Pichia pastoris 2-2 yeast strain as producer of human platelet growth factor (pdgf-bb) and method for production of human platelet growth factor

FIELD: gene engineering, in particular preparation based on PDGF-BB, useful in therapy, veterinary, diagnosis, tissue culturing.

SUBSTANCE: invention relates to PDGF-BB production using Pichia pastoris 2-2 strain as producer of human platelet growth factor. Produced two-dimensional PDGF-BB form is characterized with purity of 95 %, specific activity of 3-5 ED50/ng, and expression level in yeast up to 0.1 g/l of culture.

EFFECT: two-dimensional PDGF-BB form with high purity, specific activity and expression level in yeast.

5 cl, 11 dwg, 5 ex

 

The invention relates to the field of biotechnology and genetic engineering and can be used in the production of drugs based on human platelet-derived growth factor (PDGF-BB).

Platelet-derived growth factor (human) is a strong protein mobility in SDS page-SDS, corresponding to a molecular mass 28-39 kDa. The protein consists of two identical polypeptide chains (In-circuit)connected by disulfide bonds. Synthesis and processing of PDGF-BB is in the megakaryocytes of the bone marrow cells, the precursors of platelets and is stored in the alpha granules of blood platelets. While platelet-derived growth factor is inside of platelets, it is not available for other cells, however, the interaction with thrombin activates blood platelets with subsequent release of the contents in the serum. Blood platelets are the main source of platelet-derived growth factor in the body, however, it is shown that some other cells, mainly in cells of mesenchymal origin, can also synthesize and secrete this factor (Heldin, S.N., Westermark Century, 1999, 79(4): 1283-1316). The secretory PDGF-BB induces directional movement (chemotaxis) of leukocytes polymorphonuclear neutrophils (which provides protection against pyogenic bacteria), granulocytes, macrophages. DL the stimulation of their directional movements enough external concentrations of PDGF 1-2 ng/ml (Siegbahn A. Et al., J.Clin. Invest., 1990, 85(3):916-920). The process involved cells of the connective tissue responsible for the formation of a scar: stimulates the proliferation of fibroblasts and their directional movement, as well as the synthesis and secretion of extracellular matrix proteins.

Currently, the drugs platelet-derived growth factor (human) (Becaplermin = 0.01% Regranex gel) are used for wound healing (Nagai & Embil, Expert. Opin. Biol. Ther., 2002, Feb; 2 (2):211-218). Restrictive use of preparations containing PDGF-BB, is their high cost due to expensive technology. Therefore, the development of optimal methods for obtaining platelet-derived growth factor is a priority at the present time. An important issue when building an efficient way for PDGF-BB are not enough high level expression of biologically active protein and a low degree of dimerization of the synthesized polypeptide-chains. To solve these problems and the proposed invention is directed.

Prior art

As already mentioned, the molecule platelet-derived growth factor (human) consists of two identical polypeptide chains (a-chains)connected by disulfide bonds. It was found that PDGF-B chain undergoes proteolytic processing in the maturation process, forming the final product, consisting of 10 amino acids. Currently known methods for producing platelet-derived growth factor human in bacterial and yeast expression systems. In E.coli cells were able to achieve high levels of expression of the protein precursor of PDGF-BB, but in these bacterial cells lacking protease involved in the process of maturation of the protein. Therefore, to obtain the Mature form of the protein platelet-derived growth factor necessitating the need for additional stages of the method that leads to a significant increase in the cost of the final product. In yeast cells, in contrast to E. coli, there are protease is able to cleave the recombinant protein and lead thus to the emergence of the Mature protein. Therefore, the use of yeast cells for expression and secretion of PDGF-BB is justified. Currently proposed methods for obtaining recombinant PDGF analogs in yeast cells S.cereviside (US patents 4766073, publ. 23.08.1989, and US 4845075, publ. 04.07.1989). In the patent US 4766073 describes a method of obtaining a yeast recombinant dimeric protein with homology to a - and b - chains of PDGF. In the patent document US 4845075 disclosed receipt in yeast cells, the dimeric polypeptide with homology to PDGF-BB. However, it was found that in yeast systems protease can cleave the recombinant PDGF-B not only in the right sites, abusable the surrounding maturation protein but in other parts of the amino acid sequence. Therefore, there are problems of optimization of codons and the possibility of using shorter sequences of the b-chain. In addition, the levels of expression of recombinant proteins in yeast significantly lower than in E.coli cells. This raises the need to develop a strategy that ensures a high level expression of biologically active Mature form of the protein human platelet-derived growth factor.

Disclosure of inventions

The present invention is directed to the creation of a strain of Pichia pastoris - superproduct platelet-derived growth factor a person and method of obtaining recombinant PDGF-BB using this strain. Use for heterologous expression of the methylotrophic yeast Pichia pastoris is of particular interest. The advantages of this yeast is a significant accumulation of biomass under cultivation for inexpensive mineral nutrient media and a higher level of synthesis of recombinant proteins (K. Sreekrishna et al., J.Basic.Microbiol, 1988, v.28, R-278).

The present invention is to develop an efficient way to obtain the Mature dimeric forms of PDGF-BB with high yield in the extracellular environment in a yeast expression system.

The technical result consists in obtaining a resistant strain .pastoris 2-2 - SuperPro is ducenta dimeric forms of PDGF-BB and in creating high-performance, a simplified method of producing PDGF-BBC purity of over 95% and specific activity of 3-5 ED50/NG.

The problem is solved by the creation of DNA constructs, pGAPZA-PDGFbb, of the following composition:

5' - P-SP-PDGFb-AP-6xHis - 3', where

R - promoter sequence of a gene of glyceraldehyde-3-phosphate dehydrogenase gene alcohol oxidase;

SP - nucleotide sequence encoding a signal peptide of Saccharomyces cerevisiae, αfactor;

PDGFb - nucleotide sequence of a gene platelet-derived growth factor-b person;

AR is a synthetic sequence encoding a peptide that promotes dimerization of the polypeptide;

6xHis sequence encoding 6 histidine residues forming the metal-binding site, which is used to obtain the strain .pastoris 2-2 superproducer PDGF-BB.

The sequence PDGFB was obtained by the reaction of reverse transcription and subsequent PCR. As the matrix used mRNA in human diploid fibroblasts. Amplificatory fragment cloned into the vector pUC 128 and sequenced (figure 1). cDNA PDGF-B in pUC128 used for subsequent cloning into the yeast expression vector RSC and pGAPZA carrying a synthetic sequence encoding a dimerization domain polypeptide (AR), and a sequence encoding 6 histidine residues (6xHis) (figure 2). Then from what was eralis design, encoding the amino acid sequence of the Mature protein, differing in the presence or absence of AP-6xHis domains in the composition of the final product. To obtain strain-producer PDGF-BB created DNA constructs were used to transform competent cells of Pichia strains pastories X33 (wild type), GS115 (his4 genotype) and KM (his4, aox1:arg4 genotype) and have them tested for the ability to effective expression of Mature dimeric forms of PDGF-BB.

Control of expression of platelet-derived growth factor human was carried out by electrophoretic separation of proteins in polyacrylamide gel (SDS-PAGE) followed by transfer to nitrocellulose membrane (Western blot) and selective staining of recombinant protein using antibodies to PDGF-BB (figure 3). According to the test results was selected strain of Pichia pastoris 2-2 - superproducer PDGF-BB, which is expressed in the culture medium platelet-derived growth factor with the formation of the dimeric form, while the yield of protein was 70-100 µg/L.

The resulting strain Pichia pastoris 2-2 producing recombinant human platelet-derived growth factor (human) is characterized by the following features.

Morphological features. The cells are round, slightly oval in shape, measuring about 5 μm, part of the cells is on the surface of the kidney or connected to daughter cells.

Cultural characteristics.

In addition, the cells grow well on mineral environment SC: of 1.34% Yeast Nitrogen Base ("Difco, USA), 2% glucose (1% glycerol, 0.5% methanol), and other synthetic media for yeast.

During growth on solid media the cells form a smooth, round colonies with a matte finish, white, smooth edge.

With the growth in liquid media intensive form a smooth suspension. Culture has a characteristic odor methylotrophic yeast.

The doubling time of the number of cells in the process of their growth in suspension in the medium YPD is 2 hours. Cell culture in YPD medium without makeup grown to a density of 35-40 OD600.

Physiological and biochemical characteristics.

Cells grow in the range from 4 to 37°C. the Optimal temperature for growing is 28-30°C. Temperatures above 32°C unfavorable for productivity. With the growth in aerobic conditions the cells slightly zamalchivaut environment. The optimum pH for growth of 4,5-7,0.

As a carbon source, cells can use many simple compounds, such as glucose, glycerol, methanol.

As the nitrogen source cells can use mineral salts in the ammonium form, amino acids, urea.

Cells capable of aerobic and anaerobic growth. Productivity depends on the content of oxygen is in the environment.

As a carbon source, cells can use many simple compounds, such as glucose, glycerol, methanol.

Cells capable of aerobic and anaerobic growth.

The obtained cells of strain of the yeast Pichia pastoris 2-2 produce PDGF-BB in the amount of 70-100 µg/l of culture medium.

The resulting strain is deposited in the collection LLC BioGenius"

According to the invention the strain of the yeast Pichia pastoris 2-2 transformed by the above-described DNA construct used in the method of obtaining a recombinant human platelet-derived growth factor. The proposed method provides for the stage of culturing a strain of the yeast Pichia pastoris 2-2 in conditions that ensure the expression of the protein PDGF-BB into the culture medium. Cells grown on selective medium colonies was transferred into a flask and cultured in 5 ml of YPD medium in shaker (250 rpm) for 3 days before OD60030-35. After that, the cells were besieged by centrifugation at 3000 g for 10 min. the Supernatant was collected and 10 μl was mixed with sample-buffer and electrophoresis was performed in SDS-PAAG for analysis of the expression of PDGF-BB. Then made the extraction of protein PDGF-BB from the culture medium and its purification by known methods (kontsetrirovannoe, affinity chromatography and the like). To facilitate the isolation and purification of the recombinant protein in its composition were introduced hexaglycine sequence of poses is alausa to clear it in one stage, using affinity chromatography on metallobeta sorbent (figure 4). Derived PDGF-BB was purified by concentrating and carrying out column chromatography - ion exchange on KM-sepharose and/or affinity chromatography on metallobeta sorbent. Affine chromatographia conducted with a sorbent-based nitrilases acid charged ions Ni 2+ (resin-His-bind (Novagen Inc., USA), which is used to bind proteins with adjacent his-tag residues. For longer life (health) ion-exchange and/or affinity resin, and increasing degree of cleaning, the cleaning process PDGF-BB after concentration include stage heat denaturation of the protein by heating the concentrated drug PDGF-BB in a water bath at 100°C for 2 minutes (figure 5). The activity obtained recombinant form of PDGF-BB was checked in several ways (Raines E.W., Ross J. Biol. Chem., 1982, 257(9):5154-5160) (6). In the first variant, the cells were sown in 96 well plates (seeding 10 thousand/cm2in the medium with 10% serum, were cultured 5 days before depletion restriction in the environment, then added samples, or 10% serum. After 20 h was followed by Wednesday at the latest with 5% FCS and14With-thymidine, even after 2 h the cells were fixed THU and determined the radioactivity of the samples. Another way was that the cells were sown in 96 well plates (seeding 10 thousand/cm2, OD 0.15-0.2) in the environment C10% serum, the next day they did the replacement environment fresh with different content of serum, were cultured for 2 days, fixed and stained with crystal violet, poured a 1% solution of DMSO and photometrically (570 nm). To assess chemotactic activity culture of smooth muscle cells derived from the aorta of Wistar rats, were sown on devitalizirovannaya wall of the aorta of a pig, pre-incubated in the medium of the DMA with 2% of the culture supernatant of the transformed yeast cells of Pichia pastoris producing PDGF BB. After culturing tissue with seeded cells were stained with a mixture of dyes Hoechst 33342 and ethidium bromide, and fluorescent microscope was evaluated by the number of cells migrated in the tissue matrix.

Thus, according to the invention, the generated DNA construct comprising strain Pichia pastoris 2-2 allows to obtain dimeric form recombinant PDGF-BB with a purity of above 95% and specific activity of 3-5 ED50ng, in combination with high level expression in yeast (up to 0.1 g/l of culture). Additionally, the inclusion of the AR-and 6xHis-domains used in the DNA construct resulted in a significant simplification of the selection of the recombinant protein through the use of high-tech affinity chromatography on metallobeta media.

Figure 1 shows the nucleotide sequence of the PDGF-B; figure 2 is physically the card I plasmids, containing the DNA construct; figure 3 - results of analysis of proteins obtained from different strains; figure 4 - results of electrophoresis and immunochemical analysis of PDGF-BB, purified by metal-affinity resin; figure 5 - the effect of thermal denaturation of concentrated culture medium containing PDGF-BB; figure 6 - results of electrophoresis and immunochemical analysis of PDGF-BB, purified using ion-exchange chromatography on KM-sepharose; figure 7 - results of determining the activity of PDGF-BB, derived from the stated strain.

The invention is illustrated by the following examples.

Example 1. Cloning of cDNA-PDGFB

The sequence PDGFB was obtained through the reaction of reverse transcription and subsequent PCR in the presence of primers PDGFB-1 (5'-ATA GGA TCC ATG AAT CGC TGC TGG GC-3') and PDGFB-2 (5'- TAT CTC GAG GGC TCC AAG GGT CTC 3'). As the matrix used mRNA in human diploid fibroblasts. Amplificatory fragment cloned into the vector pUC 128 (Invitrigene) and sequenced. The resulting sequence had the following composition:

GGATCCATGAATCGCTGCTGGGCGCTCTTCCTGTCTCTCTGCTGCT ACCTGCGTCTGGTCAGCGCCGAGGGGGACCCCATTCCCGAGGAGCTTTATG AGATGCTGAGTGACCACTCGATCCGCTCCTTTGATGATCTCCAACGCCTGC TGCACGGAGACCCCGGAGAGGAAGATGGGGCCGAGTTGGACCTGAACATG ACCCGCTCCCACTCTGGAGGCGAGCTGGAGAGCTTGGCTCGTGGAAGAAG GAGCCTGGGTTCCCTGACCATTGCTGAGCCGGCCATGATCGCCGAGTGCAA GACGCGCACCGAGGTGTTCGAGATCTCCCGGCGCCTCATAGACCGCACCA ACGCCAACTTCCTGGTGTGGCCGCCCTGTGTGGAGGTGCAGCGCTGCTCCG GCTGCTGCAACAACCGCAACGTGCAGTGCCGCCCCACCCAGGTGCAGCTG CGACCTGTCCAGGTGAGAAAGATCGAGATTGTGCGGAAGAAGCCAATCTT TAGAAGGCCACGGTGACGCTGGAAGACCACCTGGCATGCAAGTGTGAGA CAGTGGCAGCTGCACGGCCTGTGACCCGAAGCCCGGGGGGTTCCCAGGAG CAGCGAGCCAAAACGCCCCAAACTCGGGTGACCATTCGGACGGTGCGAGT CCGCCGGCCCCCCAAGGGCAAGCACCGGAAATTCAAGCACACGCATGACA AGACGGCACTGAAGGAGACCCTTGGAGCCCTCGAG

(bold sequence primers)

cDNA PDGF-B in Fig 128 used for subsequent cloning into the yeast expression vector RSC and pGAPZA (Invitrogene), bearing a synthetic sequence encoding a dimerization domain polypeptide (AR), and a sequence encoding 6 histidine residues (6xHis): -CATCATCATCATCATCAT-. Were selected constructs encoding the amino acid sequence of the Mature protein, differing in the presence or absence of AP-6xHis domains in the composition of the final product. We used the primers PDGFBB-1 (5'-ATA GAA TTC AGC CTG GGT TCC HUNDRED ACC 3'), PDGFBB-2 (5'-ATA GCG GCC GCG GTC ACT CGA GTT TGG 3') in one case (AP-6xHis domains) and PDGFBB-1 (5'-ATA GAA TTC AGC CTG GGT TCC CTG ACC 3'), PDGFBBS-2 (5'-ATA GCG GCC GCC TAG GTC ACT CGA G-3') in the other (no AP-6xHis domains).

Example 2. Preparation of cells for transformation

Were held culturing and freezing 3 strains of cells of Pichia pastoris wild type HSS, GS115 (his4 genotype), CM (his4, aox1:arg4 genotype). Cells were sown in sterile conditions on agar in the medium YPD (1%yeast extract, 2%peptone, 2%glucose, 1 mm dithiothreitol), and cultivated at 30°With, then perseval in suspension and cultured overnight. The doubling time of the number in the medium YPD all clones was 2 hours. Part of the cells suspended in YPD medium with addition of 15% glycerol and frozen at -86°C. To obtain competent cells pre is sustained fashion grew colonies of cells in a Cup of agar in YPD medium at 30° With in 2 days. Then the contents of a single colonies were grown in 10 ml of YPD medium at 30°With during the night. Diluted suspension in YPD to a density OD6000.2 and final volume of 10 ml and were grown culture to OD6000-8 within 4 hours. Cell suspension was centrifuged 5 min at 500 g, the supernatant was poured, suspended in 10 ml of solution I from the following set of transformation, again centrifuged and suspended sediment in solution I, after which the cells were competent for transformation. Aliquots of competent cells 50-200 μ1 was poured in sterile tubes with a volume of 1.5 ml, which was stored at a temperature of -86°s to use.

Example 3. Transformation of competent cells.

For transformation used EasyComp Transformation Kit, which is included with Easy Select Pichia Kit (Invitrogen).

To 50 μ1 competent cells were added to 3 μg (4 μ1) DNA constructs, 1 ml of solution II from a set, mixed by shaking, incubated for 1 hour at 30°, stirring the solution every 15 minutes Then the solution was incubated 10 min at 42°With, was divided into 2 microtube at 525 μ1, was added to each 1 ml of YPD medium and incubated for 60 min at 30°With the acquisition by the cells resistance to zeocin. After that, cells were centrifuged for 5 min at 3000g, resuspendable in solution III, adding it to each tube p is 500 μ 1, poured a suspension of 2 tubes in one, again centrifuged and resuspendable residue in 150 ml of solution III. The obtained cell suspension was dispersed in sterile Cup (80 mm) agar gel prepared in YPD medium with addition of 1M sorbitol (YPDS) and antibiotic zeocin at a final concentration of 100 µg/ml After 3 days, got a few dozen colonies per Cup. Cells from colonies and cells H transformed "empty", i.e. not containing an insert of the vector, were transferred to the Cup with MMD (minimal dextrose medium)agar, lined by 50 numbered squares, and cultivated a Cup of 2 days at 30°C. After that, a Cup of crops used for the cultivation of cells in suspension and then test them.

Example 4. Control of expression of recombinant protein in the resulting strains.

Control of expression of PDGF was carried out by electrophoretic separation of proteins in polyacrylamide gel (SDS-PAGE) followed by transfer to nitrocellulose membrane (Western blot) and selective staining of recombinant protein using antibodies to PDGF-BB. For this, cells grown on selective medium colonies was transferred into a flask and cultured in 5 ml of medium MGY on the rocking chair (250 rpm) for 1 day before OD6005. After that, the cells were besieged by centrifugation at 3000 g for 10 minutes To electrophoresis used equipment is their company Bio-Rad and reagents ICN. Supernatant and intracellular proteins (cell lysate) was mixed with buffer for drawing, and was brought to 10 μl in the wells concentrating gel. The separation was carried out at a voltage of 150V for hours. Then the gel was carefully removed and carried out the transfer of the protein bands from the gel to nitrocellulose membrane using machine company Bio-Rad according to the standard Protocol. After transfer the membrane was stained with antibodies according to the manufacturer's recommendations (Amersham Biosciences). Were selected strains, which revealed the presence on electrophoregram the bands corresponding to the molecular weight of PDGF-B and stained with antibodies to PDGF-BB, which indicates the production of PDGF-BB. The level of protein synthesis PDGF-BB determined by comparing the intensity of staining bands recombinant protein band corresponding to a protein of molecular mass standard. The result of the 20 strains-producers, according to the obtained data (see figure 3), was selected strain of Pichia pastoris 2-2, cells which synthesize 70-100 mg of protein per liter of yeast culture.

Example 5. Purification of recombinant PDGF-BB and evaluation of biological activity.

1) Concentration. After sedimentation of the cells in the cultural medium was filtered through a filter with a pore diameter of 45 μm, and then was added Tris-HCl pH 6.0 to a final concentration of 20 mm. The cultural medium containing protein PDGF-BB, Ko is centered in 5-10 times, using the hub for proteins with a molecular mass of more than 10 kDa firm "Millipore".

2) Heat denaturation. After concentration of the drug PDGF-BB was heated on a water bath to a boil (t=100°C) and boiled for 2 minutes, then centrifuged at 4°, 15000×g for 15 minutes.

3) Ion exchange chromatography on KM-sepharose. Column KM-separate balanced buffer containing 20 mm Tris-HCl pH 6.0. The drug PDGF-BB was applied at a speed of 60 ml/hour. The column was washed in 20 mm Tris-HCl pH 6.0, and 20 mm Tris-HCl pH 6.0, 200 mm NaCl. The elution was performed 20 mm Tris-HCl pH 6.0, 1 M NaCl and collected fractions of 1 ml

4) Affinity chromatography on a column of resin His-bindR. The column with the carrier was washed with buffer containing 50 mm phosphate pH 8.0, 500 mM NaCl. The drug PDGF-BB, obtained after concentration or ion exchange chromatography was diluted 2 times, added phosphate pH 8.0 to a concentration of 50 mm and was applied on the column. After washing the column with buffer coating ballast proteins were removed by washing with a solution of 20 mm imidazole in the same buffer. PDGF-BB was suirable a solution containing 200 mm imidazole.

5) Evaluation biologicheskii activity

(A) Cells were planted in 96 well plates (seeding 10 thousand/cm2in the medium with 10% serum, were cultured 5 days before depletion restriction in the environment, then added samples, or 10% serum. After 20 h followed with the food fresh with 5% FCS and 14With-thymidine, even after 2 h the cells were fixed THU and determined the radioactivity of the samples.

B) Cells were planted in 96 well plates (seeding 10 thousand/cm2, OD 0.15-0.2) in medium with 10% serum, the next day they did the replacement environment fresh with different content of serum, were cultured for 2 days, fixed and stained with crystal violet, poured a 1% solution of DMSO and photometrically (570 nm).

The result was obtained preparat recombinant human platelet-derived growth factor (PDGF BB) with a purity of over 95% and specific activity of 3-5 ED50/ng. To assess chemotactic activity culture of smooth muscle cells derived from the aorta of Wistar rats, were sown on devitalizirovannaya wall of the aorta of a pig, pre-incubated in the medium of the DMA with 2% of the culture supernatant of the transformed yeast cells of Pichia pastoris producing PDGF BB. After culturing tissue with seeded cells were stained with a mixture of dyes Hoechst 33342 and ethidium bromide, and fluorescent microscope was evaluated by the number of cells migrated in the tissue matrix.

One of the advantages of the proposed method to obtain recombinant PDGF-BB is also high manufacturability of the process of protein purification, due to the simple procedures of selection, relatively low cost ISP is lsemaj resins and high yield of active protein in the cleanup.

Summarizing the above we can conclude that the resulting strain of the yeast Pichia pastoris 2-2 synthesize PDGF-BB in a quantity sufficient to highlight on an industrial scale. The result is a high quality recombinant PDGF-BB may be suitable as a pharmaceutical preparation for the treatment of soft tissue defects and skin of any location and of any origin (infectious, traumatic, burn, the effects of surgical intervention, and so on).

1. The strain of the yeast Pichia pastoris 2-2 producing recombinant human platelet-derived growth factor (PDGF-BB).

2. A method of obtaining a recombinant human platelet-derived growth factor (PDGF-BB) in the yeast Pichia pastoris, including the cultivation of a strain of the yeast Pichia pastoris according to claim 1 under conditions that ensure the expression of the protein PDGF-BB into the culture medium, removing protein PDGF-BB from the culture medium and purified.

3. The method according to claim 2, characterized in that the purification of PDGF-BB is carried out by concentrating and ion-exchange chromatography on KM-sepharose.

4. The method according to claim 3, characterized in that after concentrating conduct thermal denaturation by briefly heating the drug PDGF-BB in a water bath at 100°C.

5. The method according to claim 4, characterized in that after ion-exchange chromatography additionally conducting the affinity column chromatography on metallobeta sorbent.



 

Same patents:

FIELD: chemistry of peptides, microbiology, biotechnology.

SUBSTANCE: L-alanyl-L-glutamine is prepared by incubation of a mixture containing a microorganism able to produce L-alanyl-L-glutamine from L-alanine ester and L-glutamine, L-alanine ester and L-glutamine, and isolation of the end product. Using the invention allows simplifying the process for preparing L-alanyl-L-glutamine. Invention can be used in pharmacy and food processing industry.

EFFECT: improved preparing method of dipeptide.

3 cl, 3 tbl, 1 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to a method for preparing foodstuff containing hypotensive peptides and it using as an anti-hypertensive agent that can be used as a foodstuff. Method involves stages for fermentation of casein-containing fermenting material with lactobacillus microorganism, nanofiltration of the prepared peptide-containing fermentation product and isolation of the product. Prepared product is used as an anti-hypertensive agent and as a foodstuff also. Invention provides preparing a foodstuff with the high content of hypotensive peptides enriched by bivalent ions.

EFFECT: improved preparing method of foodstuff.

22 cl, 1 dwg, 4 ex

FIELD: molecular biology, genetic engineering, polypeptides, medicine.

SUBSTANCE: in using the double-hybrid yeast system DNA sequences encoding polypeptides (55.1 and 55.3) have been found that elicit ability for binding with intracellular domain p-55 (p-55IC) of TNF-receptor. It has been established that these polypeptides represent fragments of amino acid sequences p-55IC, respectively, from 338 to 426 and from 277 to 426 residues. As result of insertion of DNA fragments with a sequence encoding polypeptide 55.1 or 55.3 into the structure of expressing vector and transformation suitable host-cells by this vector recombinant form of indicated polypeptides have been prepared. Using this invention provides the possibility for modulating the function of intact p-55 of TNF-receptor. Invention can be used in medicine in treatment of diseases associated with transfer of TNF-signal.

EFFECT: improved preparing method and valuable properties of polypeptide.

9 cl, 17 dwg, 3 tbl, 6 ex

FIELD: biotechnology, medicine, oncology, peptides.

SUBSTANCE: invention relates to a method based on phage display for preparing peptides interacting specifically with mammary Ehrlich tumor and can be used in therapy and diagnosis of malignant neoplasm. Peptides are prepared by affinity selection from phage peptide libraries comprising ten millions of different peptides of size 15 amino acid residues, the group of nine peptides wherein each peptide shows ability for accumulation in Ehrlich tumor. For practice using mimetic-peptides selected by such manner can be prepared by chemical synthesis and to use for preparing conjugates on their basis with the known cytotoxic preparations, radioactive isotopes and they can be incorporated in the composition of liposomal preparations for visualization of tumor neoplasm also.

EFFECT: valuable medicinal properties of peptides.

2 dwg, 2 ex

FIELD: biotechnology.

SUBSTANCE: heterologous protein is obtained by cultivation of strain Corynebacterium glutamicus AJ 12036, which does not produce cell surface protein and contains gene expressing construct wherein nucleic acid sequence encoding signal peptide of cell surface protein of Corynebacterium glutamicus or C. ammoniagenes is bound in direct direction to promoter sequence, and nucleic acid sequence encoding heterologous protein is bound in direct direction to abovementioned nucleic acid sequence encoding signal peptide. Further heterologous protein secreted from cells is isolated.

EFFECT: high effective method for heterologous protein production.

6 cl, 8 tbl, 10 ex

FIELD: organic chemistry, peptides, medicine, pharmacy.

SUBSTANCE: invention relates to peptide derivatives named as memnopeptides that are used as an active component for manufacturing a medicinal preparation used in treatment of bacterial infection. Invention proposes compound of the formula (I): wherein radicals R1, R2, R3, R4, R5, R6, R7, R8 and (A)n have corresponding values, or its salt. Compounds of the formula (I) are prepared by culturing microorganism Memnoniella echinata FH 2272, DSM 13195 under suitable conditions in the nutrient medium containing at least one source of carbon atoms and at least one source of nitrogen atoms and the process is carrying out until the accumulation of at least one compound of the formula (I) in the nutrient medium followed by isolation of indicated compound. The attained technical result involves the development of a pharmaceutical composition eliciting an antibacterial activity. The development of the preparation provides expanding assortment of agents used in treatment of diseases said above.

EFFECT: improved preparing method, valuable medicinal properties of compounds.

10 cl, 2 tbl, 7 ex

FIELD: biotechnology.

SUBSTANCE: protein substances are produced from cultivation medium unlike prior art where they are produced by reprocessing of plant tissue. Application of moss protonema as plant tissue makes it possible to isolate therefrom heterologous proteins in active form without degradation of productive tissues and cells.

EFFECT: improved method for production of protein substances.

6 cl

FIELD: biotechnology, molecular biology.

SUBSTANCE: method involves transfection of cells HKB with vector pCIS25DTR comprising a selective marker and a sequence encoding protein eliciting procoagulating activity of factor VIII. Cells are selected using the selecting agent and clones with high level for expressing protein eliciting procoagulating activity of factor VIII are isolated. Invention provides preparing the protein eliciting activity of factor VIII with high yield, and strain of cells HKB with improved production under protein-free conditions also. Invention can be used for preparing the protein eliciting activity of factor VIII in industrial scale.

EFFECT: improved preparing and isolating methods.

8 cl,, 6 dwg, 1 tbl, 5 ex

Thrombopoietin // 2245365

FIELD: medicine, molecular biology, polypeptides.

SUBSTANCE: invention describes homogenous polypeptide ligand mpI representing polypeptide fragment of the formula: X-hTPO-Y wherein hTPO has amino acid sequence of human fragments TPO (hML); X means a amino-terminal amino-group or amino acid(s) residue(s); Y means carboxy-terminal carboxy-group or amino acid(s) residue(s), or chimeric polypeptide, or polypeptide fragment comprising N-terminal residues of amino acid sequence hML. Also, invention relates to nucleic acid encoding polypeptide and expressing vector comprising nucleic acid. Invention describes methods for preparing the polypeptide using cell-host transformed with vector, and antibodies raised against to polypeptide. Invention describes methods and agents using active agents of this invention. The polypeptide ligand mpI effects on replication, differentiation or maturation of blood cells being especially on megacaryocytes and progenitor megacaryocyte cells that allows using polypeptides for treatment of thrombocytopenia.

EFFECT: valuable medicinal properties of polypeptide.

21 cl, 92 dwg, 14 tbl, 24 ex

FIELD: genetic engineering, biotechnology, biochemistry, medicine, pharmacy.

SUBSTANCE: invention relates to DNA encoding glycoprotein VI (GP VI) used as a base for synthesis of recombinant GP VI by method of recombinant DNAs followed by its using for the development of pharmaceutical compositions possessing with capacity for inhibiting or blocking interaction of platelets with collagen. Using the invention provides preparing GP VI in the recombinant form and using this agent for therapeutic aims.

EFFECT: valuable medicinal properties of glycoprotein VI.

6 cl, 4 dwg, 6 ex

FIELD: biotechnology, gene engineering, medicine.

SUBSTANCE: polypeptide (IL-li) is obtained by recombinant DNA technology having activity of interleukin-1-alpha and interleukin-1-beta inhibitor. Disclosed is DNA sequences encoding inhibitor precursor and maturated form thereof. Described is method for production of vector constructs containing said DNA sequences, as well as transformed cells producing of recombinant IL-li.

EFFECT: method for large-scale production of interleukin-1-beta inhibitor, useful in medicine.

21 cl, 26 dwg, 11 ex

FIELD: biotechnology, in particular production of modified swine factor VIII (POL1212).

SUBSTANCE: DNA molecule encoding of modified swine factor VIII is cloned in expression vector, having functionality in mammalian cells. Modified swine factor VIII protein is obtained by cultivation of mammalian cell line BHK CRL-1632 (ATCC), BHK 1632, or CHO-K1, transfected with vector. Therapeutic composition for treatment of subjects suffering from deficit of factor VIII, such as haemophilia, contains effective amount of swine factor VIII protein.

EFFECT: effective agent for treatment of factor VIII deficit.

13 cl, 8 dwg, 7 ex

FIELD: immunobiotechnology.

SUBSTANCE: invention relates to soluble CTLA4, which represents mutant variant of wild type CTLA4 and conserves binding ability to CD80 and/or CD86. Molecules of soluble CTLA4 have the first amino acid sequence containing extracellular CTLA4 region, which includes some mutant amino acid residues in S25-R33 region and M97-G107 region. According the present invention mutant molecules also may include second amino acid sequence, enhancing solubility of mutant molecule. Nucleic acid (NA) molecules encoding said CTLA4 and including NA-vectors also are described. Invention also relates to method for production of mutant CTLA4 and uses thereof in controlling of interaction between T-cell and CD80 and/or CD86-positive cell; suppression of graft-versus-host reaction; and treatment of immune system diseases. Soluble mutant CTLA4 according to present invention binds to CD80 and/or CD86 antigen with higher avidity than wild type CTLA4 or non-mutant CTLA41g.

EFFECT: new preparation for treatment of immune system diseases.

65 cl, 19 dwg, 2 tbl, 2 ex

FIELD: medicine, biotechnology.

SUBSTANCE: invention relates to antibodies specifically binding to new human extracellular matrix polypeptides called as RGI; immunoconjugate containing the same and method for selective cell degradation; method for treatment of prostates cancer and metastasis in patients suffering from prostates cancer.

EFFECT: new method for treatment of prostates cancer.

28 cl, 7 ex, 7 dwg

FIELD: molecular biology, genetic engineering, polypeptides, medicine.

SUBSTANCE: in using the double-hybrid yeast system DNA sequences encoding polypeptides (55.1 and 55.3) have been found that elicit ability for binding with intracellular domain p-55 (p-55IC) of TNF-receptor. It has been established that these polypeptides represent fragments of amino acid sequences p-55IC, respectively, from 338 to 426 and from 277 to 426 residues. As result of insertion of DNA fragments with a sequence encoding polypeptide 55.1 or 55.3 into the structure of expressing vector and transformation suitable host-cells by this vector recombinant form of indicated polypeptides have been prepared. Using this invention provides the possibility for modulating the function of intact p-55 of TNF-receptor. Invention can be used in medicine in treatment of diseases associated with transfer of TNF-signal.

EFFECT: improved preparing method and valuable properties of polypeptide.

9 cl, 17 dwg, 3 tbl, 6 ex

FIELD: biotechnology, molecular biology, medicine.

SUBSTANCE: invention discloses amino acid sequences of human obesity polypeptide (OB) two isoforms possessing capacity for modulation of animal body mass, their signal peptide-containing precursors and analogues. Polypeptide isoforms are prepared as result of insertions, deletions and amino acid changes that retain activity typical for nonmodified forms of OB-polypeptides, and polyclonal and monoclonal antibodies interaction specifically with new agents modulating the body mass value also. Invention describes DNA sequences encoding these polypeptides and their analogues, vector structures comprising these sequences used for preparing recombinant forms of OB-polypeptides. Invention proposes using new polypeptides and their analogues as an active component in pharmaceutical compositions. Using this invention can promote to solving the problem for providing medicine, veterinary science and animal husbandry with effective agent used for decreasing the body mass value. Invention can be used in medicine for diagnosis and treatment of pathological states associated with disturbance of regulation of human body mass, and in animal husbandry and veterinary science.

EFFECT: valuable biological, medicinal and veterinary properties of polypeptide.

23 cl, 71 dwg, 12 tbl, 17 ex

FIELD: gene engineering.

SUBSTANCE: the present innovation deals with transferring a mutant gene due to homologous recombination into animal embryo. The animal obtained is characterized by the capacity to express mutant protein of presenylin-1 and induction of beta-myeloid protein production that leads to the development of progressing nervous disease in hippocampus or peripheral department of cerebral cortex, It is, also, suggested to apply several plasmids carrying a mutated gene. It is, also, described the way to obtain primary cell culture or subcultivated cell out of obtained mutated animals. Moreover, several methods are, also, suggested for testing the substances for usefulness in therapeutic and/or prophylactic procedures at treating Alzheimer's disease. They deal with introducing a tested substance for mutated animal to evaluate the data obtained. The obtained mutated animals could be applied as model animals while studying Alzheimer's disease nature.

EFFECT: higher efficiency.

25 cl, 8 dwg, 10 ex

FIELD: genetic engineering, pharmaceutical and medical-biological industry.

SUBSTANCE: invention proposes a chimeric sequence of nucleic acid encoding a fused polypeptide able to bind with the vessel endothelium growth factor (VEGF) and to inhibit its specific mitogenic effect. The fused polypeptide molecule comprises immunoglobulin-like domain 2 of VEGF-receptor Flt1, immunoglobulin-like domain 3 of VEGF-receptor Flk 1 or Flt4 and multimerizing component represented by either domain Fc IgG or heave chain IgG. By expression of the proposed chimeric sequence or its two successively joined copies in a host-cell a monomer or dimer of the fused polypeptide are prepared, respectively, that can be used for suppression of VEGF activity in mammals, in particular, in humans. New VEGF inhibitors differ from the known one by the improved pharmacokinetics.

EFFECT: improved preparing method, valuable biological properties of polypeptide.

23 cl, 67 dwg, 1 tbl, 35 ex

FIELD: medicine, genetic engineering.

SUBSTANCE: invention proposes a method that involves construction of bacteriophage library of random peptides based on oligonuleotide fragments encoding their, selection of bacteriophages binding with target-cells but not binding with cells of other types that can be involves in pathological process or able to show effect on its diagnosis and therapy, and confirmation of specificity of selected bacteriophages by using combination of different tests. Oligonucleotide fragments encoding random peptides are prepared by reaction of reverse transcription by using random primers and total RNAs isolated from indicated target-cells and cells of other types. Applying this invention provides preparing bacteriophages binding with target-cells with high degree of selectivity. Invention can be used in diagnosis, therapy and pharmaceutical industry.

EFFECT: improved preparing method.

3 cl, 2 dwg, 8 ex

FIELD: biotechnology, microbiology, genetic engineering.

SUBSTANCE: invention relates to methods for preparing lactic acid. Lactic acid is prepared by culturing the recombinant strain of yeast of genus Schizosaccharomyces as a producer of lactic acid comprising at least one foreign lactate dehydrogenase gene. The recombinant strain of yeast Schizosaccharomyces pombe VKPM Y-3127 is prepared by using the strain Schizosaccharomyces pombe VKPM Y-285 as a recipient and transformation of the strain is carried out with plasmid DNA carrying IdhA gene from fungus Rhizopus oryzae. Invention provides carrying out synthesis of lactic acid at low pH values and show capacity for producing lactic acid at pH 4.0 up to the concentration of lactic acid in medium 80-100 g/l.

EFFECT: improved preparing method.

3 cl, 5 dwg, 2 tbl, 4 ex

Up!