Human plasmide pbsh2egf dna encoding synthesis of human epidermal growth factor and method for production whereof using the same

FIELD: biotechnology, gene engineering, medicine, pharmaceutical industry.

SUBSTANCE: plasmide pBSH2EGF DNA providing expression of human epidermal growth factor (hEGF) in E.coli strains, containing polymerase T7 gene, under controlling of t7 promoter, associated with seeding site of lac-repressor, is synthesized. Also disclosed is method for production of human epidermal growth factor including inducible expression thereof in cells of Escherichia coli strain BL21(DE3) transformed with plasmide pBSH2EGF DNA followed by isolation of target product from inclusion bodies.

EFFECT: effective agent for gene engineering, medicine, pharmaceutical industry, etc.

2 cl, 3 ex, 4 dwg

 

The scope of the invention

The invention relates to the field of genetic engineering, biotechnology and medicine, specifically genetic design, coding and providing the biosynthesis of human epidermal growth factor and which can be used for preparative get in strains of E. coli, as well as to the procedure for obtaining human epidermal growth factor on the basis of this design. The obtained protein can serve as a basis for the creation of burns and wound healing agents, the diagnosis of malignant diseases associated with overproduction of receptor car, and also when creating new methods of targeted delivery of those or other therapeutic agents into target cells specifically expressing the receptor car.

Background of the invention

car is a peptide hormone produced by a variety of tissues and is contained in almost all biological fluids of the human body. car is synthesized as a precursor length 1217 amino acids and undergo further proteolytic processing with the formation of a Mature protein with a characteristic size of 53 amino acids and three internal disulfide bonds, having a molecular weight of about 6000 Da [Scott J. et al., J.Cell Sci Suppl, 1985, 3:19-28]. EGF affects a significant number of physiologically the processes in the body, as, in particular, one of the most potent mitogen for epithelial and connective tissue cells in vitro and in vivo. Because in most cases, the epithelial cells are rapidly updated (skin, gastrointestinal tract), the role of EGF extremely important. In contrast to hormones, it is synthesized by cells of many organs and exerts its effect not only endocrine, and paracrine way, and also secreted in biological fluids (urine, saliva, milk). In the gastrointestinal tract and urinary tract EGF exerts cytoprotective and regenerative effect on the cells lining their epithelium. In particular demonstrated the antiulcer activity of EGF [Finney K.J. et al, 1987]. During pregnancy EGF regulates the development of mammary glands and subsequently fed with milk in the baby's body to complement the insufficient production of native EGF salivary glands. It is shown that EGF is one of the factors necessary for normal spermatogenesis in mice. A detailed study of the spectrum CAFR indicates possible ways of its application as wound healing, cytoprotective and antiulcer drug [G. Schultz et al, Eye, 1994, 8(pt.2):184-187; Greenhalgh D.G., J. Trauma, 1996, 41(1):159-167; Schultz G. et al, J. Cell Biochem, 1991, 45(4):346-352].

A necessary condition for such use CEFR is Nali is their effective source of highly purified preparations of this protein. Modern molecular biology allows to obtain such source using recombinant DNA technology. The main element of this technology is to obtain the plasmid - achromosome double DNA carrying the gene for the desired protein, as well as the information necessary for reproduction plasmids (origin of replication) and one or more phenotypic characteristics, such as resistance to certain antibiotics, allowing the selection of microorganisms containing this DNA.

To date, known recombinant plasmid DNA, providing products CEFR in cells of different bacteria and yeast [Yamagata H. et al, Proc Natl Acad Sci USA, 1989, 86(10):3589-3593; Clare J.J. et al, Gene, 1991, 105(2):205-212]. The closest in technical essence are recombinant DNA Yep40AB and containing its producing strains of Saccharomyces cerevisiae BKM CR-349D capable of obtaining recombinant capr in Sekretareva in the extracellular environment of the form [Eldar, M.A. et al. RF patent 2150501, 2000].

The advantage of E. coli as an organism, providing the gene expression of the target protein within the recombinant plasmid is simplicity and cheapness of increasing bacterial culture compared with the culture of eukaryotic cells, and in the absence of glycosylation of the protein, which in this case is niela the part.

Intracellular production car, in turn, can provide a high yield of protein, to achieve its accumulation in the form of "inclusion bodies", which are easily separated from other solid and soluble components of the cell and contain the target protein with a minimal amount of impurities.

The proposed method of expression greatly simplifies the procedure of purification of the final product compared with the method using the expression in the extracellular environment, since the latter is heavily polluted as components of the nutrient medium, and by-products of microorganisms.

The essence of the invention. Inventive task is to provide high output and simplification of procedures for obtaining biologically active human epidermal growth factor (CEFR).

For solving this problem are proposed plasmid DNA pBSH2EGF encoding the synthesis of epidermal growth factor (human), characterized by the size 3393 BP and contains the following elements: operational built-in restriction sites BamHI and Hind III gene for human epidermal growth factor (CEFR), which is embedded in the start - and stop-codons, genes of resistance to the antibiotic kanamycin, replicative origin pUC on, the gene encoding lac-repressor and the sequence encoding the binding site of the ribosome (RBS), the need is first to start a broadcast protein in cells of the bacterium E. coli, when this gene CAFR is under the control of T7-promoter associated with a plot planting lac-repressor.

The General scheme of this genetic structure is presented in figure 1.

In addition, the method for obtaining human epidermal growth factor by the expression of its gene in Escherichia. coli strain BL21(DE3) or other competent strain of this species, with a synthetic gene encoding CAFR is part of the plasmid DNA pBSH2EGF. After transformation of bacterial cells with this plasmid and their cultivation perform allocations car from accumulating in the cell phone enabled.

As strain by the applicant is used BL21(DE3), which is well established as the host body for recombinant plasmid DNA of similar design [Sambrook J., Fritsch E.F. and Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989], however, suitable for transformation and other strains.

We have developed a vector pBSH2EGF carries the gene protein CAFR under the control of the T7 promoter, which can be transcribed only T7 RNA polymerase. The gene for T7 polymerase must be located in the composition of the bacterial genome of strain under the control of the lac promoter, such as in the strain BL21(DE3). In this case, the transcription of target genes under the control of T7 promoter, is possible only after inducts and lac-promoter, isopropyl-beta-D-thiogalactoside (IPTG). The composition of the vector includes a gene lac I, encoding lac-penpeccop. Lac operator is also between the T7 promoter and the coding part of the gene CAFR. Thus lac-repressor suppresses basal expression of the protein in the absence of inducer. The binding of inducer IPTG with repressing molecule disrupts its interaction with the operator site, making it possible landing on this stretch of RNA polymerase and subsequent transcription. The proposed method of exercise capacity cells transformed by plasmid DNA pBSH2EGF, in the liquid growth medium until the turbidity of 0.4-0.6 OD, after which it add 0.1-0.3 mm IPTG-inductor lac-promoter and are the expression of a product under the control of induced promoter plasmids.

Directly related to this invention is the description of the methods and ways CEFR contained as the main component in the intracellular cells bacteria cells can be extracted, purified and using refolding returned to the native structure, which is implemented by its biological activity.

Purification of the target product, obtained using plasmid DNA pBSH2EGF, carried out after the stage of renaturation by liquid chromatography high-pressure reversed phase.

The invention is illustrated by the following examples:

Example 1. Cloning of g is human epidermal growth factor (EGF) human.

As the source of the gene CAFR was used library of human genes.

A fragment of the gene pre-CEFR corresponding to a sequence that encodes CAFR was isolated by the method of amplification using the following primers:

Bam 5' TAACTTGGATCCATGAATAGTGACTCTGAAT

the underlined fragment - site recognition by the restriction enzyme BamHI

EGF-Hind 5' TTATAAAGCTTATTAGCGCAGTTCCCACCACTT

the underlined fragment - site recognition by the restriction enzyme HindIII

Gene CEFR (EGF) made with the recognition sites

restriction enzymes BamHI and Hind III, and the start - and stop-codons.

Selection - site recognition by the restriction enzyme BamHI underlined - HindIII

Example 2. Obtaining expression vector.

To obtain the expression vector sequence EGF treated with restriction enzymes BamHI and Hind III and inserted at the restriction sites BamHI and Hind III vector pBSH2. The resulting vector was named pBSH2EGF.

To implement the expression of this protein vector was transformed into the cells of the bacteria E. coli strain BL21(DE3).

Induction of the synthesis of EGF was measured in 10 ml IPTG-induced cultures (growing up OD6000-5, making IPTG to 0.2 mm, then 3 hours at 37°on the rocking chair). The protein products of the expected size was verified from the LTO-electrophoresis in SDS page.

Example 3. Synthesis CEFR in E. coli strain BL21(DE3).

p> The level of synthesis CAFR was determined in E. coli strain containing plasmid pBSH2EGF. As control was used the E. coli strain BL21(DE3) with plasmid pBSH2, not carrying the gene CAFR. Cells of E. coli strain BL21(DE3) transformed with plasmid pBSH2EGF and were grown for 12 h at 37°C in LB medium with the addition of kanamycin (100 μg/ml) and glucose (0.2%). Then was diluted overnight culture 25 times with fresh LB medium with kanamycin and pokasivali 2-3 h prior density OD600=0,5, then made IPTG to a final concentration of 0.2 mm for induction of synthesis CAFR. Raised another 3 hours, centrifuged culture at 5 Tyson/min for 10 min, the supernatant was discarded.

As follows from the data presented in figure 2, cells of E. coli containing plasmid pBSH2EGF, support the expression of car. Figure 2 presents the results of electrophoretic separation of proteins in total cell lysates of E. coli strains in the LTO-SDS page, where

1 - molecular weight markers;

2 - E. coli strain BL21(DE3)carrying plasmid pBSH2EGF;

3 - strain E. coli BL21(DE3), not carrying the plasmid pBSH2EGF;

Example 4. Purification of recombinant capr of the producer strain E. coli BL21(DE3)containing plasmid DNA pBSH2EGF.

Sediment cells obtained from the culture of E. coli suspended in a buffer for processing by ultrasound (50 mm Tris-model HC1, pH 8.0, 5 mm EDTA), after which was added lysozyme to a final concentration of 50 μg/ml, and incubated in this booth is d +4° C for 15 minutes Then treated with lysozyme cells were subjected to ultrasound using an ultrasonic disintegrator for 2 min at 0°C. the resulting suspension was centrifuged for 15 min at 10000 rpm Then spent the procedure of washing Taurus inclusion. This precipitate resuspendable in buffer containing 20 mm Tris-HCl, pH 8.0, 2 mm EDTA, 0.1 M NaCl, 0.2% deoxycholate sodium, and subjected to the action of ultrasound, as described above, followed by centrifugation (10000 rpm, 5 min). The procedure of washing Taurus enable repeated two more times. The resulting preparation was solubilization in buffer containing 50 mm Tris-HCl, 2 mm EDTA, 1% of sodium laurylsarcosine. Renaturation protein was three consecutive dialysate drug against buffer containing 25 mm Tris-HCl, 0.1 M NaCl. Next, the product was dried by lyophilization and pererestorani in a minimum volume of 10% aqueous solution of acetonitrile. Protein was subjected to purification using liquid chromatography high-pressure reversed phase, using as eluent a continuous linear gradient of acetonitrile from 10 to 60%. The fractions containing the target protein were pooled and the acetonitrile was removed by lyophilization. After the final stage of purification of the protein was obtained in high purity (see figure 3, 4). The protein yield was ˜20 mg h is FR from 1 l of cell culture.

Example 5. Electrophoretic analysis of the final drug CAFR.

Figure 4 presents data electrophoretic analysis of recombinant capr a 15% polyacrylamide gel in the presence of 0.1% sodium dodecyl sulfate:

1 - drug car from strain with plasmid pBSH2EGF after the final stage of purification.

2 - molecular markers of the masses.

From figure 4 it is seen that the drug is a practically homogeneous protein (purity more than 98%) with a molecular mass corresponding to natural CAFR.

1. Plasmid DNA pBSH2EGF providing for the expression of human epidermal growth factor (CAFR) strains of E. coli, containing the gene for T7 polymerase, characterized by the size 3393 softwares consisting of the following elements:

nucleotide sequence that encodes CAFR, which is obtained from the cDNA library of a man with the subsequent addition of start - and stop-codons and flanked by recognition sites of restriction enzymes BamHI and Hind III (EGF);

T7-promoter (T7prom)associated with the plot planting lac repressor(Lac Operator);

the gene encoding lac-repressor (lacl);

replicative origin PUC (PUC ori);

the binding site of the ribosome (RBS);

the gene of resistance to the antibiotic kanamycin (CanR),

which are located as shown in figure 1.

2. A method of obtaining a human body, control the epidermal growth factor (CAFR) by transforming a microorganism plasmid DNA, providing the expression CEFR in the cells of a specified microorganism, culturing the obtained producer and selection CEPR, characterized in that the quality of plasmid DNA using plasmid DNA pBSH2EGF according to claim 1, as the microorganism used the E. coli strain BL21(DE3)during cultivation producer induce the synthesis CAFR by adding to the culture medium of isopropylacetanilide and CEPR separated from Taurus inclusions that accumulate in the cells.



 

Same patents:

FIELD: molecular biology, biochemistry, medicine, oncology.

SUBSTANCE: invention relates to DNA sequences found in analysis of mDNA from squamous carcinoma cellular lines of different origin wherein these DNA sequences represent transcripts from rearranged genes SCCA1 and SCCA2. Result of rearrangement is formation of fused gene consisting of exon 2-7 of gene SCCA1 and exon 8 of gene SCCA2, or exons 2-7 of gene SCCA2 and exon 8 of gene SCCA1. Prepared expressing vectors comprising above said combinations of exons of two genes provide synthesis of corresponding fused protein in host-cell. Proposed sequences of nucleic acids and genetic constructions based on thereof represent novel agents for diagnosis squamous carcinomas.

EFFECT: valuable biological and medicinal properties of transcripts.

8 cl, 9 dwg, 1 tbl, 5 ex

FIELD: genetic engineering, biochemistry, virology.

SUBSTANCE: invention proposes recombinant plasmid pCI-neo-ODC-nsP1 and its variants pCI-neo-ODC-E2-L and pCI-neo-ODC-E2-M encoding proteins of Venezuelan equine encephalomyelitis (VEE) and ornithine decarboxylase protein. Plasmids are prepared by the sequential cloning gene-equivalent of non-structural protein nsP1 (fragments of L,M of the structural protein E2) of VEE virus as component of gene encoding enzyme ornithine decarboxylase being firstly into prokaryotic plasmid vector pET-23b and then into eucaryotic plasmid vector pCI-neo. Prepared plasmids can be used in the development of protective preparations used against Venezuelan equine encephalomyelitis virus as a prophylactic agent with respect of this pathogen.

EFFECT: valuable biological and medicinal properties of plasmid and agents.

3 cl, 2 tbl, 6 dwg

FIELD: microbiology, molecular biology, genetic engineering.

SUBSTANCE: invention relates to designing recombinant strains of E. coli carrying the cloned sequences of genome of meliodosis pathogen, B. pseudomallei, and determining different spectra of the medicinal resistance. Method involves transformation of E. coli JM107 competent cells with Kpn I-fragments of chromosomal DNA of the strain B. pseudomallei 56770 SMR2 ligated with Kpn I-restricts of vector pUC19 followed by selection of clones showing the combined resistance to antibacterial preparations of different classes. Then method involves carrying out the plasmid screening of the recombinant clones and hybridization analysis for detection of chromosomal DNA fragment by using B. pseudomallei chromosome sequences as a probe. Then method involves assay of the presence of the expression product of chromosomal DNA cloned sequence by immunoblotting method with immunoglobulins of specific meliodosis antsera. The prepared recombinant strain ZV1 is deposited in the State Collection of pathogenic microorganisms "Mikrob" at number KM167 and it shows resistance to pefloxacin and streptomycin. Use of the invention provides carrying out investigations of molecular-genetic bases of the multiple medicinal resistance of B. pseudomallei and to study the functional role of separate proteins in formation of the polyresistance in the meliodosis pathogen.

EFFECT: valuable properties of strain.

1 dwg, 1 tbl, 2 ex

FIELD: biotechnology, molecular biology, microbiology, genetic engineering.

SUBSTANCE: invention relates to a method for preparing an immunogenic polypeptide inducing immune response that represents the protective response against infection with Bacillus anthracis. Proposed immunogenic polypeptide comprises from one to three domains of the full-scale Protective Antigen (PA) from B. anthracis or their variants and at least one of indicated domains represents domain 1 or domain 4 from PA or its variant. These variants of immunogenic polypeptide and full-scale PA are produced as result of expression in E. coli. Also, invention proposes a vector for expression in bacterial cells that comprises nucleic acid encoding abovementioned immunogenic polypeptide. Also, invention the developed method for prophylaxis of infection caused by B. anthracis based on administration of sufficient amount of immunogenic polypeptide. Also, invention proposes a vaccine for prophylaxis of infection caused by B. anthracis that comprises the effective amount of immunogenic polypeptide and a suitable carrier. Invention provides preparing the effective agent used for prophylaxis of infection caused by B. anthracis.

EFFECT: improved preparing method and valuable properties of polypeptide and vaccine.

22 cl, 5 dwg, 3 tbl, 6 ex

FIELD: biotechnology, in particular gene engineering, pharmaceutical and food processing industry.

SUBSTANCE: DNA sequence (1341 n.p.) encoding fatty acid -desaturase (447 amino acid residue, 57 kD) of nematode Caenorhabditis elegants is isolated and characterized. Obtained DNA-sequence is expressed in bacterium and yeast cells to produce Biologically active enzyme recombinant form. Said recombinant form is capable to catalyze conversion of dihomo-γ-linolenic acid to arachidonic acid and eicosatetraenoate to eicosapentaenoate.

EFFECT: method for large-scale production of polyunsaturated fatty acid.

15 cl, 4 dwg, 1 ex

FIELD: biotechnology, microbiology, genetic engineering.

SUBSTANCE: invention proposes a new recombinant plasmid pR752 (5269 pair bases) comprising genetic construction under control of bacteriophage T5 promoter and encoding a module polypeptide consisting of 6 histidine residues, hemoglobin-like protein of E. coli, modified fragment of large T-antigen SV-40, translocation domain of diphtheria toxin, spacer sequence (Gly-Ser)5 and human epidermal growth factor (6 His-HMP-NLS-Dtox-(Gly-Ser)5-EGF) and designated for the directed transfer of photosensitizers into target-cell nuclei. By transformation of the strain E. coli M15 (rep 4) with plasmid pR752 the recombinant strain E. coli VKPM B-8356 as a producer of new polypeptide vector is prepared. The usage of this new strain is able to enhance the effectiveness of effect of photosensitizers by some orders. Invention can be used in medicinal-biological industry in preparing agents providing the directed transport of photosensitizing agents into tumor cell nuclei.

EFFECT: valuable biological and medicinal properties of polypeptide.

3 dwg, 4 ex

FIELD: biotechnology, genetic and protein engineering.

SUBSTANCE: invention reports construction of plasmid DNA pES6-1 based on plasmid pET22b(+) and DNA fragment comprising a sequence of artificial gene encoding human interferon β-1b providing expression of human recombinant interferon β-1b. Also, the strain Escherichia coli BDEES6 (BL21(DE3)/pES6-1) as producer of human recombinant interferonβ-1b is prepared. Invention provides enhancing yield of human recombinant interferon β-1b. Invention can be used in medicine and pharmaceutical industry.

EFFECT: valuable biological and medicinal properties of strain.

2 cl, 2 dwg, 2 ex

FIELD: genetic engineering, molecular biology, biochemistry.

SUBSTANCE: recombinant plasmid DNA pTES-His-OPH is constructed for expression of polypeptide eliciting properties of organophosphate hydrolase comprising Cla I/Hind III fragment of plasmid pTrcTEGF, fragment of plasmid pTES-OPH with nucleotide sequence that encodes amino acid sequence of the matured form of organophosphate hydrolase, and nucleotide sequence encoding 6 histidine residues that is located by 5'-end of nucleotide sequence encoding organophosphate hydrolase. Based on indicated plasmid the strain Escherichia coli TSKMIBKH-29 - a producer of polypeptide eliciting properties of organophosphate hydrolase is obtained. Applying the invention provides preparing polypeptide with properties of organophosphate hydrolase by simplified technology and this polypeptide elicits the improved catalytic effectiveness of action with respect to thio-containing phosphoric acid triesters. Invention can be used for carrying out hydrolysis of organophosphate compounds.

EFFECT: valuable biochemical properties of producer.

2 cl, 4 dwg, 2 tbl, 4 ex

FIELD: biotechnology, genetic engineering, pharmaceutical industry.

SUBSTANCE: plasmid DNA pET23-a(+)/PrxVIhumΔ178 with molecular weight of 19691.61 Da is constructed. DNA contains RNA-polymerase T7 promoter; replication initiation site; genetic marker which determinates resistance of cells transformed by said plasmid to ampicillin; and nucleotide sequence encoding N-terminal fragment of human peroxiredoxine VI containing 177 of amino acid residues. E.coli strain BL21/DE3/pET23-a(+)/PrxVIhumΔ178 being producer of N-terminal fragment of human peroxiredoxine VI is obtained by transformation of E.coli cells with plasmid DNA pET23-a(+)/PrxVIhumΔ178. Method of present invention makes it possible to obtain human peroxiredoxine VI fragment having reduced molecular weight, improved tissue permeability, and antioxidant activity of full-scale peroxiredoxine.

EFFECT: human peroxiredoxine VI fragment with improved tissue permeability.

2 cl, 3 dwg, 4 ex

FIELD: genetic and tissue engineering, biotechnology, medicine, agriculture.

SUBSTANCE: invention relates to the development of simple with constructive relation peptide vector (PGE-κ) consisting of polypeptide sequence of epidermal growth factor (EGF) and modified sequence of signal peptide T-antigen SV-40. New vector PGE-κ is able to provide the selective delivery of genetic material in target-cell cytoplasm carrying external receptors to EGF and the following its transport across nuclear membrane. Also, invention proposes a method for preparing peptide vector PGE-κ involving its expression as a fused protein "mutant thioredoxine-linker-vector" and cleavage of product expressed in E. coli in the linker region with specific protease. Invention provides preparing the recombinant strain E. coli B-8389 VKPM as a producer of the fused protein comprising PGE-κ. Proposed vector shows simple structure, absence of toxicity and immunogenicity and these properties provide its usefulness for the directed genetic modification of epithelial, embryonic and tumor cells in vivo.

EFFECT: improved preparing method, valuable medicinal properties of vector, improved genetic modification.

7 cl, 12 dwg, 4 tbl, 16 ex

FIELD: medicine, endocrinology, biochemistry, peptides.

SUBSTANCE: invention represents new peptides that act in vivo as stimulators of insulin secretion by pancreas beta-cells in glucose-dependent regimen. Such peptides as enhancers of insulin secretion stimulate insulin secretion by insula cells in rats in vitro and in vivo. Proposed peptides represent a new way for treatment of patients with reduced secretion of endogenous insulin, in particular, for treatment of diabetes mellitus type 2. In particular, invention represents polypeptide taken among the specific group VIP/PACAP-related polypeptides or their functional equivalents. Also, invention claims method for preparing both recombinant and synthetic peptides. The advantage of invention involves new peptides that can be used as stimulators of insulin secretion.

EFFECT: improved and valuable medicinal properties of peptides.

47 cl, 4 tbl, 10 dwg, 18 ex

v-integrins (options), receive (options) and use hybridoma, polypeptide, dna" target="_blank">

The invention relates to immunobiotechnology and applies to new monoclonal antibodies, methods for their production using hybridoma technology and our-integrin or vitronectin as antigens, polypeptides, representing light and heavy chains of the antibody and DNA encoding these polypeptides

The invention relates to medical biotechnology and is concerned with the obtaining of monoclonal antibodies (MAB) and its fragments using hybridoma FERM BR-4382, which produces the above-mentioned antibody

The invention relates to biotechnology, in particular genetic and protein engineering

FIELD: genetic and tissue engineering, biotechnology, medicine, agriculture.

SUBSTANCE: invention relates to the development of simple with constructive relation peptide vector (PGE-κ) consisting of polypeptide sequence of epidermal growth factor (EGF) and modified sequence of signal peptide T-antigen SV-40. New vector PGE-κ is able to provide the selective delivery of genetic material in target-cell cytoplasm carrying external receptors to EGF and the following its transport across nuclear membrane. Also, invention proposes a method for preparing peptide vector PGE-κ involving its expression as a fused protein "mutant thioredoxine-linker-vector" and cleavage of product expressed in E. coli in the linker region with specific protease. Invention provides preparing the recombinant strain E. coli B-8389 VKPM as a producer of the fused protein comprising PGE-κ. Proposed vector shows simple structure, absence of toxicity and immunogenicity and these properties provide its usefulness for the directed genetic modification of epithelial, embryonic and tumor cells in vivo.

EFFECT: improved preparing method, valuable medicinal properties of vector, improved genetic modification.

7 cl, 12 dwg, 4 tbl, 16 ex

Up!