Glycoprotein vi as collagen recombinant receptor on platelets and its using in pharmaceutics

FIELD: genetic engineering, biotechnology, biochemistry, medicine, pharmacy.

SUBSTANCE: invention relates to DNA encoding glycoprotein VI (GP VI) used as a base for synthesis of recombinant GP VI by method of recombinant DNAs followed by its using for the development of pharmaceutical compositions possessing with capacity for inhibiting or blocking interaction of platelets with collagen. Using the invention provides preparing GP VI in the recombinant form and using this agent for therapeutic aims.

EFFECT: valuable medicinal properties of glycoprotein VI.

6 cl, 4 dwg, 6 ex

 

The invention relates to glycoprotein VI (GPVI), its isolation, purification and method for producing a recombinant methods. In particular, the invention relates to the use of GPVI, preferably recombinant GPVI, for the treatment of disorders and pathologies that are either directly or indirectly associated with such disorders of blood coagulation, as thrombotic and cardiovascular disease. Extracellular recombinant protein can also be used for screening for potential inhibitors associated with membrane GPVI with the aim of inhibiting the interaction of platelets with collagen. During the lifetime of the platelet in vivo (in vivo) GPVI on its surface is modified and can be used as a marker to determine the age of the platelet.

Glycoprotein VI is a glycoprotein 62/65 kDa (unrestored/restored respectively) of the platelet membrane, which forms a complex with a shared subunit of Fcγ. Subunit GPVI contains the website linking collagen and subunit Fcγ. responsible for the alarm. This complex is one of the major collagen receptors on the surface of the platelet, responsible for activation of the platelet with respect to collagen. Probability of a sequence of collagen consists of placentas is Teleostei (GlyProHyp)n. Known patients from Japan with a genetic deficiency of GPVI. They have problems with blood clotting and platelet very poorly respond to collagen, probably through other receptors. It was found that the signaling cascades GPVI viable; these cascades have a great resemblance to signaling cascades immune receptors, including receptors of T cells, b cells and receptors of natural killer cells. These cascades include group src tyrosinekinase, such as Fyn and Lyn, as well as p72SYKand many other tyrosine kinase, phosphatase and adapter type LAT. The main purpose of these cascades, activation of phospholipase Cγ2, which cleaves phospholipids on the second molecules diacylglycerol and IP3. It is assumed that GPVI is involved in the activation of integrin α2β1 platelet, which plays a major role in the adhesion of platelets to the damaged vessel wall. Mouse off-subunit of Fcγ. have platelets that are still respond to collagen, which implies that the rest αR must also regulated by complex GPVI/Fcγ.

The collagen receptor GPVI platelet closely connected with activator receptor family p58KAR natural killers FcαR.

The adhesion and activation of resting platelets circulating in the damaged portion of the vessel, is the first step in the process that leads to the formation of t is AMBA, which is converted to a hemostatic plug. Collagen is one of the main components of the vessel wall, which is responsible for platelet activation. There are many types of collagen, and seven of them are found in the subendothelial layers. On the platelets identified several different receptors for collagen, but at present considered to be the main integrin α2β1and neinteen GPVI. Besides, that α2β1comprehensively studied, and both subunits were cloned and sequenced a few years ago, the structure of GPVI remains outstanding, although defined some of its properties. About twenty years ago it was found that GPVI is the major glycoprotein of the platelet; it has a weight in the range of 60-65 kDa and acidic pi. His role as the alleged receptor collagen was installed after it was discovered that platelets from a patient from Japan with poor blood clotting have a specific defect - they react poorly to collagen and they do not have these receptors. In addition, this patient had antibodies to the missing receptor, with which it was possible to define other characteristics of the molecule. Later it was found that GPVI forms a non-covalent bond with a common subunit of Fcγwhich functions as a signal cha is th complex. In addition, it was shown that recognizes GPVI sequence of collagen is a repeating triplet Gly-Pro-Hyp inside the triple helix structure of collagen, and that is based on the structure of synthetic peptides can be used as a specific against GPVI agonists. It is established that the complex GPVI/Fcγ signal inner part of the platelet by the immune mechanism of receptor types, including activation p72SYKand causes a cascade of interactions kinase/phosphatase/adapter protein, which leads to activation of the PCLγ2 and, consequently, to the release of granules and platelet aggregation. The next step in clarifying the characteristics of this molecule was made, when it was discovered that the snake lectin C-type, convulxin tropical rattlesnake Crotalus durissus terrificus can activate platelets by clustering of GPVI in the course of the multidimensional interaction. It was shown that convulxin forms a specific relationship with GPVI, which allowed on this basis to develop a method of purification of this receptor.

From all this it follows that the connection GPVI is of great interest to many therapeutic areas, and it is particularly important application belong to the sphere, which is connected directly or indirectly with the coagulation of the blood, which depends on the collagen-trombotsitnoy shimodate. In this regard, the purpose of the present invention consisted in obtaining GPVI in recombinant form and to demonstrate its effectiveness in a direct therapeutic purposes, and also as a tool for screening of short connections, especially synthesized or chemically synthesized compounds, with the ability to inhibit or block the interaction between natural and platelet collagen. The invention relates also to the portions or fragments of the GPVI protein that retained its biological activity, which is expressed in the ability to form relationships with collagen.

The invention has been successfully implemented in the clean-up plan adequate quantities of GPVI for preliminary studies and sequencing of peptides. Sequences were used to design primers for PCR to identify positive sequence in the library DNA. This DNA sequence is further used as a detector for selecting from a library of almost complete sequence of the cDNA, and the missing 5'sequence was obtained by the method of the RACE from a cDNA library of platelets.

The invention has been successfully implemented also in terms of demonstrating the application of recombinant GPVI as therapeutically applicable connection that is capable of when it is nae the treatment, for example, a patient with damaged blood vessels, to bind collagen and, thus, prevent platelet associated with membrane GPVI, which appear during the formation of ties with called collagen. Soluble recombinant extracellular domain of GPVI contains binding collagen website and can prevent platelet activation by collagen. Thus, it can be used to treat symptoms of diseases that cause increased platelet activation by collagen, such as atherosclerotic destruction of platelets, for diseases such as unstable angina, or during surgery, such as subcutaneous transilluminated coronary angioplasty (RTS), which resume the patency of the arteries by introducing a balloon of catheter, causing substantial damage to the walls of blood vessels and activation of a large number of platelets, which often leads to later re-plugging. The advantage of using recombinant fragments of GPVI in comparison with existing therapies is that they begin to act at an earlier stage by preventing or slowing down the activation of platelets, not by suppressing the effects resulting from the activation of platelets, such as aggregation of the Academy of Sciences of the agonists GPIIb-IIIa. Thus, a smaller amount content trombotsitnoy granules, including growth factors and chemokines that are involved not only in healing, but in the reconstruction of the vessel wall due to the movement of smooth muscles, and also to attract phagocytic cells such as monocytes, which stimulate atherosclerosis. For the same purposes and with the same effect to block GPVI on the surface of the platelet, you can apply the Fab fragments close to human mouse monoclonal antibody against GPVI.

Recombinant GPVI in this invention can be applied also in linking the analysis of collagen for screening small molecules (e.g., combinatorial libraries), which can inhibit this interaction and which can be used to obtain therapeutic compounds which are inhibitors of the interaction of collagen with platelet. By appropriate derivatization of these compounds can be made suitable for oral administration. The main purpose of this invention to provide compounds that reduce the interaction of GPVI-collagen and, therefore, the platelet activation in situations when there is contact of platelets with collagen. Technology screening, similar to those used in this invention is well established in the prototype. When using the AI of such screening, the invention allows to detect and to obtain new target who, as antagonists of collagen, to inhibit the formation of natural membrane-bound GPVI on the surface of the platelet. These targets, which can be a small chemical molecule, can form the basis for further inventions.

Another important use of GPVI and reagents that recognize specific domains GPVI, is their use as markers of age and functionality of the platelet. It is assumed that in General young platelets are more active and functional than they are older. Convulxin - pectin is a type of snake venom - binds and activates young platelets, because it is specific to GPVI, however, as the aging of platelets is binding and the activation level is reduced. This can occur due to either proteolytic or conformational changes GPVI or his associates with Fcγ. as a result of activation of the platelet or circulation disorders. This can be a useful parameter to measure during a medical examination of the age and functional profiles of platelets in patients and in healthy people. The age profiles of platelets change in many diseases affecting the bone marrow or immune system and if it will be developed the best methods for their determination, can become an important criterion in the diagnosis of, for Example, patients with diseases that are associated with accelerated update of platelets, should be a relatively large number of young platelets, while patients who undergo chemotherapy or radiation, will prevail over the adult population. Thus, these age profiles can be used for precise control of the treatment process. In relation to a healthy population on the distribution of age profiles and their role as a prediction parameter, very little is known. It is unknown whether changes in GPVI due to the partial involvement of platelets in the event crowoostanawlivataya, and whether changes are more pronounced in patients with extensive cardiovascular disease. At the present time to determine young reticulated platelets containing mRNA, is used titlovi orange. This mRNA is rapidly decreasing, limiting the applicability of the method only the young platelets. The reagents that would be used in this analysis should include specific to GPVI protein from snake venom, such as convulxin, or monoclonal, or polyclonal antibodies that recognize the N-end GPVI, or monoclonal antibodies, which recognize new sites or structures caused by proteolysis of domains all N, Lieb is a specific structure, present only in the intact molecules and missing in old molecules, or Vice versa, or small chemical entities selected for specific identification of intact GPVI, or a modified form. These reagents can be tagged with a fluorescent marker or a second antibody with a fluorescent label, or a reagent with specific affinity; they can be applied flow cytometry to measure the profile of the binding of platelets. At a later stage, the alternative can be implemented less time-consuming method of using the apparatus for automatic measurement of profiles of platelets. Using such methods of sorting cells as flow cytometry or magnetic, it will be possible to distinguish young and old platelets to study the factors affecting the removal from the circulation system of the old platelets. For such studies are key reagents that recognize specific forms of GPVI.

Thus, the object of the present invention is the coding DNA for Glycoprotein VI or their biologically active fragments, especially the sequence represented in figure 2.

Another object of the present invention is the coding DNA for Glycoprotein VI, including amino acid sequences, provided the law Figa and 1b.

As the subject of this invention is a pharmaceutical composition comprising an effective recombinant GPVI together with a diluent that is acceptable from the point of view of the pharmaceutical industry, the media or excipient, and its use for the production of drugs for the treatment of thrombotic and cardiovascular diseases, and disorders associated with the interaction of platelets with collagen. This pharmaceutical composition along with the specified protein can contain other known from the prior art pharmaceutically active compounds suitable for treatment of the above diseases and disorders

In addition, the subject of this invention is the use of recombinant GPVI as a tool for screening for specific inhibitors of the interaction of platelets with collagen.

Another object of this invention is the use of GPVI as a marker of age-platelet and for the detection of cardiovascular disease.

Possible medical conditions and destinations, respectively, are, for example, unstable angina, RTCA, insertion of stents, surgery on the heart vessels, common operations on blood vessels, operations that may cause damage to larger blood vessels, such as hip what's joints. In addition, there are all the indications that are associated with thromboembolic phenomena caused by disorders of the interactions of the vessel wall with the coagulation system that leads to a high risk of blood clots and blockage of blood vessels.

As shown above, the GPVI protein and fragments thereof according to this invention suitable for use as a pharmaceutically effective compounds in pharmaceutical compositions and combinations.

Pharmaceutical recipes in this invention may include additional active ingredients, such as anticoagulants such as hirudin or heparin or thrombolytic agents such as plasminogen activators or lamentin or antagonists of other receptors of platelet, for example antagonists of GPIIb-IIIa inhibitors such as abciximab or eptifibatide or antagonists of ADP-receptor, such as clopidogrel.

In this invention a new protein and its biologically active fragments, respectively, can form pharmaceutically acceptable salts with any non-toxic organic or inorganic acids. As inorganic acids can be used, for example, hydrochloric, Hydrobromic, sulfuric or phosphoric, as well as acid salts of metals such as monohydrogenphosphate sodium and gidrogensulfat potassium. Note the Rami of organic acids are mono-, bi - and tricarboxylic acid type acetic, glycolic, lactic, pyruvic, malonic, succinic, putilovo, fumaric, malic, tartaric, citric, ascorbic, maleic, hydroxymaleimide, benzoic, hydroxybenzoic, phenylacetic, cinnamic, salicylic acid and sulfonic acid type methanesulfonic acid. Salt carboxykinase components of amino acids include non-toxic salts of carboxylic acids, which are formed in their reactions with any suitable inorganic or organic bases. In these salts may include, for example, alkali metals such as sodium and potassium, alkaline earth metals such as calcium and magnesium, light metals of group IIIA including aluminum; and organic primary, secondary, and tertiary amines, such as trialkylamines, including triethylamine, procaine, dibenzylamine, 1-ethenamine, N,N'-dibenziletilendiaminom, dehydroabietylamine and N-alkylpiperidines.

In the context of this invention, the term "pharmaceutically acceptable carrier" refers to an inert, non-toxic solid or liquid filler, solvent or kapsulirujushchej material that does not react with the current connection or with the patient's body. Suitable, preferred liquid carriers are well known in the pharmaceutical industry, these include, for example, sterile water, fisr is the target. liquid dextrose, sugar syrups, ethanol, glycols and oils, including oils, petroleum, animal, vegetable or synthetic origin, such as peanut, soybean and mineral oil.

The drugs with the recipe in this invention may be administered in the form of unit doses containing appropriate non-toxic pharmaceutically acceptable carriers, solvents, auxiliary medicinal substance and a binder, which is typically used in pharmaceuticals for parenteral purposes.

The term "parenteral" includes subcutaneous, intravenous, intra-articular and intratracheal injection and infusion techniques. It is also possible oral destination and local application. Parenteral formulations and combinations is most preferable to assign intravenously or in the form of pills, as well as the permanent fusion by well-known methods. Tablets and capsules for oral assignments contain suitable excipients, such as binders, fillers, solvents, tabletiruemye substance, lubricant components, dezintegriruetsja agents and moisturizers. On tablets it is possible to form the coating by known pharmaceutical methods.

Liquid oral medications may be administered in the form of aqueous or oily suspensions, solutions, emulsions, syrups and elixirs; they can be represent the go as the dry substance, intended for dilution prior to taking in water or other suitable media. Such liquid preparations may contain suitable additives of type suspendida or emulsifying agents, non-aqueous carriers and preservatives. Preparations for local application can be aqueous or oily suspensions, solutions, emulsions, jellies, or - preferably - ointment.

A single dose of the present invention may contain the required daily amount of protein on a given invention or multiple parts from which it is possible to combine the daily dose. Optimal therapeutically acceptable dosage and dose required for a given patient (mammals, including humans)depend on many factors such as the level of activity associated with the activity of the patient's age, weight, General health, sex, diet, time and rate of the drug, an object of treatment, i.e. treatment or prevention, the nature of the thrombotic disease, the severity of antitromboticos or anticoagulant activity.

In the compositions and combinations, are shown for a particular patient (in vivo) as anticoagulants, pharmaceutically effective dose of the peptides according to this invention ranges from about 0.01 to 100 mg/kg body weight, preferably from 1 to 10 mg/kg of body weight. Depending on the method of application of a single dose may contain from 0.5 to 10 mg of inhibitor of collagen. To achieve anticoagulation effect in artificial blood, pharmaceutically effective amount of the peptides according to this invention is from 0.2 to 150 mg/l of artificial blood, preferably from 1 to 20 mg/L.

Brief description of drawings

Figure 1. Protein GPVI sequence (one-letter code):

1A: the Leading sequence

1b: the Mature protein

Open reading frame: 339 amino acids

Asterisk:The site of glycosylation
Double underline:Transmembrane domain
Underline:Sequenced peptides

Figure 2. The nucleotide sequence of GPVI, encompassing an open reading frame of 1017 BP plus region 3 ' and 5'in total - 1249 BP

Detailed description of the invention

For the synthesis of DNA primers were selected two sequences of 7 amino acids with minimal degeneracy of the genetic code with the aim of enlarging using cDNA plot GPVI in the PCR reaction. Since, in General, the localization of both peptides in the protein was not known for each of them were prepared with two degenerate primers - one see Slavoj and one antisense. These primers were used for expansion of the library of human bone marrow. The combination of a sense primer 5'TYA CNG THC CAN TGA ARMG 3' sequence encodes PAMKRSL, and antisense primer 5'TTR TAN FRN GCR AAY TGR TC 3' corresponds ukrupnennom DQFALYK the DNA fragment of 221 pairs of bases in Addition to the selected peptides amplificatory DNA encodes LysC/AspN peptide DQLELVATGVFAKPSLSAQPGPAVSS, whereby associates the sequence with the cDNA for GPVI.

Screening of 600,000 pfu from the library of the bone marrow using this DNA fragment of 221 pairs of bases allowed to get 4 positive pfu. Three of them had inserts of 1350 pairs of bases, cut restrictase Sal I and EcoR I and belong to the superfamily of IgG. The fourth had a box 4.6 thousand heterocyclic bases of the nucleotides of the nucleic acid obtained by cleavage using Sal I, and after processing EcoRI gave two fragments of 2,300 pairs of bases and 1300 pairs of bases, respectively. Her DNA encodes the sequence for 10 peptides obtained by amino acid sequencing GPVI, but broken aminobenzene. Was not detected in any source of methionine or a leader sequence, however, was attended by more than 2000 pairs of bases of pre-sequenced naschityvala the scope of DNA-terminated sequence of the Alu. The RACE experiment with conc is m 5′ was carried out on poly - A RNA platelet with primers localized in the fragment sequence GPVI, enhanced peptide sequences. To return to the prescribed sequence GPVI were found a Fragment of 348 pairs of bases, including 278 pairs of bases of the sequence of the fourth clone and 70 new pairs of bases from 1987 pairs of bases corresponding to 14 amino acids, including methionine. Thus, it was possible to sequence cDNA containing, in total, 1249 pairs of bases, the 5' sequence of the 25 pairs of bases preceding the start codon, an open reading frame of 1017 pairs of bases coding for the protein, including a leader sequence of 339 amino acids and the region 3' of 207 pairs of bases, including the stop codon.

With the aim to fill the missing 5' sequence was cloned cDNA encoding a platelet GPVI; cloning and sequencing was performed from cDNA library of human bone marrow using RACE with platelet mRNA. The open reading frame of 1017 pairs of bases encodes a 339 amino acids and noncoding region 3'. In the analysis of the hydrophobicity of the amino acid sequence of the obtained protein was detected the presence of two presumably transmembrane domains, presumably the signal sequence of 20 amino acids and the domain between the OS is Adami 247 and 265, consisting of 19 amino acids. The sequence and its amino acid translation is shown in figure 2 and 1. Comparison with amino acid sequences most similar molecules from the Bank of genes with evidence that the sequence belongs to the immunoglobulin superfamily, and the extracellular domains of two spiral Ig domain C2 formed by two disulfide bridges. One of the molecules belongs to the class of penetrating through the membrane proteins with N on the surface and passes through the membrane once. Molecules with the shortest connections belong to the class of receptors of natural killers, which contains as inhibitors and activators. It is obvious that GPVI belong to the subclass of activators not only because of their function, but also because they, unlike the molecules of a class of inhibitors that do not contain sequence ITIM in their cytoplasmic domains. In addition, they do not contain any tyrosine residues that could be involved in phosphorylation. In this domain, there is a certain amount treoninove and serine residues, but they do not meet the criteria for sequences of General common elements of the structure of the kinase. As the receptors of NK class of activators, GPVI contains agronomy balance as a third amino acid penetrating cher the C membrane domain, who takes part in the formation of the complex with subunit Fcγ. The cytoplasmic domain contains 51 amino acids and has only a very slight resemblance (in the area that is directly under the membrane with the cytoplasmic domains of other members of this family. Accordingly, we should expect that this domain in GPVI may be associated rather with other types of cytoplasmic molecules than with the other members of the family. GPVI contains only presumably N-glycosylase site Asn69. However, the domain that is directly over the membrane after beta-layers of the end of the Ig domain, contains many Tihonovich and serine residues that can provide sites of O-glycosylation, found in similar GPIbα and GPV. The main function of this O-glycosylation is the delivery of receptor structures, propagating away from the surface of the platelet, which facilitates interaction with their bulky ligands. As previously GPVI was identified as sialoglycoprotein, the difference in molecular mass between theoretical value of the mass of amino acids (37 kDa) and the value obtained using gel electrophoresis (65 kDa recovered substances), should be explained that glycosylation.

Using rentgenotomograficheskie the analysis was established structure of receptors of natural killer two types of domains and has been shown to what two Ig domain form an acute angle with the receptor site for load-bearing peptide of HLA antigens, located on the outer part of the corner. A direct comparison of the structure of the site, linking HLA peptides, collagen structure allows to make a conclusion about common sources of these receptors, because the repeated alpha-spiral structure of the site, linking HLA and peptides, which it contains, is extremely similar to the triple helical structure of collagen. Postulated that the receptors of natural killers operate on the mechanism of dimerization, with the help of two receptors that recognize two separate sites on HLA cell, which explores cell-killer. It is possible that this dimerization is part of the mechanism of activation or deactivation depending on the class of receptor. In the case of GPVI must exist the possibility that two molecules GPVI will be combined with one Fcγ., since each monomer of the dimer Fcγ. has the recognition sequence. However, the stoichiometry is still unknown, and, based on the structure of collagen, it can be assumed that the signal strength collagenopathy peptides that act through GPVI and convulxin depends on the number of formed complexes GPVI/Fcγ. Other platelet receptors belonging to this family of Ig are ICAM-2 (CD102) and RESOURCES (CD31).

All microorganisms the isms, colonies of cells derived from a single common ancestor, expression systems, the owners of the expression plasmids, promoters, resistance markers, sources of replication, restriction sites or other fragments and parts of the vectors, which are mentioned in the description, are not directly related to the subject matter of this invention they are commercially and publicly available. Unless otherwise noted, these materials are used only as examples, are not important for the invention and may be replaced by other instruments and biological materials.

The techniques that you want to use in this invention are described in detail above and below. For other methods, which are widely known, detailed description is not here, but presents links to related patents and literary sources, where they are described in sufficient detail (for example, Sambrook and others, 1989, Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor; Harlow, and Lane, 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor).

EXAMPLES

Materials protein a-sepharose, coupled with peroxidase, goat antimurine and anti-rabbit antibodies, bovine serum albumin, the venom of Crotalus durissus temficus, agglutinin wheat germ (WGA), 4% of testing those aragosa cross, activated N-hydroxysuccinimidyl and Triton X-114, purchased from Sigma Chemical Co. (St Louis, MO), octane is l-N-methylglucamide (ONMG) and nonanoyl-N-methylglucamide (NNMG) from Oxyl Chemie (Bobingen, Germany).

Example 1: Allocation of GPVI platelet membrane glycoproteins were isolated from platelets by previously described methods. Briefly, platelets (40 bright layers of a blood clot) washed and dissolved in 2% Triton X-114 in the presence of protease inhibitors. Separated Triton X-114 from the aqueous phase and the detergent phase was loaded onto a column of agglutinin wheat germ associated with separate 4 C. the platelet Glycoproteins were suirable through 10 mm Tris HCl, pH 7.4, 30 mm NaCl, and 0.2% octanol-N-methylglucamide (ONMG) and 2% N-acetylglucosamine. After dialysis and concentration of the solution of glycoproteins was loaded into the column convulxin associated with 4% testing those argosey cross (1 mg/ml), activated N-hydroxysuccinimidyl-p-nitrophenylphosphate. The column was washed with 4 volumes of 10 mm Tris HCl, pH 7.4, 30 mm NaCl, 0.2% nonanoyl-N-methylglucamide (NNMG), then 4 volumes of 10 mm Tris HCl, rn,4, 30 mm NaCl and 2% NNMG. GPVI has suirable 0,08% solution of SDS in 10 mm Tris HCl, pH 7.4. The solution was concentrated and loaded onto a preparative gel of 8.5% polyacrylamide; used to install the Model 491 Prep Cell (BioRad, CA). Preparative electrophoresis was carried out under the conditions described in the manufacturer's instructions for installation, which are not given here. In the elution GPVI received a single band at 65 kDa. Faction advocated, was concentrated on the installation Method Is 0 (Amicon, Beverly, MA) and re-suspensible in 10 mm Tris HCl, rn,4 and 0.1% ONMG.

Example 2: Analysis of amino acid GPVI - GPVI was digested endoproteinase LysC and AspN (Boenringer Mannheim, Germany). Received 10 peptides were separated using liquid chromatography high resolution (HPLC) with reversed phase and sequenced on a pulsed liquid phase protein sequencing machine Applied Biosystem model A combined with phenylthiohydantoin the amino acid analyzer model 120A.

Example 3: Amplification of a fragment of 221 BP, encoding a plot of GPVI cDNA library λ gt11 -

The sample (1010pfu) (plaque-forming number) from a library of human bone marrow (Clonetech, Palo Alto, CA) was amplified using two combinations of the 4 degenerate primers. The final concentration of primers was 2 μm, the concentration of dNTP was 200 μm and used 2 U/100 ál reaction AmpliTag Gold (Perkin Elmer, Rotkreuz, Switzerland). Conditions for PCR were as follows: 5 cycles at 37°C, then 30 cycles at 44°C. Semantic 19mer 5' TYATHCCNGCNATGAARMG 3' and antisense 20mer 5' TTRTANARNGCRAAYTGRTC 3' amplified a fragment of 221 pairs of bases, which was subcloned in Bluescript KS+(Stratagene, La Jolla, CA) and sequenced using a sequencing machine T7 Sequenase kit (Amersham, Switzerland).

Example 4: Screening of the cDNA library λdi using sample GPVI with 221 pairs - a Fragment of 221 pairs of bases tore from plasmas the water, cleared and marked α32P-ATP (20 IEC/50 ál, Hartmann Analytik, Braunschweig, Germany) using High Prime Labelling kit (Boehringer Mannheim, Switzerland). Screening libraries of human bone marrow produced in accordance with the manufacturer's instructions installation. Cultivated positive phages were isolated their DNA and subcloned into the BlueScript using sites either EcoRI or Sal I, and then sequenced. Sequencing was performed with the use of the ABS system RACE - Platelet, poly - A RNA was obtained by previously described methods (Power and others, Cytokine 7, 479-482, 1995). Reverse transcription (30 μl) was carried out using 5 μg of poly - A RNA primer 5'TGAATGAGACGGTCAGTTCAGC 3' (20 μm), dNTP (1 mm), PHKsin (40 U), buffer 1X AMV and 20 U AMV reverse transcriptase for 20 min at 45°S, then for 20 min at 52°C. Next, the reaction mixture was processed using 2 μl of 6N NaOH at 65°C for 30 min, neutralized using 2 μl of 6N acetic acid and concentrated in Method 30 (Amicon). The anchor was attached to the first DNA strand according to the system of Aptes and Siebert (BioTechniques 15: 890-893, 1993). Vnutrennuu PCR was conducted using primer, complementary to the anchor primer 5'TTGTACAGAGCAAATTGGTC 3' (35 cycles, 55°C), then primer 5'GACCAGAGGCTTCCGTTCTG 3' (30 cycles at 53°). The highest band (350 pairs of bases) was separated by electrophoresis in agarose from the lower, then it was subcloned into BlueScript, then what was venerabili.

Example 5: Receiving anti-GPVI Fab and F(ab')2- polyclonal anticigarette against human GPVI was developed in rabbits. IgG from rabbit antisera anti-GPVI was purified as described previously. To obtain Fab fragments produced cleavage of IgG using immobilized papain (Pierce) according to the standard practice of the provider. The Fab fragments were separated from undigested IgG and Fc fragments using a column with immobilized Protein Protein A (Sigma). The flow cell was transformed into a dialysis tube, made preconcentration using solid polyethylene glycol 20000 and spent dialysis to end on a background of 20 mm Hepes, 140 mm NaCl, 4 mm KCI, pH 7.4 and kept the product at 4°before it is used. Fragments F(ab')2received by pepsin cleavage of IgG at a ratio of enzyme and the basis of 1:50 (weight/weight)in 0.5 M acetate buffer, pH 4,0, at 37°C for 18 hours. Then brought the pH to 7.4 using diluted NaOH and the sample was subjected to dialysis in 20 mm phosphate, pH of 7.4. Fragments F(ab')2separated from undigested IgG and Fc fragments using chromatography with Protein A. the Flow-through cell was transformed into a dialysis tube, made preconcentration using solid polyethylene glycol 20000 and carried out intensive dialysis in 20 mm Hepes, 140 mm NaCl, 4 mm KCI, pH 7,4; the obtained product was kept in aliqu is the shaft quantities at -20° C. the Washed platelets were dissolved in Triton X-114 and produced a separation of the phases on the soluble material, followed by separation of membrane glycoproteins associated with the phase of the Triton X-114, the method of affinity chromatography on agglutinin-sepharose wheat germ 4B according to previously described methods. Since GPVI is a very small fraction of sludge glycoproteins membrane of platelets, to highlight this receptor used the specificity of snake lectin C-type convulxin. Affinity chromatography on convulxin associated with separate 4B can be obtained as the main product protein 65 kDa. Thus together with GPVI were suirvey unexplored materials with higher or lower Mr which could not be removed by thorough washing of the column. Therefore, as a final step of purification was performed preparative gel electrophoresis on 8.5% polyacrylamide. After settling fractions containing GPVI, found by repeated analysis of a single strip. Purified GPVI was subjected to tests to determine their ability to block platelet aggregation by collagen. When added to suspensions of platelets aliquot solutions GPVI observed a weak inhibitory effect. However, after pre-incubation GPVI with collagen then add it to the suspension of thrombi the comrade had an inhibiting effect, the degree of which depended on the input dose GPVI. Platelet aggregation was resumed after the introduction of a new portion of collagen. When neustanovivshiesya conditions selected protein had Mr 62 kDa with a shift towards a slightly higher Mg (65 kDa) under reducing conditions. Since it was found that the amine ends of GPVI blocked, produced cleavage of protein enzymes LysC and LysC/AspN, the result is 4, and 6 peptides, respectively, from which he received sequence. Separation of peptides was performed using HPLC with a reversed phase C4 column, then sequenced by Edman method. Amino acid sequences are underlined in figure 1, which presents the translated cDNA sequence.

The DNA fragment encoding the first 187 amino acids of the Mature receptor GPVI (3 and 4 exons), amplified by PCR by reading the information polymerase with GPVI cDNA full length using primers 5'CTTGGATCCGATTGAGGGACGCCAGAGTGGACCGCTCCC the 3' (sense) and

5'TGCGGACCTTAGGTTCCTGTGACCACAAG 3 (antisense). [DNA fragment 687 BP]. The DNA sequence for the site of cleavage by factor XA was introduced in semantic primer to remove the 6 x his-tag - tag encoded by the vector. The PCR fragment was introduced into plasmid pQE31 (Quiagen)obtained by the design of the transformed E. coli M 15 [pREP4]. For expression transformera the major E. coli were grown in the form of a series in a 5-liter fermenter 0,9D 600after administration of 0.2% lactose. After 4 hours of E.coli were collected, identified the body on and was slowly dissolved in Tris/phosphate buffer containing 6M guanidine/HCl (pH 8.0) and the supernatant was placed on a Ni-NTA column (Quiangen). The column was washed immediately after elution of 6 x His-tag protein in Tris/phosphate buffer containing 6 M guanidinium/HCl at a 5.1. Analyses lirovannomu peak by gel electrophoresis showed a major band at 26 kDa and several individual peaks with significantly lower molecular weight. Recombinant fragment GPVI incubated with DTT to reduce disulfide bonds formed in E. coli. Recovery folding initiated by the gradual addition of buffer to restore folding (40 mm NaHPO4pH 8,0,150 mm NaCl, 10% glycerol, 0.01% of CHAPS and restored glutathione GSH/oxidized glutathione GSSG) with the Association buervenich column of Ni-NTA fractions. After the restoration of folding and Valitov recombinant fragment GPVI was purified by chromatography on sepharose Q. Histidine-tag was digested with factor XA. Purified recombinant fragment of GPVI migrated on SDS-PAGE gel at 26 kDa under reducing conditions and at 24 kDa under non conditions and had a purity >97%. The incubation of recombinant protein GPVI with collagen blocks platelet aggregation in hung the basis of dose (IC 50µg/ml).

Figure 3. Recombinant fragment GPVI obtained from different series E.coli, isolated using gel electrophoresis SDS-PAGE on 15% polyacrylamide under reducing conditions (lines 2, 3, 4) or non conditions (lines 5 and 6). A clear shift in migration during recovery shows the correct folding and formation of disulfide bridges. To test the ability of recombinant GPVI to block collagen activation of platelets, the samples were purified and concentrated, 4 μg of recombinant GPVI filled in case 1, the bands.

Figure 4. Platelet aggregation inhibited by incubation of collagen with a fragment of recombinant GPVI to aggregation. Aggregation was carried out in aggregometer (Labinhtec, Montpellier, France) dissolved in platelets (5×108platelets/ml) were resuspendable in 10 mm Hepes, 150 mm NaCl, 5 mm glucose buffer, pH 7.4, in the presence of 2 mm Ca2+and 2 mm Mg2+. In the control experiment, 1 μm/ml of collagen added to stirred suspension of platelets with rapid induction of platelet aggregation. C. platelet Aggregation is completely inhibited when 1 mg/ml collagen preincubated with 5 mg/ml recombinant GPVI.

p>

1. DNA encoding Glycoprotein VI or its biologically active fragments which are partially or completely contains the sequence represented in figure 2.

2. The DNA that encodes the Glycoprotein VI and has the sequence presented in figure 2.

3. The DNA according to claims 1 and 2, which encodes Glycoprotein VI, which contains the amino acid sequence represented by Piga and 1b.

4. Recombinant Glycoprotein VI as a medicine containing the amino acid sequence represented by fig.1b, and encoded by the DNA of claim 2.

5. Pharmaceutical composition having the ability to inhibit or block the interaction between platelets and collagen, and including an effective amount of a protein according to claim 4 and a pharmaceutically acceptable solvent, carrier or excipients.

6. Pharmaceutical composition having the ability to inhibit or block the interaction between platelets and collagen, and including an effective amount of a protein according to claim 4 and other pharmacologically active compounds, and pharmaceutically acceptable solvent, carrier or excipients.



 

Same patents:

FIELD: medicine, hepatology.

SUBSTANCE: in blood serum one should detect total constant for blood clotting, elasticity and time for clot formation, the content of ceruloplasmin. In case of decreased level of ceruloplasmin by 43-49%, increased total constant of blood clotting by 18-34% against the norm, at decreased clot elasticity by 12-24% against the norm and increased time for clot formation by 21-74% and more against the norm it is possible to state upon the presence of chronic hepatitis at hepatocerebral dystrophy. At decreased level of ceruloplasmin by 50% and more, increased total constant of blood clotting by 35% and more against the norm, decreased clot elasticity by 25% and more against the norm and increased time for clot formation by 75% and more against the norm it is possible to conclude upon the availability of cirrhosis in case of hepatocerebral dystrophy. Application of the method enables to increase accuracy of differential diagnostics of chronic hepatitis and cirrhosis in patients with hepatocerbral dystrophy.

EFFECT: higher accuracy and efficiency of diagnostics.

4 ex

FIELD: medicine, ophthalmology.

SUBSTANCE: in patients with rheumatoid uveitis in acute period of disease, that is within the 7th to the 10th d one should detect the concentration of tumor necrosis factor (TNF-α) concentration in blood serum. At its content being 150 pcg/ml and higher the flow of rheumatoid uveitis is considered to be favorable, and at concentration ranged 50-100 pcg/ml - unfavorable. The innovation increases the accuracy in predicting the severity degree of the flow of rheumatoid arthritis and provides the chance for conducting adequate medicinal therapy.

EFFECT: higher efficiency of therapy.

6 ex

FIELD: medicine, juvenile endocrinology.

SUBSTANCE: one should detect the level of endothelin-1 (pcg/ml) and basic fibroblast growth factor (bFGF) (ng/ml) in patients with insulin-dependent diabetes mellitus in blood serum. At the ratio of endothelin-1 against bFGF being equal to 40 and higher it is possible to diagnose subclinical stage of diabetic neuropathy (DNP) in children. The innovation provides the opportunity for prescribing adequate therapy in due time and, thus, prevent the development of severe complications.

EFFECT: higher accuracy and objectivity.

2 ex

FIELD: medicine, neonatology.

SUBSTANCE: it is necessary to determine neopterin concentration in spinal fluid and in blood serum. At values of neopterin concentration being 51.6±7.29 nM/l in blood serum and 16.3±3.80 nM/l in spinal fluid one should diagnose intracranial hemorrhage, moreover, one should apply the technique of immunoenzymatic assay that requires minimal quantity of biological liquids. The innovation is simple in implementation, requires small quantities of biological liquids that enables to apply it widely in resuscitation departments, neonatal pathology departments and in maternity hospitals.

EFFECT: higher accuracy of diagnostics.

2 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: method involves determining transforming growth factor in male saliva β1 (TGF-β1) using immunoenzyme assay method with a set of standards for determining the TGF-β1. The TGF-β1 value growing 2, 4 and more times as large when compared to a value taken for healthy patient norm, bronchus remodeling is to be diagnosed. The value taken as healthy patient norm is equal to 403.88±102.58 selected as a result of forced expiration volume per 1 s comparison in healthy patients and bronchus biopsy results.

EFFECT: high information capacity, safety and reliability of diagnosis method.

2 cl, 2 tbl

FIELD: medicine.

SUBSTANCE: method involves determining lactate dehydrogenase activity and NADP-dependent glutamate dehydrogenase. Lactate dehydrogenase activity being equal to or greater than 12.50 mcU and NADP-dependent glutamate dehydrogenase activity being equal to or less than 0.25 mcU, no metastases in lung root lymph node in pulmonary carcinoma cases are thought to be available. Lactate dehydrogenase activity being less than 12.50 mcU and NADP-dependent glutamate dehydrogenase activity being greater than 0.25 mcU, the metastases are proved to be available.

EFFECT: high accuracy of diagnosis.

FIELD: veterinary medicine.

SUBSTANCE: method involves determining protein expression level induced during pregnancy in an animal with desirable pregnancy status. Protein expression level of this animal is compared to the protein expression level in non-pregnant animals.

EFFECT: high accuracy and reproducibility of pregnancy test.

36 cl, 4 dwg

FIELD: medicine, laboratory diagnostics.

SUBSTANCE: at detecting tumoral ovarian neoplasm, at the stage of preoperational procedure one should additionally detect the concentration of alpha-2-glycoprotein (ABG) in blood serum due to rocket immunoelectrophoresis, and at its concentration being 0.008-0.019 g/l one should diagnose benign ovarian tumoral process and match laparoscopic access in case of operative interference; at concentration of 0.024 g/l and more one should diagnose high risk for availability of malignant tumoral process and match laparotomy as an access for operative interference. Thus, the innovation provides the reason for matching the access for operative interference that enables to decrease the frequency of traumatic interference and risk of postoperational complications.

EFFECT: higher efficiency.

4 ex, 1 tbl

FIELD: medicine, cytology.

SUBSTANCE: one should sample cell material from affected part due to puncture biopsy or, at availability of free excreta out of teats, with exfoliative technique and cytological testing of microscopy-obtained material. Decision on the fact of availability or absence of mammary tissue pathology should be established according to the presence or absence proliferative cells, cells with foamy cytoplasm, and cell-free protein masses. Moreover, if proliferative cells are absent, cells with foamy cytoplasm are, also, absent or their quantity is low and one can observe cell-free protein masses it is possible to diagnose the absence of pathology. If proliferative cells are present, and cells with foamy cytoplasm and cell-free protein masses are absent the state should be evaluated as pathological; if proliferative cells, cells with foamy cytoplasm and cell-free protein masses are present the state should be evaluated as instable and control-demanding. The innovation enables to detect optimal medicinal tactics and conduct control for therapeutic efficiency.

EFFECT: higher objectivity of investigation.

1 cl, 1 dwg, 3 ex, 1 tbl

FIELD: pulmonology and thoracic medicine.

SUBSTANCE: method is characterized by that on first or second day from the beginning of treatment blood serum of patient is analyzed on the level of peptide-bound hydroxyproline. When this level is increased to 82.44 μmol/L and higher. Development of acute metapneumonic nonspecific pleural empyema is prognosed.

EFFECT: use of the method allows performing early prognosis of acute metapneumonic nonspecific pleural empyema and preventing this sickness.

3 ex

FIELD: biotechnology, gene engineering, medicine.

SUBSTANCE: polypeptide (IL-li) is obtained by recombinant DNA technology having activity of interleukin-1-alpha and interleukin-1-beta inhibitor. Disclosed is DNA sequences encoding inhibitor precursor and maturated form thereof. Described is method for production of vector constructs containing said DNA sequences, as well as transformed cells producing of recombinant IL-li.

EFFECT: method for large-scale production of interleukin-1-beta inhibitor, useful in medicine.

21 cl, 26 dwg, 11 ex

FIELD: biotechnology, in particular production of modified swine factor VIII (POL1212).

SUBSTANCE: DNA molecule encoding of modified swine factor VIII is cloned in expression vector, having functionality in mammalian cells. Modified swine factor VIII protein is obtained by cultivation of mammalian cell line BHK CRL-1632 (ATCC), BHK 1632, or CHO-K1, transfected with vector. Therapeutic composition for treatment of subjects suffering from deficit of factor VIII, such as haemophilia, contains effective amount of swine factor VIII protein.

EFFECT: effective agent for treatment of factor VIII deficit.

13 cl, 8 dwg, 7 ex

FIELD: immunobiotechnology.

SUBSTANCE: invention relates to soluble CTLA4, which represents mutant variant of wild type CTLA4 and conserves binding ability to CD80 and/or CD86. Molecules of soluble CTLA4 have the first amino acid sequence containing extracellular CTLA4 region, which includes some mutant amino acid residues in S25-R33 region and M97-G107 region. According the present invention mutant molecules also may include second amino acid sequence, enhancing solubility of mutant molecule. Nucleic acid (NA) molecules encoding said CTLA4 and including NA-vectors also are described. Invention also relates to method for production of mutant CTLA4 and uses thereof in controlling of interaction between T-cell and CD80 and/or CD86-positive cell; suppression of graft-versus-host reaction; and treatment of immune system diseases. Soluble mutant CTLA4 according to present invention binds to CD80 and/or CD86 antigen with higher avidity than wild type CTLA4 or non-mutant CTLA41g.

EFFECT: new preparation for treatment of immune system diseases.

65 cl, 19 dwg, 2 tbl, 2 ex

FIELD: medicine, biotechnology.

SUBSTANCE: invention relates to antibodies specifically binding to new human extracellular matrix polypeptides called as RGI; immunoconjugate containing the same and method for selective cell degradation; method for treatment of prostates cancer and metastasis in patients suffering from prostates cancer.

EFFECT: new method for treatment of prostates cancer.

28 cl, 7 ex, 7 dwg

FIELD: molecular biology, genetic engineering, polypeptides, medicine.

SUBSTANCE: in using the double-hybrid yeast system DNA sequences encoding polypeptides (55.1 and 55.3) have been found that elicit ability for binding with intracellular domain p-55 (p-55IC) of TNF-receptor. It has been established that these polypeptides represent fragments of amino acid sequences p-55IC, respectively, from 338 to 426 and from 277 to 426 residues. As result of insertion of DNA fragments with a sequence encoding polypeptide 55.1 or 55.3 into the structure of expressing vector and transformation suitable host-cells by this vector recombinant form of indicated polypeptides have been prepared. Using this invention provides the possibility for modulating the function of intact p-55 of TNF-receptor. Invention can be used in medicine in treatment of diseases associated with transfer of TNF-signal.

EFFECT: improved preparing method and valuable properties of polypeptide.

9 cl, 17 dwg, 3 tbl, 6 ex

FIELD: biotechnology, molecular biology, medicine.

SUBSTANCE: invention discloses amino acid sequences of human obesity polypeptide (OB) two isoforms possessing capacity for modulation of animal body mass, their signal peptide-containing precursors and analogues. Polypeptide isoforms are prepared as result of insertions, deletions and amino acid changes that retain activity typical for nonmodified forms of OB-polypeptides, and polyclonal and monoclonal antibodies interaction specifically with new agents modulating the body mass value also. Invention describes DNA sequences encoding these polypeptides and their analogues, vector structures comprising these sequences used for preparing recombinant forms of OB-polypeptides. Invention proposes using new polypeptides and their analogues as an active component in pharmaceutical compositions. Using this invention can promote to solving the problem for providing medicine, veterinary science and animal husbandry with effective agent used for decreasing the body mass value. Invention can be used in medicine for diagnosis and treatment of pathological states associated with disturbance of regulation of human body mass, and in animal husbandry and veterinary science.

EFFECT: valuable biological, medicinal and veterinary properties of polypeptide.

23 cl, 71 dwg, 12 tbl, 17 ex

FIELD: gene engineering.

SUBSTANCE: the present innovation deals with transferring a mutant gene due to homologous recombination into animal embryo. The animal obtained is characterized by the capacity to express mutant protein of presenylin-1 and induction of beta-myeloid protein production that leads to the development of progressing nervous disease in hippocampus or peripheral department of cerebral cortex, It is, also, suggested to apply several plasmids carrying a mutated gene. It is, also, described the way to obtain primary cell culture or subcultivated cell out of obtained mutated animals. Moreover, several methods are, also, suggested for testing the substances for usefulness in therapeutic and/or prophylactic procedures at treating Alzheimer's disease. They deal with introducing a tested substance for mutated animal to evaluate the data obtained. The obtained mutated animals could be applied as model animals while studying Alzheimer's disease nature.

EFFECT: higher efficiency.

25 cl, 8 dwg, 10 ex

FIELD: genetic engineering, pharmaceutical and medical-biological industry.

SUBSTANCE: invention proposes a chimeric sequence of nucleic acid encoding a fused polypeptide able to bind with the vessel endothelium growth factor (VEGF) and to inhibit its specific mitogenic effect. The fused polypeptide molecule comprises immunoglobulin-like domain 2 of VEGF-receptor Flt1, immunoglobulin-like domain 3 of VEGF-receptor Flk 1 or Flt4 and multimerizing component represented by either domain Fc IgG or heave chain IgG. By expression of the proposed chimeric sequence or its two successively joined copies in a host-cell a monomer or dimer of the fused polypeptide are prepared, respectively, that can be used for suppression of VEGF activity in mammals, in particular, in humans. New VEGF inhibitors differ from the known one by the improved pharmacokinetics.

EFFECT: improved preparing method, valuable biological properties of polypeptide.

23 cl, 67 dwg, 1 tbl, 35 ex

FIELD: medicine, genetic engineering.

SUBSTANCE: invention proposes a method that involves construction of bacteriophage library of random peptides based on oligonuleotide fragments encoding their, selection of bacteriophages binding with target-cells but not binding with cells of other types that can be involves in pathological process or able to show effect on its diagnosis and therapy, and confirmation of specificity of selected bacteriophages by using combination of different tests. Oligonucleotide fragments encoding random peptides are prepared by reaction of reverse transcription by using random primers and total RNAs isolated from indicated target-cells and cells of other types. Applying this invention provides preparing bacteriophages binding with target-cells with high degree of selectivity. Invention can be used in diagnosis, therapy and pharmaceutical industry.

EFFECT: improved preparing method.

3 cl, 2 dwg, 8 ex

FIELD: biotechnology, genetic engineering, immunology.

SUBSTANCE: invention proposes: isolated nucleic acid encoding feline ligand CD86; diagnostic oligonucleotide; cloning vector; vaccine for modulation of the immune response in cat; method for induction, enhancement and suppression of immune response in cats. Proposed group of inventions allows designing effective vaccines used in prophylaxis of immunodeficiency in felines and infectious peritonitis in domestic cats. Invention can be used in veterinary science.

EFFECT: valuable properties of nucleic acid.

27 cl, 13 dwg, 5 tbl, 8 ex

FIELD: immunobiotechnology.

SUBSTANCE: invention relates to soluble CTLA4, which represents mutant variant of wild type CTLA4 and conserves binding ability to CD80 and/or CD86. Molecules of soluble CTLA4 have the first amino acid sequence containing extracellular CTLA4 region, which includes some mutant amino acid residues in S25-R33 region and M97-G107 region. According the present invention mutant molecules also may include second amino acid sequence, enhancing solubility of mutant molecule. Nucleic acid (NA) molecules encoding said CTLA4 and including NA-vectors also are described. Invention also relates to method for production of mutant CTLA4 and uses thereof in controlling of interaction between T-cell and CD80 and/or CD86-positive cell; suppression of graft-versus-host reaction; and treatment of immune system diseases. Soluble mutant CTLA4 according to present invention binds to CD80 and/or CD86 antigen with higher avidity than wild type CTLA4 or non-mutant CTLA41g.

EFFECT: new preparation for treatment of immune system diseases.

65 cl, 19 dwg, 2 tbl, 2 ex

Up!