Method for preparing fodder complex enzyme preparation (variants) and strain penicillium canescens (variants)

FIELD: biotechnology, biochemistry, microbiology.

SUBSTANCE: method involves to a method for preparing the fodder complex enzyme preparation possessing activities of endo-1,4-β-glucanase, β-glucanase, endo-1,4-β-xylanase, phytase, pectin-lyase and α-galactosidase. The preparation is prepared by combined culturing multicopy strains of fungus Penicillium canescens VKM F-3868D and VKM F-3869D. The enzyme preparation possessing activities of endo-1,4-β-glucanase, β-glucanase, endo-1,4-β-xylanase, phytase and pectin-lyase is prepared in combined culturing multicopy strains of fungus Penicillium canescens VKM F-3868D and VKM F-3870D. For preparing the enzyme preparation possessing activities of endo-1,4-β-glucanase and β-glucanase the strain Penicillium canescens VKM F-3868D is cultured, and for preparing the enzyme preparation possessing activities of phytase, pectin-lyase and α-galactosidase the strain Penicillium canescens VKM F-3869D is cultured. The enzyme preparation possessing activities of phytase and pectin-lyase is prepared by culturing the strain Penicillium canescens VKM F-3870. The claimed invention provides expanding assortment of enzyme preparations.

EFFECT: improved preparing method.

12 cl, 3 dwg, 12 ex

 

The invention is in the field of biotechnology relates to the microbiological industry, and is a method of obtaining complex feed enzyme preparation with endo-1,4-β-glucanase, 1,3/1,4-β-glucanases, endo-1,4-β-xylanase, Fitzroy, pectin-Lesnoy and α-galactosidase activity by co-cultivation of two multicopying strains of the fungus Penicillium canescens.

In modern feed production as a necessary feed additives are widely used enzyme preparations. The leading role belongs to the enzymes that break down polymeric and other biostructure plant cells, which form the basis of forage mass.

One of the major non-starch polysaccharide component of plant cell walls is cellulose, which is cleaved by endo-1,4-β-glucanase (cellulase). In the result of the action of the enzyme endo-1,4-β-glucanase in the cell wall of cereals (wheat, rye, VHF, barley, maize) improving the access of digestive enzymes farm animals to the main nutritional components of food - starch and proteins. In addition, this enzyme possesses endo-1,3/1,4-β-glucanase (1,3/1,4-β-glucanase) activity and hydrolyzes β-glucan of the cell wall of cereals, which also improves access PI is everythingnyc enzymes of animals to the nutritional components of food - due to the reduced viscosity of forage mass, because it facilitates its passage through the gastro-intestinal tract of animals. In addition, endo-1,4-β-glucanase used in textile industry for surface processing cotton products.

Xylan is a major component of hemicellulose, included in the composition of plant cell walls of cereal grains. The role of endo-1,4-β-xylanase as a feed additive is in the hydrolysis of xylan, which also improves the access of digestive enzymes to the feed components, reduces the viscosity of the feed and facilitates its passage through the gastrointestinal tract. In addition, xylanase find application in the pulp and paper industry in the process of pulp bleaching.

The phosphorus in grains like cereals and legumes (soybeans, peas, lupins and other)used in the feed, is bound, tough farm animals condition, in the form of phytin. The role of phytase as a feed additive, is the hydrolysis of phytin with the formation of phosphate and myo-Inositol and, thereby, enriching the food easily digestible farm animals phosphate. Hydrolysis of phytin also leads to better assimilation of animals calcium, iron, manganese, magnesium and other metals, cations which form insoluble joint is with phytin.

Pectin is one of the major non-starch polysaccharides grain legumes (used in animal feed as a protein source), impeding the access of digestive enzymes to the nutritional components of food. The role of pectin-LiAZ (pectinase) as feed additives is to improve the access of digestive enzymes to protein components of the feed and increase their absorption in the digestive tract of animals. In addition, the pectin-LiAZ (pectinase) find application in the food industry to increase the output of fruit juice and extractives, clarification and stabilization of juices and wines.

For legumes are characterized by high contents galactosaemia oligosaccharides (stachyose, raffinose, and others). Farm animals do not have their own α-galactosidase and is not able to hydrolyze the oligosaccharides to monosaccharides - galactosidase oligosaccharides mix microflora of the gastrointestinal tract of animals with the formation of gaseous products. This can lead to undesirable feeding and keeping of farm animals consequences. Role α-galactosidase as a feed additive is in the hydrolysis galactosaemia oligosaccharides improve their digestibility and improve forage quality.

To obtain these enzymes inindustry used microbial and fungal producers of different species. For example, to obtain endo-1,4-β-glucanase used strains of Trichoderma reesei and Humicola insolens. To obtain use of xylanase strains Tr.reesei, Hum.insolens and Thermoascus aurantiacus. Drugs with Fitzroy activity obtained using fungal strains Aspergillus niger, Asp.ficuum and Tr.reesei. Under cultivation each producer uses its technological cycle, including individual nutrient medium, the temperature and duration of fermentation. The complex enzyme preparation requires a blending operation separately derived drugs with the specified activity that adds cost and complexity to the final product. This raises the problem of production of the complex enzyme preparation with cellulase, β-glucanase, xylanase, Fitzroy, pectinases and α-galactosidase activity in the joint cultivation of multiple strains in a single technological process cycle.

Describes a method for enzyme complex containing phytase, cellulase (CMC-ABC) and xylanase by culturing Streptomyces cuspidosporus on a medium containing wheat bran and xylan. The activity of phytase, cellulase and xylanase be 0.43; 0.74 and 105 u/ml, respectively [World Journal of Microbiology & Biotechnology, 2000, 16:(3) 257-263]. There is information about how to obtain the complex enzyme preparations possessing cellulolyticus and glucoamylase activities, by co-cultivation of the fungus Tr.longibrachiatum and yeast Endomycopsis fibuligera [Microbiology, t, B.3, 407-412, 1986]. Described is a method of obtaining complex cellulolyticus enzymes containing cellobiose, pectinase and xylanase by culturing fungi Tr.viride and Asp.foetidus [Patent RU 2018534, 1994]. A common shortcoming of these methods are low values of enzyme activities obtained in the final product, because the genes controlling the target proteins are under different regulatory control, and therefore the selection of the medium and process conditions, optimal for the co-fermentation of different strains, is almost an impossible task. However, the problem of obtaining the complex enzyme preparation at joint cultivation of two fungal strains can be solved if we use as the producer base of the mushroom body, which for the synthesis of several secreted enzymes was used a single regulatory mechanism.

The task of the claimed group of inventions is to develop a method of producing a complex enzyme preparation with high activity of endo-1,4-β-glucanase (1,3/1,4-β-glucanase, endo-1,4-β-xylanase, phytase, pectin-LiAZ and α-galactosidase by co-cultivation of two multicopying strains of the fungus Penicllium canescens. In one of these two strains amplified heterologous gene endo-1,4-β-glucanase with 1,3/1,4-β-glucanase activity (Eg3, 12 family glycosyl-hydrolases), which is under the control of xylanase promoter (pxylA), and multiplied copies of homologous gene endo-1,4-β-xylanase (xylA, 10 family glycosyl-hydrolases), resulting in regulation of activity multiplied copies of the gene endo-1,4-β-glucanase (with 1,3/1,4-β-glucanase activity and gene endo-1,4-β-xylanase is carried out by the mechanism of regulation of a strong promoter homologous xylanase gene. In another strain amplified homologous genes phytase (phyA), pectin-LiAZ (pelA) and α-galactosidase (aglA), which are under the control of a promoter homologous gene β-galactosidase (pbgaS), resulting in regulation of activity multiplied phytase gene copies, pectin-LiAZ and α-galactosidase is carried out by the mechanism of regulation of a strong promoter homologous gene β-galactosidase. General in the regulation of these genes (xylanase and β-galactosidase) is the nature of the activator, which is five-membered sugar arabinose - product of the breakdown of pectin sugar beet pulp, arabinoxylan grass or other natural arabinosidases substrates.

In the last decade, widespread industrial the e multicabinet mushroom superproducers enzymes have amplification of genes encoding secreted enzymes allowed us to dramatically increase the productivity of the strains. It is known multicopying producers endo-1,4-β-glucanase are strains on the basis of Tr.longibrachiatum [Clarkson et al. 1995, US Patent 5419778], Tr.reesei [Saloheimo et al., 1994, WO Patent 94/28117] and Hum.insolens [Rasmussen et al., 1991, Patent WO 91/17243]. There are various mushroom multicabinet producers of xylanase - Asp.niger [van den Broek et al., 1994, US Patent 5358864], Tr.reesei [Nevalainen et al., 1994, US Patent 5298405], Therm.auranticus [Yu et al., 1990, US Patent 4966850], Hum.insolens [Schulein et al., 1997, US Patent 5610048]. Among the producers of fits have multicabinet producers Tr.reesei [Barendse et al., 1998, Patent WO 98/55599], and fungi of the genus Aspergillus [van Gorcom et al., 1990, EP 0420358 A1].

The filamentous fungus Penicillium canescens (PMBC F178) when the growth on the medium with the sugar beet pulp is used as a source of carbohydrates (or environments other polysaccharide composition), secretes a number of enzymes carbohydrates, among which the greatest quantities presents β-galactosidase and xylanase. Recently natural strain Pen. canescens was adapted to recombinant DNA technology and used to create multicopying superproducers β-galactosidase (Pen.canescens PMBC F725) and xylanase (Pen.canescens PMBC F832) with increased productivity 7-10 times compared to the original strain Pen.canescens F178 [Eventref, Abbaker, Wasurerarenai, Amelkin, Upenergy. 1999. Biotechnology, No. 3, the ts.3-13; Wasurerarenai Iaavolea, Amelkin, Upenergy. Go active. biochemistry, microbiol., 2002, V. 38, No. 5, str-501]. For biotechnology mushroom Pen.canescens very attractive as a base body, as strong promoters of genes β-galactosidase and xylanase, regulatory proteins, and other components to control the activity of these genes can be used to create industrial producers of other secreted enzymes using recombinant DNA technology. The advantage of using strain Pen.canescens as the base body for the production of several secreted enzymes is the use of similar environments and uniform fermentation process. This raises the possibility of obtaining strains Pen.canescens, simultaneously producing two or more secreted enzyme by introducing a single recipient strain corresponding number of genes of these enzymes under the control of strong promoters of genes β-galactosidase and xylanase. Recently, it was shown that strains Pen.canescens with amplified genome of xylanase synthesis β-galactosidase reduced, while in strains Pen.canescens with multiplied genome β-galactosidase synthesis of xylanase remains unchanged. The mechanism of this phenomenon depends on the interaction of specific transactivator genes β-galactosidase and xylanase, which is ω activator gene β -galactosidase active and, accordingly, is titrated multiple promoters of the amplified gene xylanase and activator gene of xylanase in respect of the promoter of the gene β-galactosidase inactive [Vavilov E.A., Vinecki Y.P. go active. biochemistry and Microbiology 2003, C., No. 2, str-151]. With this in mind for comprehensive preparation with endo-1,4-β-glucanase, xylanase, Fitzroy, pectin-Lesnoy and α-galactosidase activity for joint cultivation is possible to use two strain Pen.canescens, one of which amplificatoare structural part of the gene endo-1,4-β-glucanase and endo-1,4-β-xylanase are under the control of the promoter of the gene of xylanase, and the other amplificatoare structural parts of homologous genes phytase and pectin-LiAZ or phytase, pectin-LiAZ and α-galactosidase under the control of a promoter homologous gene β-galactosidase.

The development of a method of producing a complex enzyme preparation with endo-1,4-β-glucanase (1,3/1,4-β-glucanase activity), endo-1,4-β-xylanase, Fitzroy, pectin-Lesnoy and α-galactosidase activity by co-cultivation of two multicopying strains of the fungus Pen.canescens carried out by several steps.

Step 1. By cloning into the phage vector you elaut DNA fragment Pen.canescens, the encoding gene Sekretareva phytase with full regulatory region. Include this DNA fragment into the structure of vector molecules. Get expression plasmid pPrPHY, in which the nucleotide sequence of the structural gene phytase Pen.canescens combined with a nucleotide sequence that encodes a promoter region and signal peptide gene β-galactosidase Pen.canescens. Expression of the plasmid pPrPHY enabled genome phytase spend the transformation strain of the recipient Pen. canescens PCA(niaD-), carry out the selection of transformants secreting into the culture fluid vitasoy activity, and conduct the fermentation of selected transformants on medium with sugar beet pulp and peptone. Among them select the most productive strain producing phytase Pen.canescens PHY.

Step 2. By cloning into the phage vector isolated DNA fragment Pen.canescens encoding gene Sekretareva pectin-liase with full regulatory region. Next, as in step 1, obtain the expression plasmid pPrPEL, in which the nucleotide sequence of the structural gene pectin-LiAZ Pen.canescens combined with a nucleotide sequence that encodes a promoter region and signal peptide gene β-galactosidase Pen.canescens, carry out the transformation strain of the recipient Pen.canescens PCA (niaD-). Carry out the fermentation of selected transformants on medium with light is lowicryl the pulp and peptone and among them select the most productive strain-producer of pectin-LiAZ Pen.canescens PEC.

Step 3. Isolated DNA fragment Pen.canescens encoding gene Sekretareva α-galactosidase with full regulatory region. Next, as in step 1, obtain the expression plasmid pPrα-GAL, in which the nucleotide sequence of the structural gene α-galactosidase Pen.canescens combined with a nucleotide sequence that encodes a promoter region and signal peptide gene β-galactosidase Pen.canescens, and spend the transformation strain of the recipient Pen.canescens PCA (niaD-). Carry out the fermentation of selected transformants on medium with sugar beet pulp and peptone and among them select the most productive strain-producer α-galactosidase Pen.canescens AGL.

Step 4. Get multicopying strain Pen.canescens producing endo-1,4-β-glucanase (with 1,3/1,4-β-glucanase activity) and endo-1,4-β-xylanase. For this purpose the strain Pen.canescens R1103 producing endo-1,4-β-glucanase Pemcillium verruculosum (Sinitsyna O.A.; Kida. Diss. M, 2002), containing multicopying expression plasmid pPrXYL, in which the nucleotide sequence of the structural gene endo-1,4-β-glucanase Pen.verruculosum combined with a nucleotide sequence that encodes a promoter region and signal peptide gene endo-1,4-β-xylanase Pen. canescens. Strain Pen.canescens R1103, secreting endo-1,4-β-glucanase treated with mutagen and get it in the (niaD-) mutant, which is used for subsequent cotransformation the plasmid pPCXYLA with cloned homologous gene endo-1,4-β-xylanase Pen.canescens receive a series of strains Pen.canescens EgX with amplificatoare homologous genes endo-1,4-β-xylanase and amplificatoare copies of the heterologous gene endo-1,4-β-glucanase Pen.verruculosum under the control of the promoter of the gene of xylanase Pen.canescens. Carry out the fermentation of selected transformants on medium with sugar beet pulp and peptone and among them select the most productive strains of series Pen.canescens - producers of endoglucanase (β-glucanase and xylanase EgX.

Step 5. Get multicopying strain Pen.canescens producing phytase and dectin-LiAZ. Using mutagenic processing of the producer strain phytase Pen.canescens PHY receive his mutant Pen.canescens PHY (niaD-). Expression of the plasmid pPrPEL enabled genome pectin-LiAZ spend the transformation strain of the recipient Pen.canescens PHY (niaD-) and carry out the selection of transformants secreting into the culture fluid at the same time vitasoy and pectinase activity. Carry out the fermentation of selected transformants on medium with sugar beet pulp and peptone and among them select the most productive strains of series Pen.canescens - producers of phytase and pectin-LiAZ PhPl.

Step 6. Get multicopying strain Pen.canescens producing phytase, pectin-LiAZ and α-galactosidases by using mutagenic processing of the producer strain phytase and pectin-LiAZ Pen.canescens PhPl get his mutant Pen.canescens PhPl (niaD-). Expression of the plasmid pPrα-Gal-enabled genome α-galactosidase spend the transformation strain of the recipient Pen.canescens PhPl (niaD-) and carry out the selection of transformants secreting into the culture fluid at the same time vitasoy, pectinase and α-galactosidase activity. Carry out the fermentation of selected transformants on medium with sugar beet pulp and peptone and among them select the most productive strains of series Pen.canescens - producers phytase, pectinase and α-galactosidase PhPlAgl.

Step 7. Optimize the fermentation process of joint strain Pen.canescens series EgX and strain Pen.canescens series PhPl receive the drug culture fluid with the high-activity endo-1,4-β-glucanase (1,3/1,4-β-glucanase, endo-1,4-β-xylanase, phytase and pectin-LiAZ.

Step 8. Optimize the fermentation process of joint strain Pen.canescens series EgX and strain Pen.canescens series PhPlAgl and get the drug culture fluid with the high-activity endo-1,4-β-glucanase (1,3/1,4-β-glucanase, endo-1,4-β-xylanase, phytase, pectin-LiAZ and α-galactosidase.

When determining the activity of enzymes using the following methods.

The determination of the activity of endo-1,4-β-glucanase (CMC-ASE): 100 μl of 1% solution of Na-CMC salt in 0.1m acetate buffer mixed with 60 μl of 0.1 m acetate buffer and 40 ál of prediluted restoration.the of the drug (or the culture fluid), incubate 5 min at 50°With, stop the reaction by adding 200 μl of reagent a Somogyi. The reaction mixture was incubated for 40 min in a boiling water bath, cooled to room temperature, add 200 ál of reagent Nelson, incubated 10 min at room temperature, add 360 ál of acetone and 1040 ál of water and measure the optical density of the solution at a wavelength of 610 nm. The concentration of reducing sugars determined from the calibration graph obtained for glucose. Per unit of activity taking that amount of enzyme which causes the action on the CMC education under the reaction conditions of 1 µmol of reducing sugars for 1 min [Apenten, Avhukov, Vmerkulov. Bioconversion of lignocellulosic materials. M.: Izd-vo Mosk. University, 1995].

Determination of activity β-glucanase: 100 µl of 1% solution β-glucans of oats in water mixed with 60 μl of 0.1 m acetate buffer and 40 ál of pre-diluted enzyme preparation (or the culture fluid), incubated 5 min at 50°With, stop the reaction by adding 200 μl of reagent a Somogyi. The reaction mixture was incubated for 40 min in a boiling water bath, cooled to room temperature, add 200 ál of reagent Nelson, incubated 10 min at room temperature, add 1400 μl of water, centrifuged and measure pricesbuy density of the solution at a wavelength of 610 nm. The concentration of reducing sugars determined from the calibration graph obtained for glucose. Per unit of activity taking that amount of enzyme which causes the action on the β-glucan formation under the reaction conditions of 1 µmol of reducing sugars for 1 min [Apenten, Avhukov, Vmerkulov. Bioconversion of lignocellulosic materials. M.: Izd-vo Mosk. University, 1995].

Determination of the activity of xylanase: 100 µl of 1% solution of birch xylan in water mixed with 60 μl of 0.1 m acetate buffer and 40 ál of pre-diluted enzyme preparation (or the culture fluid), incubated 10 min at 50°With, stop the reaction by adding 200 μl of reagent a Somogyi. The reaction mixture was incubated for 40 min in a boiling water bath, cooled to room temperature, add 200 ál of reagent Nelson, incubated 10 min at room temperature, add 1400 μl of water, centrifuged and measure the optical density of the solution at a wavelength of 610 nm. The concentration of reducing sugars determined from the calibration graph obtained for glucose. Per unit of activity taking that amount of enzyme which causes the action on the xylan education under the reaction conditions of 1 µmol of reducing sugars for 1 min [Apenten, Avhukov, VMC movlatov. Bioconversion of lignocellulosic materials. M.: Izd-vo Mosk. University, 1995].

Determination of phytase activity: 300 ál of 1.4×10-3 M solution of Na-salt of phytin in 0,25M acetate buffer mixed with 33 μl of pre-diluted enzyme preparation (or the culture fluid), incubated for 30 min at 40°With, stop the reaction by adding 10% solution of trichloroacetic acid is added to the reaction mixture 667 ál of freshly prepared reagent for phosphate anion (the reagent is prepared as follows - 3,66 g FeSO4·7H2O dissolved in 50 ml of ammonium molybdate (solution of ammonium molybdate is prepared by dissolving 2.5 g of ammonium molybdate in 8 ml of sulfuric acid with a further increase to 250 ml water)), incubated for 30 min at room temperature and measure the optical density of the solution at a wavelength of 750 nm. The concentration of phosphate anion determined from the calibration graph obtained for KH2PO4. Per unit of activity taking that amount of enzyme which causes the action on the phytin education under the reaction conditions of 1 µmol of phosphate anion for 1 min [A.J.Engelen, F.van der Heeft, P.H.Randsdorp, E.L.Smit, Journal of AOAC International, 1994, v.77, No.3, p.760-764].

The determination of the activity of pectin-LiAZ: to 0.9 ml of 0.24% solution of citrus pectin (degree of etherification 70%) in 0,05M acetate buffer, pH 5.0, add 0.1 ml has preliminarily the diluted enzyme preparation (culture fluid) and incubated at 40° within 10 min, stop the reaction by adding 0.1 ml of 1M HCl and measure the absorbance at 232 nm. Per unit of activity taking that amount of enzyme which under the action of pectin under the reaction conditions produces 1 µmol of 4,5-unsaturated reaction products for 1 min [V.M.Taragano, A.M.R.Pilsof Enz. Environ. Technol., 1999, v.25, No.3, p.414-420].

Determination of activity α-galactosidase: to 0.9 ml of 1 mm solution of p-NF-a-Gal (p-nitrophenyl-α-galactopyranoside) in 0.1m acetate buffer, pH 5.0, add 0.1 ml of pre-diluted enzyme preparation (culture fluid) and incubated at 40° within 10 min, stop the reaction by adding 0.5 ml of 1M solution of Na2CO3and measure the optical density at a wavelength of 400 nm. Per unit of activity taking that amount of enzyme which under the action of p-NF-a-Gal under the reaction conditions produces 1 µmol of p-NITROPHENOL in 1 min [Apenten, Avhukov, Vmerkulov. Bioconversion of lignocellulosic materials. M.: Izd-vo Mosk. University, 1995].

Feed enzyme preparations obtained using the proposed method can be used in the form of the culture fluid, in the form of liquid concentrated preparations obtained by ultrafiltration or evaporation of the culture fluid, or in the form of dry products obtained by drying or granular the requirement.

The invention is illustrated in the examples which do not limit the scope and nature of the claims associated with them.

Example 1. The selection of a DNA fragment Pen.canescens encoding gene Sekretareva phytase with full regulatory region by cloning into the phage vector and obtaining strain Pen.canescens producer phytase.

For cloning of the phytase gene using genomic Bank Pen.canescens F178 in the phage vector EMBL4 obtained earlier [Eventref, Smeelen, Essouria, Svitenko, Upenergy. Molecular biology. 1992, CH, No. 4, str-875). For selection of phage clone with the gene phytase synthesize radioactively labeled PCR fragment, using as template DNA strain Pen.canescens F178. For the synthesis of fragment using oligonucleotide primers with the following sequence:

PPHYD1 5' CTG TTG ATG GCG GTT ATC AAT GC-3'

PPHYR1 5' GGC GAC ATT GCA TCA TCT CGA 3'

The sequence of nucleotides in the primers derived from conservative nucleotide sequences fungus fits available in the GenBank Database. Next, using polymerase chain reaction (PCR) to synthesize an internal DNA fragment of the gene phytase size 1 TPN clone This fragment into the plasmid vector pUC57 and used for selection of phage clone with the gene phytase. For this task, carried out molecular hybridization on nylon filters with32P-labeled PCR fragment. The phages the x clones, obnarujivshih positive signal with a radioactive probe identified a clone with phytase gene in the DNA fragment size 12 TPN using restrictive analysis in the selection Carteret phytase gene. For sublimirovanny phytase gene using bacterial vector plasmid pUC57, in which is inserted a DNA fragment from the genome of phytase and receive plasmid pPHYA. Next sostakovic nucleotide sequence encoding a structural part of the gene phytase Pen.canescens with nucleotide sequence that encodes a promoter region and signal peptide gene β-galactosidase Pen.canescens, and get the expression of the nucleotide sequence (figure 1). This sequence include bacterial vector pUC19 and receive expression plasmid pPrPHY, which are cotransformation strain-recipient Pen.canescens PCA (niaD-) plasmids pSTA(niaD) (Silver VA, Vavilov E.A., Culkin A.M., Vinecki Y.P. go active. biochem. microbiol. 2002, V. 38, No. 5, pp. 495-501) and plasmid pSTA with marker niaD gene (Aleksenko A.Y., Makarova N.A., I.V. Nikolaev, Clutterbuck A.J. 1995. Curr. Genet. V.28. P.474-478). Next, carry out the selection of transformants secreting vitasoy activity.

Selected strains are cultivated on a circular shaker (240 rpm) at 30°in flasks on environments with sugar beet pulp (30 g/l), peptone (50 g/l) and KN2PO4(25 g/l), pH 4.5, and take away the strain Pen.canescens PHY-215, to the which can accumulate in the culture fluid for 120 hours fermentation 450-500 units/ml Fitzroy activity.

Example 2. The selection of a DNA fragment Pen.canescens encoding gene Sekretareva pectin-liase with full regulatory region by cloning into the phage vector and obtaining strain Pen.canescens producer pectin-LiAZ.

The selection gene pectin-LiAZ carried out as described in example 1, using two pairs of oligonucleotide primers PELT2/PELB1 and PELT2/PELB2 sequence:

PELT2 5' CACTGGTGGYGGYRNTGCYACCCCYGTCTACCC 3'

PELB1 5' GTAGTGGTAGCCATCGCAGGTGGCGGAGTA 3'

PELB2 5' ACCGYTGACSATRCGSAGACCCYKGCCCTTGA 3'

The sequence of nucleotides in the primers derived from conservative nucleotide sequences of fungal pectin lyase available in the GenBank Database.

Among the phage clones, obnarujivshih positive signal with a radioactive probe identified a clone with the gene pectin-LiAZ in DNA fragment size 14 TPN using restrictive analysis in the selection Carteret gene pectin-LiAZ. For sublimirovanny gene pectin-LiAZ use bacterial vector plasmid pUC57, in which is inserted a DNA fragment from the genome of pectin-LiAZ and receive plasmid Ren. Next sostakovic nucleotide sequence encoding a structural part of the gene pectin-LiAZ Pen.canescens with nucleotide sequence that encodes a promoter region and signal peptide gene β-galactosidase Pen.canescens and get the expression of the nucleotide serial is inost (figure 2). This sequence include bacterial vector pUC57 and receive expression plasmid pPrPEL, which together with a marker plasmid plasmids pSTA(niaD) are cotransformation strain-recipient Pen.canescens PCA, as in example 1, and perform the selection of transformants secreting pectin-Lesnoy activity.

Selected strains are cultivated on a circular shaker (240 rpm) at 30°in flasks on environments with sugar beet pulp (30 g/l), peptone (50 g/l) and KN2PO4(25 g/l), pH 4.5, and take away the strain Pen.canescens PEC-23, which can accumulate in the culture fluid for 120 hours fermentation 200-250 IU/ml pectin-Lesnoy activity.

Example 3. The selection of a DNA fragment Pen.canescens encoding gene Sekretareva α-galactosidase with full regulatory region by cloning into the phage vector and obtaining strain Pen.canescens - producer α-galactosidase.

The selection gene α-galactosidase were carried out as described in example 1-2, using two pairs of oligonucleotide primers αGAL1/αGAL2 and sequence:

αGAL1 5' CACTGGTGGYGGYRNTGCYACCCCYGTCTACCC 3'

αGAL2 5' GTAGTGGTAGCCATCGCAGGTGGCGGAGTA 3'

The sequence of nucleotides in the primers derived from conservative nucleotide sequences mushroom α-galactosidases, available in the GenBank Database.

Among the phage clones, obnaruzhivali is a positive signal with a radioactive probe, allocate clone with the gene α-galactosidase in DNA fragment size 12 TPN using restrictive analysis in the selection Carteret desired gene. For sublimirovanny use bacterial vector plasmid pUC57, in which is inserted a DNA fragment with the gene α-galactosidase and receive plasmid l32. Next sostakovic nucleotide sequence encoding a structural part of the gene α-galactosidase Pen.canescens with nucleotide sequence that encodes a promoter region and signal peptide gene β-galactosidase Pen.canescens and get the expression of the nucleotide sequence (figure 3). This sequence include bacterial vector pUC57 and receive expression plasmid pPrα-GAL, which together with a marker plasmid plasmids pSTA(niaD) are cotransformation strain-recipient Pen.canescens PCA, as in example 1, and perform the selection of transformants secreting α-galactosidase activity.

Selected strains are cultivated on a circular shaker (240 rpm) at 30°in flasks on environments with sugar beet pulp (30 g/l), peptone (50 g/l) and KN2PO4(25 g/l), pH 4.5, and take away the strain Pen.canescens AGL-3, which can accumulate in the culture fluid for 120 hours fermentation 400-450 units/ml α-galactosidase activity.

Example 4. Getting multicopying piece is MOV Pen.canescens series EgX-producers of endo-1,4-β -glucanase, 1,3/1,4-β-glucanase and endo-1,4-β-xylanase.

For solving the problem using strain Pen.canescens R1103 - multicopying producer endo-1,4-β-glucanase Pen.verroculosum, with 1,3/1,4-β-glucanase activity. Conidia of this strain is treated with nitrosoguanidine to the survival of the order of 1% and plated on plates with selective medium containing chlorate Na (0,45M) and NH4CL (10 mm). Chlorate-resistant colonies are tested for environments with NaNO3and gipoksantin (5 mm) and selected mutants with genotype (niaD-) no growth on plates with NaNO3. Then selected mutants cultured on a circular shaker (240 rpm) at 30°in flasks on environments with sugar beet pulp (30 g/l), peptone (50 g/l) and KN2PO4(25 g/l), pH 4.5. At the end of the fermentation culture liquid is separated from the mycelium and the solid residues of the medium by centrifugation (10000g, 15 min), the supernatant determine the activity of endoglucanase and xylanase and choose the strain-recipient Pen.canescens R1103-3 (niaD-), whose mutagenic treatment did not lead to decreased production of secreted enzymes. Next, by cotransformation plasmids pPCXYLA and pSTA(niaD), as in example 1, into the genome of the received recipient strain Pen.canescens R1103-3 (niaD-) include additional copies of homologous gene endo-1,4-β-xylanase and create a series of strains Pen.canescens EgX with amplificatoare the s xylanase and endoglucanase under control mechanism of regulation of the xylanase gene.

Selected strains are cultivated on a circular shaker (240 rpm) at 30°in flasks on environments with sugar beet pulp (30 g/l), peptone (50 g/l) and KN2PO4(25 g/l), pH 4.5, and take away the strain Pen.canescens EgX-29, which can accumulate in the culture fluid for 120 hours fermentation 150-200 IU/ml endo-1,4-β-glucanase (CMC-ASE), 200-300 IU/ml β-glucanase and 1200-1400 u/ml endo-1,4-β-xylanase.

Example 5. Getting multicopying strains Pen.canescens series PhPl - producers of phytase and pectin-LiAZ.

For solving the problem of conidia of strain Pen.canescens PHY-215-multicopying producer phytase treated with nitrosoguanidine and are breeding strain Pen.canescens PHY-215-1 (niaD-) under conditions as in example 1. Then hold cotransformation as in example 1, the strain Pen.canescens PHY-215-1 (niaD-) expression by plasmid G3 gene pectin-LiAZ under the control of the promoter and signal peptide β-galactosidase and a marker plasmid pSTA and receive the transformed series PhPl.

Selected transformants are cultivated on a circular shaker (240 rpm) at 30°in flasks on environments with sugar beet pulp (30 g/l), peptone (50 g/l) and KN2PO4(25 g/l), pH 4.5, and take away the strain Pen.canescens PhPl-33, which can accumulate in the culture fluid for 120 hours fermentation 190-200 u/ml Fitzroy activity and 150-200 IU/ml activity of pectin-LiAZ.

Example 6. Obtaining m is lycopine strains Pen.canescens series PhPlAgl - producers phytase, pectin-LiAZ and α-galactosidase.

For solving the problem of conidia of strain Pen.canescens PhPl-33 - multicopying producer phytase and pectin-LiAZ treated with nitrosoguanidine and are breeding strain Pen.canescens PhPl-33-1 (niaD-) under conditions as in example 1. Then hold cotransformation as in example 1, the strain Pen.canescens PhPl-33-1 expression by plasmid pPrα-GAL gene α-galactosidase under the control of the promoter and signal peptide β-galactosidase and receive the transformed series PhPlAgl.

Selected transformants are cultivated on a circular shaker (240 rpm) at 30°in flasks on environments with sugar beet pulp (30 g/l), peptone (50 g/l) and KN2PO4(25 g/l), pH 4.5, and take away the strain Pen.canescens PhPlAgl-9, which can accumulate in the culture fluid for 120 hours fermentation 250-300 IU/ml Fitzroy activity, 100-150 IU/ml activity of pectin-LiAZ and 300-350 units/ml activity α-galactosidase.

Example 7. Joint fermentation strain Pen.canescens EgX-29 and strain Pen.canescens PhPl-33 in katalozhnyh flasks.

The method is carried out at different ratio of inoculum strains Pen.canescens EgX-29 and Pen.canescens PhPl-33. As seed use conidia of strains. In the conditions of one fermentation contribute an equal number of conidia of strain Pen.canescens EgX-29 and strain Pen.canescens PhPl-33. In another fermentation contribute advienne the number of conidia of strain Pen.canescens EgX-29 in relation to the number of conidia of strain Pen.canescens PhPl-33, or twice the number of conidia of strain Pen.canescens PhPl-33 in relation to the number of conidia of strain Pen.canescens EgX-29. The fermentation is carried out on a circular shaker (240 rpm) at 30°in flasks on environments with sugar beet pulp (30 g/l), peptone (50 g/l) and KN2PO4(25 g/l), pH 4.5.

When planting an equal number of conidia of strain Pen.canescens Sb EgX-29 and strain Pen.canescens PhPl-33 in the culture fluid for 120 hours fermentation accumulates 110 u/ml endo-1,4-β-glucanase activity (CMC-ASE), 160 u/ml β-glucanase activity, 720 u/ml endo-1,4-β-xylanase activity, 180 u/ml Fitzroy activity and 130 u/ml pectin-Lesnoy activity.

When planting double quantity of conidia of strain Pen.canescens EgX-29 in relation to the number of conidia of strain Pen.canescens PhPl-33 in the culture fluid for 120 hours fermentation accumulated 130 u/ml endo-1,4-β-glucanase activity (CMC-ASE), 210 IU/ml β-glucanase activity, 950 IU/ml endo-1,4-β-xylanase activity of 120 u/ml Fitzroy activity and 110 u/ml pectin-Lesnoy activity.

When planting double quantity of conidia of strain Pen.canescens PhPl-33 in relation to the number of conidia of strain Pen.canescens EgX-29 in the culture fluid for 120 hours fermentation accumulates 80 u/ml of endo-1,4-β-glucanase activity (CMC-ASE), 150 u/ml β-glucanase activity, 550 IU/ml endo-1,4-β-xylanase is aktivnosti, 220 u/ml Fitzroy activity and 180 u/ml pectin-Lesnoy activity.

Example 8. Joint fermentation strain Pen.canescens EgX-29 and strain Pen.canescens PhPlAgl-9 in katalozhnyh flasks.

The method is carried out as in example 7, with varying proportions of inoculum strains Pen.canescens EgX-29 and Pen.canescens PhPlAgl-9.

When planting an equal number of conidia of strain Pen.canescens EgX-29 and strain Pen.canescens PhPlAgl-9 in the culture fluid for 120 hours fermentation accumulate 100 u/ml of endo-1,4-β-glucanase activity (CMC-ASE), 140 u/ml β-glucanase activity, 670 IU/ml endo-1,4-β-xylanase activity, 150 u/ml Fitzroy activity, 130 u/ml pectin-Lesnoy activity and 160 u/ml α-galactosidase activity.

When planting double quantity of conidia of strain Pen.canescens EgX-29 in relation to the number of conidia of strain Pen.canescens PhPlAgl-9 in the culture fluid for 120 hours fermentation accumulated 130 u/ml endo-1,4-β-glucanase activity (CMC-ASE), 190 IU/ml β-glucanase activity, 890 u/ml endo-1,4-β-xylanase activity, 140 u/ml Fitzroy activity of 120 u/ml pectin-Lesnoy activity and 120 IU/ml α-galactosidase activity.

When planting double quantity of conidia of strain Pen.canescens PhPlAgl-9 with respect to the number of conidia of strain Pen.canescens EgX-29 in the culture fluid for 120 hours fermentation accumulates 90 u/ml endo-1,4-β-glucan is heat activity (CMC-ASE), 160 u/ml β-glucanase activity, 570 IU/ml endo-1,4-β-xylanase activity, 190 IU/ml Fitzroy activity, 160 u/ml pectin-Lesnoy activity and 170 u/ml α-galactosidase activity.

Example 9. Joint fermentation strain Pen.canescens EgX-29 and strain Pen.canescens PhPl-33 10-liter fermenter.

The method is carried out as in example 7, with varying proportions of conidia in seeding material, but the co-culturing is carried out in a 10-liter fermenter type ANKUM 2M with a working volume of 6 liters of the Fermentation is carried out at 30°With the environment with sugar beet pulp (30 g/l), peptone (50 g/l) and KN2PO4(25 g/l), pH 4.5. Aeration is 1 volume of air to 1 volume of medium in the fermentor.

When planting an equal number of conidia of strain Pen.canescens EgX-29 and strain Pen.canescens PhPl-33 (in the fermenter at the same time make 10 ml of a water suspension of conidia of each strain with a concentration of 1-2×108conidia/ml) in the culture fluid for 120 hours fermentation accumulate 120 IU/ml of endo-1,4-β-glucanase activity (CMC-ASE), 160 u/ml β-glucanase activity, 750 u/ml endo-1,4-β-xylanase activity, 180 u/ml Fitzroy activity and 140 u/ml pectin-Lesnoy activity.

When planting double quantity of conidia of strain Pen.canescens EgX-29 (12.5 ml water suspension of conidia) in relation to the number of conidia of strain Pen.canescens PhPl-33 (6,5 ml suspense the conidia in culture fluid for 120 hours fermentation accumulated 130 u/ml endo-1,4-β -glucanase activity (CMC-ASE), 220 IU/ml β-glucanase activity, 970 u/ml endo-1,4-β-xylanase activity, 130 u/ml Fitzroy activity and 120 u/ml pectin-Lesnoy activity.

When planting double quantity of conidia of strain Pen.canescens PhPl-33 (12.5 ml water suspension of conidia) in relation to the number of conidia of strain Pen.canescens EgX-29 (6.5 ml water suspension of conidia in culture fluid for 120 hours fermentation accumulates 90 u/ml endo-1,4-β-glucanase activity (CMC-ASE), 160 u/ml β-glucanase activity, 570 IU/ml endo-1,4-β-xylanase activity, 210 u/ml Fitzroy activity and 190 units/ml pectin-Lesnoy activity.

Example 10. Fermentation multicopying strain Pen.canescens EgX-29 together with the strain-producer Pen.canescens PhPlAgl-9 10-liter fermenter.

The method is carried out as in example 8, with varying proportions of inoculum strains Pen.canescens EgX-29 and Pen.canescens PhPlAgl-9, but the co-culturing is carried out in a 10-liter fermenter type ANKUM 2M with a working volume of 6 liters of the Fermentation is carried out at 30°With the environment with sugar beet pulp (30 g/l), peptone (50 g/l) and KN2PO4(25 g/l), pH 4.5. Aeration is 1 volume of air to 1 volume of medium in the fermentor.

When planting an equal number of conidia of strain Pen.canescens EgX-29 and strain Pen.canescens PhPlAgl-9 (in the fermenter at the same time make 10 ml of water suspensibility each strain with a concentration of 1-2× 108conidia/ml) in the culture fluid for 120 hours fermentation accumulates 110 u/ml endo-1,4-β-glucanase activity (CMC-ASE), 150 u/ml β-glucanase activity, 690 u/ml endo-1,4-β-xylanase activity, 160 u/ml Fitzroy activity of 150 u/ml pectin-Lesnoy activity and 180 IU/ml α-galactosidase activity.

When planting double quantity of conidia of strain. Pen.canescens EgX-29 (12.5 ml water suspension of conidia) in relation to the number of conidia of strain Pen.canescens PhPlAgl-9 (6.5 ml of a suspension of conidia in culture fluid for 120 hours fermentation accumulated 140 u/ml endo-1,4-β-glucanase activity (CMC-ASE), 210 IU/ml β-glucanase activity, 870 IU/ml endo-1,4-β-xylanase activity, 150 u/ml Fitzroy activity, 130 u/ml pectin-Lesnoy activity and 150 IU/ml α-galactosidase activity.

When planting double quantity of conidia of strain Pen.canescens PhPlAgl-9 (12.5 ml water suspension of conidia) in relation to the number of conidia of strain Pen.canescens EgX-29 (6.5 ml water suspension of conidia in culture fluid for 120 hours fermentation accumulates 110 u/ml endo-1,4-β-glucanase activity (CMC-ASE), 180 units/ml β-glucanase activity, 610 IU/ml endo-1,4-β-xylanase activity, 220 u/ml Fitzroy activity, 180 units/ml pectin-Lesnoy activity and 210 IU/ml α-galactosidase activity.

Note the p 11. Getting feed complex enzyme preparation with endo-1,4-β-glucanase, 1,3/1,4-β-glucanases, endo-1,4-β-xylanase, Fitzroy and pectin-Lesnoy activity.

The culture fluid obtained by the method as in example 9, when the seeding is equal to the number of conidia of strain Pen.canescens EgX-29 and strain Pen.canescens PhPl-33, subjected to ultrafiltration hollow fibers with a limit of penetration of 10 kDa. The filtrate is freeze-dried and receive comprehensive enzyme activity: endo-1,4-β-glucanase (CMC-ASE - 2500 u/g β-glucanase - 3300 u/g xylanase - 12300 u/g phytase - 3800 IU/g pectin-lease - 3100 units/year

Example 12. Getting feed complex enzyme preparation with endo-1,4-β-glucanase, 1,3/1,4-β-glucanases, endo-1,4-β-xylanase, Fitzroy, pectin-Lesnoy and α-galactosidase activity.

The culture fluid obtained by the method as in example 10, when the seeding is equal to the number of conidia of strain Pen.canescens EgX-29 and strain Pen.canescens PhPlAgl-9, is subjected to ultrafiltration hollow fibers with a limit of penetration of 10 kDa. The filtrate is freeze-dried and receive comprehensive enzyme activity: endo-1,4-β-glucanase (CMC-ASE - 2300 u/g β-glucanase - 3100 u/g xylanase - 11200 u/g phytase - 3300 u/g pectin-lease - 3200, α-galactosidase - 4500 units/year

Thus, h is aemy method allows you to receive the feed complex enzyme preparation, possessing endo-1,4-β-glucanase (1,3/1,4-β-glucanase activity), endo-1,4-β-xylanase, Fitzroy, pectin-Lesnoy and α-galactosidase activity in a unified fermentation process using multicopying strains of the fungus Pen.canescens that eliminates the need for separate components of the complex in different fermentation processes and their subsequent mixing.

1. The method of obtaining the enzyme preparation, characterized in that the preparation with endo-1,4-β-glucanases, β-glucanases, endo-1,4-β-xylanase, Fitzroy and pectin-Lesnoy and α-galactosidase activity, obtained by co-cultivation of two multicopying strains of Penicillium canescens EgX-29 (BKM F-3868 D) producer endo-1,4-β-glucanase with β-glucanase activity and endo-1,4-β-xylanase and Penicillium canescens PhPlAgl-9 (BKM F-3869 D) - producer phytase, pectin-LiAZ and α-galactosidase.

2. The method of obtaining the enzyme preparation, characterized in that the preparation with endo-1,4-β-glucanases, β-glucanases, endo-1,4-β-xylanase, Fitzroy and pectin-Lesnoy activity by culturing two multicopying strains of Penicillium canescens EgX-29 (BKM F-3868 D) - producer endo-1,4-β-glucanase with β-glucanase activity and endo-1,4-β-XI anazi and Penicillium canescens PhPl-33 (BKM F-3870 (D) - producer phytase and pectin-LiAZ.

3. The method of obtaining the enzyme preparation, characterized in that the preparation with endo - 1,4-β-glucanases, β-glucanases and endo-1,4-β-xylanase activity by culturing multicopying strain Penicillium canescens EgX-29 (BKM F-3868 D) - producer endo-1,4-β-glucanase with β-glucanase activity and endo-1,4-β-xylanase.

4. The method of obtaining the enzyme preparation, wherein receiving a drug that has Fitzroy, pectin-Lesnoy and α-galactosidase activity by cultivating multicopying strain Penicillium canescens PhPlAgl-9 (BKM F-3869 D) - producer phytase, pectin-LiAZ and α-galactosidase.

5. The method of obtaining the enzyme preparation, wherein receiving a drug that has Fitzroy and pectin-Lesnoy activity by cultivating multicopying strain Penicillium canescens PhPl-33 (BKM F-3870 (D) - producer phytase and pectin-LiAZ.

6. The strain of the fungus Penicillium canescens PHY-215 (BKM F-3866 D) producing phytase, which contains amplificatoare copies of homologous gene phytase and in which the structural part of the gene encoding the phytase is functionally combined with the promoter region and the sequence encoding the signal peptide β-galactosidase Penicillium canescens.

7. The strain of the fungus Penicillium canescens PEC-23 (BKM F-3852 D) producing pectin-whether the SHL, which contains amplificatoare copies of homologous gene pectin-LiAZ, in which the structural part of the gene encoding pectin-liasu, functionally combined with the promoter region and the sequence encoding the signal peptide β-galactosidase Penicillium canescens.

8. The strain of the fungus Penicillium canescens AGL-3 (BKM F-3871 (D) - producer α-galactosidase, which contains amplificatoare copies of homologous gene α-galactosidase and in which the structural part of the gene encoding α-galactosidase, functionally combined with the promoter region and the sequence encoding the signal peptide β-galactosidase Penicillium canescens.

9. The strain of the fungus Penicillium canescens EgX-29 (BKM F-3868 D) producing endo-1,4-β-glucanase with β-glucanase activity and endo-1,4-β-xylanase, which contains amplificatoare copies of the heterologous gene endo-1,4-β-glucanase Penicillium verruculosum and amplificatoare copies of homologous gene endo-1,4-β-xylanase and in which the structural part of the gene endo-1,4-β-glucanase and endo-1,4-β-xylanase functionally combined with the promoter region and the sequence encoding the signal peptide of endo-1,4-β-xylanase Penicillium canescens.

10. The strain of the fungus Penicillium canescens PhPl-33 (BKM F-3870 (D) producing phytase and pectin-LiAZ, which contains amplificatoare copies of homologous gene phytase is amplificatoare copies of homologous gene pectin-LiAZ, in which the structural part of the gene encoding the phytase and pectin-liasu, functionally combined with the promoter region and the sequence encoding the signal peptide β-galactosidase Penicillium canescens.

11. The strain of the fungus Penicillium canescens PhPlAgl-9 (BKM F-3869 D) producing phytase, pectin-LiAZ and α-galactosidase, which contains amplificatoare copies of homologous genes phytase, pectin-LiAZ and α-galactosidase and in which the structural part of the gene encoding the phytase, pectin-liasu and α-galactosidase, functionally combined with the promoter region and the sequence encoding the signal peptide β-galactosidase Penicillium canescens.



 

Same patents:

FIELD: microbiology, genetics of microorganisms.

SUBSTANCE: invention relates to methods for transduction of anthrax pathogen and closely related bacilli. Method for transduction of Bacillus anthracis and closely related bacilli involves incubation a mixture of bacteriophage with recipient cells taken in the definite ratio. After the first bacteriophage generation in 20 min the preparation of recipient cell receptors is added to the transducing system and the transducing system is inoculated on selective media. Invention describes a method for preparing receptors from recipient cells B. anthracis, B. thuringiensis and B. cereus. Using the proposed method provides the full-value substitution of antiphage serum in the transducing system for a cheaper and simple in preparing component, namely, the preparation prepared from recipient cell receptors that neutralizes phage effectively and prevents excessive death of the recipient strain cells in the transducing system.

EFFECT: improved method for transduction.

9 dwg, 1 tbl, 2 ex

FIELD: immunology, biology.

SUBSTANCE: invention relates to variants of IL-1β-binding molecule having common functionally active sites (CDR sites) and may bind human IL-1β. Said molecules have neutralizing activity IC50 of approximately 50 pM and binding constant KD of approximately 30 pM. Amino acid sequence is described in description of present invention. Variants of DNA constructs encoding of heavy chain and light chain of IL-1β-binding molecule are disclosed. Expression vectors carrying at least one abovementioned nuclear acid and method for production of IL-1β-binding molecules by using the same also are described.

EFFECT: IL-1β-binding molecules against human IL-1β with high neutralizing activity and binding constant useful in suppression of HAMA response.

10 cl, 1 dwg, 3 tbl, 4 ex

FIELD: biotechnology, in particular production of modified swine factor VIII (POL1212).

SUBSTANCE: DNA molecule encoding of modified swine factor VIII is cloned in expression vector, having functionality in mammalian cells. Modified swine factor VIII protein is obtained by cultivation of mammalian cell line BHK CRL-1632 (ATCC), BHK 1632, or CHO-K1, transfected with vector. Therapeutic composition for treatment of subjects suffering from deficit of factor VIII, such as haemophilia, contains effective amount of swine factor VIII protein.

EFFECT: effective agent for treatment of factor VIII deficit.

13 cl, 8 dwg, 7 ex

FIELD: biotechnology, medicine.

SUBSTANCE: invention relates to new recombinant allergens that represent mutants of allergens of the natural origin and comprising at least four mutations. Examples of recombinant allergens are allergens Bet v1 and Ves v1. The primary mutations in recombinant allergen are separated of one another by interval for at least 15 Å and is location is characterized by that at least one circle region of surface of size 800 Å doesn't comprise mutations. Recombinant allergens are used as a pharmaceutical agent as a component of pharmaceutical composition that represents vaccine against allergic response reactions. Invention describes methods for using recombinant allergens in pharmaceutical composition for producing the immune response in subject. Invention represents DNA sequences given in the invention claim that encode recombinant allergens, expressing vector comprising DNA and cell-host for providing the recombinant allergen. Also, invention describes methods for preparing pharmaceutical composition and recombinant mutant allergen. Using recombinant allergen allows decreasing the specific IgE-binding capacity as compared with IgE-binding capacity of the natural allergen. Invention can be used in medicine for preparing vaccine against allergic response reactions.

EFFECT: valuable medicinal properties of allergens.

33 cl, 62 dwg, 10 ex

FIELD: biology.

SUBSTANCE: invention relates to nucleotide sequence associated with increasing or reducing of ovulatory rate in mammalians, namely GDF-9B. Mutated GDF-9B molecule useful in modulation of ovulatory rate in female mammalians is disclosed. Also disclosed are various methods for modulation of ovulatory rate and composition for method embodiment.

EFFECT: method for inducing of sterility or reduced fertility of female mammalians.

30 cl, 14 dwg, 6 tbl

FIELD: biotechnology.

SUBSTANCE: invention relates to isolated nucleic acid sequence encoding of polypeptide with nitrilase activity, wherein nitriles are converted to carboxylic acids in presence of said nitrilase.

EFFECT: method for production of chiral carboxylic acids with high effectiveness and low cost.

10 cl, 4 dwg, 2 tbl, 1 ex

FIELD: veterinary virology.

SUBSTANCE: invention relates to 5 strains of II type porcine circovirus (PCV II) which represents causative agent of porcine post-wealing multy-systemic wasting syndrome (PMWS). Disclosed are various immunogenic compositions and vaccine based on said strains for PMWS prophylaxis and/or treatment. Also disclosed are vectors, viral preparations, cell extracts, cell culture supernatants, containing PCV II or nucleotide or protein components thereof; method for PCV II diagnosis, as well as diagnostic composition and kit.

EFFECT: new agent for treatment of porcine PMWS.

178 cl, 7 dwg, 5 tbl, 19 ex

FIELD: immunobiotechnology.

SUBSTANCE: invention relates to soluble CTLA4, which represents mutant variant of wild type CTLA4 and conserves binding ability to CD80 and/or CD86. Molecules of soluble CTLA4 have the first amino acid sequence containing extracellular CTLA4 region, which includes some mutant amino acid residues in S25-R33 region and M97-G107 region. According the present invention mutant molecules also may include second amino acid sequence, enhancing solubility of mutant molecule. Nucleic acid (NA) molecules encoding said CTLA4 and including NA-vectors also are described. Invention also relates to method for production of mutant CTLA4 and uses thereof in controlling of interaction between T-cell and CD80 and/or CD86-positive cell; suppression of graft-versus-host reaction; and treatment of immune system diseases. Soluble mutant CTLA4 according to present invention binds to CD80 and/or CD86 antigen with higher avidity than wild type CTLA4 or non-mutant CTLA41g.

EFFECT: new preparation for treatment of immune system diseases.

65 cl, 19 dwg, 2 tbl, 2 ex

FIELD: biotechnology and gene engineering.

SUBSTANCE: invention relates to recombinant plasmide encoding hybrid GST-ESAT-6 polypeptide having activities of species-specific mycobacterial ESAT-6 antigen. Plasmide has molecular mass of 3.45 MD and size of 5315 n.p. Recombinant E.coli polypeptide containing such plasmide and recombinant GST-ESAT-6 polypeptide also are disclosed. Recombinant protein has activities of species-specific antigen protein Mycobacterium tuberculosis ESAT-6. Method of present invention makes in possible to simplify purification process of recombinant polypeptide and to produce protein of high purity hawing activities of mycobacterial ESAT-6 antigen without degradation thereof.

EFFECT: earlier species-specific diagnosis of tuberculosis infection.

3 cl, 3 dwg, 4 tbl, 5 ex

FIELD: biotechnology.

SUBSTANCE: method for production L-histidine includes culturing of Escherichia genus bacteria, containing DNA fragment encoding of mutant bacterial phosphoribozyl pyrophosphate synthetase (FRPP-synthetase), and collection of produced and accumulated L-histidine from cultural liquid, wherein in mutant FRPP-synthetase L-amino acid residue, corresponding to 115-position of amino acid sequence in natural FRPP-synthetase from Escherichia coli is replaced by serine residue.

EFFECT: high effective method for production of L-histidine.

11 cl, 1 tbl, 2 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to mutant carbamoyl-phosphate synthase from Escherichia coli wherein amino acid sequence in 947-951-positions of natural carbamoyl-phosphate synthase in replaced with any amino acid sequences from SEQ ID NO:1- SEQ ID NO:9. Similar mutant carbamoyl-phosphate synthase from Escherichia coli containing any deletions, insertion, substitutions, or additions of one or more amino acids in one or more positions excluding 947-951-positions is described. Also disclosed are DNA fragment encoding aforementioned mutant carbamoyl-phosphate synthases, as well as method for production of carbamoyl-phosphate derivatives using strain Escherichia coli modified with said DNA fragment. Further invention relates to various strains Escherichia coli, for instance: strain Escherichia coli 311 that is producer of orotic acid; strain Escherichia coli 333 that is producer of L-arginine and citrulline; strain Escherichia coli 374 that is producer of citrulline.

EFFECT: method for production of carbamoyl-phosphate derivatives such as L-arginine, citrulline, pyrimidine derivatives in increased amounts as compared with natural strains Escherichia coli.

10 cl, 2 dwg, 5 tbl, 4 ex

FIELD: medicine, genetics, biochemistry.

SUBSTANCE: invention relates to new NOS-variants or mutants that comprise structural modifications in site Akt-dependent phosphorylation. Modified NOS-proteins or peptides, in particular, human proteins or eNOS-peptides having change of amino acid residue corresponding to S/T in motif of the consensus-sequence RXRXXS/T of NOS-polypeptide of wild type and nucleic acid molecules encoding thereof can be used in genetic therapy and proteins and NOS-peptides can be used in screening methods of agents modulating activity of NOS. The advantage of invention involves the creature of new NOS-variants or mutants that can be used in genetic therapy.

EFFECT: valuable medicinal properties of mutants.

25 cl, 1 tbl, 9 dwg, 3 ex

FIELD: genetic engineering, molecular biology, biochemistry.

SUBSTANCE: recombinant plasmid DNA pTES-His-OPH is constructed for expression of polypeptide eliciting properties of organophosphate hydrolase comprising Cla I/Hind III fragment of plasmid pTrcTEGF, fragment of plasmid pTES-OPH with nucleotide sequence that encodes amino acid sequence of the matured form of organophosphate hydrolase, and nucleotide sequence encoding 6 histidine residues that is located by 5'-end of nucleotide sequence encoding organophosphate hydrolase. Based on indicated plasmid the strain Escherichia coli TSKMIBKH-29 - a producer of polypeptide eliciting properties of organophosphate hydrolase is obtained. Applying the invention provides preparing polypeptide with properties of organophosphate hydrolase by simplified technology and this polypeptide elicits the improved catalytic effectiveness of action with respect to thio-containing phosphoric acid triesters. Invention can be used for carrying out hydrolysis of organophosphate compounds.

EFFECT: valuable biochemical properties of producer.

2 cl, 4 dwg, 2 tbl, 4 ex

FIELD: biotechnology, in particular method for production of L-amino acid except L-glutamic acid.

SUBSTANCE: claimed method includes cultivation of bacteria Methylophilus, which is capable to grow utilizing methanol as a main carbon source and to produce L-amino acid; and collection L-amino acid from culture. For example, bacteria Methylophilus with increased activity of dihydrodipicolinate synthase and aspartokinase is used. Said activity is increased by introducing DNA encoding dihydrodipicolinate synthase which is not inhibited with L-lysine by negative back coupling, and DNA encoding aspartokinase which is not inhibited with L-lysine by negative back coupling, into cells.

EFFECT: increased yield of L-amino acids.

10 cl, 7 dwg, 6 tbl, 7 ex

FIELD: biotechnology, in particular prephenate dehydrotase-chorismatmutase and DNA fragment encoding the same.

SUBSTANCE: prephenate dehydrotase-chorismatmutase is isolated from Methylophilus methylotropus and may contain replacements, deletions, inserts, or incorporations of one or more amino acids. Said enzyme plays an important role in L-phenylalanine biosynthesis. Method of present invention makes it possible to improve L-phenylalanine production due to increased activity of enzymes involving in L-phenylalanine biosynthesis pathway.

EFFECT: improved L-phenylalanine production.

2 cl, 2 dwg, 1 tbl

The invention relates to the field of biotechnology and concerns get a new polyketide-synthase, required for biosynthesis epothilones a and b

The invention relates to biotechnology, in particular genetic engineering

FIELD: microbiological industry, biotechnology.

SUBSTANCE: invention relates to production of bacterial preparations. Method involves construction of recombinant plasmid DNA comprising gene determining the resistance to erythromycin (ErmC), sequence of DNA fragment of B. thuringiensis subsp. tenebrionis encoding synthesis of δ-endotoxin cry IIIA, sequence of DNA fragment of chromosome B. thuringiensis subsp. kurstaki of size 448 nucleotide pairs, sequence of DNA fragment of chromosome B. thuringiensis subsp. kurstaki of size 501 nucleotide pairs, and sites for cleavage with restriction site-specific endonucleases Eco RI, Pst I, Bam HI, Hind III and Kpn I. The strain B. thuringiensis subsp. kurstaki comprising the indicated recombinant plasmid DNA is prepared. Invention provides preparing the strain B. thuringiensis possessing the enhanced insecticide activity with respect to representatives of Lepidoptera, Coleoptera and Homoptera orders showing the damage effects on agriculture cultures and crops.

EFFECT: valuable properties of plasmid DNA.

3 cl, 5 dwg, 6 tbl, 4 ex

Up!