Methods for identification, isolation and production of antigens for specific pathogen

FIELD: medicine, vaccines.

SUBSTANCE: disclosed is method for identification, isolation and production of antigens interacting with hyperimmune serum from specific pathogen useful in vaccines for human or animals. Claimed method includes providing of antibody preparation from serum pool of certain animals or human or individual serums with antibodies against certain pathogen; production of at least one expression library of certain pathogen; data screening of said at least one expression library using abovementioned antibody preparation; identification of antibodies binding to antibodies in antibody preparation during screening; screening of identified antigens using individual antibody preparations from individual serums obtained from subjects having antibodies against said certain pathogen; identification of reacting with hyperimmune serum antigen part of identified antigens than bind to relevant part of individual antibody preparations from individual serums optionally isolation of reacting with hyperimmune serum antigens and production thereof by chemical or recombinant methods.

EFFECT: improved method for identification of effective antigens for certain pathogen useful as preferable candidates of antigen vaccines.

20 cl, 11 dwg, 10 tbl, 7 ex

 

The technical field to which the invention relates.

The invention concerns a method for the identification, isolation and antigen specific pathogen, as well as new antigens suitable for use in the vaccine is preferred for a particular species of animals or to humans.

The level of technology

The vaccine can save more lives (and resources)than any other medical intervention. Thanks to a worldwide vaccination programs have dramatically reduced the frequency of many deadly diseases. Although this is true of a number of diseases, for example, diphtheria, whooping cough, measles and tetanus, but there is no effective vaccines against many infectious diseases, including most viral infections such as HIV, HCV, CMV, and many others. There are no effective vaccines against other diseases, not only infectious diseases that claim the lives of millions of patients a year, including malaria or cancer. In addition, the rapid emergence of antibiotic-resistant bacteria and microorganisms requires alternative methods, of which vaccines represent a logical choice. Finally, a great need for vaccines is also illustrated by the fact that infectious diseases, but not cardiovascular, cancer or traumatic injury remains the single greatest cause of death is disability in the world.

Some recognized vaccines consist of live attenuated organisms, in which there is a risk of reversion to a virulent wild type. In particular, in immunodeficiencies that may be dangerous for life. On the other hand, vaccines can be administered in the form of a combination of antigens derived from a pathogen, together with compounds that induce or enhance the immune responses to these antigens (such compounds are usually called adjuvants), such as subunit vaccines in General are not effective by themselves.

Although there is no doubt that these vaccines are valuable means of treatment, however, has a drawback, namely that due to their complexity they can cause severe side effects, for example, the antigens included in the vaccine and those who exhibit cross-reactivity with molecules that are expressed in cells of vaccinated persons in Addition, the existing rules emanating from regulatory authorities, for example, the world Health Organization (who), Department for control over products and medicines (FDA) and their counterparts in Europe and require a precise indication of the composition of the vaccine and the mechanism of induction immunity that difficult.

Some common vaccines are vaccines from whole cells attenuated bacteria is or viruses, for example, bacilli Calmette-Guerin (BCG) against tuberculosis), measles, mumps, rubella, oral polio vaccine (Sabin); killed bacteria or viruses, for example, a vaccine against pertussis, inactivated polio vaccine (Salk); subunit vaccines, for example, from toxoid (diphtheria, tetanus), capsular polysaccharide (.influenzae type), yeast recombinant subunit (surface protein of hepatitis b).

The vaccine may contain a number of different antigens. Examples of antigens are killed whole organisms, such as inactivated viruses or bacteria, protozoa, fungi and even cancer cells. Antigens can also consist of subcellular fractions of these organisms/tissues, proteins or, in the simplest form of peptides. The antigens can be recognized by the immune system in the form of glycosylated proteins or peptides, and may represent or contain polysaccharides or lipids. Can be used short peptides, as, for example, cytotoxic T cells (CTL) recognize antigens in the form of short peptides, usually from 8 to 11 amino acids, in combination with major histocompatibility complex (MHC). B cells can recognize linear epitopes length of only 4-5 amino acids, as well as the 3-dimensional structure (conformational epitopes). In order visuat the long-lasting antigen-specific immune response, adjuvant should start the immune cascade, which should include all the cells of the immune system. Mainly adjuvants are not limited to this mechanism, the so-called antigenpresenting cells (APC). These cells usually first encounter with antigen, followed by a presentation (presentation) processioning or unprocessed antigen immunoelectron cells. May also participate intermediate cell types. When productive immune response are activated only effector cells that have the appropriate specificity. Adjuvants can also be kept in the place antigens and other introduced with them the factors. In addition, the adjuvant may act as chemoattractant for other immune cells or to provide local and/or systemic effect as a stimulant of the immune system.

Antigenpresenting cells belong to the system of innate immunity, which has emerged as the first line of defense of the body, limiting the infection immediately after contact with microorganisms. Cell system of innate immunity recognize patterns or relatively non-specific patterns, expressed their targets, whereas the adaptive immune system recognizes more complex, specific patterns. Examples of cells of the VRO system is established immune system are macrophages and dendritic cells, as well as granulocytes (e.g., neutrophils), natural killer cells and others. In contrast, cells of the adaptive immune system to recognize specific antigenic structures, including the peptides in the case of T cells and peptides along with 3-dimensional structures in the case of b-cells. The system acquired immunity is much more specific and complex than the system of innate immunity, and improves with repeated exposure to a given pathogen/antigen. Evolutionary system of innate immunity is much more ancient, and is found even in very primitive organisms. However, the system of innate immunity plays a crucial role in the initial phase of antigenic exposure, because, along with the containment of pathogens, cells system of innate immunity, i.e. ARS, primesouth cell system of acquired immunity and thereby trigger specific immune responses, leading to the elimination of the "uninvited guests". Thus, the cells of the system of innate immunity, particularly ARS, play a crucial role in the induction phase of the immune response in that they: (a) inhibit the spread of infections through primitive recognition system simple structures and b) will primesouth cell system of acquired immunity, which leads to specific immune from the Etam and memorize resulting in elimination of invading pathogens or other targets. These mechanisms can also be important in the removal or containment of cancer cells.

Used for such vaccine antigens is often chosen randomly or according to availability. There is a need to identify effective antigens of a given pathogen or - preferably - an almost complete set of all the antigens of this pathogen with practical (clinical) importance. Such antigens may be the preferred candidate antigens for vaccines.

The invention

Thus, the object of the present invention is to satisfy these needs and provide a method by which such antigens can be obtained and with which almost the full set of antigens specific pathogen can be identified using this serum as a source of antibodies. This method should be suitable for highly variable pathogens, which quickly develops resistance to conventional drugs or vaccines. The method should also be applicable for the identification and selection of tumor antigens, allergens, autoimmune antigens.

Thus, the present invention provides a method for identification, isolation and hyperimmune reactive serum anti-Christ. ENES from a specific pathogen, moreover, these antigens are suitable for use as a vaccine intended for the particular type of animals or humans, characterized by the following stages:

- a drug antibodies from pooled plasma of this type of animal or pooled human plasma or individual sera with antibodies against that particular pathogen,

obtaining at least one expression library display on the bacterial surface of this particular pathogen,

- screening of this at least one expression library display on the bacterial surface using the specified drug antibodies

- identification of antigens that bind by screening with antibodies in the specified drug antibodies

screening identified antigens with individual antibody preparations from individual sera from individuals with antibodies against the indicated specific pathogen

- identification of hyperimmune reactive serum antigen part of the identified antigens, where these hyperimmune reactive serum antigens associated with the relevant part of the individual antibody preparations from individual sera, and

- if necessary, the allocation of hyperimmune reactive serum antigen and receive chemical is Kimi or recombinant means, provided, these individual sera receive from patients with antibody titer to the specified specific pathogen, exceeding the 90 percentile, and the IgG titer above 10,000 units

This method also works well in General to identify a virtually complete set of hyperimmune reactive serum antigen specific pathogen using these sera as a source of antibodies when screening at least three different expression libraries program identification of pathogens/antigens method of the present invention. Therefore, the present invention also relates to a method of identification, isolation and almost a full set of hyperimmune reactive serum antigen specific pathogen, and these antigens are suitable for use as a vaccine intended for the particular type of animals or humans, characterized by the following stages:

- a drug antibodies from pooled plasma of this type of animal or pooled human plasma or individual sera with antibodies against that particular pathogen,

- getting at least three different expression libraries specified a specific pathogen, and at least one expression library display on the bacterial surface,/p>

the screening data of at least three gene-expression libraries using the specified drug antibodies

- identification of antigens that bind at least one of the at least three screening with antibodies in the specified drug antibodies

screening identified antigens with individual antibody preparations from individual sera from individuals with antibodies against that particular pathogen,

- identification of hyperimmune reactive serum antigen part of the identified antigens, where these hyperimmune reactive serum antigens associated with the relevant part of the individual antibody preparations from individual sera,

- the repetition of the stages of the screening and identification of at least one more time,

- comparison of hyperimmune reactive serum antigen identified by repeating the stages of screening and identification, hyperimmune reactive serum antigen, identified at the initial stages of screening and identification

further repetition of the stages of screening and identification, if only at the stage of re-screening and identification were identified at least 5% hyperimmune reactive serum antigen, up until the next repetition stadium identified less than 5% hyperimmune reactive serum antigen for a complete set of hyperimmune reactive serum antigen of this pathogen,

- if necessary, the allocation of hyperimmune reactive serum antigen and receive chemical or recombinant means, provided that these individual sera receive from patients with antibody titer to the specified specific pathogen, exceeding the 90 percentile, and the IgG titer above 10,000 units

List of drawings

Figure 1 shows the preliminary selection of serums based on antibody titers against staphylococci, measured using ELISA method.

Figure 2 presents the size distribution of DNA fragments in the library LSA50/6 in the vector pMAL4.1.

Figure 3 presents the selection method of the magnetic sorting of cells (MACS) using biotinylated human serum. Library LSA50/6 in the vector pMAL4.1 were subjected to screening using 10 µg biotinylated human serum in the first (a) and 1 µg second (In) cycle screening. Serum P - serum of patients serum In children's serum. Shows the number of selected cells after 2-nd and 3-th elution for each cycle of selection.

4 shows the immunoreactivity of specific clones obtained by the display on the bacterial surface by results of the analysis by the method of Western blotting using patient serum at a dilution of 1:5000.

Figure 5 presents the analysis method ELISA with sera of patients and healthy individuals, pept is Yes epitope, identified by way of ribosomal display.

Figure 6 presents a representative two-dimensional immunoblot surface proteins of S.aureus, detected using human serum. 800 µg of protein from S. aureus/COL, cultured on BHI, shared methods IEF (PI 4-7) and DDS-Na-PAG electrophoresis (9-16%), and then transferred to PVDF membrane. After blocking the membrane was incubated with serum IC35 (1:20000). Binding of serum IgG was visualized using the HRPO conjugate with antibody to human IgG and manifestations using enhanced chemiluminescence ECL.

Figure 7 presents a representative two-dimensional gel showing the surface proteins of S.aureus at colouring Kumasi blue. 1 mg of protein from S.aureus/COL shared methods IEF (PI 4-7) and DDS-Na-PAG electrophoresis (9-16%). Marked the spot selected for sequencing after serological proteomic analysis.

On figa and 8B shows the structure of protein LPXTG cell wall.

Figure 9 presents IgG response in uninfected (N, C) and infected (B) patients on LPXTGV, a new antigen and probable surface adhesin S.aureus, outdoor according to the invention using the display on the bacterial surface and proteomic approach.

Figure 10 presents paint the surface of S.aureus purified IgG against LPXTGV.

Figure 11 presents two-dimensional gel, which over ostrye proteins of S.aureus were stained with Kumasi blue (left). 1 mg of protein from S. aureus/agr, cultured to early logarithmic phase, divided by the methods of IEF (PI 4-7) and DDS-Na-PAG-electrophoresis (9-16%). Marked the spot selected for sequencing after serological proteomic analysis. The corresponding two-dimensional immunoblot (right). 800 µg of protein from the same preparation were separated in parallel by the method of two-dimensional electrophoresis, and then transferred to PVDF membrane. After blocking the membrane was incubated with a pool of P (1:10000). Binding of serum IgG was visualized using the HRPO conjugate with antibody to human IgG and manifestations using enhanced chemiluminescence ECL.

Information confirming the possibility of carrying out the invention

The method according to the present invention mainly consists of three main parts, namely: 1) the identification of sources of hyperimmune serum containing specific antibodies against a particular pathogen, 2) screening appropriate expression libraries with an appropriate drug antibodies, which are selected antigens candidates (or antigenic fragments of these antigens), and 3) the second cycle of screening, in which hyperimmune reactive serum antigens identified by their ability to bind to the relevant part of the individual antibody preparations from individual sera in order to make the change, these antigens are practically important and not only react with hyperimmune serum, but also have a broad immunogenicity (i.e., that the number of individual sera react with a given antigen). This method makes it possible to obtain a set of specific antigens of the pathogen, which is complete with respect to this pathogen and this serum. Thus, in the present method eliminates the bias towards "bad" antigens candidate or incomplete set of antigens of this pathogen.

The completeness of this set of antigens of the pathogen in the context of the present invention, of course, depends on the completeness of expression libraries used in this way, and the quality and size of the test collections serum (number of individual plasma/serum)as regards the representativeness of the library, and the suitability of the expression system. Therefore, the preferred embodiment of the present method are characterized in that at least one of the expression libraries selected from a library of ribosomal display, ribosome display library), library display on the bacterial surface (bacterial surface library) and proteome.

Collection of serum used in the present invention, should be checked against the set of known antigenic compounds of this pathogen, such as the policy is Aridi, the lipid and protein components of the cell wall, cell membrane and cytoplasm and secreted products. Preferably use three separate collections of sera: 1) with a very stable repertoire of antibodies from normal adult, clinically healthy people who have had previous cases of contact, or from carriers of this pathogen without acute signs and symptoms of the disease; 2) with antibodies induced acute by the presence of the pathogenic organism from patients with acute illness in different ways (for example, sepsis or infection of the wound S.aureus and so on); 3) without any specific antibodies in General (as negative control): from infants at the age of 5-8 months, lost maternal antibodies through 5-6 months after birth. Serum should react with many pathogen-specific antigens, then it can be considered hyperimmune for this pathogen (bacteria, fungus, worm, or other), so it will be relevant for the screening method of the present invention.

The program identification of antigens to identify the full set of antigens according to the present invention it is preferable that the above at least three expression libraries were represented at least by the library ribosomal display library display on BA the material surface and the proteome. It was noted that although all expression library can be complete, however, the use of only one or two expression libraries in the program identification of antigens does not lead to a complete set of antigens due to inherent in each of the different expression libraries properties preferred expression. Thus, although it is possible to obtain hyperimmune reactive serum antigens using only one or two different expression libraries, but in many cases this may not lead eventually to the identification of a complete set of hyperimmune reactive serum antigen. Of course, the term "full" according to the present invention means not a theoretical maximum, but only practical completeness, i.e. that this pathogen identified at least 95% practically relevant antigens or antigenic determinants. While the practical significance is determined by the prevalence of antibodies to this pathogen in the patient population.

According to the present invention, the pools of serum or plasma fraction, or other pools of the internal environment of the organism containing the antibodies are also pools of plasma.

Expression library used in the present invention should at least provide the expression of all potentially the x antigens for example, all surface proteins of this pathogen. The expression library of the present invention provides at least one set of potential antigens of this pathogen, and preferably this set is a full theoretical set of (poly)peptides encoded by the genome of a pathogen (i.e. genomic library as described in Example 2) and expressed either in recombinant host (see Example 3)or in vitro (see Example 4). This set of possible antigen may be a protein preparation, in the case of extracellular pathogens - protein preparation containing surface proteins of the pathogen obtained from the pathogen cultured under certain physiological conditions (see Example 5). At that time, as genomic approach is able to provide a complete set of antigens, the latter approach has the advantage that it provides protein in its natural state, that is, including, for example, post-translational modification or subjected to processing forms of these proteins, which are not obvious from the DNA sequence. These and any other sets of potential antigens from a pathogen, tumor, allergen or tissue or organism exposed to autoimmune reactions, hereinafter referred to as "expression library". A completely different expression libraries can primantis is in the implementation of the present invention. Examples are given, for example, in Ausubel et al., 1994. Particularly preferred expression library that represents the display of a genetic set of the pathogen in recombinant type methods broadcast in vitro, for example, ribosomal display, or prokaryotic expression systems, for example, expression libraries display on the bacterial surface, or such that are close to the specific conditions of physiological expression of this pathogen in this physiological state of the proteome.

Ribosome display is a recognized method of recombinant DNA technology, which is applicable to any particular pathogen in the interests of the present invention (Schaffitzel et al., 1999). Library display on the bacterial surface presents a recombinant library of bacterial host, representing the (complete) set of peptide sequences of this pathogen, expressed, for example, the selected outer membrane protein on the membrane of the bacterial host (Georgiou et al., 1997). In addition to presenting the peptide or protein on the outer membrane protein, the expression library display on the bacterial surface is preferred, other methods bacterial display, such as display technologies on the enzymatic activity and expression of h is cut secreted proteins (Forrer et al., 1999; Rodi and Makowski, 1993; Georgiou et al., 1997).

Preparation of antigen for the first cycle screening method of the present invention may be from any source that contains antibodies against this pathogen. Preferably, if the source of the drug antibodies use a pool of plasma, then select a pool of human plasma, including donors who have undergone or are in the state of infection by this pathogen. Although this choice of plasma or plasma pools in principle is a standard method, for example, upon receipt of hyperimmune immunoglobulin products, however, it was unexpectedly found that these methods have such effects, especially as shown by the preferred embodiment of the present invention.

Preferably expression libraries represent a genomic expression library of this pathogen, or, alternatively, a library of mRNA. Preferably these genomic or mRNA libraries are full of genomic or mRNA libraries, which means that they contain at least one copy of all possible proteins, peptides or peptide fragments that can Express the pathogen. Preferably genomic expression library show redundancy for at least 2-fold, more preferably at least 5-fold, particularly at least 10-fold.

Prefer the eno method of the present invention includes screening at least the libraries of ribosomal display, library display on the bacterial surface and proteome using drug antibodies and the identification of antigens that bind at least two, and preferably all screening with antibodies in the preparation of antibodies. Then, these antigens can be considered as a very suitable as hypermonogenic antigens, regardless of how their expression. Preferably, these at least two screening should at least include the proteome, as in the proteome antigens is always represented in the form expressed in a natural way proteins, including post-translational modification, processing, etc. that are not apparent from the DNA sequence.

The method of the present invention can be applied to any pathogen. Therefore, pathogens preferably selected from a number of bacterial, viral, fungal, and protozoal pathogens. The method of the present invention is also applicable to cancer, you have to identify tumor antigens, as well as for identification of allergens or antigens involved in autoimmune diseases. Of course, recombinant methods will be particularly simple for pathogens with a small genome or a relatively small number of expressed proteins (e.g., bacterial or viral pathogens), and more difficult for complex (eukaryotic) the organization of the MOU with large genomes. However, even such large genomic library of pathogens among higher organisms can be analyzed by the method of the present invention, at least faster and more reliable than known methods identification of relevant antigens.

Preferred pathogens used for data analysis or extraction of antigens, respectively, include the human immunodeficiency virus (HIV), the hepatitis a virus (HAV), hepatitis b virus (HBV), hepatitis C virus (HCV), rous sarcoma virus (RSV), Epstein-Barr (EBV), influenza virus (IV), rotavirus (RV), Staphylococcus aureus (S.aureus), Staphylococcus epidermidis (S.epidermidis), Chlamydia pneumoniae (C.pneumoniae), Chlamydia trachomatis (C.trachomatis), Mycobacterium tuberculosis (M.tuberculosis), Mycobacterium leprae (M.leprae), Streptococcus pneumoniae (S.pneumoniae), Streptococcus pyogenes (these bacteria to antibiotics), Streptococcus agalactiae (S.agalactiae), Enterococcus faecalis (E.faecalis), Bacillus anthracis (.anthracis), Vibrio cholerae (V.cholerae), Borrelia burgdorferi (B.burgdorferi), Plasmodium sp., fungal pathogens such as Pneumocystis carinii, Aspergillus sp., Cryptococcus sp., Candida albicans, or parasitic pathogens, such as roundworm (Ascaris lumbricoides), and tapeworms (Taenia saginata). The method of the present invention is most applicable to bacteria, worms or Candida.

As a model organism for this application selected Staphylococcus aureus, to show the applicability and efficiency of the method of the present invention. In particular examples, it is clear that the invention can be easily extended to all possible pathogens is particularly those what is listed above.

It was unexpectedly found that the method of the present invention provides an efficient and rapid biological screening of a specific pathogen, especially in view of the fact that only a small part of the repertoire of antibodies of the patient is directed to this pathogen, even when against this pathogen produces effective protection. In the course of the present invention, especially when you run the example with S.aureus, discovery was made that only 1-2% of the repertoire of antibodies of a patient with a high titer of antibodies against S.aureus in fact represent antibodies directed against S.aureus. Moreover, over 70% of this specific fraction of 1% is directed against non-protein antigens, such as tagaeva acid, so that only 0.1% or less of antibodies directed against protein antigens.

One of the advantages of using a recombinant expression libraries, especially libraries of ribosomal display library display on the bacterial surface, is that the identified antigens reacting with hyperimmune serum, can be immediately obtained by expression of coding sequences screened and selected clones expressing antigens reacting with hyperimmune serum, and further stage of recombinant DNA technology or cloning tenovate unnecessary.

Therefore, hyperimmune reactive serum antigens, obtained by the method of the present invention, can be immediately enclosed in a pharmaceutical composition, preferably by adding a pharmaceutically acceptable carrier and/or excipient, immediately after receiving (during the second stage of selection), for example, when expression of the expression library.

Preferably the pharmaceutical composition containing the antigen reacting with hyperimmune serum is a vaccine for the prevention or treatment of infection caused by a particular pathogen, from which were selected antigens.

The pharmaceutical composition can contain any suitable excipients such as buffering agents, stabilizers and / or additional active ingredients, in particular the well-known ingredients associated with receipt of vaccines.

Preferably the carrier and/or excipient for hyperimmune reactive serum antigen of the present invention is a connection-immunostimulant for additional stimulation of the immune response on this hyperimmune reactive serum antigen. Preferably the compound adjuvant in a pharmaceutical composition of the present invention are selected from among poly-substance, especially palikat the district peptides immunostimulatory of deoxynucleotides, alum, complete adjuvant's adjuvant, incomplete adjuvant-blockers, neuroactive compounds, especially human growth hormone, or combinations thereof.

Poly-compounds for use according to the present invention can be any poly-compounds exhibiting the characteristic effects according to WO 97/30721. Preferred poly-compounds are selected from the basic polypeptides, organic polycation, the main polyaminoacid or mixtures thereof. Chain length such polyaminoacid must be at least 4 amino acid residues (see Tuftsin, as described in Goldman et al., 1983). Particularly preferred substances of the type polylysine, polyalanine and polypeptides containing more than 20%, preferably more than 50% of basic amino acids in the range of more than 8, preferably more than 20 amino acid residues, or mixtures thereof. Other preferred polycation and their pharmaceutical compositions are described in WO 97/30721 (for example, polyethylenimine) and WO 99/38528. Preferably such polypeptides contain from 20 to 500 amino acid residues, more preferably from 30 to 200 residues.

Such poly-compounds can be obtained by chemical or recombinant methods, or originate from natural sources.

Cationic (poly)peptides may also possess the AMB antimicrobial properties, as described in the reviews: Ganz et al., 1999; Hancock, 1999. These (poly)peptides may be derived from prokaryotes, animals or plants, or can be obtained by chemical or recombinant methods (Andreu et al., 1998; Ganz et al., 1999; Simmaco et al., 1998). The peptides may also belong to the class of defensins (Ganz, 1999; Ganz et al., 1999). Sequences of such peptides, for example, can be found in the Database on antimicrobial sequences at the following Internet address: http://www.bbcm.univ.trieste.it/˜tossi/pag2.html.

Such protective peptides of the host body or defensin also are the preferred form of poly-polymers according to the present invention. In General, as poly-polymers using connections that provide ultimately the activation (or lower regulation of adaptive immunity, preferably mediated by ARS (including dendritic cells).

Especially preferred for use as a poly-substances in the present invention antimicrobial peptides derived from cathelicidin, or their derivatives (international patent application PCT/ER/09529, included in the description by reference), especially antimicrobial peptides derived from cathelicidin mammalian, preferably human, a bull or a mouse.

To poly-compounds of natural origin Rel who are HIV-REV and HIV-TAT (derived cationic peptides, the antennapedia peptides, chitosan and derivatives of chitin) and other peptides derived from these peptides or proteins biochemical or recombinant means. Other preferred poly-connection - katelin and related or derivative of the substance. For example, katelin mouse is a peptide having the amino acid sequence of NH2-RLAGLLRKGGEKIGEKLKKIGOKIKNFFQKLVPQPE-COOH. Related Catelyn or derived substances contain full or partial sequence of Catelyn, including at least 15-20 amino acid residues. Derivatives may include the replacement or modification of the natural amino acids are those amino acids that are not among the standard 20 amino acids. In addition, such molecules Catelyn can be entered for more cationic residues. Such molecules Catelyn are preferred to combine with the antigen. Suddenly these molecules Catelyn has also proved effective as adjuvants for antigens without the addition of other adjuvants. Therefore, such molecules Catelyn can be used as an effective adjuvant in the composition of the vaccines together with other immunoactive substances or without them.

Other preferred poly-substance for use according to the present invention is a synthetic peptide containing less is th least 2 motif KLK, separated by a linker of 3 to 7 hydrophobic amino acids (international patent application PCT/ER/12041, included in the description by reference).

To immunostimulatory deoxynucleotides include natural or artificial CpG-containing DNA, short segments of DNA from invertebrates or short oligonucleotides (ODNs)containing neetilirovannye dinucleotides cytosine-guanine (CpG) in a particular context (see Krieg et al., 1995), as well as containing inosine ODNs (I-ODNs), as described in WO 01/93905.

Neuroactive compounds, for example, combined with poly-substances described in WO 01/24822.

According to a preferred embodiment, the individual antibody preparations for the second cycle of screening receive from patients with acute infection caused by this pathogen, especially from patients in whom the titer of antibodies to this pathogen exceeds a certain minimum level, for example, the antibody titer in excess of 80-percentile, preferably greater than 90-percentile, more preferably greater than 95-percentile for tested samples of human serum (patients or carriers). The use of individual antibody preparations with such a high titer in the second round of screening provides high selectivity in identifying hyperimmune reactive serum antigen of this pathogen.

Importantly, the second screening with individual antibody preparations (which can serve and selected serum) provides selective identification hyperimmune reactive serum antigen from all perspective candidates obtained in the first cycle. Therefore, when the identification of such antigens in the second round of screening should preferably be used at least 10 individual antibody preparations (i.e. antibody preparations, for example, sera obtained from at least 10 different people who have had the infection caused by this pathogen). Of course, you can use less than 10 individual drugs, however, a small number of individual antibody preparations selectivity at this stage may be suboptimal. On the other hand, if this hyperimmune reactive serum antigen (or antigen fragment) recognized at least 10 individual antibody preparations, preferably at least 30, particularly preferably at least 50 individual antibody preparations, identification hyperimmune reactive serum antigen is sufficiently selective for proper identification. Of course, to test the ability to react with hyperimmune serum can be used and the number of individual drugs as possible (for example, more than 100 or even 1000).

Thus, the relevant part hyperimmune reactive serum antibody preparations in accordance with the method of the present invention should is and it is preferable to be at least 10, more preferably at least 30, particularly preferably at least 50 individual antibody preparations. Alternatively (or in addition), hyperimmune reactive serum antigen can preferably be identified using at least 20%, preferably at least 30%, especially preferably at least 40% of all individual antibody preparations used in the second round of screening.

According to a preferred embodiment of the present invention whey, which are the individual antibody preparations for the second cycle of screening (or use as antibody preparations), are selected based on their titles against a particular pathogen (i.e. against the preparation of this pathogen, for example, lysate, components of the cell wall or recombinant proteins). Preferably they are selected with a total titer of IgA more than 4,000 units, especially more than 6,000 units, and/or IgG titer of more than 10,000 units, especially over 12,000 units (unit = unit, calculated by the value of CD405nm at the appropriate dilution)as antigen for ELISA using whole body (total lysate or whole cells). Individual proteins with Ig titers more than 800-1000 units is especially preferred for the selection of antigens reacting with hyperimmune serum, only as a General title. The report toindividuals proteins can be obtained from figure 9.

In the illustrative example, also represents a preferred embodiment of the present invention, the pathogen are staphylococci, especially Staphylococcus aureus and Staphylococcus epidermidis. Staphylococci are conditional pathogens that can cause a number of diseases, from mild infections to life-threatening diseases. From the large number of staphylococci at least 3 usually associated with human diseases: S.aureus, S.epidermidis and occasionally tendency of development (Crossley and Archer, 1997). In the course of the present invention S.aureus was used as an illustrative example of how the present invention. In addition, it is also an important body in terms of its strong pathogenic effects on humans. Staph infections are a growing threat in hospitals around the world. The spread of staphylococci and their ability to cause infections associated with the widespread use of antibiotics, which are induced and continue to induce multiple drug resistance. For this reason, the treatment of staphylococcal infections can no longer rely on antibiotics. Therefore it is necessary to change the tactics of treatment of these diseases, with a focus on infection prevention. Production of high affinity antibodies are opsonic and neutralizing type of vaccination contributes to the elimination of bacteria and t is xinou system of innate immunity. As a consequence, the method of the present invention becomes the best tool for the identification of antigenic proteins of staphylococci.

Everyone colonized S.epidermidis. OK S.epidermidis lives on the skin and mucous membranes. The most pathogenic species, S.aureus, lives mainly in the nose and perineum. Some individuals become permanent carriers of S.aureus, often the same strain. Stage carriage has clinical value, since the operations of infection occur most frequently from the media. In General, a strong nose flora prevents the acquisition of new strains. However, colonization of other strains may occur during treatment with antibiotics, which leads to the elimination of sensitive inherent in the carrier strain. Because this situation occurs in hospitals, patients can occur colonization of resistant nosocomial Staphylococcus. These bacteria have an innate adaptability, which is complemented by a broad and not always correct application of antimicrobial agents. Therefore, hospitals represent a favorable environment for the development of drug resistance (close contacts between patients, the widespread use of antimicrobial agents of nosocomial infections). S.aureus and S.epidermidis acquired resistance to many common and is tibeticum, the most important methicillin (MRSA) and vancomycin (VISA). Drug resistance is a growing threat in health care, and soon many infections caused by staphylococci, would be impossible to treat with antibiotics. Along with, adverse effects on public health, antimicrobial resistance contributes to the increase in the cost of treatment, because the treatment of resistant infections often requires the use of more toxic and more expensive drugs and can lead to longer hospital stays infected patients.

Moreover, even with the use of effective antibiotics, the mortality rate for the most serious staphylococcal infections is 30-50%.

Staphylococci are potentially pathogenic, once disturbed the natural balance between the microorganisms and the immune system, damaged natural barriers (skin, mucous membranes). Positive for coagulase S.aureus is the most pathogenic species of Staphylococcus, which has long been afraid of surgeons. Most often it causes wound infections and causes the formation of abscesses. A local infection may become systemic, causing bacteremia and sepsis. Especially after viral infections and in older people it can cause severe pneumonia. S.aureus is often what is the reason for infections, associated with medical devices such as vascular and subcutaneous catheters (endocarditis, sepsis, peritonitis), prostheses (septic arthritis, osteomyelitis). S.epidermidis is the most common cause of the disease associated with the presence of foreign bodies and the use of fixtures: infections associated with catheters, infection by shunting cerebrospinal fluid, peritonitis in patients on dialysis (mainly CAPD), endocarditis in people with artificial heart valves. As an example, immunocompromised patients, such as cancer patients and premature babies often infections caused negative for coagulase staphylococci in connection with the use of vascular catheters. The increase in the number of cases associated with increasing use of such devices and the increase in the number immunocompromised patients.

Much less is known about the other negative for the coagulase Staphylococcus tendency of development, causing acute urinary tract infections in previously healthy people. With a few exceptions, they are women aged 16-25 years.

The pathogenesis of staphylococcal infections is multifactorial. In order to cause infection, the pathogen must gain access to the cells and tissues of the host that is attached. S.aureus expresses surface proteins, which is haunted facilitate attachment to proteins such owner, as laminin, fibronectin, elastin, vitronectin, fibrinogen, and many other molecules that are part of the extracellular matrix (binding to extracellular matrix proteins, ESBWR). S.epidermidis has cell surface molecules that promote attachment to alien material and through this mechanism cause infection in the host. Another powerful weapon used by staphylococci, is secreted products, such as enterotoxins, exotoxins and enzymes that damage tissue. The toxins kill or deceive the immune cells that are important for the protection of the owner. Several different types of toxins are responsible for most of the symptoms of the infections.

Protection of the host body from S.aureus mainly depends on the mechanisms of innate immunity. The skin and mucous membranes are powerful barriers against the penetration of staphylococci. However, as soon as the skin or mucous membrane is exposed to damage (wounds, subcutaneous catheters and the like), the first line of defense cells, not system-specific, acquired immunity, consistently effective over the complement and phagocytes, particularly polymorphonuclear leukocytes (PMNs). These cells can be considered as cornerstones in the elimination penetrating bacteria. Because staphylococci are primarily uncle the internal pathogens, the main adaptive response against Staphylococcus derives from the humoral branch of the immune system and is mediated by three main mechanisms: run opsonization, neutralization of toxins and inhibition of attachment. I think that is especially important opsonization, as it requires effective phagocytosis. For effective opsonization surface of the microbe must be coated with antibodies and complement factors for recognition by cells of PMNs through the receptors for the Fc fragment of the IgG molecule or to an activated 3b. After opsonization of Staphylococcus undergo phagocytosis and die. In addition, S.aureus may be attached to the endothelial cells and be internalized by such phagocytosis process. Antibodies bound peroxidase with specific antigens on the surface of bacterial cells, serve as ligands for attachment to PMNs and promote phagocytosis. The same antibodies, contacting adesanmi and other proteins on the cell surface, must oppose the attachment and to prevent colonization.

Clinical evidence that cellular immunity plays a significant role in protection against staphylococci, too little, however, should recognize that this issue is not yet sufficiently developed. However, it is known that Staphylococcus aureus uses a wide range of molecular countermeasures for osdate protective microenvironment of the infected host by secreting polypeptides, called superantigens that take aim at multireceptor communication between T cells and antigen presenting cells, which play a fundamental role in the launch of pathogen-specific immune neutralization. Superantigen play a crucial role in toxic shock syndrome and food poisoning, but their function in normal infections are not entirely clear. In addition, it is impossible to expect a long or antibody-based test response (memory) T cells. It is well known that the majority of antibodies against Staphylococcus directed to T-independent antigens (capsular polysaccharides, lipoteichoic acid, composition), not causing memory. Dependent T-cell protein antigens can induce long-lasting protective or antibody-based test answers. But such proteins and peptides staphylococci is not yet installed.

For all these reasons mentioned above, it is essential to change tactics on the battlefield with staphylococcal infections. One way of fighting infections is prevention by active immunization. The development of a vaccine against S.aureus was undertaken various research groups and national institutions around the world, however, an effective vaccine has not yet appeared. It was shown that the state of immunodeficiency promotes perestiani staphylococci, videtelstvo, what antistaphylococcal antibodies are important in protecting the host. Against surface components of the antibodies listed in passive immunization or induced by active immunization could prevent the attachment of bacteria to neutralize toxins and stimulate phagocytosis. A vaccine based on a fibronectin-binding protein induces protective immunity against mastitis in cows, indicating that this approach may work in humans (REFs). With all this in mind we can assume that an effective vaccine should consist of those proteins or polypeptides, which are expressed by all strains and are able to induce high-affinity, mass antibodies against components of the cell surface S.aureus. Antibodies must be of type IgG1 and/or IgG3 for opsonization and any subtype of IgG and IgA to suppress attachment and neutralise toxins. Vaccine specific chemical composition clearly must exceed vaccines based on whole cells (attenuated or dead), so how can you eliminate those components S.aureus which paralyze the T-cells (superantigen) or inhibit the opsonization (protein a), and to select individual proteins that induce protective antibodies. Identification of relevant antigens will help to ensure effective passive immunization (those who Apia humanitarianism monoclonal antibodies), which can replace the introduction of human immunoglobulin with all its dangerous side effects. Staphylococcal infection of the newborn, severe septicaemia and other life-threatening acute conditions are the main target of passive immunization. An effective vaccine is great potential for patients waiting for surgery in General, and those who enter vascular catheters, in particular. In addition, this vaccine should benefit patients with chronic diseases which decrease the immune response, and those who are subjected to continuous the peritoneal dialysis on an outpatient basis.

For the illustrative example against Staphylococcus aureus used in parallel three different approaches. All these three methods are based on the interaction of proteins or peptides with Staphylococcus antibodies in human serum in accordance with the method of the present invention. This interaction depends on the recognition of epitopes on proteins, which can be a short peptides (linear epitopes) or polypeptide domains (structural epitopes). Antigenic proteins identified by different methods, using the pre-selected pools of sera and in the second round of screening individual serum.

After high-throughput screening of selected antigen is s Express proteins as recombinant proteins or products of in vitro translation (in the case if they cannot be expressed in the prokaryotic expression system and tested in a series of analyses by the method of ELISA or Western-hybridization for assessment of immunogenicity with a large collection of human sera (>100 uninfected, >50 patients). Preferred antigens located on the cell surface or are secreted, they are available extracellular. It should be expected that antibodies against cell wall proteins (type to bind to the extracellular matrix proteins) will have a dual purpose: to inhibit the adhesion and stimulate phagocytosis. Antibodies against secreted proteins useful for the neutralization of toxins. It is well known that bacteria communicate with each other by means of secreted proteins. Neutralizing antibodies against these proteins will stop stimulating the growth of interspecific or intraspecific "negotiations" of staphylococci. Bioinformatics (signal sequence, the signal localization on the cell surface, transmembrane domains) proved very useful in the analysis of localization on the cell surface or secretion. The experimental approach includes the selection of antibodies to the respective imitators and proteins from human serum and their use as reagents in the following tests: staining of the cell surface of Staphylococcus, kultivirovanija different conditions (FACS, microscopy), determination of the neutralizing capacity (toxin, enlistment and induction of opsonization and phagocytosis (analysis of phagocytosis in vitro).

Antibodies can recognize linear epitopes with sequences of only 4-5 amino acids. Of course, this does not mean that these short peptides are able to induce the formation of specific antibodies in vivo. For this reason, certain epitopes, polypeptides and proteins can be subjected to further testing on animals (mainly mice) in relation to their ability to induce antibodies to selected proteins in vivo. Antigens with a proven ability to induction of antibodies subjected to testing in animal models for their ability to prevent infections.

Production of antibodies against staphylococci by human immune system and their presence in human serum testify to the expression of antigenic proteins in vivo and their immunogenicity.

Accordingly, there have been new hyperimmune reactive serum antigens from Staphylococcus aureus or Staphylococcus epidermidis method of the present invention. According to further aspect of the present invention, the invention relates to a hyperimmune reactive serum antigen selected from the group consisting of sequences listed in any of table, 2b, 2c, 2d, 3, 4 and 5, in particular the choice is emich from the group consisting of Seq.ID No.56, 57, 59, 60, 67, 70, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 85, 87, 88, 89, 90, 92, 95, 96, 97, 99, 100, 101, 102, 103, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 126, 128, 130, 132, 134, 138, 140, 142, 151, 152, 154, 155 and hyperimmune fragments. Accordingly, the present invention also concerns a hyperimmune reactive serum antigen, obtained by the method of the present invention and selected from the group consisting of sequences listed in any of table, 2b, 2c, 2d, 3, 4 and 5, in particular selected from the group consisting of Seq.ID No.56, 57, 59, 60, 67, 70, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 85, 87, 88, 89, 90, 92, 95, 96, 97, 99, 100, 101, 102, 103, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 126, 128, 130, 132, 134, 138, 140, 142, 151, 152, 154, 155 and hyperimmune fragments.

Antigens from Staphylococcus aureus and Staphylococcus epidermidis were obtained by the method of the present invention, which can be used for the manufacture of medicinal products, in particular for the manufacture of vaccines against infections caused by Staphylococcus aureus and Staphylococcus epidermidis. Examples of such hyperimmune reactive serum antigen Staphylococcus aureus and Staphylococcus epidermidis for use in drugs selected from the group consisting of sequences listed in any of table, 2b, 2C, 2d, 3, 4 and 5, in particular selected from the group consisting of Seq.ID No.55, 56, 57, 58, 59, 60, 62, 66, 67, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 87, 88, 89, 90, 92, 94, 95, 96, 97, 99, 100, 101, 102, 103, 104, 106, 108, 110, 112, 114, 116, 118, 120, 12, 126, 128, 130, 132, 134, 138, 140, 142, 151, 152, 154, 155, 158 and hyperimmune fragments, for the manufacture of a medicinal product, in particular for the manufacture of vaccines against infections caused by Staphylococcus aureus and Staphylococcus epidermidis.

Hyperimmune fragment is defined as a fragment of the identified antigen, which in itself antigenic or may be antigenic in combination with the hapten. Therefore, the present invention also provides for antigens or antigenic fragments with one or (for long fragments) multiple substitutions of amino acids, provided that the antigenic properties of these fragments with substitutions of amino acids does not deteriorate much when replacing(s), i.e. they are suitable for the induction of an appropriate immune response in individuals vaccinated with this antigen, and identifies the individual antibody preparations from individual sera.

Preferred examples of such hyperimmune fragments hyperimmune reactive serum antigen selected from the group consisting of peptides containing amino acid sequences of column "Predicted immunogenic amino acids", "Location of identified immunogenic site" and "Reactivity of the serum with the relevant land" in table, 2b, 2C and 2d and amino acid sequences of column "Estimated antigenic region is poverhnosti" in table 4 and 5, in particular, peptides containing amino acids No. 12-29, 34-40, 63-71, 101-110, 114-122, 130-138, 140-195, 197-209, 215-229, 239-253, 255-274 and 39-94 of Seq.ID No.55,

amino acids No. 5-39, 111-117, 125-132, 134-141, 167-191, 196-202, 214-232, 236-241, 244-249, 292-297, 319-328, 336-341, 365-380, 385-391, 407-416, 420-429, 435-441, 452-461, 477-488, 491-498, 518-532, 545-556, 569-576, 581-587, 595-602, 604-609, 617-640, 643-651, 702-715, 723-731, 786-793, 805-811, 826-839, 874-889, 37-49, 63-77 and 274-334 of Seq.ID No.56,

amino acids No. 28-55, 82-100, 105-111, 125-131, 137-143, 1-49 of Seq.ID No.57,

amino acids No. 33-43, 45-51, 57-63, 65-72, 80-96, 99-110, 123-129, 161-171, 173-179, 185-191, 193-200, 208-224, 227-246, 252-258, 294-308, 321-329, 344-352, 691-707, 358-411 and 588-606 of Seq.ID No.58,

amino acids No. 16-38, 71-77, 87-94, 105-112, 124-144, 158-164, 169-177, 180-186, 194-204, 221-228, 236-245, 250-267, 336-343, 363-378, 385-394, 406-412, 423-440, 443-449, 401-494 of Seq.ID No.59,

amino acids No. 18-23, 42-55, 69-77, 85-98, 129-136, 182-188, 214-220, 229-235, 242-248, 251-258, 281-292, 309-316, 333-343, 348-354, 361-367, 393-407, 441-447, 481-488, 493-505, 510-515, 517-527, 530-535, 540-549, 564-583, 593-599, 608-621, 636-645, 656-670, 674-687, 697-708, 726-734, 755-760, 765-772, 785-792, 798-815, 819-824, 826-838, 846-852, 889-904, 907-913, 932-939, 956-964, 982-1000, 1008-1015, 1017-1024, 1028-1034, 1059-1065, 1078-1084, 1122-1129, 1134-1143, 1180-1186, 1188-1194, 1205-1215, 1224-1230, 1276-1283, 1333-1339, 1377-1382, 1415-1421, 1448-1459, 1467-1472, 1537-1545, 1556-1566, 1647-1654, 1666-1675, 1683-1689, 1722-1737, 1740-1754, 1756-1762, 1764-1773, 1775-1783, 1800-1809, 1811-1819, 1839-1851, 1859-1866, 1876-1882, 1930-1939, 1947-1954, 1978-1985, 1999-2007, 2015-2029, 2080-2086, 2094-2100, 2112-2118, 2196-2205, 2232-2243, 198-258, 646-727 and 2104-2206 of Seq.ID No.60,

amino acids No. 10-29, 46-56, 63-74, 83-105, 107-114, 138-145, 170-184, 186-193, 216-221, 242-248, 277-289, 303-311, 346-360, 379-389, 422-428, 446-453, 459-469, 479-489, 496-501, 83-156 of Seq.ID No.62,

amino acids No. 14-22, 32-40, 52-58, 61-77, 81-93, 111-117, 124-38, 151-190, 193-214, 224-244, 253-277, 287-295, 307-324, 326-332, 348-355, 357-362, 384-394, 397-434, 437-460, 489-496, 503-510, 516-522, 528-539, 541-547, 552-558, 563-573, 589-595, 602-624, 626-632, 651-667, 673-689, 694-706, 712-739, 756-790, 403-462 of Seq.ID No.66,

amino acids No. 49-56, 62-68, 83-89, 92-98, 109-115, 124-131, 142-159, 161-167, 169-175, 177-188, 196-224, 230-243, 246-252, 34-46 of Seq.ID No.67,

amino acids No. 11-20, 26-47, 69-75, 84-92, 102-109, 119-136, 139-147, 160-170, 178-185, 190-196, 208-215, 225-233, 245-250, 265-272, 277-284, 300-306, 346-357, 373-379, 384-390, 429-435, 471-481, 502-507, 536-561, 663-688, 791-816, 905-910, 919-933, 977-985, 1001-1010, 1052-1057, 1070-1077, 1082-1087, 1094-1112, 493-587, 633-715 and 704-760 of Seq.ID No.70,

amino acids No. 6-20, 53-63, 83-90, 135-146, 195-208, 244-259, 263-314, 319-327, 337-349, 353-362, 365-374, 380-390, 397-405, 407-415, 208-287 and 286-314 of Seq.ID No.71,

amino acids No. 10-26, 31-43, 46-58, 61-66, 69-79, 85-92, 100-115, 120-126, 128-135, 149-155, 167-173, 178-187, 189-196, 202-222, 225-231, 233-240, 245-251, 257-263, 271-292, 314-322, 325-334, 339-345, 59-74 of Seq.ID No.72,

amino acids No. 4-9, 15-26, 65-76, 108-115, 119-128, 144-153, 38-52 and 66-114 of Seq.ID No.73,

amino acids No. 5-22, 42-50, 74-81, 139-145, 167-178, 220-230, 246-253, 255-264, 137-237 and 250-267 of Seq.ID No.74,

amino acids No. 10-26, 31-44, 60-66, 99-104, 146-153, 163-169, 197-205, 216-223, 226-238, 241-258, 271-280, 295-315, 346-351, 371-385, 396-407, 440-446, 452-457, 460-466, 492-510, 537-543, 546-551, 565-582, 590-595, 635-650, 672-678, 686-701, 705-712, 714-721, 725-731, 762-768, 800-805, 672-727 of Seq.ID No.75.

amino acids No. 5-32, 35-48, 55-76 of Seq.ID No.76,

amino acids No. 7-35, 54-59, 247-261, 263-272, 302-320, 330-339, 368-374, 382-411, 126-143 and 168-186 of Seq.ID No.77,

amino acids No. 5-24, 88-94, 102-113, 132-143, 163-173, 216-224, 254-269, 273-278, 305-313, 321-327, 334-341, 31-61 and 58-74 of Seq.ID No.78,

amino acids No. 16-24, 32-39, 43-49, 64-71, 93-99, 126-141, 144-156, 210-218, 226-233, 265-273, 276-284, 158-220 the C Seq.ID No.79,

amino acids No. 49-72, 76-83, 95-105, 135-146, 148-164, 183-205, 57-128 of Seq.ID No.80,

amino acids No. 6-15, 22-32, 58-73, 82-88, 97-109, 120-131, 134-140, 151-163, 179-185, 219-230, 242-255, 271-277, 288-293, 305-319, 345-356, 368-381, 397-406, 408-420, 427-437, 448-454, 473-482, 498-505, 529-535, 550-563, 573-580, 582-590, 600-605, 618-627, 677-685, 718-725, 729-735, 744-759, 773-784, 789-794, 820-837, 902-908, 916-921, 929-935, 949-955, 1001-1008, 1026-1032, 1074-1083, 1088-1094, 1108-1117, 1137-1142, 1159-1177, 1183-1194, 1214-1220, 1236-1252, 1261-1269, 1289-1294, 1311-1329, 1336-1341, 1406-1413, 1419-1432, 1437-1457, 1464-1503, 1519-1525, 1531-1537, 1539-1557, 1560-1567, 1611-1618, 1620-1629, 1697-1704, 1712-1719, 1726-1736, 1781-1786, 1797-1817, 1848-1854, 1879-1890, 1919-1925, 1946-1953, 1974-1979, 5-134 of Seq.ID No.81,

amino acids No. 6-33, 40-46, 51-59, 61-77, 84-104, 112-118, 124-187, 194-248, 252-296, 308-325, 327-361, 367-393, 396-437, 452-479, 484-520, 535-545, 558-574, 582-614, 627-633, 656-663, 671-678, 698-704, 713-722, 725-742, 744-755, 770-784, 786-800, 816-822, 827-837, 483-511 of Seq.ID No.82,

amino acids No. 4-19, 57-70, 79-88 [in Russian], 126-132, 144-159, 161-167, 180-198, 200-212, 233-240, 248-255, 276-286, 298-304, 309-323, 332-346, 357-366, 374-391, 394-406, 450-456, 466-473, 479-487, 498-505, 507-519, 521-530, 532-540, 555-565, 571-581, 600-611, 619-625, 634-642, 650-656, 658-665, 676-682, 690-699, 724-733, 740-771, 774-784, 791-797, 808-815, 821-828, 832-838, 876-881, 893-906, 922-929, 938-943, 948-953, 969-976, 1002-1008, 1015-1035, 1056-1069, 1105-1116, 1124-1135, 1144-1151, 1173-1181, 1186-1191, 1206-1215, 1225-1230, 1235-1242, 6-66, 65-124 and 590-604 of Seq.ID No.83,

amino acids No. 5-32, 66-72, 87-98, 104-112, 116-124, 128-137, 162-168, 174-183, 248-254, 261-266, 289-303, 312-331, 174-249 of Seq.ID No.84,

amino acids No. 4-21, 28-40, 45-52, 59-71, 92-107, 123-137, 159-174, 190-202, 220-229, 232-241, 282-296, 302-308, 312-331, 21-118 of Seq.ID No.85,

amino acids No. 9-28, 43-48, 56-75, 109-126, 128-141, 143-162, 164-195, 197-216, 234-242, 244-251, 168-181 of Seq.ID No.87,

amino acids No. 4-10, 20-42, 50-86, 88-98, 102-171, 176-182, 189-221, 22-244, 246-268, 276-284, 296-329, 112-188 of Seq.ID No.88,

amino acids No. 4-9, 13-24, 26-34, 37 to 43, 45-51, 59-73, 90-96, 99-113, 160-173, 178-184, 218-228, 233-238, 255-262, 45-105, 103-166 and 66-153 of Seq.ID No.89,

amino acids No. 13-27, 42-63, 107-191, 198-215, 218-225, 233-250, 474-367 of Seq.ID No.90,

amino acids No. 26-53, 95-123, 164-176, 189-199, 8-48 of Seq.ID No.92,

amino acids No. 7-13, 15-23, 26-33, 68-81, 84-90, 106-117, 129-137, 140-159, 165-172, 177-230, 234-240, 258-278, 295-319, 22-56, 23-99, 97-115, 233-250 and 245-265 of Seq.ID No.94,

amino acids No. 13-36, 40-49, 111-118, 134-140, 159-164, 173-183, 208-220, 232-241, 245-254, 262-271, 280-286, 295-301, 303-310, 319-324, 332-339, 1-85, 54-121 and 103-185 of Seq.ID No.95,

amino acids No. 39-44, 46-80, 92-98, 105-113, 118-123, 133-165, 176-208, 226-238, 240-255, 279-285, 298-330, 338-345, 350-357, 365-372, 397-402, 409-415, 465-473, 488-515, 517-535, 542-550, 554-590, 593-601, 603-620, 627-653, 660-665, 674-687, 698-718, 726-739, 386-402 of Seq.ID No.96,

amino acids No. 5-32, 34-49, 1-43 of Seq.ID No.97,

amino acids No. 10-27, 37-56, 64-99, 106-119, 121-136, 139-145, 148-178, 190-216, 225-249, 251-276, 292-297, 312-321, 332-399, 403-458, 183-200 of Seq.ID No.99,

amino acids No. 5-12, 15-20, 43-49, 94-106, 110-116, 119-128, 153-163, 175-180, 185-191, 198-209, 244-252, 254-264, 266-273, 280-288, 290-297, 63-126 of Seq.ID No.100,

amino acids No. 5-44, 47-55, 62-68, 70-78, 93-100, 128-151, 166-171, 176-308, 1-59 of Seq.ID No.101,

amino acids No. 18-28, 36-49, 56-62, 67-84, 86-95, 102-153, 180-195, 198-218, 254-280, 284-296, 301-325, 327-348, 353-390, 397-402, 407-414, 431-455, 328-394 of Seq.ID No.102,

amino acids No. 7-37, 56-71, 74-150, 155-162, 183-203, 211-222, 224-234, 242-272, 77-128 of Seq.ID No.103,

amino acids No. 34-58, 63-69, 74-86, 92-101, 130-138, 142-150, 158-191, 199-207, 210-221, 234-249, 252-271, 5-48 of Seq.ID No.104,

amino acids No. 12-36, 43-50, 58-65, 73-78, 80-87, 108-139, 147-153, 159-172, 190-203, 211 to 216, 224-232, 234-246, 256-261, 273-79, 286-293, 299-306, 340-346, 354-366, 167-181 of Seq.ID No.106,

amino acids No. 61-75, 82-87, 97-104, 113-123, 128-133, 203-216, 224-229, 236-246, 251-258, 271-286, 288-294, 301-310, 316-329, 337-346, 348-371, 394-406, 418-435, 440-452 of Seq.ID No.112,

amino acids No. 30-37, 44-55, 83-91, 101-118, 121-128, 136-149, 175-183, 185-193, 206-212, 222-229, 235-242 of Seq.ID No.114,

amino acids No. 28-38, 76 to 91, 102-109, 118-141, 146-153, 155-161, 165-179, 186-202, 215-221, 234-249, 262-269, 276-282, 289-302, 306-314, 321-326, 338-345, 360-369, 385-391 of Seq.ID No.116,

amino acids No. 9-33, 56-62, 75-84, 99-105, 122-127, 163-180, 186-192, 206-228, 233-240, 254-262, 275-283, 289-296, 322-330, 348-355, 416-424, 426-438, 441-452, 484-491, 522-528, 541-549, 563-569, 578-584, 624-641, 527-544 of Seq.ID No.142,

amino acids No. 37-42, 57-62, 121-135, 139-145, 183-190, 204-212, 220-227, 242-248, 278-288, 295-300, 304-309, 335-341, 396-404, 412-433, 443-449, 497-503, 505-513, 539-545, 552-558, 601-617, 629-649, 702-711, 736-745, 793-804, 814-829, 843-858, 864-885, 889-895, 905-913, 919-929, 937-943, 957-965, 970-986, 990-1030, 1038-1049, 1063-1072, 1080-1091, 1093-1116, 1126-1136, 1145-1157, 1163-1171, 1177-1183, 1189-1196, 1211-1218, 1225-1235, 1242-1256, 1261-1269, 624-684 of Seq.ID No.151,

amino acids No. 8-23, 31-38, 42-49, 61-77, 83-90, 99-108, 110-119, 140-147, 149-155, 159-171, 180-185, 189-209, 228-234, 245-262, 264-275, 280-302, 304-330, 343-360, 391-409, 432-437, 454-463, 467-474, 478-485, 515-528, 532-539, 553-567, 569-581, 586-592, 605-612, 627-635, 639-656, 671-682, 700-714, 731-747, 754-770, 775-791, 797-834, 838-848, 872-891, 927-933, 935-942, 948-968, 976-986, 1000-1007, 1029-1037, 630-700 of Seq.ID No.152,

amino acids No. 17-25, 27-55, 84-90, 95-101, 115-121, 55-101 of Seq.ID No.154,

amino acids No. 13-28, 40-46, 69-75, 86-92, 114-120, 126-137, 155-172, 182-193, 199-206, 213-221, 232-238, 243-253, 270-276, 284-290, 22-100 of Seq.ID No.155,

amino acids No. 7-19, 46-57, 85-91, 110-117, 125-133, 140-149, 156-163, 198-204, 236-251, 269-275, 283-290, 318-323, 347-363, 9-42 and 158-174 of Seq.ID No.158,

amino acid No. is 7-14, 21-30, 34-50, 52-63, 65-72, 77-84, 109-124, 129-152, 158-163, lasts 175-190, 193-216, 219-234 of Seq.ID No.168,

amino acids No. 5-24, 38-44, 100-106, 118 to 130, 144-154, 204-210, 218-223, 228-243, 257-264, 266-286, 292-299 of Seq.ID No.174,

amino acids No. 29-44, 74-83, 105-113, 119-125, 130-148, 155-175, 182 to 190, 198-211, 238-245 of Seq.ID No.176,

and the fragments containing at least 6, preferably more than 8, especially more than 10 amino acids of the above sequence. All these pieces one by one and each of them independently form a preferred aspect of the present invention.

Of these antigens can also occur especially suitable T-helper epitopes. Especially preferred T-helper-epitopes are peptides containing fragments selected from the peptides listed in the column "Estimated area antigenic surface" in table 4 and 5, as well as from the group of amino acids No. 6-40, 583-598, 620-646 and 871-896 of Seq.ID No.56, amino acids No. 24-53 of Seq.ID No.70, amino acids No. 240-260 of Seq.ID No.74, amino acids No. 1660-1682 and 1746-1790 of Seq.ID No.81, amino acids No. 1-29, 680-709 and 878-902 of Seq.ID No.83, amino acids No. 96-136 of Seq.ID No.89, amino acids No. 1-29, 226-269 and 275-326 of Seq.ID No.94, amino acids No. 23-47 and 107-156 of Seq.ID No.114, amino acids No. 24-53 of Seq.ID No.142 and their fragments, which are T-cell epitopes.

In accordance with another aspect, the present invention relates to a vaccine containing such hyperimmune reactive serum antigen or its fragment, indicated the p above for Staphylococcus aureus and Staphylococcus epidermidis. Such a vaccine may include one or more antigens S.aureus and S.epidermidis. If necessary, these antigens S.aureus and S.epidermidis can be combined with antigens of other pathogens in the combined vaccine. Preferably the vaccine additionally comprises an immunostimulatory substance, preferably selected from the group consisting of poly-polymers, in particular poly-peptides, immunostimulatory deoxynucleotides (ODNs), neuroactive compounds, especially human growth hormone, alum, complete or incomplete adjuvants's adjuvant, or combinations thereof. This vaccine can also contain an antigen obtained by the technology of surface display of proteins presented on the surface of a genetically modified microorganism type E. coli.

In accordance with the following aspect, the present invention relates to a specific preparations containing antibodies obtained at least against one of the antigens or antigenic fragments of the Staphylococcus aureus and Staphylococcus epidermidis defined above. These antibodies are preferably monoclonal antibodies.

Methods of obtaining such drugs antibodies, polyclonal or monoclonal, very affordable expert in this field and are well described previously. The preferred method of obtaining such a monoclonal antibody character is being implemented in the following stages:

- induction of an immune response in an animal (not human) the introduction of antigen Staphylococcus or its fragment, as defined above, this animal,

- removal of the spleen or spleen cells from the animal,

- receiving cells hybridoma from the spleen or spleen cells,

selection and cloning of cells hybridoma specific to this antigen

- a drug antibody by culturing the cloned cells hybridoma and, if necessary, an additional stage of treatment.

Preferably the removal of the spleen or spleen cells associated with the slaughtering of the animal.

Monoclonal antibodies and their fragments can be done chimeric or humanitarianism (Graziano et al., 1995), which makes possible their re-introduction. Alternatively, monoclonal human antibodies and fragments thereof can be obtained from a library of phage display (McGuinnes et al., 1996) or from transgenic animals (Brüggemann et al., 1996).

The preferred method of obtaining preparations of polyclonal antibodies against antigens of Staphylococcus aureus or Staphylococcus epidermidis, identified in the present invention, is characterized by the following stages:

- induction of an immune response in an animal (not human) the introduction of antigen Staphylococcus or its fragment, as defined above, this animal,

- removal of containing antibodies inside the it environment of the body of the animal,

- a drug antibodies, exposing containing antibodies internal environment of the body additional stages of treatment.

These drugs are monoclonal or polyclonal antibodies can be used to manufacture a medicinal product for the treatment or prevention of diseases caused by staphylococcal infection. In addition, they can be used for diagnostics and imaging.

Further, the method described in the following examples and figures, but should not be limited to them.

EXAMPLES

The discovery of new antigens of Staphylococcus aureus

Example 1. Obtaining antibodies from human sera

Antibodies produced by the human immune system against staphylococci and in human sera are indicative of the expression of the antigenic proteins and their immunogenicity. These molecules necessary to identify the individual antigens method of the present invention, which is based on the interaction of specific antibodies against staphylococci with the relevant peptides or proteins of S.aureus. To access the relevant repertoire of antibodies, collected human serum at: I) patients with acute S.aureus infections, such as bacteremia, sepsis, infection and subcutaneous vascular catheters and devices, wound infections, infections of superficial and deep soft tissues. Doctor who-microbiological analyses showed what pathogen is S.aureus; (II) collection of sera from uninfected adults also used for analysis, as staphylococcal infections are frequent and the presence of antibodies is the result of natural immunization from previous contacts with Staphylococcus infections of skin and soft tissues (boils, wound infections, periodontitis etc).

Sera were examined for antibodies against S.aureus series of tests ELISA. Used several staphylococcal antigens to confirm that the measured titers are not the result of summation of antibodies with cross-reactivity. With this purpose in ELISA method was used not only extracts (devoid of protein And whole S.aureus cells (cultured in different conditions) or whole bacteria, but also the individual components of the cell wall, such as lipoteichoic acid and a composition selected from S.aureus. Even more importantly, created a collection of recombinant proteins representing the known proteins on the cell surface of Staphylococcus, for the best characteristics of this collection of human sera.

Recently it was reported that serum not only antibodies of class IgG, and IgA can be detected by FcRIII receptor cells PMNs and cause opsonization (Phillips-Quagliata et al., 2000; Shibuya et al., 2000). The main role of antibodies of the IgA class is neutralizaci is, mainly on the surface of mucous membranes. The level of IgA in serum reflects the quality, quantity and specificity of dimeric secretory IgA. For this reason, the collection of sera were analyzed not only for antibodies against Staphylococcus IgG class, but also on the level of IgA. In the ELISA method used highly specific secondary reagents to detect high-affinity antibodies such as IgG and IgA, and avoid IgM. The production of antibodies IgM occurs when the primary humoral adaptive response and leads to the formation of low-affinity antibodies, whereas antibodies of classes IgG and IgA have already been subjected to affinity maturation, and they are of great value in disease control or prevention.

Experimental part

Enzyme-linked immunosorbent assay (ELISA). Cups for ELISA were covered with different antigens (2-10 µg/ml) in coating buffer (sodium carbonate, pH of 9.2).

Serial dilution of sera (100-100000) did in the buffer TBS-BSA. Highly specific (subjected to cross-adsorbirovanny) secondary antibodies against IgG or IgA person, labeled with horseradish peroxidase (HRP)was used according to the manufacturer's recommendations (Southern Biotech, ˜2000×). Complexes of antigen-antibody quantitatively determined by measuring the conversion of substrate (ABTS) to a colored product by the values OD450 nmon the automatic read the next device for ELISA (Wallace Victor 1420). Titers were compared at these dilutions, when storing the linearity of the response (table 1). About 100 serum samples were ranked by reactivity to multiple components of staphylococci and had the highest rank (percentile 90%) were selected for further analysis to identify antigens. Importantly, antibodies against Staphylococcus sera from clinically healthy individuals has been very stable, giving equally high titers using ELISA method to all staphylococcal antigens when measured after 3, 6 and 9 months (data not shown). In contrast, antibodies against S.aureus in patients decrease and then disappear in a couple of weeks after infection (Coloque-Navarro et al., 1998). However, antibodies from patients is very important, as they are a direct proof of the expression in vivo of bacterial antigens tested using ELISA method or identified as immunogenic for screening according to the present invention.

This integrated approach followed in the analysis of antibodies, is unique, and it led to the unambiguous identification of hyperimmune antistaphylococcal sera.

Purification of antibodies for genomic screening. We selected 5 sera from groups of patients and groups of uninfected individuals on the basis of the General titer against staphylococci. Antibodies against E. coli proteins were removed by either John is ubali inactivated by heating the sera with whole cells of E. coli (DH5a, transformed pHIE11, cultured in the same conditions as for bacterial display), or by affinity chromatography of lysates for E. coli ribosomal display. Highly enriched preparations of IgG was obtained from a pool depleted serum was obtained by the method of affinity chromatography on protein G according to the manufacturer's instructions (UltraLink Immobilized Protein G firm Pierce). The IgA antibodies were also obtained by the method of affinity chromatography, using labeled with Biotin antibody to human IgA (Southern Biotech), immobilized on streptavidin-agarose (Gibco BRL). The efficiency of depletion and purification were tested methods DDS-Na-PAG-electrophoresis, Western blotting, ELISA and measurement of protein concentration. For proteomic analysis was not required exhaustion of drugs IgG and IgA, as a secondary reagent provided specificity.

Example 2. The creation of highly random, selected by the frame, libraries of small fragments of genomic DNA of Staphylococcus aureus

Experimental part

Obtaining genomic DNA of Staphylococcus. This method was developed as a modification of the two previously published methods (Sohail, 1998; Batley et al., 1984) and was originally adapted for methicillin-resistant strain COL S.aureus order to obtain genomic DNA of high quality and in large quantities. 500 ml of medium BHI (Brain Heart Infusion) supplemented with tetracycline (5 μg/ml) was inoculable bacter the s with frozen jamb and cultured with aeration and shaking for 18 h at 37° C. then the culture was collected in two portions of 250 ml, centrifuged at 1600 g for 15 min and remove the supernatant. Precipitation of bacteria carefully resuspendable in 26 ml of 0.1 M Tris-HCl, pH 7,6, and centrifuged at 1600 g for 15 min Precipitation resuspendable in 20 ml of 1 mm Tris-HCl, pH to 7.6, 0.1 mm EDTA, and transferred to sterile polypropylene tubes 50 ml In each tube was added 1 ml treated by heating RNase A (10 mg/ml) and 200 units of RNase T1 and thoroughly mixed. Then the tubes were made in 250 ál of lysostaphin (concentrate 10 mg/ml, freshly prepared solution of b/e N2O), thoroughly mixed, and incubated for 10 min at 40°With water bath with constant shaking. After adding 1 ml of 10% VAT-Na, 40 µl of proteinase K (concentrate 25 mg/ml) and 100 µl of pronase (10 mg/ml) test tube several times turned and incubated for 5 min at 40°With water bath with shaking. Then were added to 3.75 ml of 5 M NaCl and 2.5 ml of cetyltrimethylammonium bromide (BECOMING) (10% weight/vol., 4% weight/vol. NaCl) and again incubated the tubes for 10 min at 65°With water bath with shaking. The samples were cooled to room temperature and was extracted with a mixture of PhOH/CHCl3/IAA (25:24:1) and a mixture of CHCl3/IAA (24:1). The aqueous phase was carefully collected and transferred into new sterile tubes 50 ml In each tube was added 1.5 ml of Strataclean resinȢ gently, but thoroughly mixed, and incubated for 1 min at room temperature. The samples were centrifuged and collected the top layers containing the DNA into a new tube 50 ml DNA was besieged at room temperature by adding 0.6 volume of isopropanol, was pulled from the solution with a sterile Pasteur pipette and transferred into tubes containing chilled in ice 80% ethanol. DNA was collected by centrifugation, precipitation with 10-12000 g, dried in air and dissolved in b/d H2O.

Obtain small fragments of genomic DNA. Fragments of genomic DNA were digested mechanically into fragments ranging in size from 150 to 300 BP by treatment with ultrasound (ultrasonic deintegration type Cup-probe Bandelin Sonoplus UV 2200 equipped with a probe W, pulse for 10 seconds at 100% power) or fragments ranging in size from 50 to 70 BP by mild treatment with Dnazol I (Novagen). It was found that sonication gave a much narrower distribution of the fragments by size in the destruction of the DNA fragments in the range of 150-300 BP However, even exposing DNA to an extensive impact hydro-mechanical shear effort induced ultrasonic wave, it was not possible to achieve effective and reproducible decrease the size of the fragments. Therefore, DNA fragments ranging in size from 50 to 70 BP was obtained by mild treatment with Dnazol I used the UYa set for splitting method "shotgun" by Novagen. Tnkase I set diluted 1:20 and perform the splitting in the presence of MnCl2in volume of 60 μl with 20°C for 5 min, providing a double strand cleavage by the enzyme. Reactions were stopped by adding 2 μl of 0.5 M EDTA and evaluate the effectiveness of splitting on 2% TAE-agarose gel. This treatment resulted in complete cleavage of genomic DNA into fragments of about 50-70 BP Then the ends of the fragments twice "small mistake" using DNA polymerase T4 in the presence of 100 μm each of dNTPs, effectively filling in the protruding ends. Fragments directly used for ligation reactions were either frozen at -20°for later use.

Description vectors. Vector pMAL4.1 was constructed on the basis of ran (Hashemzadeh-Bonehi et al., 1998) with the gene for resistance to kanamycin. In addition, he carries the gene β-lactamase (bla)built into the multiple cloning site. Gene bla precedes the sequence of the leader peptide is how it is!, providing efficient secretion across the cytoplasmic membrane. The restriction site SmaI serves for insertion of the library. Ahead (upstream) from the SmaI site is the FseI site, and behind (downstream) - NotI site, which was used to extract the selected fragments. These three restriction site is inserted after the leader sequence is how it is! so that the bla gene is transcribed in a frame MF is tawania -1, resulting in a stop codon is at a distance of 15 BP after the NotI site. Insert +1 BP restores the open reading frame (ORF) for bla so that the produced protein β-lactamase together with the subsequent acquisition of resistance to ampicillin.

Vector pMAL4.31 was constructed on the basis of pASK-IBA (Skerra, 1994) with the replacement of the gene of the p-lactamase gene for resistance to kanamycin. In addition, he carries the gene β-lactamase (bla)built into the multiple cloning site. Before sequence that encodes a Mature β-lactamase, is the sequence of the leader peptide is how it is!, providing efficient secretion across the cytoplasmic membrane. In addition, the sequence of the leader peptide ompA consider the sequence encoding the first 12 amino acids (spacer) Mature β-lactamase, to avoid merging sequences immediately after the cleavage site of the signal by peptidases, as, for example, clusters of positively charged amino acids in this area could reduce or eliminate the translocation through the cytoplasmic membrane (Kajava et al, 2000). The Smal restriction site used for insertion of the library. Ahead (upstream) from the Smal site is the site Fsel, and behind (downstream) - NotI site, which was used to extract the selected fragments. These three restriction site inserted after the follower of the spine, coding the spacer of 12 aminocyclo so that the bla gene is transcribed in the frame read -1, resulting in a stop codon at a distance of 15 BP is after the NotI site. Insert +1 BP restores ORF for bla so that the produced protein β-lactamase together with the natural acquisition of resistance to ampicillin.

Vector pMAL9.1 was constructed by cloning the gene lamB in the multiple cloning site in. After that lamB after amino acids 154 inserted the sequence containing the restriction sites Fsel, Smal and NotI. In this reading frame was chosen so that when the transfer plasmid pMAL9.1 selected frame of the DNA fragments cut by splitting with Fsel and NotI from plasmids pMAL4.1 or pMAL4.31, we get a continuous reading frame for the lamB and the respective insert.

Vector pHIE11 was constructed by cloning fhuA gene in the multiple cloning site in. Then in fhuA after amino acids 405 inserted the sequence containing the FseI restriction enzymes cut sites, XbaI and NotI. In this reading frame was chosen so that when the transfer plasmid pHIE11 selected frame of the DNA fragments cut by splitting with FseI and NotI from plasmids pMAL4.1 or pMAL4.31, we get a continuous reading frame for fhuA and the respective insert. 7

Cloning and analysis of the bib is iteki for selection by the frame read. Fragments of genomic DNA S.aureus ligated into the SmaI site of the vector pMAL4.1 or pMAL4.31. Recombinant DNA was introduced by electroporation in electrocompetent cells E. coli DH10B (Gibco BRL)and were sown transformants on LB-agar with kanamycin (50 µg/ml) and ampicillin (50 μg/ml). The cups were incubated over night at 37°and collected colonies to allocate a large amount of DNA. Selected representative Cup and retained for collection of colonies for PCR analysis of colonies and large-scale sequencing. Used a simple PCR analysis of single colonies for preliminary gross estimate of the size of the fragments, as well as the effectiveness of embedding. According to the results of sequencing determined the exact size of the fragments, the integrity of the connection at the place of injection and the correct frame (rule 3n+1).

Cloning and analysis of the library for display on the bacterial surface. Fragments of genomic DNA are cut out of the vector pMAL4.1 or pMAL4.31 that contains the library S.aureus, using restriction enzymes Fsel and NotI. Then the whole population of fragments carried in plasmids pMAL9.1 (LamB) or pHIE11 (FhuA), pre-split FseI and NotI. Using these two restriction enzymes that recognize GC rich sequence in the 8 BP, allows you to save each of the supporting vectors of those reading frames, which were selected in the vector pMAL4.1 or pMAL4.1. Then, the plasmid library was transformed into cells of E. coli DH5a using electroporation. Cells were seeded on large plates with LB-agar and kanamycin (50 μg/ml) and cultured overnight at 37°at a density that allows you to get distinct single colonies. Then the cells were scraped off from the surface of these cups washed fresh LB medium and kept portions at -80°for screening libraries.

Results

Library for selection by the frame read. Created two libraries (LSA50/6 and LSA250/1) in the vector pMLA4.1 with the size of the inserts about 50 and 250 BP, respectively. From both libraries after selection by the frame as a whole was obtained 1-2×106clones when using approximately 1 μg DNA plasmid pMAL4.1 and 50 ng of fragmented genomic DNA S.aureus. To estimate the random nature of the library LSA50/6 was prosecutorial 672 randomly selected clones. Bioinformatic analysis showed that none of these clones was not presented more than once. In addition, it was shown that 90% of the clones fall in a range of sizes from 19 to 70 BP with an average size of 25 BP (figure 2). All 672 clones was performed by the rule 3n+1, indicating that all clones have been the right choice framework.

Library display on the bacterial surface. For the display of peptides on the surface of E. coli had perelistali from the library LSA50/6 from the vector for selection by the frame pMAL4.1 in the display plasmids pMAL9.1 (LamB) or pHIE11 (FhuA). Fragments of genomic DNA cut with restriction enzymes Fsel and NotI and after ligating the 5 ng inserts with 0.1 μg of plasmid DNA received 2-5·106the clones. Clones were scraped off with LB-cups and froze without additional amplification.

Example 3. Identification sequences are highly immunogenic peptides S.aureus using genomic libraries display on the bacterial surface and the person's serum

Experimental part

The screening method of the magnetic sorting of cells (MACS). Approximately 2.5×108cells from a specific library was cultured in 5 ml LB medium with kanamycin (50 µg/ml) for 2 h at 37°C. Expression was induced by adding 1 mm IPTG for 30 min Cells were washed 2 times with fresh LB medium and about 2×107cells resuspendable in 100 µl LB medium and transferred to microprobing (Eppendorf).

To the cells was added 10 μg biotinylated human serum and the suspension incubated overnight at 4°With weak shaking. Added 900 μl of LB medium, the suspension was stirred, and then centrifuged 10 min at 6000 rpm at 4°C. the Cells were washed once with 1 ml LB, and then resuspendable in 100 μl of LB medium. Added 10 μl of beads for MACS, conjugated with streptavidin (Miltenyi Biotech, Germany), and incubation was performed for 20 min at 4°C. After the addition was added 900 μl of LB medium, and the suspension of beads for MACS cells were applied to the equilibrated MS column (Miltenyi Biotech, Germany) attached to a magnet. Column MS balanced by passing 1 ml of 70% EtOH and twice in 2 ml of LB medium.

The column was then washed three times in 3 ml of LB medium. Elution was performed by removing the magnet and passing 2 ml of LB medium. After washing the column 3 ml of LB medium, re-applied 2 ml of the eluate in the same column and repeat the process of washing and elution. The process of applying, washing and elution was repeated and the third time, receiving 2 ml final eluate.

The second round of screening was carried out as follows. Cells from the resulting eluate was collected by centrifugation and resuspendable in 1 ml of LB medium with kanamycin (50 µg/ml). The culture was incubated 90 min at 37°and then induced with 1 mm IPTG for 30 minutes After that, cells were washed in 1 ml of LB medium, and suspended in 10 μl of LB medium. Since the volume has decreased, then added 1 μg biotinylated human serum and the suspension incubated overnight at 4°With weak shaking. All further operations were the same as in the first cycle of selection. The last two cycles of selection, the cells were sown on plates with LB-agar with kanamycin (50 µg/ml) and cultured overnight at 37°C.

The analysis of the selected clones by sequencing and Western blotting. Past breeding clones were cultured overnight at 37°With 3 ml of LB medium with kanamycine (50 μg/ml) for plasmid DNA by standard methods. Sequencing was performed at MWG (Germany) or in collaboration with TIGR (USA).

For Western blotting from about 10 to 20 μg of total cellular protein were separated by the method DDS-Na-PAG-electrophoresis in a 10%gel and transferred to membrane HybondC (Amersham Pharmacia Biotech, England). Merged with LamB or FhuA proteins detektivi using human serum as the primary antibody at a dilution of 1:5000 and conjugated with HRP antibodies against human IgG as secondary antibodies. Detection was performed using a kit for detection based on the enhanced chemiluminescence ECL (Amersham Pharmacia Biotech, England). Alternatively used rabbit antibodies to FhuA or mouse antibodies to the LamB as the primary antibody in combination with the appropriate secondary antibodies conjugated with HRP for detection slit proteins.

Results

Screening libraries of the display on the bacterial surface by the method of magnetic sorting of cells (MACS) using biotinylated human serum. Library LSA50/6 in pMAL9.1 and LSA250/1 RNA were subjected to screening using pooled biotinylated serum of patients (see Example 1 - Getting antibodies from human serum). The process of selection were performed as described under "Experimental". As control was used children's pool sera from infants who were unlikely under ergatis S.aureus infection. In the described conditions are usually selected in 10-50 times more cells using serum of patients than a child's serum (figure 3). To assess the effectiveness of screening chose randomly about 100 past the selection of clones and subjected them to Western-blotting with the same pool of sera of patients. This analysis showed that 30 to 50% past the selection of clones that reacted with antibodies present in the serum of patients, whereas the control strain expressing the LamB or FhuA without S.aureus - specific insert, did not respond to this serum. PCR analysis of single colonies showed that all past breeding clones contained an insert of the expected size range.

Subsequent sequencing of a larger number of randomly selected clones (from 500 to 800 for one screening led to the identification of the gene and the corresponding sequence of the peptide or protein is specifically recognized used for screening the serum of patients. The frequency with which a particular clone is selected when the selection reflects, at least in part, the prevalence and/or the affinity of specific antibodies in the serum used for breeding and recognizes an epitope represented by this clone. In this respect it is surprising that some clones (ORF2264, ORF1951, ORF0222, lipase and IsaA) met up to 90 times, which indicates their high IMM is neginoth. All clones presented in table 2, were tested by the method of Western blotting using extracts of whole cells from a single clone to confirm the specified reactivity with pooled human sera used in the screening.

In addition, it should be noted that most of the genes identified in the screen display on the bacterial surface, encode proteins that are attached to the surface of S.aureus and/or are secreted. This is consistent with the expected role attached to the surface and secreted proteins in virulence S.aureus.

Evaluation of the reactivity of highly immunogenic peptide sequences from different human sera. Used from 10 to 30 different sera of patients to assess the presence of antibodies against selected immunogenic peptide sequences detected by screening according to the present invention. To eliminate possible cross-reaction with proteins expressed by E. coli, all sera were pre-adsorbed with total lysate of E. coli cells DHa expressing the protein FhuA.

The analysis summarized in table 2 and are presented as an example in figure 4, indicating the adequacy of this screening. It also shows that a separate short epitopes could cause the formation of the antibodies is a large number of patients (ORF1618, ORF1632, IsaA, Empbp, protein a). And those peptide sequences that are not recognized by a large set of sera of patients can still be part of a highly immunogenic protein, but you can check this on themselves recombinant proteins in each case.

Example 4. Identification of highly immunogenic peptide sequences from genomic fragments of S.aureus using ribosomal display, and human serum

Experimental part

Screening of ribosomal display. PCR amplified 2,4 ng genomic library S.aureus LSA250/1 pMAL4.1 (described above) using oligonucleotides ICC277 and SS for ribosomal display. Oligonucleotides ICC277 (CGAATAATACGACTCACTATAGGGAGACCACAACGGTTTCCCACTAGTAATAATTT TGTTTAACTTTAAGAAGGAGATATATCCATGCAGACCTTGGCCGGCCTCCC) and ICC202 (GGCCCACCCGTGAAGGTGAGCCGGCGTAAGATGCTTTTCTGTGACTGG) hybridize to the 5'- and 3'-direction from the FseI-NotI insertion site of the plasmid pMAL4.1, respectively. ICC277 enters the promoter RNA polymerase of phage T7, palindrome sequence, forming a loop structure with a stem (stem-loop) at the level of RNA, the binding site of the ribosome (RBS) and the start of the broadcast of the gene 10 of phage T7, including the start codon ATG. Oligonucleotide ICC202 hybridized in the position of the nucleotide 668 open reading frame β-lactamase and also introduces the structure of the loop-and-a-leg on the 3'-end of the resulting RNA. PCR was carried out using a set of High fidelity PCR kit (Roche Diagnostics), spending 25 is of eklow at a temperature of hybridization 50° With and other standard conditions.

The resulting library of PCR products used in 5 consecutive cycles of selection and amplification method ribosomal display, as described previously (Hanes et al., 1997), but with the modifications described below.

One cycle of ribosomal display consisted of the following stages. When in vitro transcription of 2 µg of PCR product using the RiboMax kit (Promega) was about 50 µg RNA. The in vitro translation was carried out for 9 min at 37°in the volume of 22 μl with the addition of 4.4 ál of the mixture Premix Z (250 mm Tris-acetate, pH 7.5, by 1.75 mm of each amino acid, 10 mm ATP, 2.5 mm GTP, 5 mm camp, 150 mm acetylfuran, 2.5 mg/ml E. coli tRNA, 0.1 mg/ml folic acid, 7.5% PEG 8000, 200 mm potassium glutamate, 13,8 mm Mg(Ac)2), 8 μl of S30 extract (× mg/ml) and about 2 μg pool transcribed RNA. The S30 extract was obtained as described (Chen et al., 1983). Then the sample was transferred into a chilled ice tube containing 35,2 μl of a mixture of 10% milk-WBT (Tris-acetate, pH 7.5, 150 mm NaCl, 50 mm Mg(Ac)2, 0,1% Tween-20, 10% milk powder) and 52.8 μl mixture WBTH (as +2.5 mg/ml heparin). Then spent immunoprecipitation by adding 10 μg of purified IgG, inquira for 90 min on ice, and then adding 30 μl of protein G beads MAGmol (Miltenyi Biotech, 90 min on ice). The sample was applied onto a pre-equilibrated column, μ (Miltenyi Biotech) and were let in 5 volumes of ice-cold buffer WBT. the ATEM was applied to the column 20 µl lucynova buffer I (50 mm Tris-acetate, 150 mm NaCl, 20 mm EDTA, 50 μg/ml RNA S.cerevisiae) and incubated for 5 min at 4°C. the Elution was completed by the addition of 2×50 μl EV. mRNA from lirovannomu sample was purified using a kit High pure RNA isolation kit (Roche Diagnostics). Then reverse transcription was performed using containing reverse transcriptase kit Superscript II (Roche Diagnostics) according to the manufacturer's instructions in the presence of 60 pmol of the oligonucleotide ICC202 for 1 h at 50°in a volume of 50 μl. Took 5 µl of this mixture and used for the subsequent PCR reaction with primers ICC202 and ICC277, as described above.

Conducted three cycles of ribosome display, after which the pool of past selection of PCR products cloned in plasmid RNA (described above) after cleavage with restriction endonucleases NotI and Fsel.

Analysis of past selection of clones by sequencing and analysis of peptides using ELISA method. Past breeding clones were cultured overnight at 37°With 3 ml of LB medium with kanamycin (50 µg/ml) for plasmid DNA by standard methods. Sequencing was performed at MWG (Germany) or at the Institute of genome research (TIGR, Rockville, MD, USA). Synthesized peptides corresponding to the inserts, and covered them 96-well plates (Nunc) in 10 mm NaHCO3pH of 9.3, at a concentration of 10 μg/ml (50 μl). After blocking with 1% BSA solution in PBS at 37°With holes made is svedeniya 1:200 and 1:1000 of these sera in 1% BSA/PBS. After washing PBS/0,1% Tween-20 was added labeled with Biotin secondary antibody against human IgG (SBA), which were detected and then adding conjugated with horseradish peroxidase streptavidin according to standard methods.

Results

The above-described genomic library 250 BP (LSA250/1) was used for screening. For selection of antigenic peptides used purified IgG from uninfected adults, but with a high titer against S.aureus, as described above.

Conducted three cycles of selection ribosomal display and amplification according to the "Experimental part", which resulted in the cloning and sequencing of the obtained PCR products.

Analysis of the sequences of a large number (700) taken randomly clones led to the identification of the gene and the corresponding sequence of the peptide or protein is specifically recognized used for screening serum with high titer. The frequency with which a particular clone is selected when the selection reflects, at least in part, the prevalence and/or the affinity of specific antibodies in the serum used for breeding and recognizes an epitope represented by this clone. It is remarkable that some of the clones (ORFs) were found up to 50 times, which indicates their high immunogenicity. Table 2 shows the ORF name, Seq.ID No. and how RA is the clone met for screening according to the invention.

For a number selected by immunoselection ORFs were synthesized peptides corresponding to the identified immunogenic site, and tested by the method of ELISA for reactivity against a pool of sera with which they were identified, and a number of additional sera from patients suffering from infection caused by S.aureus. Two examples on the chart of figure 5 show the caption of the peptides from aureolin and Pls. They are not only hyperimmunisation in respect of a pool of sera with high titers, but also of a number of individual sera of patients. All synthesized peptides corresponding to the selected immunogenic sites, showed reactivity against a pool of sera with high titers, and table 2 shows the number of times the peptides reacted with the individual sera of patients, just as described above.

In addition, it is remarkable that for those ORFS that were identified by the display on the bacterial surface, as described above, very often immunogenic region of this ORF was identical or overlapping with the one that was identified by ribosomal display. This comparison is presented in table 2.

Example 5. Identification of highly immunogenic antigens of S.aureus using serological proteomic analysis

Experimental part

Drugs stand rnostly proteins of S.aureus. contains highly immunogenic antigens. Strains of S.aureus COL (Shafer and landolo, 1979) and agr- (Recsei et al., 1986) were stored in glycerol at -80°With or cups with medium BHI (Difco) at 4°C. a Single colony was used for inoculation night cultures on Wednesday BHI ("standard terms"), or medium RPMI 1640 (Gibco BRL), devoid of iron ("stress conditions") by processing during the night iminodiacetic acid (Sigma). The next day was inoculable fresh medium 1:100 and were cultured bacteria to the value CD600between 0.3 and 0.7. Bacteria were collected by centrifugation and washed with ice-cold PBS. Surface proteins were obtained by processing lysostaphin in isotonic conditions (Lim et al., 1998). Briefly, about 3×109bacteria (assuming that OD600=1 corresponds to approximately 5×107bacteria) resuspendable in 1 ml buffer for splitting, containing 35% raffinose (Aldrich Chemical Company), protease inhibitors (Roche) and 5 units of lysostaphin (Sigma). After incubation for 30 min at 37°With the protoplasts gently besieged by centrifugation at low speed. Under this treatment in the supernatant released surface proteins covalently associated with pentaglycine bridge of the peptidoglycan cell wall (see Crossley, 1997). Proteins on the cell surface or planted with a mixture of methanol/chloroform (Wessel, 1984), or concentrated in the centrifuge tubes with filters is (Millipore). Protein samples were frozen and kept at -80°With or dissolved in the sample buffer and immediately used for isoelectric focusing (IEF) (Pasquali et al., 1997).

Serological proteomic analysis of drugs of surface proteins of S.aureus. Samples were received from: a) S.aureus/agr grown in "stressful conditions", b) S.aureus/COL grown in the "standard conditions", and (C) S.aureus/COL grown in "stressful conditions". Drawing on strips of length 17 cm, containing immobilized pH gradients was carried out according to the "in-gel reswelling procedure" (Pasquali et al., 1997). On gel blotting was applied 100-800 µg protein on preparative gels - 400-1000 µg of protein. Isoelectric focusing and DDS-Na-PAG-electrophoresis (gradient gels 9-16%) was performed as described (Pasquali et al., 1997). For Western blotting, proteins were transferred to PVDF membrane (BioRad) by semidry blotting. The transfer efficiency was examined by staining lidocainum. After blocking (PBS/ 0,1% Tween-20/ 10% dry milk for 16 h at 4° (C) the blots were incubated for 2 hours with serum (1:2500-1:100000 in blocking solution, see table 3). After washing the specic binding of IgG serum visualized using peroxidase conjugate goat antibodies to human IgG (1:25 000, Southern Biotech) as secondary antibodies and symptoms using a chemiluminescent substrate (ECL™, Amersham). Representati the economic result is shown in Fig.6. Membranes were washed from antibody treatment in the buffer Laemmli with 2% β-mercaptoethanol for 30 min at 50-65°immediately subjected to reaction with another serum and showed, as described above. This procedure was repeated up to 5 times. The signals occurring during the reaction with sera of patients and/or healthy control donors, but not with children's pool, compared with colored Kumasi (BioRad) preparative gels (example 7). The results of this serological proteomic analysis of drugs of surface proteins of S.aureus are given in table 3.

Sequencing of the protein zones method "peptide fingerprinting MALDI-TOF mass spectrometry and tandem MS/MS. The pieces of gel were alternately washed 3 times in 10 μl of buffer for cleavage (10 mm NH4HCO3/CAN, 1:1). After that, the pieces of gel were first jimali in 10 ál of ACN, and then subjected to repeated swelling by adding 2 μl of proteasome solution (0.05 μg/μl trypsin, Promega, Madison, USA). Cleavage was carried out for 10-12 h at 37°C. For MALDI-TOF-mass spectrometry peptides were extracted from gel pieces 10 μl of buffer for splitting. The supernatant was concentrated using ZipTip™ (Millipore, Bedford, USA), peptides were suirable on target for MALDI using a 0.5 µl of extraction buffer (0.1% of TFA/CAN, 1:1) was added to 0.5 μl of the solution matrix (NASSA in ACN/0.1% of TFA, 1:1). MALDI-TOF-mass-spectrome the Tory conducted on the instrument REFLEX III (Bruker Daltonik, Bremen, Germany)equipped with an ion source SCOUT384. Set the acceleration voltage of 25 kV and the voltage reflection 28,7 kV. The mass range was set from 700 to 4000 Da. Data collection was performed on a SUN Ultra computer using XACQ, version 4.0. Data processing after the analysis was performed using the program for THEM, 4.02 (Bruker Daltonik, Bremen, Germany). The results are shown in tables 3 and 4.

Example 6. Characterization of highly immunogenic proteins of S.aureus

The antigens identified by different methods of screening using drugs IgG and IgA from pre-selected serum, were subjected to further characterization in the following ways :

1. Purified proteins, most preferably in the form of recombinant proteins expressed in E. coli, the expression system of gram-positive bacteria or the translation system in vitro, and investigated their antigenicity using a series of human sera. Proteins were subjected to modification on the basis of bioinformatics analysis: deleted N-terminal sequence representing signal peptides, was also deleted the C-terminal parts, following the anchor sequence to the cell wall, and have introduced additional amino acids as labels for easier cleaning (for example, Strep-tagII, His-tag and the like). Then using a large number of sera using ELISA method was evaluated, what is varodi person contain specific antibodies against a specific protein (see figure 9 as an example). One of the selected antigen is a protein of 895 amino acids, which is called LPXTGV (see table 2 and 4), as it contains the anchor sequence LPXTG cell wall of gram-positive bacteria. It was shown that this motif serves as a cleavage site for sortase - transpeptidase, covalently linking containing motif LPXTG proteins to the peptidoglycan cell wall. LPXTGV also equipped with a typical signal peptide (Fig). The data obtained by ELISA with the use of this protein as a recombinant protein tagged with Strep, shows that he has high immunogenicity (high titers compared to other recombinant proteins) with a high percentage of sera (Fig.9). It is also important that patients with acute infections S.aureus produce significantly more antibodies against LPXTGV than healthy individuals, indicating that this protein is expressed during infection in vivo. Comparing the total titers (ELISA) individual antigenic proteins and selected those that induce high levels of antibodies (strongly immunogenic), most individuals (protein is expressed by most strains). Because of antigenic specificity and quality (class, subtype, functionality or lack thereof) of antibodies against S.aureus produced by individual patients may argirov the th depending on the place of the infection, related chronic diseases (e.g. diabetes) and chronic conditions (for example, vascular catheter), as well as the severity of the immune response of an individual, particular attention was paid to differences between different groups of patients had histories for each serum. In addition, the obtaining of each serum sample of patients was accompanied by the allocation of a pathogenic strain of the patient at the time of receipt of serum.

2. Purified specific antibodies for functional studies. Tried the purity and integrity of the recombinant proteins (e.g., identification of N-terminal Strep-tag at the Western-blotting and compared with staining with silver DDS-Na-PAG-electrophoresis). The antigen was immobilized through the label to obtain the affinity matrix for the purification of specific antibodies from sera with high reactivity. For example, using LPXTGV labeled Strep as a capture antigen, received 20 µg of purified antibody from 125 mg of IgG. According to ELISA, was obtained pure drug, it does not show activity, for example, against the LTA and against peptidoglycan (which predominate in nefrackzionirovannam IgG). Then the antibodies used for testing localization on the cell surface methods FACS and fluorescence microscopy (figure 10).

3. The prevalence of genes in clincheck the x isolates. Ideal antigen for vaccine must be present in all or the vast majority of strains of the organism against whom the vaccine. In order to establish how widespread the genes encoding the identified antigens S.aureus, in various strains of S.aureus, PCR was performed on a series of independent isolates of S.aureus with primers specific for the desired gene. The S.aureus isolates were obtained from patients with various infections caused by S.aureus. In addition, collected and analyzed several isolates from the nasal cavity of healthy carriers and several laboratory strains. These strains were identified by the polymorphism of the lengths of restriction fragments (RFLP) genes spa and SOA (Goh et al., 1992; Frenay et al., 1994; vanden Bergh et al., 1999). From these results it was identified 30 different strains of 24 isolates from patients, 3 isolates from the nasal cavity and 3 laboratory strain. In order to identify the distribution of genes selected antigen, genomic DNA from these 30 strains were subjected to PCR with genespecific primers flanking the selected epitopes (ORF1361: Seq.ID No.187 and 188; ORF2268: Seq.ID No.193 and 194; ORF1951: Seq.ID No.195 and 196; ORF1632: Seq.ID No.181 and 182; ORF0766: Seq.ID No.183 and 184; ORF0576: Seq.ID No.185 and 186; ORF0222: Seq.ID No.189 and 190; ORF0360: Seq.ID No.191 and 192). PCR products were analyzed by gel electrophoresis to identify the correct products designed size. ORF 1361, 2268, 1951, 1632, 0766 0222 and found a% of tested strains and ORF0576 97%. However ORF0360 met only 71% of the strains. Thus, ORFs 1361, 2268, 1951, 1632, 0766, 0576 and 0222 meet the demand distribution among isolates of S.aureus.

These antigens or antigenic fragments, in particular the identified fragments) are particularly preferred for use in the vaccination program against S.aureus.

4. Identification of "promiscuous" (promiscuous) T-helper epitopes for HLA class II ORF selected antigens

Open reading frames (ORFS)corresponding to the antigens identified by their recognition by antibodies in human serum, likely also contain linear T-cell epitopes. In particular, an unexpected discovery in the process of the invention that even healthy, uninfected, non-colonized persons are extremely high antibody titers (>100000 for some antigens, see Example 5), which are stable for >1 year (see Example 1), indicates the existence of a T-dependent memory, which is likely to be mediated by T-helper cells CD4+. Determination of molecules carrying the corresponding T-helper epitopes for HLA class II, it is useful for the development of synthetic vaccines against Staphylococcus, which could induce immunological memory. In this regard, T-helper epitopes from staphylococcal antigens provide "p is dstvennogo help" In-cell response to these antigens or their fragments. Moreover, it is possible to use these T-helper epitopes for the induction of memory to T-independent antigens, for example, carbohydrates (combined vaccine). On the other hand, inside the cells of staphylococci can eliminirovat cytotoxic T-cells CD8+, which recognize epitopes, restrictively in Association with HLA class I.

T-cell epitopes can be predicted using a variety of algorithms are in the public domain: http://bimas.dcrt.nih.gov/molbio/hla.bind/ (Parker et al. 1994), http://134.2.96.221/script/MHCServer.dll/home.htm (Rammensee at al. 1999), http://mypage.ihost.com/usinet.hamme76/ (Sturniolo et al. 1999). The last of these predictive algorithms makes it possible to identify a "promiscuous" T-helper epitopes, i.e. peptides that bind to several molecules HLA class II. In order to identify very "promiscuous" T-helper epitopes in staphylococcal antigens were analyzed ORF corresponding to Seq ID 64 (IsaA), Seq ID 114 (POV2), Seq ID 89 (ORF0222), Seq ID 70 (LPXTGIV), Seq ID 56 (LPXTGV), Seq ID 142 (LPXTGVI), Seq ID 81 (ORF3200), Seq ID 74 (ORF 1951), Seq ID 94 (Empbp), Seq ID 83 (autolysin) and Seq ID 58 (ORF2498) using software package TEPITOPE http://mypage.ihost.com/usi-net.hamme76/ (Sturniolo et al. 1999). The analysis was carried out on 25 main DR alleles and peptides were selected, if the calculations of their binding was: a) strong (1%threshold) at least 10 of 25 alleles or b) intermediate (3%threshold) at least 17 of 25 alleles.

Were selected (which are patented) the following peptides contains one or more "promiscuous" T-helper epitopes:

Seq ID 56: position. 6-40, 583-598, 620-646, 871-896

Seq ID 58: no peptide does not meet the selection criteria

Seq ID 64: no peptide does not meet the selection criteria

Seq ID 70: position. 24-53

Seq ID 74: position. 240-260

Seq ID 81: position. 1660-1682, 1746-1790

Seq ID 83: position. 1-29, 680-709, 878-902

Seq ID 89: position. 96-136

Seq ID 94: position. 1-29, 226-269, 275-326

Seq ID 114: position. 23-47, 107-156

Seq ID 142: position. 24-53

The corresponding peptides or fragments thereof (e.g., overlapping 15-measures) can be synthesized and tested for their ability to bind to different HLA molecules in vitro. Immunogenicity can be tested, determining the induced peptide (antigen) proliferation of T cells (power-Br-dU, or3H-thymidine) or the secretion of cytokines by them (ELIspot, intracellular staining for cytokines in vitro (Mayer et al., 1996, Schmittel et al., 2000, Sester et al., 2000). In this respect it is of interest to identify the quantitative and qualitative differences in T-cell responses to antigens of Staphylococcus or selected "illegible" peptides or fragments thereof in populations of patients with different staphylococcal infections, as well as comparison colonized with healthy individuals have not been recently any infection or colonization. Moreover, we should expect a correlation between antibody levels and ve is ichino and quality of T-cell responses in these populations. On the other hand, the immunogenicity of the alleged peptides can be tested in transgenic for HLA mice (Sonderstrup et al., 1999).

Similar approaches can be taken to identify restrictively in Association with HLA class I epitopes in antigens of Staphylococcus.

Synthetic peptides corresponding to one or more "promiscuous" T-helper epitopes S.aureus

Were synthesized overlapping peptides covering these areas Seq ID 56 (LPXTGV), Seq ID 70 (LPXTGIV), Seq ID 74 (ORF1hom1), Seq ID 81 (EM_BP), Seq ID 83 (autolysin), Seq ID 89 (ORF1hom2), Seq ID 94 (EMPBP), Seq ID 114 (POV2) and Seq ID 142 (LPXTGVI). The sequence of individual peptides is given in table 5. All peptides were synthesized by Fmoc method, purified by HPLC and analyzed by the method of mass spectrometry. Liofilizovannye peptides were dissolved in DMSO and kept at -20°at a concentration of 5-10 mm.

Binding of synthetic peptides corresponding to "promiscuous" T-helper epitopes with HLA molecules in vitro

Binding of peptides to HLA molecules is a prerequisite for the activation of T cells. Binding was determined in vitro by two independent biochemical methods using soluble recombinant variants of molecules HLA class II. In one method measured dependent on the concentration of competitive displacement of labeled control peptide tested peptides. Central to the e of the second method is the formation of stable to DDS-Na complexes in the binding of high - and sredneotpusknyh ligands. The results obtained by two methods, summarized in table 5.

Soluble HLA molecules (DRA1*0101/DRB 1*0101 and DRA1*0101/DRB1*0401) expressed in cells SC-2 and was purified as described in Aichinger et al, 1997. For competitive binding (Hammer et al., 1995) HLA molecules were made in the amount of from 50 to 200 ng/well. For DRB1*0101 used biotinylated indicator peptide (PKYVKQNTLKLAT, Valli et al., 1993) at a concentration of 0,008 mm. For DRB 1*0401 used biotinylated indicator peptide UD4 (YPKFVKQNTLKAA, Valli et al., 1993) in a concentration of from 0.03 to 0.06 μm. The tested peptides used in serial dilutions from 0.02 nm to 200 μm. Molecules, indicator and test peptides were incubated over night at 37°C, pH 7. Complexes of HLA: peptide formed after incubation with serial dilutions of test and control peptides (as positive control used is known for its high affinity peptides ON and UD4), recorded on cups for ELISA coated with antibody L243, which recognizes a conformational epitope formed only by properly connected heterodimers. Bound Biotin was measured by a standard colorimetric method using conjugate streptavidin-alkaline phosphatase (Dako), using as substrate tablets NBT/BCIP (Sigma) and measuring the OD values for the automatic reading device Victor (Wallac).

Evaluation of T-cell response is and "promiscuous" T-helper epitopes by definition IFNg ELIspot method

After antigenic stimulation begins proliferation of T-cells and secretion of cytokines by them, such as γ-interferon (IFNg). T-cells that specifically recognize epitopes in antigens S.aureus, revealed by definition IFNg ELIspot method (Schmittel et al., 2000). Cells RVMS were isolated from healthy individuals with a strong IgG response against S.aureus from 50-100 ml of venous blood by centrifugation in a density gradient ficoll and used after freezing and thawing. Cells were planted in 96-well plates (200,000 cells/well). Peptides were added in the form of mixtures corresponding to individual antigens, in all cases at 10 μg/ml. Concanavalin A (Amersham) and PPD (purified protein product of tuberculin, Statens Serum Institute) served as positive controls, and the environment without peptide negative control. After incubation overnight in a 96-well filtration tablets, Multi Screen (Millipore)coated with a monoclonal antibody 140 against human IFNg (Bender Med Systems), the results of the ELIspot analysis showed using biotinylated monoclonal antibodies V-VT against human IFNg (Bender Med Systems), conjugate streptavidin-alkaline phosphatase (Daco) and substrate of alkaline phosphatase BCIP/NBT (Sigma). Spots were counted by an automatic reading device Bioreader (BioSys). The number of spots in the wells with cells incubated only with medium (negative control, the usual less than 10 spots per 100,000 cells), took the background and subtracted from the number of spots in the wells with peptides.

5. Antigens can enter mice and measure antibodies against these proteins.

6. Protective capacity of antibodies induced by antigens in vaccination can be assessed in animal models.

Methods 5 and 6 are well accessible to specialists in this field.

Example 7. The application

A) an Effective vaccine is great potential for patients facing electoral surgery in General, and those who enter vascular catheters, in particular. Patients with chronic diseases which decrease the immune response, and those who are subjected to continuous the peritoneal dialysis outpatient, should also benefit from the vaccine against S.aureus with the use of immunogenic antigens of the present invention. Identification of relevant antigens will help to ensure effective passive immunization therapy humanitarianism monoclonal antibodies), which can replace the introduction of human immunoglobulin with all its dangerous side effects. So that an effective vaccine is great potential for patients facing electoral surgery in General, and those who enter the vascular cat is Thera, in particular.

S.aureus can cause many different diseases:

1) sepsis, bacteremia,

2) those who undergo hemodialysis - bacteremia, sepsis,

3) in those exposed to the peritoneal dialysis is peritonitis,

4) in patients with vascular catheters (heart surgery, etc.) - endocarditis, bacteremia, sepsis,

5) in orthopedic patients with prosthetic - septic arthritis,

6) preventive vaccination of the entire population.

B) Preventive and therapeutic vaccination, with special emphasis on T-cells in the latter. Its purpose is to induce a strong T-helper response in vaccination to achieve an effective humoral response and immunological memory. There is currently no direct evidence that T cells play an important role in the elimination caused by S.aureus infections, however, this issue has not yet been adequately investigated. In an effective humoral response to protein antigens must participate T-helpers, and they are necessary for the emergence of memory. "Naive" CD4+ they undergo differentiation into Th1 cells or Th2. Because the innate immunological response (cytokines) affect this choice, the participation of T cells may be different during acute, serious infections compared with immunization of healthy individuals subunit vaccines that do not contain the component is in, violating the immune response during natural infection. The choice between induction of Th1 or Th2 has profound implications. The Th1 cells is called cell-mediated immunity, whereas Th2 cells provide humoral immunity.

C) Preventive and therapeutic vaccines

Prevention: active vaccination or passive immunization in high-risk groups, before infection

Treatment: passive vaccination of already sick

Active vaccination to eliminate intranasal carriage

A specific example of the application

Eliminating carriage of methicillin-resistant S.aureus (MRSA) and prevention of colonization of the medical staff

Carriage of S.aureus in the nostrils people outside the hospital ranges from 10 to 40%. Patients of hospitals and personnel carrier even higher. It is particularly high in patients undergoing hemodialysis, and in diabetics, drug addicts and patients with a variety of dermatological diseases. The greatest risk of Contracting MRSA patients are large hospitals of the third step, especially the elderly and imunokompromitovane, in the intensive care unit, patients with burns, with operating wounds and patients with intravenous catheters.

Obtained by the method of ELISA data clearly demonstrate the existence of a pronounced IgA response to S.aureus, which is not detected or unknown the ten in the literature. Because the predominant immune response of the mucous membranes is in the production of IgA with neutralizing activity, it is clear that staphylococcal epitopes and antigens identified using highly purified preparations IgA, lead to an effective vaccine for mucous membranes.

Direct testimony: all in danger in those departments where the operations are conducted (especially orthopedic, trauma, General surgery).

- Clearly defined group of the population for vaccination (doctors and nurses).

- Health care workers, identified as intranasal carriers of epidemic strains of S.aureus, currently treated with mupirocin and rifampicin to eliminate bacteria. Sometimes the treatment is ineffective, and it takes time.

- Availability of animal models: there are a murine model of intranasal carriage.

Table 1.

Titers of sera from uninfected individuals according to ELISA to several staphylococcal proteins
no savor.BHI lysateLTAPGClfAD1+D3FnBPAsdrEsdrCHEBenolaseLP309LP342coagulFibSrtAClB Map-w
1
2228463
373113222374
41***1***16223626, 783413
5
645
7677547
888578, 9
94, 5, 64556313, 415, 6
105, 6
1166
124, 5
1352
14
15352, 356788, 9
166
17
186, 7134
191
20
2122
22
234, 5, 65362746, 776, 722
24468, 9
255
2687
27844, 54, 55
28
291
30
31111
324
338445
347, 82216, 761
354, 5, 682, 351***34
363
3777, 83
3883, 4
39
4076, 734, 58, 9

Table 1. Titers of sera from uninfected individuals according to ELISA to several staphylococcal proteins

The levels of antibodies against staphylococci were measured separately by the standard ELISA method using total lysate of S.aureus cells, cultured in the medium BHI, lipoteichoic acid (LTA), peptidoglycan (PG), 13 recombinant proteins representing proteins on the cell surface and secreted proteins, such as the clumping factors a and b (ClfA, ClfB), fibronectin-binding protein a (FnBPA), proteins SD repeats (sdrC, sdrE), protein-similar to MHC class II (Map-w), elastin-binding protein (HEB), enolase (reported it localization cell surface and immunogenicity), lipoproteins transport of iron (LP309, LP342), sortase (srtA), coagulase (coagul), extracellular fibrinogen-binding protein (fib). As antigens were included and two short synthetic peptide, representing 2 of 5 immunodominant domains D-repeats FnBPA (D1+D3). Individual sera were ranked in accordance with the titer of IgG on a 9-point scale. 1 corresponds to the serum with the highest titer, and 8 and 9 correspond to sera, who received the 8-th and 9-th place from all serum samples tested for this antigen. This led to the selection of sera from the top 20 percentile (8-9 out of 40). On the basis of the number of points from 1 to 8 were selected 5 best serums", that is the most hyperreactive in respect of antibodies to Staphylococcus aureus. Asterisks (***) indicate that the reactivity of antibodies to this antigen was particularly high, exceeding more than 2 times the number of ELISA-units relative to the 2nd on the reactivity of serum.

Table 2A. Immunogenic proteins of S.aureus, identified by the methods of display on the bacterial surface and ribosomal display

The display on bacterial surfaces: A, library LSA250/1 in fhuA with the sera of patients 1 (655); In the library LSA50/6 in lamB serum of patients 1 (484); (C, library LSA250/1 in fhuA with sera immunocompromising 1 (571); (E, library LSA50/6 in lamB serum immunocompromising 2 (454); F, is the world LSA50/6 in lamB serum of patients P1 (1105); G, library LSA50/6 in lamB serum immunocompromising 1 (471); N library LSA250/1 in fhuA with the sera of patients 1 (IgA, 708). Ribosomal display: D, library LSA250/1 in fhuA with sera immunocompromising (1686). *identified in 18 of the 33 screening and therefore withdrawn from screening; **, prediction of antigenic sequences longer than 5 amino acids was performed with the program ANTIGENIC (Kolaskar and Tongaonkar, 1990); #identical to a sequence present 2 times in ORF; ##, the clone is not represented in the database (sequence not from TIGR).

Table 2b. Additional immunogenic proteins of S.aureus, identified by the methods of display on the bacterial surface and ribosomal display

The display on bacterial surfaces: A, library LSA250/1 in fhuA with the sera of patients 1 (655); In the library LSA50/6 in lamB serum of patients 1 (484); (C, library LSA250/1 in fhuA with sera immunocompromising 1 (571); (E, library LSA50/6 in lamB serum immunocompromising 2 (454); F, library LSA50/6 in lamB serum of patients P1 (1105); G, library LSA50/6 in lamB serum immunocomp oneiromancy 1 (471); N., library LSA250/1 in fhuA with the sera of patients 1 (IgA, 708). Ribosomal display: D, library LSA250/1 in fhuA with sera immunocompromising (1686). **, prediction of antigenic sequences longer than 5 amino acids was performed with the program ANTIGENIC (Kolaskar and Tongaonkar, 1990). ORF, open reading frame; CRF, frame readout on the complementary chain; ARF, alternative reading frame.

Table 2C. Immunogenic proteins S.epidermidis, identified by the methods of display on the bacterial surface and ribosomal display

The display on bacterial surfaces: A, library LSE150 in fhuA with the sera of patients 2 (957); In the library LSE70 in lamB serum of patients 2 (1420); From the library LSE70 in lamB serum of patients 1 (551). Ribosomal display: D, library LSE150 in pMAL4.31 serum P2 (1235). **, prediction of antigenic sequences longer than 5 amino acids was performed with the program ANTIGENIC (Kolaskar and Tongaonkar, 1990). ORF, open reading frame; ARF, alternative reading frame; CRF, frame readout on the complementary chain.

Table 2d. Immunogenic proteins of S.aureus, identified by the methods of display on the bacterial surface and ribosomal display (new annotation)

The display on bacterial surfaces: A, library LSA250/1 in fhuA with the sera of patients 1 (655); In the library LSA50/6 in lamB serum of patients 1 (484); (C, library LSA250/1 in fhuA with sera immunocompromising 1 (571); (E, library LSA50/6 in lamB serum immunocompromising 2 (454);

F, library LSA50/6 in lamB serum of patients P1 (1105); G, library LSA50/6 in lamB serum immunocompromising 1 (471). Ribosomal display: D, library LSA250/1 in fhuA with sera immunocompromising (1686). **, prediction of antigenic sequences longer than 5 amino acids was performed with the program ANTIGENIC (Kolaskar and Tongaonkar, 1990); #identical to a sequence present 2 times in ORF.

Table 3.

Serological proteomic analysis of surface proteins of S.aureus using human serum

a) S.aureus/agr, "stress conditions"
Spot/serumIC40 1:20000IC35, N26, C4 all 1:50 000Children's pool C2, 5, 6, 10, 12 1:10000N22 1:10000 IC40 1:50000
RSK++-+
RSK++++-+++
RSK-(+)-+
RSK++-+
Spot/serumIC35, 40 1:50000 N22 1:10000P-pool (P6, 18, 25, 28, 29) all 1:50000Children's pool C2, 5, 6, 10, 12 1:10000
RAS++++-
RAS+++++-
RAS-+-
RAS-++-
Spot/serumR-the str (P6, 18, 25, 28, 29) all 1:50000Children-14 1:10000IC-nyn/IgG (N26, IC34, 35) all 1:30000IC-nyn/IgA(N26, IC34, 35) all 1:30000
RAS++-++++
RAS++-++++
RAS---++
RAS--++
RAS--++++++
RAS+-++
RAS+-++
RAS++---
RAS--++++
RAS++---
POV31+++- --
POV32+---
POV33+---
POV34+---
POV35+---
POV36+---
POV37++---
POV38++---
POV39+++---
POV40+++---

b) S.aureus/COL, "standard conditions"

Spot/serumIC-pool (N26, IC34, 35) all 1:30000IC35 1:20000P18 1:10000P25 1:10000P1 1:5000R29 1:2000Children 18 1:10000
POV2+++++++++++++++--
POV3.1+++++++++++++++--
POV3.2+++++++++++++++--
POV4++++-----
POV7--+++----
POV10-++(+)(+)-(+)-
POV12-----+++-
POV13+++++++++++++++-
POV14++++++++++++++-
POV15++-+(+)--

c) S.aureus/COL, "stress conditions"/p>

Spot/serumP-pool (P6, 18, 25, 28, 29) all 1:50000IC34+IC35 both 1:20000P18 1:10000R29 1:10000Children-14 1:10000
POV16-+++---
POV17-+++(+)--
POV18+-++--
POV19(+)-+++--
POV21--+--
POV23-+---
POV24-+---
POV25+----

References

Aichinger, G., Karlsson L., M.R. Jackson, Vestberg, M., Vaughau J.H., Teyton L., Lechler R.I.

and Peterson P A. Major Histocompatibility Complex classll-dependent unfolding, transport and degradation of endogenous proteins. J. Biol. Chem., v.272, 1997, pp. 29127-29136.

Ausubel, F.M., Brent, R., Kingston, R.E., Moore, .D., Seidman, J.G., Smith, J.A. and Struhl, K. Eds. (1994). Current protocols in molecular biology. John Wiley & Sons, Inc. Betley, M.J., Lofdahl, S., Kreiswirth, B.N., Bergdoll, M.S. and Novick, R.P. (1984).

Gets enterotoxin A gene is associated with a variable genetic element. Proc. Hatl. Acad. Sci. U.S.A. 81:5179-5183.

Bruggemann M, Heuberger MS (1996) Immunol. Today 17:391-397/

Burnie, J.P., Matthews, R.C., Carter, T., Beaulieu, E., Donohoe, M., Chapman, C., Williamson, P. and Hodgetts, S.J. (2000). Identification of an immunodominant ABC transporter in methicillinresistant Staphylococcus aureus infections. Infect. Immun. 68:3200-3209.

Chen, H.Z. and Zubay, G. (1983). Methods Enzymol. 101:674-690.

Coloque-Navarro, P., Söderquist, C., Holmberg, H., Blomqvist, L., Olcen, P., and Möllby, R.

(1998) Antibody response in Staphylococcus aureus septicaemia - a prospective study. J. Med. Microbiol.47, 217-25.

Crossley, K.B. and G.L. Archer, eds. (1997). The Susceptible in Human Disease. Churchill Livingston Inc.

Flock, J.-I. (1999). Increasing interest among-matrix-binding proteins as targets for the prevention of Staphylococcus aureus infections. Molecular Medicine Today 5:532-537.

Forrer, P., Jung, S. and Pluckthun, A. (1999). Beyond binding: using phage display to select for structure, folding and enzymatic activity in proteins. Curr. Opin. Struct. Biol. 9:514-520.

Foster, T.J. and Hook, M. (1998). Surface protein adhesins of Staphylococcus aureus. Trends Environ. 6:484-488.

Frenay, H.M.E., Theelen, J.P.G., Schouls, L.M., Vandenbroucke-Grauls, C.M.J.E., Vernoef, J., van Leeuwen, W.J., and Mooi, F.R. (1994). Discrimination of epidemic and nonepidemic methicillin-resistant Staphylococcus aureus on the basis of protein A gene polymorphism. J. Clin. Environ. 32:846-847.

Georgiou, G., Stathopoulos, C., Daugherty, P.S., Nayak, A.R., Iverson, B.L. and Curtiss III, R. (1997). Display of heterologous proteins on the surface of microorganisms: From the screening of combinatorial libraries to live recombinant vaccines. Nature Biotechnology 15:29-34.

Goh, S.-H., Byrne, S.K., Zhang, J.L., and Chow, A.W. (1992). Molecular typing of Staphylococcus aureus on the basis of coagulase gene polymorphisms. J. Clin. Environ. 30:1642-1645.

Graziano et al. (1995) J. Immunol. 155:4996-5002.

Hammer et al. J. Exp. Med (1995) 181: 1847-1855.

Hanes, J. and Pluckthun, A. (1997). In vitro selection and evolution of functional proteins by using ribosome display. PNAS 94:4937-4942.

Hashemzadeh-Bonehi, L., Mehraein-Ghomi, F., Mitsopoulos, C., Jacob, J.P., Hennessey, E.S. and Broome-Smith, J.K., (1998). Importance of using lac rather than ara promoter vectors for modulating the levels of toxic gene products in Escherichia coli. Mol. Environ. 30:676-678.

Hryniewicz, W. (1999). Epidemiology of MRSA. Infection 27:S13-16.

Immler, D., Gremm, D., Kirsch, D., Spengler, B., Presek, P., Meyer, H.E. (1998). Electrophoresis 19:1015-1023.

Kajava, A.V., Zolov, S.H., Kalinin, A.E. and Hesmeyanova, M.A. (2000). The net charge of the first 18 residues of the mature sequence affects protein translocation across the cytoplasmic membrane of Gram-negative bacteria. J. Bacteriol. 182:2163-2169.

Kluytmans, J., van Belkum, A. and Verbrugh, H. (1997). Nasal carriage of Staphylococcus aureus: epidemiology, underlying mechanisms, and associated risks. Clin. Environ. Rev. 10:505-520.

Kolaskar, A.S. and Tongaonkar, P.C. (1990}. A semi-empirical method for prediction of antigenic determinants on protein antigens. FEBS Lett. 276:172-174.

Lim, Y., Shin, S.H., Jang, I.Y., Rhee, J.H. and Kirn, I.S. (1998). Human transferring-binding protein of Staphylococcus aureus is immunogenic in vivo and has an an epitope in common with human transferring receptor. FEMS Environ. Letters 166:225-230.

Lorenz, U., Ohlsen, K., Karch, H., Hecker, M., Thiede, A. and Hacker, J. (2000). Human antibody response during sepsis against targets expressed by methicillin resistant Staphylococcus aureus. FEMS Immunol. Med. Environ. 29:145-153.

Mamo, W., Jonsson, P. and Muller, H.P. (1995). Opsonization of Staphylococcus aureus with a fibronectin-binding protein antiserum dosage protection in mice. Microb. Pathog. 19:49-55.

McGuiness W et al. (1996) Nature Biotech. 14:1149.

Modun, B., Evans, R.W., Joannou, C.L. and Williams, P. (1998). Receptor-mediated recognition and uptake of iron from human transferring by Staphylococcus aureus and Staphylococcus epidermidis. Infect. Immun. 66:3591-3596.

Hilsson, I., Patti, J.M., Bremell, T., Höök, M. and Takowski, A. (1998). Vaccination with a Recombinant Fragment of Collagen Adhesin provides Protection against Staphylococcus aureus-mediated Septic Death. J. Clin. Invest. 101:2640-2649.

Parker, K.C., M.A. Bednarek, and J.E. Coligan (1994) Scheme for ranking potential HLA-A2 binding peptides based on independent binding of individual peptide side-chains. J. Immunol. 152:163.

Pasquali, C., Fialka, I. & Huber, L.A. (1997). Electrophoresis 18:2573-2581.

Phillips-Quagliata, J.M, Patel, S., Han, J.K., Arakelov, S., Rao, T.D., Shulman, M.J., Fazel, S., Corley, R.B., Everett, M., Klein, M.H., Underdown, B.J. and Corthesy, B. (2000). The IgA/IgM receptor expressed on a murine cell lymphoma is poly-Ig receptor. J. Immunol. 165:2544-2555.

Rammensee, Hans-Georg, Jutta Bachmann, Niels Nikolaus Ernmerich., Oskar Alexander Bachor, Stefan Stevanovic (1999) SYFPEITHI: database for MHC ligands and peptide motifs. Immunogenetics 50:213-219.

Recsei, P., Kreiswirth, B., O'reilly, M., Schlievert, P., Gruss, A. and Novick, R.P. (1986).

Regulation of exoprotein gene expression in. Staphylococcus aureus by agr. Mol. Gen. Genet.

202:58-61.

Rodi, D.J. and Makowski, L. (1999). Phage-display technology-finding a needle in a vast molecular haystack. Curr. Opin. Biotechnol. 10:87-93.

Schaffitzel et al., Ribosome display: an in vitro method for selection and evolution of antibodies from libraries; Journal of lmmunological Methods 231, 119-135 (1999).

Sanchez-Campillo, M., Bini, L., Comanducci, M., Raggiaschi, R., Marzocchi, W., Pallini, V., and Ratti, G. (1999). Electrophoresis 20:2269-2279.

Schmittel a, Keilholz U., Thiel e, Scheibenbogen C. (2000) Quantification of tumor-specific T lymphocytes with the ELISPOT assay. J Immunother 23(3):289-95.

Sester m, Sester u, Kohler H., T. Schneider, L. Deml, Wagner R., Mueller-Lantzsch N., Pees HW, Meyerhans, A. (2000) Rapid whole blood analysis of virus-specific CD4 and CD8 T cell responses in persistent HIV infection. AIDS 14(17):2653-60.

Shafer, W.M. and landolo, J.J. (1979). Genetics of gets enterotoxin In methicillin-resistant isolates of Staphylococcus aureus. Infect. Immun. 25:902-911.

Shibuya, A., Sakamoto, N., Shimizu, Y., Shibuya K., Osawa, M., Hiroyama T., Eyre, H.J., Sutherland G.R., Endo, Y., Fujita, T., Miyabyashi So, Sakano, S., Tsuji, T., Nakayama, E., Phillips, J.H., Lanier, L.L. and Nakauchi, H. (2000). Fca/qreceptor mediates endocytosis of IgM-coated microbes. Nature Immunology 1:441-446.

Skerra, A. (1994). Use of the tetracycline promoter for the tightly regulated production of a murine antibody fragment in Escherichia coli. Gene 151:131-135. Sohail, M. (1993). A simple and rapid method for preparing genomic DNA from Gram-positive bacteria. Mol. Biotech. 10:191-193.

Sonderstrup G, Cope AP, Patel S, Congia M, Hain N, Hall FC, Parry SL, Fugger LH, Michie S, McDevitt HO (1999) HLA class II transgenic mice: models of the human CD4+ T-cell immune response. Immunol Rev 172:335-43.

Stumiolo, T. et al., E Bono, Ding J, L Raddrizzani, 0. Tuereci, Sahin U, Braxenthaler M, Gallazzi F, Protti MP, Sinigaglia F, and J Hammer (1999) Generation of tissue-specific and promiscuous HLA ligand databases using DNA chips and virtual HLA class II matrices. Nature Biotechnology 17:555-562.

Valli et al. J. Clin. Invest. (1993) 91: 616-62.

Vandenbergh M.F.Q., Yzerman E.P.F., van Belkum, A., Boelens, H.A. M., Sijmons, M., and Verbrugh, H.A. (1999). Follow-up of Staphylococcus aureus nasal carriage after 8 years: redining the persistent carrier state. J. Clin. Environ. 37:3133-3140.

Wessel, D. and Fluegge, figure U.I. (1984). Anal. Biochem. 138:141-143.

1. The method of identification, isolation and hyperimmune reactive serum antigen from a pathogen, and these antigens are suitable for use in a vaccine designed for certain types of animals or humans, characterized by the following stages: obtaining a preparation of antibodies from pooled plasma of this type of animal or pooled human plasma or individual sera with antibodies against that particular pathogen, obtaining at least one expression library display on the bacterial surface the displacement of a particular pathogen, the screening of this at least one expression library display on the bacterial surface using the specified drug antibodies, identification of antigens that bind by screening with antibodies in the specified drug antibodies, screening of the identified antigens with individual antibody preparations from individual sera from individuals with antibodies against that particular pathogen identification hyperimmune reactive serum antigen part of the identified antigens, where these hyperimmune reactive serum antigens associated with the relevant part of the above mentioned individual antibody preparations from individual sera, and if necessary, the allocation of hyperimmune reactive serum antigen and receive chemical or recombinant means, provided that these individual sera receive from patients with antibody titer to the specified specific pathogen, exceeding the 90 percentile, and the IgG titer above 10,000 units

2. The method of identification, isolation and almost a full set of hyperimmune reactive serum antigen specific pathogen, and these antigens are suitable for use in a vaccine designed for certain types of animals or humans, characterizes is by the following stages: obtaining a preparation of antibodies from pooled plasma of this type of animal or pooled human plasma or individual sera with antibodies against that particular pathogen, obtaining at least three different expression libraries of this particular pathogen, and at least one expression library display on the bacterial surface, the screening data of at least three different expression libraries using the specified drug antibodies, identification of antigens that bind at least at one of said at least three screening with antibodies in the specified drug antibodies, screening of the identified antigens with individual antibody preparations from individual sera from individuals with antibodies against the indicated specific pathogen identification hyperimmune reactive serum antigen part of the identified antigens, where these hyperimmune reactive serum antigens contact the relevant part of the above mentioned individual antibody preparations from individual sera, the repetition of the stages of the screening and identification of at least one more time, comparing hyperimmune reactive serum antigen identified by repeating the stages of screening and identification, hyperimmune reactive serum antigen, identified at the initial stages of the screening and identification of further repetition of the stages of screening and identify the purpose, if only at the stage of re-screening and identification were identified at least 5% hyperimmune reactive serum antigen, up until the next repetition of the stages will be identified less than 5% hyperimmune reactive serum antigen, for a complete set of hyperimmune reactive serum antigen specific pathogen, and if necessary, the allocation of these hyperimmune reactive serum antigen and receive chemical or recombinant means, provided that these individual sera receive from patients with antibody titer to the specified specific pathogen, exceeding the 90 percentile, and the IgG titer above 10,000 units

3. The method according to claim 1 or 2, characterized in that conduct screening using at least one expression library, which is selected from a library of ribosomal display, and proteome.

4. The method according to claim 2, characterized in that the said at least three different gene-expression library presents at least the library ribosomal display library display on the bacterial surface and the proteome.

5. The method according to any one of claims 1 to 4, characterized in that a pool of plasma is a pool of human plasma obtained from individuals undergoing or suffering the x infection induced by the specified pathogen.

6. The method according to any one of claims 1 to 5, characterized in that the expression library are genomic expression libraries specified by the pathogen.

7. The method according to any one of claims 1 to 6, characterized in that the expression library are complete genomic expression libraries, which preferably have not less than 2-fold redundancy, more preferably not less than 5-fold, particularly at least 10-fold.

8. The method according to any of claim 2 to 7, characterized in that it includes the screening phase, the at least library ribosomal display library display on the bacterial surface and proteome using drug antibodies and identification of antigens that bind at least two, and preferably all screening with antibodies in the preparation of antibodies.

9. The method according to any one of claims 1 to 8, characterized in that the pathogen is selected from the group of bacterial, viral, fungal, and protozoal pathogens.

10. The method according to any one of claims 1 to 9, characterized in that the pathogen is selected from a group of human immunodeficiency virus, hepatitis a virus, hepatitis b virus, hepatitis C virus, rous sarcoma virus, Epstein-Barr, influenza virus, rotavirus, Staphylococcus aureus, Staphylococcus epidermidis, Chlamydia pneumoniae, Chlamydia trachomatis, Mycobacterium tuberculosis, Mycbacterium leprae, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae, Enterococcus faecalis, Bacillus anthracis, Vibrio cholerae, Borrelia burgdorferi, Plasmodium sp., Aspergillus sp. or Candida albicans.

11. The method according to any of claim 2 to 10, characterized in that at least one expression library presents library ribosomal display and hyperimmune reactive serum antigens produced by expression of the coding sequences of these hyperimmune reactive serum antigen contained in the specified library.

12. The method according to any one of claims 1 to 11, characterized in that the above derived antigens reacting with hyperimmune serum, conclude in the pharmaceutical composition, optionally adding a pharmaceutically acceptable carrier and/or excipient.

13. The method according to item 12, characterized in that the pharmaceutical composition is a vaccine.

14. The method according to item 12 or 13, characterized in that the pharmaceutically acceptable carrier and/or the filler is an immunostimulating connection.

15. The method according to 14, characterized in that the immunostimulatory compound is chosen from the group of poly-substances, preferably poly-peptides, immunostimulatory of deoxynucleotides, alum, complete adjuvant's adjuvant, incomplete adjuvant-blockers, neuroactive compounds, especially the hormone human growth, or combinations thereof.

16. The method according to any one of claims 1 to 15, characterized in that the individual antibody preparations come from patients with acute infection caused by these pathogens, with the titer of antibodies to this pathogen, exceeding the 90 percentile, preferably in excess of 95-percentile for the tested serum samples of people - patients or carriers.

17. The method according to any one of claims 1 to 16, characterized in that when identifying hyperimmune reactive serum antigen used at least 10, preferably at least 30, particularly preferably at least 50 individual antibody preparations.

18. The method according to any one of claims 1 to 17, characterized in that the relevant part of the individual antibody preparations from individual sera is at least 10, preferably at least 30, particularly preferably at least 50 individual antibody preparations, and/or at least 20%, preferably at least 30%, especially preferably at least 40% of all individual antibody preparations used in the screening.

19. The method according to any one of claims 1 to 18, characterized in that the individual sera are selected based on their IgA titers against lysate, components of the cell wall or recombinant proteins, specified pathogen, is estimated at more than 4,000 units, preferably more than 6,000 units, and/or titers of IgG, comprising over 12,000 units

20. The method according to any one of claims 1 to 19, characterized in that the specified pathogen is Staphylococcus, especially Staphylococcus aureus and/or Staphylococcus epidermidis.



 

Same patents:

FIELD: medicine, namely immunology, allergology, dermatology, microbiology; veterinary.

SUBSTANCE: claimed method includes providing of control mixture (CM); blood sampling with anticoagulant; providing of mixture for phagocytosis investigation (PhIM) by introducing in tested blood sample preliminary prepared 0.1 % solution of chromogenic reagent, namely tetrasolium nitroblue (NTB) dissolved in 0.9 % sodium chloride solution; PhIM incubation; preparation of smears from incubated followed by determination of amount of formasan-positive phagocytes in percents based on total phagocyte amount and FAF evaluation by comparison obtained values with normal ones. To produce CM part of preliminary prepared NTB solution with volume of at least 0.05 ml is blended with yeast Saccharomyces cerevisiae and obtained CM is held for at least 6 min at temperature of (20±2)°C. Then CM color is analyzed and rest part of NTB solution is used for PhIM preparation only in presence of pink color in CM. Method of present invention makes it possible to increase accuracy of FAF determination by 25-33 %.

EFFECT: method for FAF determination with improved accuracy.

7 cl, 8 tbl

FIELD: medicine, laboratory diagnostics.

SUBSTANCE: one should isolate neutrophilic leukocytes, form immune complexes, measure background luminescence of incubation medium (A), add neutrophils, measure the level of spontaneous chemiluminescence (B), introduce immune complex and detect the value of stimulated chemiluminescence (C), calculate the coefficient of stimulation (CS) and at CS≥0.3 it is possible to diagnose allergic reaction. The innovation provides higher accuracy and specificity in detecting the presence of allergic sensitization to certain antigen, the chance for screening serial assay, excludes additional body sensitization associated with introducing allergens in case of skin sample.

EFFECT: higher accuracy of allergodiagnostics.

1 cl, 5 ex, 6 tbl

FIELD: medicine, laboratory diagnostics.

SUBSTANCE: before prescribing quetiapin, it is necessary to conduct immunological studying in patients and at the content of natural killers (CD16+)0.15x109/l and more, IgA concentration in blood serum being 2.50 g/l and less one should predict positive dynamics of therapy with atypical neuroleptic quetiapin (seroquel). The innovation enables to elaborate prognostic criteria for therapeutic efficiency in schizophrenia-suffering patients with atypical neuroleptic quetiapin (seroquel) and carry out rehabilitation of pharmacological measures purposefully.

EFFECT: higher accuracy and efficiency of prediction.

3 ex, 3 tbl

FIELD: medicine, ophthalmology.

SUBSTANCE: due to the method of immunoenzymatic assay one should detect the content of antiphlogistic IL-1 and TNF- and antiphlogistic IL-4 cytokins in lacrimal liquid and based upon the values obtained one should calculate the index of inflammatory activity (IIA) by the following formula: where CHR - a coefficient of homeostatic reserves of cornea which should be calculated by the following formula: where T0 - the data of corneal thermometry before loading vacuum sample; T1 - the data of corneal thermometry immediately after the sample; T2 - the data of corneal thermometry 30 min after loading vacuum sample and at IIA value ranged 0.9-1.0 one should predict uncomplicated adaptive flow of inflammatory-regenerator processes, at IIA>1.0 one should predict exudative character of inflammatory-regenerator processes at the development of early subepithelial corneal disorders, and at IIA<0.9 one should predict chronic proliferative flow of inflammatory-regenerator processes at developing late subepithelial corneal fibroplasias.

EFFECT: higher quality and accuracy of prediction.

3 ex, 1 tbl

FIELD: medicine, laboratory diagnostics.

SUBSTANCE: before immunotherapy one should detect initial leukocytic level in venous blood, the content of CD3-lymphocytes, the content of serumal IgG and phagocytic index according to the results of immunogram in patients with purulent-septic diseases. In case when patient's phagocytic index is under 54.97%, the content of CD3-lymphocytes is under 1.00*109/l, the content of serumal IgG is above 10.93 g/l, the content of leukocytes in venous blood is above 6.13*109/l application of immunophan should be considered to be useful for the purpose of immunotherapy. If in initial values of immunogram phagocytic index is under 51.19%, the content of CD3-lymphocytes is under 1.17*109/l, the content of serumal IgG is under 14.76 g/l, the content of leukocytes in venous blood is under 5.19*109/l application of licopid should be considered to be useful for the purpose of immunotherapy. The innovation provides the chance for carrying out adequate immunotherapy and optimize application of immunomodulators.

EFFECT: higher efficiency.

3 ex, 3 tbl

FIELD: immunology.

SUBSTANCE: through a flow microcell of 15-20 mcl volume one should pass the flow of phosphate buffer solution-carrier at the rate of about 30-90 mcl/min which should be supplemented with analyzed serumal sample at the volume of 200 mcl. The flow cell is supplied with a horizontally fixed piezogravimetric immunosensor at fluctuation frequency fm and receptor covering based upon one of the LPC Yersinia enterocolitica of serovars O:3, O:5 or O:6.30. Then it is necessary to register the binding LPC Yersinia enterocolitica of serovars O:3, O:5 or O:6.30 with antibodies according to the decrease of sensor's fluctuation frequency from fm up to f to detect the concentration of antibodies according to calibration graph being directly proportional against ▵f being equal to fm-f. Application of the present innovation enables to decrease the procedure of analysis up to 10 min and, also, carry out a re-usable analysis after regeneration of sorbed LPC at sensitivity being 1.3 mcg/ml and detect concentration of antibodies ranged 10-100 mcg/ml.

EFFECT: higher accuracy and efficiency of detection.

8 ex, 1 tbl

FIELD: medicine, laboratory diagnostics.

SUBSTANCE: the present innovation deals with detecting the concentration of antibodies to neurospecific enolase (NSE) and gliofibrillo-acid protein (GFAP) in blood serum of pregnant women. The development of gestosis should be predicted at the level of anti-NSE-antibodies being above 0.6 mcg/ml or anti-GFAP-antibodies being above 0.9 mcg/ml. The innovation provides high information value and specificity of the method suggested to predict the development of gestosis.

EFFECT: higher efficiency.

3 ex, 1 tbl

FIELD: medicine, ophthalmology.

SUBSTANCE: while inspecting a patients with chorioretinitis it is necessary to fulfill immunogenetic typing of peripheral blood lymphocytes by HLA I class (loci A and B). At detecting antigens HLA-A9 and/or A24 and/or B53 one should predict light flow of chorioretinitis, at detecting antigens HLA-B5(B51) and/or B27 - sever flow and at detecting antigens HLA-B22 and/or B56 - highly severe flow of chorioretinitis. The innovation provides improved quality of diagnostics of chorioretinitis due to predicting the severity degree of the disease flow that enables to prevent irreversible retinal alterations and vascular membrane as it is by prescribing adequate therapy in due time.

EFFECT: higher accuracy of prediction.

3 ex, 2 tbl

FIELD: medicine, laboratory diagnostics.

SUBSTANCE: additionally to clinico-anamnestic survey it is necessary to carry out immunoenzymatic assay of a liquor for the content of IL-8, at its level being equal 95 pg/ml and higher one should diagnose hemorrhagic insult, and at IL-8 content being under 95 pg/ml - ischemic insult. The innovation enables to diagnose both ischemic and hemorrhagic insult under inpatient conditions in hospitals during the first days of insult occurred.

EFFECT: higher accuracy of diagnostics.

4 ex, 2 tbl

FIELD: analytical chemistry, immunology.

SUBSTANCE: invention relates to a method for selective determination of nonylphenol that is carried out by using a piezoelectric crystal immunosensor. Sample containing nonylphenol and fixed amount of antibodies raised to its in phosphate buffer (pH = 7.1-7.5) is passed through a flow-type cell comprising mass-sensitive piezoelectric crystal immunosensor with receptor cover based on aminophenol-protein conjugate. Nonylphenol is determined by recording change of the sensor frequency oscillation in interaction of aminophenol-protein conjugate with antibodies to nonylphenol wherein the sensor frequency oscillation change is inversely with the nonylphenol concentration in a sample to be analyzed. Then method involves regeneration of receptor cover for carrying out the following assays by passing 0.02-0.10 mM solution of potassium thiocyanate through a cell. Using the invention provides carrying out multiple selective analysis with the detection limit of nonylphenol 0.8 ng/ml and to determine the concentration of nonylphenol in the range 1-20 ng/ml.

EFFECT: improved assay method.

1 tbl, 13 ex

FIELD: medicine, dermatology.

SUBSTANCE: method involves carrying out the complex therapy by using antibiotic griseofulvin and the immune modulating preparation "Anaferon" for children orally in the dose 1 tablet, 3 times per a day for 14 days. Method provides effectiveness of treatment based on the immune stimulating effect involving activation of cellular immune response for trichophyton antigens and inactivation processes of fungus-pathogen by cell phagocytes and the absence of transformation of infiltrative forms of disease to the suppurative form. Invention can be used in treatment of zooanthroponosis trichophytosis in children.

EFFECT: improved method of treatment, enhanced effectiveness.

6 tbl, 2 ex

FIELD: veterinary science.

SUBSTANCE: the present innovation deals with obtaining secretory immunoglobulin A (S-IgA) applied for evaluating immune status in animals. The method deals with biochemical treatment of animals' biological liquid, separating a target product due to gel-filtration followed by freezing, moreover, biological liquid should be centrifuged at 1000-1700 g for about 15-30 min followed by dialysis against 0.02 M Tris-HCL pH 8.0-8.2 for about 1.5-2.5 h and gel-filtration upon Sephacryl S-400 with 0.015-0.02 M Tris-HCL buffer at pH being 8.0-8.2 and with 0.4-0.9 M sodium chloride due to separating the second fraction of proteins under the control of immunoelectrophoresis at applying antisera to animal proteins, as for the target product it should be obtained due to concentrating the fractions of proteins in polyethylene glycol-40000 to increase the content of immunoglobulin A in the target product by 3-6-fold in comparison to its content in initial biological liquid in animals. The innovation provides higher output and quality of the target product and more accelerated rate of method's implementation.

EFFECT: higher efficiency.

3 ex

FIELD: veterinary science.

SUBSTANCE: on proving the diagnosis one should introduce immune serum of animals-donors for sick calves till clinical recovery at the titers of hemagglutinins to IRT virus being 1:256, to PG-3 virus being 1:1280 and to VD-BC virus being 1:1024, and, additionally, it is necessary to apply a probiotic preparation lactobifadol at 32x108 microbial cells bifido- and 4x107 lactobacteria. The innovation increases the quantity of recovered animals, shortens the terms of therapy and the number of relapses.

EFFECT: higher efficiency of therapy.

2 ex, 3 tbl

FIELD: veterinary science.

SUBSTANCE: one should immunize down-calving cows 1.5 mo before calving with a live, dry culture associated vaccine against paragrippe-3 (PG) and infectious rhinotracheitis in cattle (IRT) and simultaneously it is necessary to introduce Ligfol per 5 ml/animal; in 14 d Ligfol should be introduced once more at the same dosage; for calves born form these cows for 0.5-1 h after the birth it is necessary to introduce Ligfol once intramuscularly at the dosage of 2 ml. The innovation decreases the quantity of diseases and accelerates the recovery in animals.

EFFECT: higher efficiency of immunoprophylaxis.

3 ex, 6 tbl

FIELD: veterinary science.

SUBSTANCE: the present innovation deals with immunization of down-calving cows with a live dry culture associated vaccine against paragrippe-3 (PG) and infectious rhinotracheitis in cattle at the dosage of 2 ml 1.5 mo before calving at simultaneous intramuscular injection of Selecor at the dosage of 10 mcg/kg animal's body weight; in 14 d one should introduce Selecor once more at the same dosage; then Selecor should be once injected intramuscularly for calves born in above-mentioned cows for 0.5-1 h after their birth. The innovation increases colostral cell and humoral immunity in calves, decrease sickness rate and accelerates the recovery.

EFFECT: higher efficiency of prophylaxis.

3 ex, 6 tbl

FIELD: biotechnology, medicine, immunology.

SUBSTANCE: invention relates to a modified antibody comprising two or more V-regions in H-chain and two or more V-regions in L-chain of antibody bound directly or over a linker by covalent or noncovalent bond. Antibody has a lesser size as compared with the parent antibody possessing or not possessing the agonistic effect to TPO receptors. Antibody represents TPO agonist and able for specific recognizing and cross-linking the TPO receptor. For induction of the agonistic effect in cells expressing TPO receptors cells are contacted with the modified antibody. Measurement of the antibody TRO-agonistic effect is carried out by cross-linking TRO receptors. The modified antibody can be used as a medicinal agent in treatment of thrombocytopenia. Modified antibodies possess higher activity as compared whole antibodies (JgG) and improved penetration capacity into tissues owing to decreased molecular sizes and absence of constant regions.

EFFECT: improved and valuable properties of antibody.

38 cl, 92 dwg, 3 tbl, 8 ex

FIELD: medicine, hematology, pharmacy.

SUBSTANCE: invention relates to medicinal preparations comprising antigens and antibodies. Agent comprises xenogenic polyclonal immunoglobulins of IgG class with molecular mass 150 kDa prepared as the humoral immune response for complex of antigens of endothelial and mesenchymal stem cells. Invention provides the development of agent stimulating the production of blood coagulation VIII factor in patients suffering with hemophilia A in severe form and moderate severe form.

EFFECT: valuable medicinal properties of agent.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: it has been suggested to apply CD-25-binding molecules, basiliximab being the representative, to be applied in combination with other medicinal preparation. It is considered to be efficient in treating inflammatory diseases of gastrointestinal tract. Moreover, it has been suggested to apply basiliximab for improving a painful state of gastrointestinal tract.

EFFECT: higher efficiency of application.

9 cl

FIELD: biotechnology.

SUBSTANCE: DNA is constructed encoding protein, advancing fungus resistance to certain group of compounds. Alternatively DNA is constructed having defect in function and encoding protein, which advances lowering of GPI-anchored protein amount in fungus cell wall. Encoded protein is useful in production of antibody thereto which may by applied as active ingredient of antifungal agent.

EFFECT: new method for production of antifungal agent.

11 cl, 8 dwg, 1 tbl, 2 ex

FIELD: medicine, immunology.

SUBSTANCE: claimed method includes administration of composition comprising immunoregulatory anti-CD80 antibody or immunoregulatory binding fragment thereof and anti-CD80 antibody having activity directed to attenuation of B-cells in claimed dosages and regimes. Method of present invention makes it possible to effectively treat of autoimmune diseases due to attenuation of B-cell population caused by selective directivity of claimed combination against both activated and non-activated B-cells.

EFFECT: effective method for treatment of autoimmune diseases.

3 ex, 1 tbl, 36 cl

FIELD: medicine.

SUBSTANCE: method involves intranasally administering immunomodulator preparation of bacterial origin with one dose placed in each nasal passage twice a day during 14 days repeated in obligatory way every 3 months during one year.

EFFECT: stable repair of injured immunity chains; hindered fixation and reproduction of pathogenic organisms.

Up!