistry, medicine.

SUBSTANCE: invention relates to a liposome directly effecting on αvβ3-integrin receptors and comprising cationic amphiphilic substance including 1,2-dioleoyloxy-3-(N,N,N-trimethylammonium)propane chloride, neutral lipid, lipid with a direct effect having domain with a direct effect and hydrophobic domain bound with domain of a direct effect, and nucleic acid forming complex with cationic lipid. Cationic lipid presents in the amount from about 1 to about 50 molar % and indicated lipid with a direct effect presents in the amount from about 1 to about 20 molar % wherein molar percents are calculated as measured for the total number of lipid moles in liposome. Domain with a direct effect comprises a nonpeptide antagonist of αvβ3-integrin comprising 4-[2-(3,4,5,6-tetrahydropyrimidin-2-ylamino)ethyloxy]-benzoyl-2-(S)-aminoethylsulfonamino-β-alanine (compound 10) bound covalently with hydrophilic domain by amide bond. Also, invention relates to a method for inhibition of angiogenesis and involving administration to a patient needing in inhibition of angiogenesis a liposome in the therapeutically effective dose that directly effects on αvβ3-integrin receptors and comprising nucleic acid that is able to express a protein or peptide suppressing angiogenesis.

EFFECT: valuable properties of system.

27 cl, 2 tbl, 18 dwg, 8 ex

FIELD: organic chemistry, chemical technology, medicine, oncology, pharmacy.

SUBSTANCE: invention relates to novel derivative of variolin B of the general formula (I) or their pharmaceutically acceptable salts possessing antitumor activity. In the general formula (I) radical R1 means aromatic group representing aromatic group representing phenyl optionally substituted with nitro-group, amino-group or alkyl-substituted amino-group, or aromatic group represents 5-6-membered heterocycle with two nitrogen atoms or sulfur atom as heteroatoms optionally substituted with (C1-C12)-alkyl, -OH, unsubstituted amino-group or amino-group substituted with (C1-C4)-acyl, phenyl-(C1-C4)-alkyl wherein phenyl group can be substituted with -OR1, or (C1-C12)-alkylthio-group, (C1-C12)-alkyl- or phenylsulfonyl, (C1-C12)-alkyl- or phenylsulfinyl or -OR1 wherein R1 is chosen from (C1-C12)-alkyl or phenyl; R2 represents hydrogen atom; R3 represents oxo-group when a dotted line is between nitrogen atom to which R2 is bound and carbon atom to which R3 is absent, or R2 is absent when R3 represents optionally protected amino-group wherein a substitute is chosen from (C1-C4)-acyl, phenylsulfonyl and (C1-C4)-alkylphenylsulfonyl when a dotted line forms a double bond between nitrogen atom to which R2 is bound and carbon atom to which R2 is bound; R4 represent hydrogen atom. Also, invention relates to a method for synthesis of compounds of the invention and to intermediate substances for their realization. Also, invention relates to a pharmaceutical composition based on variolin B derivatives.

EFFECT: improved method of synthesis, valuable medicinal property of compounds and pharmaceutical composition.

22 cl, 5 sch, 1 tbl, 50 ex

FIELD: organic chemistry, medicine, oncology, biochemistry, pharmacy.

SUBSTANCE: invention relates to novel tricyclic compounds, their pharmaceutically acceptable salts and solvates useful for inhibition of activity of farnesyl-protein-transferase. Invention describes compound of the formula (1.0): or its pharmaceutically acceptable salt or solvate wherein one among a, b, c and d means nitrogen atom (N) or -N+O-, and other a, b, c and d mean carbon atom and wherein each carbon atom comprises radical R1 or R2 bound to indicated carbon atom; or all a, b, c and d mean carbon atom wherein each carbon atom comprises radical R1 or R2 bound to indicated carbon atom; broken line (- - -) means optional binds; X means N or -CH when optional bond is absent, and it means carbon atom (C) when optional bond presents; when optional bond between carbon atom 5 and carbon atom 6 presents then only a single substitute A presents bound with carbon atom 5, and only a single substitute B presents bound with carbon atom 6, and A and B fifer from hydrogen atom (H); if optional bind between carbon atom 5 and carbon atom 6 is absent then two substitutes A present bound with carbon atom 5, and two substitutes B bound with carbon atom 6 wherein at least one of two substitutes A or one among two substitutes B mean H and wherein at least one of two substitutes A or one of two substitutes B has value distinct from H, and other radical are described in the invention claim. Also, invention disclosed a pharmaceutical composition comprising such compounds, a method for inhibition of anomalous growth of cells and methods for treatment of proliferative diseases as cancer.

EFFECT: valuable medicinal properties of compounds and pharmaceutical composition, improved method of treatment.

52 cl, 2 tbl, 505 ex

FIELD: medicine, biochemistry, pharmacy.

SUBSTANCE: invention describes dipeptide-nitrile inhibitors of cathepsin K, their pharmaceutically acceptable salts or their esters that are used in therapeutic or prophylaxis treatment of disease of morbid state mediated by cathepsin K.

EFFECT: valuable medicinal properties of inhibitors.

3 cl, 11 ex

FIELD: organic chemistry, biochemistry, medicine, pharmacy.

SUBSTANCE: invention describes compound of the formula (U): or its pharmaceutically acceptable salt wherein X is chosen from -NR1, sulfur atom (S); Y1 and Y2 represent oxygen atom (O); Z represents O; m = 0 or 1; A is chosen from a direct bond, (C1-C6)-alkyl; R1 is chosen from hydrogen atom (H), alkyl; R3 and R6 are chosen independently from H, alkyl, halogenalkyl, heteroalkyl, cycloalkyl, aryl, cycloalkyl-alkyl, cycloalkyl-heteroalkyl, heterocycloalkyl-alkyl, alkylaryl, heteroaryl, arylalkyl, aryl-heteroalkyl, heteroaryl-alkyl, heteroaryl-heteroalkyl or heterocycloalkyl; R4 is chosen from H, alkyl; R5 represents a bicyclic or tricyclic group comprising two or three ring structure wherein each of that comprises from 3 to 7 ring atoms chosen independently from cycloalkyl, aryl, heterocycloalkyl or heteroaryl wherein each ring structure is joined with the next ring structure through a direct bond, through -O-, through -S-, through (C1-C6)-alkyl, through (C1-C6)-heteroalkyl, through (C1-C6)-alkynyl, through carboxy-(C1-C6)-alkyl, or it is condensed with the next ring structure wherein heteroalkyl represents heteroatom-substituted alkyl comprising one heteroatom chosen from N, O and S. Also, invention describes compounds of formulae (Ib), (Ic) and (Id) given in the invention description, pharmaceutical composition and using these compounds in preparing a medicine for using in treatment of disease or state mediated by one or more enzymes representing metalloproteinase. Represented compounds are useful as inhibitors of metalloproteinases and especially as inhibitors of MMP12.

EFFECT: valuable medicinal and biochemical properties of compounds and pharmaceutical composition.

17 cl, 3 tbl, 17 ex

FIELD: organic chemistry, biochemistry, medicine, pharmacy.

SUBSTANCE: invention describes compound of the formula (I): wherein X represents -NR1; Y1 and Y2 represent oxygen atom (O); Z is chosen from -SO2N(R6), -N(R7)SO2; m = 1 or 2; A is chosen from a direct bond, (C1-C6)-alkyl; R1 represents hydrogen atom (H); each R2 and R3 is chosen independently from H, alkyl, aryl, alkylaryl, arylalkyl; each R4 is chosen independently from H, (C1-C3)-alkyl; R6 is chosen from H, alkyl, aryl, heteroaryl, alkylaryl, alkyl-heteroaryl, arylalkyl, heteroaryl-alkyl; R2 and R6 can join to form a ring comprising up to 7 ring atoms, or R3 and R6 can join to form a ring comprising up to 7 ring atoms, or R4 and R6 can join to form a ring comprising up to 7 ring atoms; R5 represents monocyclic, bicyclic or tricyclic group comprising one or two ring structures wherein each of that comprises up to 7 ring atoms chosen independently from cycloalkyl, aryl, heterocycloalkyl or heteroaryl and possibly substituted; when R5 represents bicyclic group then each ring structure is bound with the next ring structure through a direct bond, through -O-, through (C1-C6)-alkyl or condensed with this next ring structure; R7 is chosen from (C1-C6)-alkyl. Also, invention describes compound of the formula (II) given in the description, pharmaceutical compositions and using compound of the formula (I) or the formula (II) in preparing a medicine for using in treatment of disease or state mediated by one or more enzymes and representing metalloproteinase. Represented compounds are useful as inhibitors of metalloproteinases and especially as inhibitors of MMP12.

EFFECT: valuable medicinal and biochemical properties of inhibitors and pharmaceutical compositions.

20 cl, 3 tbl, 6 ex

FIELD: medicine, oncology.

SUBSTANCE: method involves using an antitumor preparation prepared by using the apparatus-program complex (APC) "IMEDIS-TEST". Method involves blood sampling in a patient, its diluting in physiological solution in the ratio 1:1 followed by addition of the preparation "MP-antiprotein-blocker" and diluted blood in contour APC "IMEDIS-TEST". Then method involves effect with this preparation on blood in regimen "transfer" followed by returning blood in patient body. Then method involves carrying out treatment involving detoxification of body in 1, 14, 21, 28, 35 and 42 days of treatment using Glauber's salt (sodium sulfate decahydrate) as a laxative agent and also cleansing enema and fractional dose of citrus juice (40-50 ml) in the ratio 1:1 with water for 10-12 h and aqueous-turpentine bath. Then method involves carrying out the monocarrot diet for 12 days from 2-d to 13-th day of treatment inclusively; basic nutrition - each 6 days after detoxification comprising: a dose of olive oil before eating (30-35 g) with lemon juice in the ratio 1:1, in 25-30 min a dose of 100-120 ml of carrot-beet juice in the ratio 1:1, in 25-30 min a dose of 200-250 ml kefir infusion prepared from crude buckwheat grain, and a dose of 0.3 g of pepsin or 10-15 ml of pepsidil, a dose of 3.0-5.0 ml of horse radish roots infusion with lemon juice, a dose of 50-60 ml of medicinal herbs aqueous species. Method provides antitumor effect based on disturbance of cancer cells nutrition and normalization of body normal cells nutrition and recovery of metabolism and detoxification of the patient body. Invention can be used in treatment of malignant tumors of different localization and development stage.

EFFECT: enhanced effectiveness of diagnosis and treatment.

1 tbl, 2 ex

FIELD: medicine, oncology, immunology, tumor biology.

SUBSTANCE: invention relates, in particular, to methods for enhancing cytotoxicity based on applying anti-CD38-immune toxins. Method involves carrying out the treatment of patient with pathophysiological state taken among the group including myelomas and leukosis and involves the following stages: a) administration to the indicated patient the pharmacologically effective dose of retinoid that enhances expression of antigen CD38; and b) administration to the indicated patient the pharmacologically effective dose of immune toxin acting against effectively expressing antigen CD38. Method provides enhancing the cytotoxicity with respect to above said diseases in their resistance to anti-tumor medicinal agents.

EFFECT: enhanced and valuable method for treatment.

6 cl, 1 tbl, 9 dwg, 10 ex

The invention relates to biotechnology

The invention relates to medicine and relates to antibodies with reduced total positive charge

The invention relates to biotechnology and immunology, and can be used to generate neutralizing antibodies against different strains and clinical isolates of HIV-1

The invention relates to medicine, in particular to the immunological treatment response graft-versus-host (GVHD)

The invention relates to medicine and relates to a method of modifying a protein such as an antibody, methods of securing binding protein antibody pharmaceutical compositions of modified proteins for the treatment of human

The invention relates to medicine and concerns immunotoxin with neoplastic effect, the composition having a neoplastic activity, containing immunotoxin, and method of treatment of neoplastic cells
The invention relates to the application of Virology, specifically to the processes of separation, purification, modification of viruses and viral drugs, i.e

FIELD: veterinary, immunology.

SUBSTANCE: healthy calves are immunized three time with 10-day interval by hypodermic injection of immune serum from donor animal with hemagglutinin titer to infective rhinotracheitis virus of 1:256; to parainfluenza-3 virus of 1:1280; and to viral diarrhoea virus of 1:1024. After the first injection additionally probiotic preparation lactobifadol in amount of 16x108 microbial bifido- cells and 2x107 lactobacteria for 10 days in three courses.

EFFECT: nocifensor activation; decreased calf morbidity rate.

3 ex, 5 tbl

Up!