Recombinant dna molecule encoding of modified swine factor viii (pol1212), expression vectors, modified swine factor viii, therapeutic composition, methods for production of modified swine factor viii protein (variants) and cell lines (variants)

FIELD: biotechnology, in particular production of modified swine factor VIII (POL1212).

SUBSTANCE: DNA molecule encoding of modified swine factor VIII is cloned in expression vector, having functionality in mammalian cells. Modified swine factor VIII protein is obtained by cultivation of mammalian cell line BHK CRL-1632 (ATCC), BHK 1632, or CHO-K1, transfected with vector. Therapeutic composition for treatment of subjects suffering from deficit of factor VIII, such as haemophilia, contains effective amount of swine factor VIII protein.

EFFECT: effective agent for treatment of factor VIII deficit.

13 cl, 8 dwg, 7 ex

 

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the priority of patent applications in the United States of America No. 09/037601 filed March 10, 1998, which is a partial continuation patent application of the United States of America No. 08/670707, filed June 26, 1996, which issued U.S. patent No. 5859204, and International patent application PCT/US 97/11155, filed June 26, 1997.

NOTICE OF FEDERAL RESEARCH SUPPORT

The government has rights in this invention result from the use of grant No. HL46215 National Institute of health, which partially funded the research that led to this invention.

BACKGROUND of the INVENTION

Clotting begins when platelets are attached to cut the damaged wall of the blood vessel at the site of damage. Then, in a cascade of enzyme-controlled reactions of molecules of soluble fibrinogen into the enzyme thrombin into insoluble strands of fibrin, which keeps the platelets together in the thrombus. At each stage in the cascade of the precursor protein into a protease, which cleaves following the precursor protein sequence. In most of these stages require cofactors.

Factor VIII circulates in the blood as an inactive precursor that is associated to p is full-time and ecovalence with the factor a background of Villebranda. Factor VIII proteoliticeski is activated by thrombin or factor XA, which dissociates it from the factor a background of Villebranda and activates its procoagulant function in this cascade. In its active form of the protein factor VIIIa is a cofactor that increases the catalytic efficiency of factor IXa in relation to the activation of factor X by several orders of magnitude.

People with a deficiency of factor VIII or antibodies against factor VIII who do not receive treatment with factor VIII, suffer from neostanovimaja internal bleeding, which can cause a number of serious symptoms, inflammatory reactions in the joints to early death. Severe hemophilic patients, including in the United States reaches approximately 10,000, can be treated by infusion of factor VIII of the person who will restore normal clotting ability of the blood with the introduction of with sufficient frequency and concentration. The classic definition of factor VIII is in fact: it is a substance present in normal blood plasma that corrects the clotting defect in plasma derived from individuals with hemophilia A.

The development of antibodies (inhibitors" or "inhibitory antibody"), which inhibit the activity of factor VIII, is a serious complication in patients with GE is Ofelia. Antibodies develop in approximately 20% of patients with hemophilia And in response to therapeutic infusion of factor VIII. In previously untreated patients with hemophilia a develop inhibitors, the inhibitor usually develops within one year of treatment. In addition, antibodies that inactivate factor VIII, sometimes develop in individuals with previously normal levels of factor VIII. If the titer of the inhibitor is sufficiently low, patients can be treated by increasing the dose of factor VIII. Often, however, the titer of the inhibitor is so high that it is impossible to overcome his factor VIII. An alternative strategy is to bypass the need of factor VIII during normal hemostasis using complex preparations of factor IX (for example, KONYNE*, Proplex®) or recombinant factor VIIa person. In addition, since porcine factor VIII is usually significantly lower reactivity with inhibitors than human factor VIII, used partially purified factor VIII pigs (HYATE:C®). Many patients who have developed inhibitory antibodies to human factor VIII, successfully treated porcine factor VIII and endured this treatment for long periods of time. However, the introduction of porcine factor VIII is not a complete solution, because in some patients inhibi the ora can develop to porcine factor VIII after one or more infusions.

Some drugs derived from human plasma factor VIII varying degrees of purity are commercially available for the treatment of hemophilia A. They include partially purified factor VIII obtained from the combined blood of many donors, which is processed by heating and detergents against viruses, but contains a significant level of antigenic protein; purified monoclonal antibodies to factor VIII, which has lower levels of antigenic impurities and viral contamination; and recombinant factor VIII human clinical trials which are ongoing. Unfortunately, the human factor VIII is unstable at physiological concentrations and pH values, is present in the blood in very low concentrations (0.2 ág/ml plasma) and has a low specific activity of coagulation. Concerns about public health regarding the risk of viruses or other carried by blood impurities limited the applicability of porcine factor VIII purified from the blood of pigs.

Hemophilia patients require daily replenishment of factor VIII to prevent bleeding and emerging deforming hemophilic arthropathy. However, the supply was insufficient, and problems arise in therapeutic application because of the difficulty of isolation and purification, immunogenicity and necessary the cost of eliminating the risk of infectivity of the AIDS and hepatitis. The use of recombinant human factor VIII or partially purified porcine factor VIII will not solve all problems.

The problems associated with commonly used commercially available obtained from plasma factor VIII, stimulated considerable interest in the development of the best product of factor VIII. There is a need for more potent the factor VIII molecule, so that a greater number of units of blood coagulation activity could be delivered to the molecule; in the factor VIII molecule that is stable at the desired pH and physiological concentrations; in the factor VIII molecule, which is less prone to the production of inhibitory antibodies; and the factor VIII molecule, which escapes immune detection in patients who have already acquired antibodies to human factor VIII.

Thus, the objective of this invention is the provision of factor VIII, which corrects hemophilia in a patient, the lack of factor VIII or with inhibitors against factor VIII human.

The next task of this invention is the provision of methods of treatment of patients with hemophilia.

Another objective of this invention is the provision of factor VIII, which is stable under selected physiological pH and concentration.

Another objective of this invention is about AspectJ factor VIII, which has a higher coagulating (coagulant) activity than human factor VIII.

The next task of this invention is the provision of factor VIII, against which a smaller quantity of antibodies.

The next task of this invention is the provision of a method of obtaining a recombinant porcine factor VIII and, in particular, modified porcine factor VIII.

The INVENTION

Determination of the entire DNA sequence that encodes a porcine factor VIII, presented here for the first time made possible the synthesis of porcine factor VIII expression of DNA that encodes a porcine factor VIII in a suitable cell host. Thus, purified porcine factor VIII is an aspect of the present invention. DNA encoding each domain of porcine factor VIII, as well as any fragment described, can also be expressed. In addition, porcine factor VIII deletionism full In-domain or deletional part of the In-domain (does not contain a domain of porcine factor VIII (fVIII)) made available as part of the present invention by expression of DNA encoding porcine fVIII having a deletion of one or more codons In the domain.

Also provided pharmaceutical compositions and methods of treatment of patients with deficiency of factor VIII, introducing recombinant the th porcine factor VIII or modified porcine factor VIII, in particular, does not contain In-domain of porcine factor VIII.

BRIEF DESCRIPTION of DRAWINGS

Figa-1H, taken together, represent a comparison of matched amino acid sequences of human, porcine, and murine factor VIII.

DETAILED description of the INVENTION

If there is no other description or instructions in the application here, "factor VIII" refers to any functional protein molecule of factor VIII from any mammal.

In the application here, "factor VIII mammals" includes factor VIII with amino acid sequence derived from any mammal, not a person, unless directed otherwise. "Animal", in the application here, denotes the pig and other mammals, non-human.

"Protein" or "fusion factor VIII or fragment, in the application here, denotes the product of the hybrid gene in which the coding sequence for a single protein is changed, for example, attach it to the coding sequence for the second protein from a different gene in the correct sequence in reading frame, so there may be continually the transcription and translation of the connecting segments, with the formation of a hybrid gene that encodes this protein.

"Corresponding" sequence of nucleic acid or amino acid in sledovatelnot, in the application here, is a sequence present in the factor VIII molecule or its fragment, which have the same structure and/or function as the site in the factor VIII molecule of another species, although the number of nucleotides or amino acids can be non-identical. DNA sequence "corresponding" sequence another factor VIII, essentially corresponds to this sequence and hybridizes with the sequence of the numbers SEQ ID NO: under strict conditions. DNA sequence "corresponding" sequence another factor VIII, also includes a sequence that leads to expression of factor VIII or its fragment and could gibridizatsiya with the indicated sequence of SEQ ID NO:if not for the redundancy of the genetic code.

"Unique" amino acid residue or "unique" sequence in the application here, refers to the amino acid sequence or aminokisloty the residue in the factor VIII molecule of the same species that differ from the homologous residue or homologous sequences in the factor VIII molecule of another species.

"Specific activity", in the application here, refers to the activity that corrects the clotting defect lack of factor VIII human plasma. Specific activestore in units of clotting activity in milligrams of total protein of factor VIII in the standard test, in which the clotting time lack of factor VIII human plasma compared with the clotting time of normal human plasma. One unit of activity of factor VIII is equal to the activity present in one milliliter of normal human plasma. In this test, the shorter the time of clots, the higher the activity of the analyzed factor VIII. Porcine factor VIII is active in the test of human factor VIII.

"Expression" refers to the number of processes that occur when genetic information is used to obtain the product. DNA encoding amino acid sequence of porcine factor VIII, can be expressed in the cell host mammal with a protein of porcine factor VIII. Materials, genetic structure, the cells of the host and the conditions that allow to happen the expression of specific DNA sequences are well known in this field and can be manipulated to influence the timing and amount of expression, as well as on the intra - or extracellular localization of the expressed protein. For example, as a result of incorporating DNA that encodes a signal peptide at the 5'end of DNA encoding porcine factor VIII (the 5'-end is, as is customary, end, encoding NH2-end of the protein), xpressway protein becomes exported from inside nego space of the host cell into the culture medium. The software encodes a signal peptide DNA in combination with DNA encoding porcine factor VIII, is advantageous, as expressed factor VIII is exported into the culture medium, which simplifies the cleaning process. A preferred signal peptide is the signal peptide of factor VIII mammal.

The nucleotide sequence of cDNA and predicted amino acid sequence of human factor VIII is shown in SEQ ID NO:1 and 2, respectively. Factor VIII is synthesized as single-chain protein of approximately 300 kDa with internal homology sequence, which determines the sequence "domain" NH2-A1-A2-B-A3-C1-C2-COOH. In the factor VIII molecule "domain", in the application there is a continuous sequence of amino acids, which is determined by the identity of the internal amino acids and the sites of proteolytic cleavage by thrombin. If there are no other instructions, the domains of factor VIII include the following amino acid residues in the alignment of these sequences with the amino acid sequence of human (SEQ ID NO:2): A1, residues l1-Arg372; A2, residues Sr373-Arg740; B, residues Sr741-Arg1648; A3, residues Ser1690-Ile2032; C1, residues Arg2033-Asn2172; C2, residues Ser2173-Tyr2332. The sequence A3-C1-C2 includes the remains of Ser1690-Tyr2332. The remaining segment, residues Glu1649-Arg1689, usually referred to as peptide Akti the emission light chain of factor VIII. Factor VIII proteoliticeski is activated by thrombin or factor XA, which dissociates it from the factor a background of Villebranda formation of factor VIIIa, which has procoagulant function. The biological function of factor VIIIa is to increase the catalytic efficiency of factor IXa in relation to the activation of factor X by several orders of magnitude. Activated thrombin factor VIIIa is heterotrimer A1/A2/A3-C1-C2 160 kDa, which forms a complex with factor IXa and factor X on the surface of platelets or monocytes. "Partial domain in the application there is a continuous sequence of amino acids forming part of the domain.

"Subunit" of factor VIII, human or animal, in the application there are heavy and light chains of this protein. Heavy chain of factor VIII contains three domains, A1, A2 and B. the Light chain of factor VIII also contains three domains, A3, C1 and C2.

The terms "epitope", "antigenic site" and "antigenic determinant", in the application here, are used interchangeably and are defined as part of the factor VIII of human or animal or its fragment, which is specifically recognized by the antibody. They can consist of any number of amino acid residues and may depend on the primary, secondary, or tertiary structure of a protein.

The term "immunodominant site, in the application here, determined is expressed as the area factor VIII human or animal or its fragment, which specifically induces the production of antibodies to factor VIII or fragment, in man or animal, as measured by routine protocols, such as an immunoassay, such as ELISA or Bethesda, described here. It may consist of any number of amino acid residues and may depend on the primary, secondary, or tertiary structure of the protein. In some embodiments, a hybrid or an equivalent hybrid factor VIII or fragment is nimmanahaeminda or less immunodominant in the animal or human than human factor VIII or pigs.

"Deficiency of factor VIII", in the application here, includes the lack of activity of coagulation caused by biogas produced defective factor VIII produced insufficient or no production of factor VIII or partial or complete inhibition of factor VIII inhibitors. Hemophilia a is the type of deficiency of factor VIII derived from defect in X-linked gene and the absence or deficiency of the protein factor VIII, which it encodes.

In the application here, "diagnostic tests include tests that in some way use the interaction of the antigen-antibody for detection and/or determination of the amount of specific antibody, which is present in the test sample, to facilitate the choice of the drug therapies. There are many such analyses, well-known specialists with expertise in this area. In the application here, the DNA factor VIII, human, pig or modified factor VIII or fragment and the protein expressed from them, fully or partially, can be replaced by the corresponding reagents known in other respects the analyses, resulting in these modified tests can be used for detection and/or quantification of antibodies to factor VIII. It is the application of these reagents, DNA factor VIII or a fragment or a protein expressed by them, allows you to modify the known assays for detection of antibodies to factor VIII human or animal. Such analyses include, but are not limited to, ELISA, immunodiffusion analysis and Western blot turns. Suitable methods for the practical application of these assays known to those with skill in this area. In the application here, the factor VIII or fragment that includes at least one epitope of this protein can be used as a diagnostic reagent. Examples of other tests that can be used factor VIII, human, pig or modified porcine factor VIII or fragment include analysis of Bethesda and anticoagulation tests.

The term cDNA encoding a protein,such as porcine factor VIII" means polyethoxyethanol acid, the nucleotide sequence which contains the coding information for the host cell to the amino acid sequence of the protein, for example, porcine factor VIII, in accordance with known dependency of the genetic code.

"The product of the expression of DNA that encodes a factor VIII human or animal or modified factor VIII is a product obtained from the expression of the reference DNA in a suitable cell host, which includes such features pre - or post-translational modification of the proteins encoded by the reference DNA, such as, including, but not limited to, glycosylation, proteolytic cleavage, etc. In this area it is known that such modifications can occur and may differ somewhat depending on the type of host cell and other factors and can lead to molecular isoforms of the product with retention of procoagulant activity. See, for example, Lind, P. et al., Eur. J. Biochem. 232:1927 (1995), incorporated herein by reference.

"Expressing vector" is a DNA element, often a ring structure with the ability of Autonomous replication in the desired cell, the owner or the ability to integrate into the genome of the host cell, as well as possessing certain well-known characteristics that make possible the expression of the coding DNA that is built into this vector in the correct site and in the correct orientation. Such signs may include, but are not limited to, one or more promoter sequences to start the initiation of transcription of the coding DNA and other DNA elements, such as enhancers, polyadenylation sites and the like, all of them are well known in this field. The term "expressing vector" is used to denote a vector with the coding DNA sequence, which must be expressed, integrated in its sequence and vector, with appropriate expression regulatory elements are arranged relative to the site of insertion, that he may serve for the expression of any coding DNA that is built into this website, all of these regulatory elements are well known in this field. So, for example, a vector with no promoter, may be expressing a vector as a result of insertion of the promoter together with the encoding DNA.

GENERAL DESCRIPTION of METHODS

In U.S. patent 5364771 the discovery of the hybrid molecules of factor VIII human/pig having coagulant activity, in which the elements of a molecule of factor VIII human or pig replaces the corresponding elements of a molecule of factor VIII of the other species. In U.S. patent 5663060 described procoagulant hybrid factor VIII molecule person/animal and equivalent hybrid molecules fact the RA VIII, in which the elements of a molecule of factor VIII of one species replaces the corresponding elements of the factor VIII molecule of another species.

Because the existing information shows that In the domain has no inhibitory epitope and has no known effects on the function of factor VIII, in some embodiments, domain fully or partially deleterows in active hybrid or an equivalent hybrid factor VIII molecules or fragments ("(-)-factor VIII), obtained by any of the methods described here.

The gene of human factor VIII was isolated and expressed in mammalian cells, as reported'toole, J.J. et al. (1984) Nature 312:342-347 (Genetics Institute); Gitschier, J. et al. (1984) Nature 312:326-330 (Genentech); Wood, W.I. et. al. (1984) Nature 312:330-337 (Genentech); Vehar, G.A. et al. (1984) Nature 312:337-342 (Genentech); WO 87/04187; WO 88/08035; WO 88/03558; US Patent No. 4757006, and amino acid sequence was transcribed from the cDNA. In U.S. patent number 4965199 issued by Capon et al., the described method of recombinant DNA to obtain factor VIII in the cells of the host mammal and purification of human factor VIII. It was reported the expression of factor VIII human cells Cho (cells Chinese hamster ovary) and VNX (kidney cells baby hamster). The human factor VIII was modified for the deletion of part of the In-domain or only In-domain (U.S. patent No. 4868112) and an attempt was made to replace the In-domain of human factor VIII b-domain of factor V man is ka (U.S. patent No. 5004803). The cDNA sequence encoding the human factor VIII, and the predicted amino acid sequence shown in SEQ ID NO:1 and 2, respectively. In SEQ ID NO:1 coding region begins at nucleotide position 208, and the triplet GCC is the codon for amino acid number 1 (Ala) of the Mature protein shown in SEQ ID NO:2.

Porcine factor VIII was isolated from plasma [Fass, D.N. et al. (1982) Blood 59:594]. Partial amino acid sequence of porcine factor VIII, the corresponding parts of the N-terminal sequence of light chain having the relative homology of ceruloplasmin and coagulation factor V, described by Church et al. (1984) The OEWG, Natl. Acad. Sci. USA 81:6934. 'toole, J.J. et al. (1984) Nature 312:342-347 described by partial sequencing of the N-terminal four amino acid fragments of porcine factor VIII, but not described these pieces in relation to their positions in the factor VIII molecule. Amino acid sequence of In-domain and part of the A2 domain of porcine factor VIII have been reported'toole, J.J. et al. (1986) the OEWG. Natl. Acad. Sci. USA 83:5939-5942. cDNA sequence encoding a full A2 domain of porcine factor VIII, and the predicted amino acid sequence and hybrid factor VIII human/pig, with replacement of all domains, all subunits and specific amino acid sequences described in U.S. patent 5364771, entitled "Hybrid Human/Porcine factor VIII", issued 15 noyabrya year and in WO 93/20093, published on 14 October 1993. cDNA sequence encoding the A2 domain of porcine factor VIII, the corresponding residues 373-740 in Mature human factor VIII shown in SEQ ID NO:1, and the predicted amino acid sequence shown in SEQ ID NO:3 and 4 respectively. More recently it was reported nucleotide and corresponding amino acid sequence of part of the A1-domain without first 198 amino acids, and A2 domain of porcine factor VIII in WO 94/11503, published may 26, 1994. Finally, the complete nucleotide sequence encoding a porcine factor VIII, which includes the full A1-domain peptide activation, A3-, C1 - and C2-domains, as well as the encoded amino acid sequence were obtained Lollar, as described in U.S. patent 5859204, issued January 12, 1999, and in WO 97/49725, published December 31, 1997, both incorporated herein by reference.

As swine and human factor VIII separated from the plasma in the form of a protein of two subunits. These subunits, known as the heavy and light chains, held together by non-covalent bond, which requires calcium ions or other divalent metal. Heavy chain of factor VIII contains three domains, A1, A2 and b, which are linked covalently. Light chain of factor VIII also contains three domains named A3, C1 and C2. In a domain has no known biological function and can b is to be removed or partially removed from this molecule proteoliticeski or methods of recombinant DNA technology without significant changes of any measurable parameter of factor VIII. Recombinant human factor VIII has a structure and function similar to those obtained from plasma factor VIII, although he is not glycosylated, if it is not expressed in mammalian cells.

Activated factor VIII both human and pig ("factor VIIIa") has three subunits due to cleavage of the heavy chain between the domains A1 and A2. This structure is named A1/A2/A3-C1-C2. Factor VIIIa person is not stable under conditions which stabilize porcine factor VIIIa, presumably due to the weak connection A2 subunit of factor VIIIa person. The dissociation of the A2 subunit of factor VIIIa humans and pigs is associated with loss of activity in the molecule of factor VIIIa. Yakhyaev, A. et al. (1997) Blood 90:Suppl. 1, Abstract #126 reported binding of A2-domain protein related receptor low-density lipoprotein, suggesting that the cellular uptake A2-mediated in such a binding, valid, negatively regulating the activity of factor VIII.

The expression "not contain In-domain of factor VIII enhanced by the inclusion of parts In the domain. It was reported that the inclusion of these parts In the domain named "SQ" [Lind, P. et al. (1995), supra], leads to a favourable expression. Design "SQ" not contain In-domain person except 5 amino acids of the N-end In-domain and 9 amino acids of the b-domain.

Purified hybrid f is ctor VIII or fragment can be tested for immunoreactivity and coagulating activity of the standard tests, including, for example, analysis on free plasma factor VIII, the one-stage coagulation analysis and enzyme-linked immunosorbent assay using purified recombinant human factor VIII as standard.

Other vectors, including plasmid and eukaryotic viral vectors, can be used for expression of the recombinant gene constructs in eukaryotic cells, depending on the preferences and evaluation of qualified practice (see, for example, Sambrook et al. Chapter 16). Can be used for other vectors and sexpression systems, including bacterial, yeast and insect cells, but they are not preferred due to differences in glycosylation or absence of glycosylation.

Recombinant protein of factor VIII can be expressed in various cells, commonly used for the cultivation and expression of recombinant proteins in mammals. In particular, it was found that a number of cell lines rodents are particularly applicable hosts for the expression of large proteins. Preferred cell lines available from the American type culture Collection, Rockville, MD, include kidney cells baby hamster cells Chinese hamster ovary, which is cultivated using rutin what's procedures and conventional environments.

The basis for greater coagulants activity of porcine factor VIII is, apparently, more rapid spontaneous dissociation of subunit A2 human factor VIIIa person than subunit A2 pigs against porcine factor VIIIa. Dissociation of subunit A2 leads to loss of activity [Lollar, R. et al. (1990) J. Biol. Chem. 265:1688-1692; Lollar, P. et al. (1992) J. Biol. Chem. 267:23652-23657; Fay, P.J. et al. (1992) J. Biol. Chem. 267: 13246-13250].

The factor VIII molecule with reduced immunoreactivity:

Epitopes that are immunoreactive with antibodies, any abscopal coagulant activity of factor VIII ("inhibitors" or "inhibitory antibody"), were characterized on the basis of known relationships between structure and function in factor VIII. Presumably, inhibitors could act destruction of any macromolecular interactions associated with the domain structure of factor VIII or its relations with the factor a background of Villebranda, thrombin, factor XA, factor IXa or factor X. However, most of inhibitory antibodies to factor VIII act by binding to epitopes localized in the A2 domain of 40 kDa or C2-domain 20 kDa factor VIII, destroying specific functions associated with these domains, as described Fulcher et al. (2985) the OEWG. Natl. Acad. Sci. USA 82:7728-7732; Scandella et al. (1988) Proc. Natl. Acad. Sci, USA 85:6152-6156. In addition to epitopes A2 and C2 may be the third epitope in the A3 domain of the Il is the domain C1 light chain of factor VIII, according Scandella et al. (1993) Blood 82:1767-1775. The value of this hypothetical third epitope is unknown, but, apparently, he is responsible for a minor part of the reactivity of the epitope in factor VIII.

Anti-A2 antibodies block the activation of factor X, as shown Lollar et al. (1994) J. Clin. Invest. 93:2497-2504. Previous research in mapping using deletion mutagenesis described by Ware et al. (1992) Blood Coagul. Fibrinolysis 3:703-716, localized-A2 epitope in the region of 20 kDa NH2-terminal side of the A2-domain of 40 kDa. Competitive Immunoradiometric analysis showed that the A2 inhibitors learn or shared epitope, or closely assembled epitopes as described Scandella et al. (1992) Throm. Haemostas 67:665-671 and as shown in U.S. patent 5859204.

Molecules of factor VIII animals or modified factor VIII of animals can be tested in people in their reduced antigenicity and/or immunogenicity in clinical trials. In one type of test designed to determine whether the factor VIII immunoreactive with inhibitory antibodies to factor VIII is administered preferably by the intravenous injection of approximately 25 patients with deficiency of factor VIII, which are antibodies that inhibit coagulant therapeutic activity of human factor VIII. The dose of factor VIII animal or modified factor VIII of the animal on titsa in the range between 5 and 50 Units/kg body weight, preferably 10-50 Units/kg and most preferably 40 Units/kg of body weight. After approximately 1 hour after each injection the release of factor VIII from blood samples measured in one analysis of coagulation. The samples were taken again after approximately 5 hours after infusion and measure the output. The total yield and the rate of disappearance of factor VIII from these samples are predictive in relation to the titer of antibodies and inhibitory activity. If the antibody titer is high, the output of factor VIII usually cannot be measured. The results of the extraction are compared with the results of extraction in patients receiving obtained from plasma factor VIII, human, recombinant human factor VIII obtained from plasma porcine factor VIII and other commonly used therapeutic forms of factor VIII or substitutes for factor VIII.

After identification of clinically important epitopes can be expressed recombinant factor VIII molecule, which have a lower or equal to the cross-reactivity in comparison with those obtained from plasma porcine factor VIII when tested in vitro against a broad spectrum inhibitor plasmas. To reduce cross-reactivity may be added mutagenesis in areas epitope. Reduced cross-reactivity, although desirable, is not required to obtain about the ukta, which may have advantages over existing concentrate obtained from plasma porcine factor VIII, which can have side effects due to impurity pork proteins or contaminating infectious agents such as viruses or prions. Recombinant molecule pork or modified porcine factor VIII does not contain alien pork proteins.

Diagnostic tests

cDNA factor VIII and/or expressed protein from it, in whole or in part, may be used in assays as diagnostic reagents for the detection of inhibitory antibodies to factor VIII humans or animals or to the modified factor VIII of animals in substrates, including, for example, samples of serum and body fluids of patients-people with a deficiency of factor VIII. These antibody assays include tests like ELISA, immunoblot, radioimmunoassays, immunodiffusion tests and analysis of the biological activity of factor VIII (e.g., analysis of coagulation). The methods of preparation of these reagents and methods for their use are well known to specialists in this field. For example, an immunoassay for the detection of inhibitory antibodies in the serum sample of a patient can include the reaction of the test sample with a sufficient number of test factor VIII to experience that detec the dummy complex can be formed with inhibitory antibodies in the sample or that the test factor VIII really is antigenic.

Can be prepared probes of nucleic acids and amino acids based on sequence of the cDNA molecule or protein molecule hybrid factor VIII or fragments. In some embodiments, they may be marked with dyes or enzymes, fluorescent, chemiluminescent or radioactive labels, which are commercially available. Amino acid probes can be used, for example, for screening of sera or other physiological fluids (body fluids), where it is expected the presence of inhibitors of factor VIII of human, animal, or hybrid factor VIII human/animal. The levels of inhibitors can be quantified in patients and compared with healthy controls and can be used, for example, to determine whether a deficiency of factor VIII to be treated factor VIII animal or modified factor VIII of the animal. The cDNA probes can be used, for example, for research purposes in screening DNA libraries.

Pharmaceutical compositions.

Pharmaceutical compositions containing recombinant porcine or modified porcine factor VIII, alone or in combination with appropriate pharmaceutical stabilization compounds, delivering carriers and/or transferring media prepared in accordance with known and ways, for example, described in Remington''s Pharmaceutical Sciences by E.W.Martin.

In one preferred embodiment, the preferred media or delivering carriers for intravenous infusion are saline or phosphate buffered saline.

In another preferred embodiment, suitable stabilizing compounds that delivers the media, and media-vectors include, but are not limited to, other proteins of human or animal, such as albumin.

Phospholipid carriers or liposomal suspensions are also preferred as pharmaceutically acceptable transferring or delivering media. They can be prepared according to methods known to specialists with expertise in this area, and may contain, for example, phosphatidylserine/phosphatidylcholine or other composition of phospholipids or detergents, which together give a negative surface charge, as factor VIII binds to negatively charged phospholipid membranes. Liposomes can be obtained by dissolving appropriate lipid (suitable lipids) such as stearoylethanolamine, stearoylethanolamine, arachidonylglycerol and cholesterol) in an inorganic solvent that is then evaporated, leaving a thin film of dried, LIPI is on a surface of the container. Then in the container is injected aqueous solution of hybrid factor VIII. Then the container is shaken manually to release lipid material from the walls of the container and dispersion of lipid aggregates with education thus suspension of liposomes.

Recombinant porcine or modified porcine factor VIII can be combined with other suitable stabilizing compounds that delivers the media and/or media-carriers, including those dependent on vitamin K clotting factors, tissue factor, factor von Willebrand's disease (vWf) or a fragment of vWf, which contains the binding site of factor VIII, and polysaccharides such as sucrose.

Recombinant porcine or modified porcine factor VIII can also be delivered by hemotherapy in the same manner, as may be delivered to the human factor VIII, using such means of delivery as retroviral vectors. This method consists in incorporating a desired structure factor VIII cDNA in human cells that are transplanted directly into having a deficiency of factor VIII of the patient or which is placed in an implantable device, permeable to molecules of factor VIII, but not permeable to cells, which is then transplanted. The preferred method is mediated by retrovirus transfer of GE is and. In this way the exogenous gene (e.g., factor VIII cDNA) clone into the genome of the modified retrovirus. This gene is embedded by a virus of the apparatus into the genome of the host cell where it is expressed in this cell. The retroviral vector modify so that it will not produce a virus that prevents viral infection of the host. Common types of therapy of this type known to specialists in this field and have been considered in the literature [e.g., Kohn, D.B. et al. (1989) Transufusion 29:812-820].

Pork or modified porcine factor VIII can be stored in the associated with vWf as to increase the half-period of the existence and retention of this hybrid molecule. Additionally, the lyophilization of factor VIII can improve the output of the active molecules in the presence of vWf. Existing storage methods of factor VIII of human and animal, used commercial suppliers can be used for storage of recombinant factor VIII. These methods include: (1) the lyophilization of factor VIII in a partially purified state (in the form of a concentrate of factor VIII, which is used for infusion without additional purification); (2) immunoaffinity purification of factor VIII by way of Zimmerman and lyophilization in the presence of albumin, which stabilizes factor VIII; (3) the lyophilization of recombinant factor VIII in the presence of al is umina.

In addition, it was found that the pork or modified porcine factor VIII is indefinitely stable at 4°With 6 M NaCl, 20 mm MES, and 5 mm CaCl2at pH 6.0 and can also be stored frozen in these buffers and activitise with minimal loss of activity.

Methods of treatment

Recombinant porcine or modified porcine factor VIII used to treat neostanovimaja bleeding caused by deficiency of factor VIII (e.g., intraarticular, intracranial or gastrointestinal bleeding in patients with hemophilia with inhibitor antibodies or without inhibitory antibodies in patients with acquired deficiency of factor VIII due to the development of inhibitory antibodies. Active materials are preferably injected intravenously.

In addition, recombinant porcine or modified porcine factor VIII can be entered by transplantation of cells, genetically engineered to produce the protein, implantation of a device containing such cells, as described above.

In a preferred embodiment, the pharmaceutical compositions of recombinant porcine or modified porcine factor VIII, single or in combination with stabilizers, delivering carriers and/or carriers injected intravenous infusion in patients under stand the same sa the second procedure, which is used for infusion of factor VIII human or animal.

Therapeutic dose of a composition of recombinant porcine or modified porcine factor VIII, which shall be administered to a patient in need of such therapy will vary depending on the severity of the deficiency of factor VIII. Usually the level of doses adjusted according to the frequency, duration and number of units in accordance with the severity and duration of each episode of bleeding the patient. Thus, factor VIII include pharmaceutically acceptable carrier for delivering carrier or stabilizer in sufficient quantity for delivery to the patient a therapeutically effective amount of this protein to stop bleeding, as measured by standard tests of coagulation.

Factor VIII is defined classically as a substance present in normal blood plasma that corrects the clotting defect in plasma derived from individuals with hemophilia A. Coagulating (coagulant) activity in vitro of purified or partially purified form factor VIII is used to calculate the dose of factor VIII infusion in patients-men, and it is a reliable indicator of activity extracted from the plasma of the patient and defect correction bleeding in vivo. He was reported contradictions between the standard analysis of the new the x factor VIII molecules in vitro and their behavior in the infusion model dog or patients-people according to Lusher, J.M. et al. New Engl. J. Med. 328:453-459; Pittman, D.D. et al. (1992) Blood 79:389-397 and Brinkhous et al. (1985) Proc. Natl. Acad. Sci. USA 82:8752-8755.

Usually the desired level of activity of factor VIII in plasma, which must be achieved in a patient by administration of a recombinant porcine or modified porcine factor VIII is in the range of 30-100% of the normal level. In the preferred method of administration of therapeutic factor VIII this composition is intravenously at a preferred dose in the range of from about 5 to 50 units/kg body weight, more preferably in the range of 10-50 units/kg body weight and most preferably at a dose of 20-40 units/kg body weight; the frequency of injection is in the range from about 8 to 24 hours (in patients with severe hemophilia); and duration of treatment in days is in the range from 1 to 10 days or as long as the episode of bleeding will not stop. See, for example, Roberts, H.R., and M.R. Jones, "Hemophilia and Related Conditions - Congenital Deficiencies of Prothrombin (Factor II, Factor V, and Factors VII to XII)," Ch. 153, 1453-1474, 1460, in Hematology, Williams, W.J., et al., ed. (1990). Patients with inhibitors may have different number of recombinant porcine or modified porcine factor VIII than their previous form factor VIII. For example, patients may require fewer recombinant porcine or modified discharge the wow factor VIII because of its higher specific activity, than the specific activity of human factor VIII, and its reduced reactivity with antibodies. As in the treatment of the human or obtained from plasma porcine factor VIII, number of therapeutic factor VIII entered by infusion, is determined using the one-stage analysis of coagulation factor VIII and in selected cases in vivo is determined by measurement of factor VIII in plasma of patients after infusion. It should be clear that for any particular subject, specific scheme of doses should be adjusted over time in accordance with individual need and in accordance with professional assessment of the person introducing the composition and / or responsible for the introduction of the compositions, and that the concentration ranges set here are only approximate and are not intended to limit the scope or practice of application of the claimed composition.

Treatment can take the form of a single intravenous administration of the composition or periodic or continuous injection for a long period of time, as needed. Alternatively, therapeutic factor VIII can be administered subcutaneously or orally with liposomes in the form of one or more doses at varying intervals of time.

Recombinant porcine or modified porcine factor VIII can also use the van to ensure neostanovimaja bleeding due to deficiency of factor VIII in patients with hemophilia, who developed antibodies to human factor VIII. In this case, the coagulating activity, which exceeds the coagulating activity of one of the factor VIII human or animal, is not necessary. Coagulating activity, which is lower than the coagulating activity of human factor VIII (i.e. less than 3000 units/mg), will be applicable if the activity is not neutralized by antibodies in the plasma of the patient.

Here it was shown that recombinant porcine or modified porcine factor VIII may differ on the specific activity of human factor VIII. Protein factor VIII, with a higher procoagulant activity than human factor VIII, applicable in the treatment of hemophilia, as will be required a lower dose for correction of the deficiency of factor VIII of human rights. Factors VIII, having a lower procoagulant activity than human factor VIII, also suitable for therapeutic use, provided that they have at least 1% of the specific activity in comparison with factor VIII healthy person. Thus, the factor VIII of the present invention, having procoagulant activity, defined as having at least 1% of the specific activity of human factor VIII.

A molecule of recombinant porcine or modified porcine factor VIII and how kind the people characteristics, production and application described above in General terms, will be more clear with reference to the following non restrictive examples.

Example 1: Analysis of porcine factor VIII and hybrid factor VIII human/pig

Porcine factor VIII has a higher coagulating activity than human factor VIII based on the specific activity of this molecule. This conclusion is based on the use of appropriate standard curves, which allow an unbiased comparison of the factor VIII of human and pig. Tests of coagulation based on the ability of factor VIII to shorten the clotting time of plasma obtained from a patient with hemophilia A. Use two types of tests: single-stage and two-stage analysis.

In one analysis, 0.1 ml of plasma of a patient with hemophilia A (George King Biomedical, Inc.) incubated with 0.1 ml of the reagent for activated partial thromboplastin time (ARTT) (Organon Teknika) and the breakdown of 0.01 ml or standard, consisting of diluted citrate plasma of a healthy person, for 5 min at 37°With water bath. Incubation was accompanied by the addition of 0.1 ml of 20 mm CaCl2and the time development of the fibrin clot was determined by visual observation.

Unit of factor VIII is defined as the amount present in 1 ml citrate plasma of a normal person. From human plasma in image quality is as standard compared directly the activity of porcine and human factor VIII. Breeding standard plasma or purified proteins were prepared in 0.15 M NaCl, 0.02 M HEPES, pH 7.4. A standard curve constructed on the basis of 3 or 4 dilution of plasma, and was the highest dilution of 1/50, and on the basis of log10-clotting time, built against log10-the plasma concentration, which resulted in a line graph. Units of factor VIII in the unknown sample was determined by interpolation from the standard curve.

Single-stage analysis based on endogenous activation of factor VIII by activators generated in the plasma of a person with hemophilia, Whereas the two-stage analysis measures the procoagulant activity of pre-activated factor VIII. In the two-stage analysis of samples containing factor VIII, which interacted with thrombin was added to the mixture of the reagent for activated partial thromboplastin time and plasma of a person with hemophilia A, which was preincubation for 5 min at 37°C. Then, the clotting times were converted into units/ml based on the same standard curve of human plasma, as described above. Relative activity in the two-stage analysis was higher than in the single-stage analysis, since the factor VIII was activated.

Example 2: Characterization of the functional differences between the human factor VIII and light of the year

The allocation obtained from plasma factor VIII and recombinantly the human factor VIII have been described in the literature in Fulcher, S.A. et al. (1982) Proc. Natl. Acad. Sci. USA 79:1648-1652; 'toole et al. (1984) Nature 312:342-347 (Genetics Institute); Gitschier et al. (1984) Nature 312:326-330 (Genentech); Wood et al. (1984) Nature 312:330-337 (Genentech); Vehar et al. Nature 312:337-342 (Genentech); Fass et al. (1982) Blood 59:594; 'toole et al. Proc. Natl. Acad. Sci. USA 83:5939-5942. This can be accomplished in several ways. All these drugs are similar in composition subunits, although there is a functional difference in stability between human and porcine factor VIII.

For comparison, recombinant human and porcine factor VIII preparations of purified recombinant human factor VIII (Cutter Laboratories, Berkeley, CA) and porcine factor VIII [immune purified as described in Fass et al. (1982) Blood 59:594] were subjected to liquid chromatography high pressure (ghvd) through the Mono Q™ (Pharmacia-LKB, Piscataway, NJ) anion-exchange column (Pharmacia, Inc.). The purpose of phase Mono Q™-jhud was the elimination of minor impurities exchange of human and porcine factor VIII in the shared buffer for comparative purposes. The vials containing 1000-2000 units of factor VIII, restored to a solution of 5 ml of N2O. Then added HEPES (2 m, pH 7.4) to a final concentration of 0.02 M. the Factor VIII was applied on the column, Mono Q™ HR 5/5, equilibrated in 0.15 M NaCl, 0.02 M HEPES, 5 mm CaCl2at pH 7.4 (Buffer a plus 0.15 M NaCl); washed with 1 ml of a mixture of Buffer A + 0.15 M NaCl and was suirable 20 ml linear gradient of 0.15 M-0.90 M NaCl in the Buffer And when the speed of the current of 1 ml/min

For comparison obtained from plasma factor VIII human (purified using a Mono Q™-ghvd) and porcine factor VIII immunoaffinity purified, obtained from plasma porcine factor VIII was diluted 1:4 0.04 M HEPES, 5 mm CaCl2, 0.01% tween-80, at pH 7.4, and subjected to Mono Q™-ihvd under the same conditions described in the previous paragraph for human factor VIII. These procedures for the selection of the factor VIII of human and pig are the standard for professionals with qualifications in this field.

Column fractions were analyzed for the activity of factor VIII using a one-stage coagulation analysis. The average results of these analyses, expressed in units of activity in A280material given in the table and show that porcine factor VIII has at least 6-fold higher activity than human factor VIII, the application of one-stage analysis.

Table

Comparison of the clotting activity of factor VIII human and swine
Activity (E/A280
Pork21300
Derived from human plasma3600
Recombinant human2400

Example 3: Comparison of stability facto is and VIII of human and swine

The results of one-stage analysis for factor VIII reflect the activation of factor VIII to factor VIIIa in the sample and, possibly, the loss of activity resulting factor VIIIa. Conducted a direct comparison of the stability of the factor VIII of human and pig. Samples from Mono Q™-Ehud (Pharmacia, Inc., Piscataway, NJ) was diluted to the same concentration and buffer of the same composition and gave them to interact with thrombin. At different time points samples were taken for two-stage analysis of coagulation. Typically, the maximum (peak) activity (2 min) was 10 times higher for porcine factor VIIIa than for the human factor VIIIa, and activity of swine and human factor VIIIa then decreased, and the activity of factor VIIIa person decreased more quickly.

Usually attempts to allocate a stable factor VIIIa person are unsuccessful, even when using the conditions giving stable porcine factor VIIIa. To demonstrate this Mono Q™-ehvd-purified human factor VIII activated by thrombin and subjected to Mono S™-cation exchange ghvd (Pharmacia, Inc.) in circumstances which give stable porcine factor VIIIa, as described by Lollar et al. (1989) Biochemistry 28:666.

Human factor VIII, 43 μg/ml (0.2 μm) in 0.2 M NaCl, 0.01 M HEPES, 2.5 mm CaCl2at pH 7.4, 10 ml total volume, interacted with thrombin (being 0.036 μm) for 10 min, and at this time it is time to relax is whether FPR-CH 2Cl (D-phenyl-shed-arginyl-chloromethylketone) to a concentration of 0.2 μm to irreversible inactivation of thrombin. Then this mixture was diluted 1:1 with 40 mm 2-(N-morpholino)econsultancy acid (MES), 5 mm CaCl2at pH 6.0 and was applied at a speed of 2 ml/min column Mono S™-HR 5/5-Ehud (Pharmacia, Inc.), equilibrated in 5 mm MES, 5 mm CaCl2at pH 6.0 (Buffer) plus 0.1 M NaCl. Factor VIIIa was suirable without washing the column with 20 ml gradient from 0.1 M NaCl to 0.9 M NaCl in Buffer at the speed of a current of 1 ml/min

Fractions with coagulating activity in the two-stage analysis was loirevalley as a single peak under these conditions. The specific activity of the fractions of the peak was approximately 7500 S/A280. Gel electrophoresis in sodium dodecyl sulphate polyacrylamide gel (LTOs-PAG) peak factor VIIIa with speakers Mono S™ with subsequent silver staining revealed two bands corresponding heterodimeric derived factor VIII A3-C1-C2/A1). Although the A2 fragment was not identified by silver staining under these conditions due to its low concentration, it was identified as a component in trace quantities by125I-tagging.

In contrast to the results with human factor VIII, porcine factor VIIIa, dedicated Mono S™-ihvd under the same conditions, had a specific activity of 1.6×106E/A280. Analysis of porcine factor VIIIa is ri using electrophoresis in LTO-SDS page revealed 3 fragment, the respective subunits A1, A2 and A3-C1-C2, which showed that porcine factor VIIIa has three subunits.

The results of the Mono S™-ihvd drugs activated by thrombin of human factor VIII at pH 6.0 showed that the factor VIIIa person is labile under conditions which give stable porcine factor VIIIa. However, although trace amounts of A2-fragments were identified in fractions of the peak determination, there was a coagulating activity of small amounts of heterotrimeric factor VIII or heterodimeric factor VIIIa, which has a low specific activity, is impossible when using only this method.

To resolve this issue is desirable method of extraction of factor VIIIa man before he will lose his A2-subunit. For this purpose, the selection was performed using a procedure that includes lowering the pH of Mono S™-buffers to a pH of 5. Mono Q™-purified human factor VIII (0.5 mg) was diluted in H2O obtaining a final concentration of 0.25 mg/ml (1 μm) of factor VIII in 0.25 M NaCl, 0.01 M HEPES, 2.5 mm CaCl2, of 0.005% Tween-80, at pH 7.4 (total volume of 7.0 ml). Thrombin was added to a final concentration of 0,072 μm and allowed to react for 3 minutes Then thrombin iactiveaware FPR-CH2Cl (0.2 μm). Then this mixture was diluted 1:1 with 40 mm sodium acetate, 5 mm CaCl2, in 0.01% Tween-80, p and pH 5.0 and was applied at a speed of current of 2 ml/min column Mono S™ -HR 5/5-ihvd, equilibrated in 0.01 M sodium acetate, 5 mm CaCl2, in 0.01% Tween-80, at pH 5.0, plus 0.1 M NaCl. Factor VIIIa was suirable without washing the column with 20 ml gradient from 0.1 M NaCl to 1.0 M NaCl in the same buffer at a speed of current of 1 ml/min. This led to removing the coagulating activity peak, which contained the detected number of fragment A2, as shown by electrophoresis in LTO-SDS page and silver staining. The specific activity of the fractions of the peak was 10 times higher than the specific activity, which was extracted at pH 6.0 (75000 E/A280against 7500 S/A280). However, in contrast to pork factro VIIIa allocated at pH 6.0, which was indefinitely stable at 4°C, the activity of factor VIIIa person decreased uniformly over a period of several hours after elution from Mono S™. In addition, the specific activity of factor VIIIa, purified at pH 5.0, some immediately, accounts for only 5% of the activity of porcine factor VIIIa, which indicates that before the analysis has significant dissociation.

These results demonstrate that both human and porcine factor VIIIa consists of three subunits (A1, A2 and A3-C1-C2). Dissociation of subunit A2 is responsible for the loss of activity of both human and porcine factor VIIIa in certain conditions, such as physiological ion is th power, the pH and concentration. The relative stability of porcine factor VIIIa in certain conditions due to a stronger relationship with the A2 subunit.

Example 4: isolation and sequencing of DNA, encoding the A2 domain of porcine factor VIII

Previously sequenced only the nucleotide sequence encoding B-domain and part of the A2 domain of porcine factor VIII ['toole et al. (1986) Proc. Natl. Acad. Sci. USA 83:5939-5942]. Here we describe the cDNA sequence and amino acid sequence (SEQ ID NO:3 and 4, respectively) for all A2 domain of porcine factor VIII.

A2 domain of porcine factor VIII has cloned by reverse transcription of total RNA pork spleen and PCR amplification; used degenerate primers based on the known cDNA sequence of human factor VIII and accurate pork primer on the basis of the sequence of porcine factor VIII. PCR product 1 TPN was isolated and amplified by insertion in formigny vector Bluescript™ (Stratagene).

Porcine A2 domain was completely sequenced, dideoxy-sequencing. cDNA sequence and predicted amino acid sequence presented in SEQ ID NO:3 and 4, respectively.

Example 5: the Complete DNA sequence that encodes a porcine factor VIII

Fragment maple, phosphorylated Clal linkers, linkers Notl, T4 ligase and DNA Taq polymerase was purchased from Promega (Madison, Wiscosin). Polynucleotides were purchased from Life Technologies, Inc., Gaithersburg, Maryland. γ32P-ATP (Redivue, >5000 CI/mmol) was purchased from Amersham. pBluescript II KS - and E. coli cells Epicurean XL1-Blue were purchased from Stratagene (La Jolla, California). Synthetic oligonucleotides were purchased from Life Technologies, Inc. or Cruachem, Inc. When PCR products were received for the purposes of cloning, we used 5'-phosphorylated primers. Nucleotide (nt) the numbering of the oligonucleotides used as primers for amplification using the polymerase chain reaction (PCR) cDNA or genomic DNA porcine factor fVIII (fVIII), uses fVIII cDNA person as a standard (reference) (Wood et al. (1984) supra).

Total RNA spleen pigs were isolated by extraction with a mixture of sour guanidinylation-phenol-chlorofom [Chomczynski et al. (1987) Anal. Biochem. 162:156-159]. Porcine cDNA was obtained from total spleen RNA using reverse transcriptase (FROM) leukosis virus, Malone mice and random hexamers for priming of the reaction (the set for the synthesis of the first chain cDNA, Pharmacia Biotech), unless otherwise indicated. FROM reactions containing 45 mm Tris-Cl, pH 8.3, 68 mm KCl, 15 mm DTT, 9 mm MgCl2, 0.08 mg/ml bovine serum albumin and 1.8 mm deoxynucleotides (dNTP). Porcine genomic DNA was isolated from the spleen using standard procedures (Strauss, W.M. (1995) In Current Protocols in Molecular Biology, F.M.Ausubel et al., editors, John Wiley and Sons, pp. 2.2.1-2.2.3). delanie DNA from agarose gels was performed using the kit for the extraction of gels Geneclean II (Bio 101) or Quiex II (Qiagen).

PCR reactions were performed using thermal cycler Hybaid OmniGene. For PCR reactions using DNA polymerase Taq reaction mixture consisted of 0.6 ml MgCl2, 0.2 mm dNTP, 0.5 µm oligonucleotide primer, 50 u/ml Taq polymerase and 0.1 volume of the reaction mixture for the first chain cDNA. Except where given other instructions, PCR products were purified from gel, the end was a small mistake fragment maple, precipitated with ethanol and either ligated with the EcoRV site dephosphorylating plasmids pBluescript II KS-or ligated to phosphorylated by Clal linkers using T4-ligase, Clal digested, purified by Sephacryl 3400-chromatography and ligated with the cut Clal, dephosphorylating the plasmid pBluescript II KS-. Ligation was performed with DNA ligase T4 (set for quick ligation of DNA, Boehringer Mannheim) except where specified differently. Containing insert of the plasmid pBluescript II KS - used for transformation of E. coli cells Epicurean XL1-Blue.

Sequencing of plasmid DNA was performed using automated DNA sequencing machine Applied Biosystems 373a and set for termination using PRISM dye or manual using the kit Sequenase sequencing v. 2,0 (Amersham Corporation). Direct sequencing of PCR products, including32R-end labeling of oligonucleotides was performed using the Protocol of cyclic s is tiravanija (dsDNA Cycle Sequencing System, Life Technologies).

The selection of cDNA clones of porcine fVIII. containing 5' UTR sequence, codons of the signal peptide and the A1-domain

cDNA of porcine fVIII 5' (left) from the A2-domain of amplified RT-PCR with built primers total RNA of the spleen in female pigs using Protocol rapid amplification of 5'-end cDNA (5'-RACE (Marathon cDNA Amplification, Clontech, Version PR55453). This Protocol included the synthesis of the first chain cDNA using dominuyushego (joining) the type of shutter oligo(dt)primer [Borson, N.D. et al. (1992) PCR Methods Appl. 2:144-148], synthesis of the second chain cDNA using DNA polymerase I of E. coli and ligation with 5'-extended double-stranded adapter, SEQ ID NO:5

5'-HUNDRED ATA CGA CTC ACT ATA GGG CTC GAG CGG CCG CCC GGG CAG GT-3

3'-H2N-CCCGTCCA-PO4-5'

short circuit which is blocked at the 3'-end amino group to reduce non-specific PCR priming and which was 8 complementary to the nucleotide on the 3'-end (Siebert, P.D., et al. (1995) Nucleic. Acids. Res. 23:1087-1088). First round PCR was performed using adapter-specific oligonucleotide, SEQ ID NO:6 5'-CCA TCC TAA TAC GAC TCA HUNDRED TAG GGC-3' (named AP1) as a sense primer specific for the A2 domain of porcine fVIII of the oligonucleotide SEQ ID NO:7 5'-CCA TTG ACA TGA AGA CCG TTT CTC-3' (nucleotides 2081-2104) as an antisense primer. The second round PCR was performed using the built, adapter-SP is specific oligonucleotide, SEQ ID NO:8 5'-ACT CAC TAT AGG GCT CGA GCG GC-3' (named AR) as a sense primer and built specific for the A2 domain of porcine fVIII of the oligonucleotide SEQ ID NO:9 5'-GGG TGC AAA GCG CTG ACA TCA GTG-3' (nucleotides 1497-1520) as an antisense primer. PCR was performed using a commercial kit (Advantage cDNA PCR core kit), which uses indirect antibody Protocol with hot start [Kellogg, D.E. et al. (1994) BioTechniques 16:1134-1137]. The PCR conditions include denaturation at 94°C for 60 sec, followed by 30 cycles (first PCR) or 25 cycles (second PCR) denaturation for 30 sec at 94°C, annealing for 30 sec at 60°C and elongation for 4 min at 68°using the temperature control tubes. This procedure gave a notable product -1,6 TPN, which is consistent with the amplification of the fragment extends to approximately 150 BP 5'-UTR. The PCR product was cloned into pBluescript using Clal linkers. The four inserts of clones sequenced in both directions.

The sequence of these clones included the areas corresponding to 137 BP 5'-UTR, the signal peptide, A1-domain and part of the A2 domain. Consensus was achieved in at least 3 of the 4 sites. However, these clones contained an average of 4 obvious PCR-generated mutations, presumably as a result of multiple rounds of PCR required to generate cloned what about the product. Thus, the inventors used the sequence obtained from the region of the signal peptide, to construct phosphorylated PCR primer semantic chain, SEQ ID NO:10 5'-CCTCTCGAGSSA SSA TGT CGA GCC ACCATGCAG HUNDRED GAG CTC TCC ACC TG-3', named RENEOPIGSP, for the synthesis of other PCR product to confirm the sequence and cloning in expressing vector. The sequence is shown in bold indicates the start codon. The sequence of the 5' (left) from it denotes a sequence identical to the sequence 5' (left) from the site insertions in expressing the vector of This mammal used for the expression of fVIII (Lubin et al. (1994) supra). This site includes a site of cleavage Xhol (underlined). RENEOPIGSP and oligonucleotide from nucleotides 1497-1520 used for priming mediated DNA polymerase Taq PCR reaction using cDNA spleen in female pigs as a matrix. DNA polymerase from several other suppliers could not provide the detected product. The PCR conditions included denaturation at 94°C for 4 min, then 35 cycles of denaturation for 1 min at 94°C, annealing for 2 min at 55°C and elongation for 2 min at 72°With subsequent end-stage elongation for 5 min at 72°C. the PCR product was cloned in pBluescrit using Clal linkers. The two inserts of these clones sequenced in both directions and comparing the consensus sequence.

The selection of cDNA clones of porcine fVIII containing codons domains A3. C1 and 5'-half of the C2 domain

First cloned two RT-PCR product from the spleen of a pig, the corresponding fragment In the A3 domain (nucleotides 4519-5571) and the fragment of domain C1-C2 (nucleotides 6405-6990). 3'-end of the C2 domain, which has been lengthened in the region of exon 26, which is the terminal exon in fVIII. B-A3-product was obtained with the use of specific In-domain pigs primer, SEQ ID NO:11 5'-CGC GCG GCC GCG CAT CTGGCA AAG CTG AGT T-3', where the underlined region corresponds to the region in porcine fVIII, which is mapped to nucleotides 4519-4530 in human fVIII. the 5'region of the oligonucleotide includes a Notl site, which was originally intended for the purposes of cloning. Antisense primer used in generating In-A3-product, SEQ ID NO:12 5'-GAA ATA AGC CCA GGC TTT GCA GTC RAA-3' was based on the reverse complement cDNA sequences of human fVIII in the nucleotide 5545-5571. The PCR reaction contained 50 mm KCl, 10 mm Tris-Cl, pH of 9.0, 0.1% Triton X-100, 1.5 mm MgCl2, 2.5 mm dNTP, 20 μm primers, 25 units/ml DNA polymerase Taq and 1/20 volume of the reaction mixture FROM. The PCR conditions were as follows: denaturation at 94°C for 3 min followed by 30 cycles of denaturation for 1 min at 94#x000B0; C, annealing for 2 min at 50°C and elongation for 2 min at 72°C. PCR products were fosforilirovanii using DNA T4 kinase and added linkers Notl. After cutting Notl PCR fragments were cloned into the Notl site pBluescript II KS - and transformed into cells XL1-Blue.

C1-C2-product was obtained using the known sequence of human cDNA for the synthesis of sense and antisense primers, SEQ ID NO: 13 and 5'-AGG AAA TTC CAC TGG AAC CTT N-3' (nucleotides 6405-6426) and SEQ ID NO: 14 5'-CTG GGG GTG AAT TCG AAG GTA GCG N-3' (reverse complement of nucleotides 6966-6990 respectively. The PCR conditions were identical to the conditions used to generate the In-A2-product. The resulting fragment ligated to the cloning vector pNOT using cloning Prime PCR Cloner Cloning system (5 Prime-3 Prime, Inc., Boulder, Colorado) and were grown in JM109 cells.

B-A3 - C1-C2 plasmids partially sequenced to obtain specific for swine sense and antisense oligonucleotides, SEQ ID NO:15 5'-GAG TTC ATC GGG AAG ACC TGT TG-3' (nucleotides 4551-4573) and SEQ ID NO:16 5'-ACA GCC CAT CAA CTC CAT GCG AAG-3' (nucleotides 6541-6564), respectively. These oligonucleotides were used as primers for RT-PCR-product 2013 P.N. using a set of PCR cDNA Clontech Advantage ® cDNA PCR kit. This product, which corresponds to nucleotides 4551-6564 person, includes a region corresponding to the peptide activation of the light chain is (nucleotides 5002-5124), A3-domain (nucleotides 5124-6114) and most of the C1 domain (nucleotides 6115-6573). The sequence C1-C2-clone found that the cDNA of human and pig from nucleotide 6565 to the 3'-end of the C1 domain were identical. The PCR product was cloned into the EcoRV site pBluescript II KS-. Four clones were completely sequenced in both directions. Consensus was achieved in at least 3 of the 4 sites.

The selection of cDNA clones of porcine fVIII containing the 3'half of the codons C2-domain

C2-domain of human fVIII (nucleotides 6574-7053) is contained in exons 24-26 [Gitschier J. et al. (1984) Nature 312:326-330]. Exon person 26 is a 1958 BP corresponding to nucleotides 6901-8858. It includes 1478 BP 3'-untranslated sequence. Attempts to clone the cDNA exon 26, corresponding to the 3'-end of the C2 domain and the 3'UTR, using 3'-RACE [Siebert et al. (1995) supra], inverse PCR [Ochman, H. et al. (1990) Biotechnology (N.Y.), 8:759-760], PCR using restriction site [Sarkar, G. et al. (1993) PCR Meth. Appl. 2:318-322], "unpredictable praimirovanie" PCR [Dominguez, O. et al. (1994) Nucleic Acids Res. 22:3247-3248] and screening cDNA libraries pig liver were not successful. 3'-RACE was trying to make using the same library legirovannykh with adaptor double-stranded cDNA, which was successfully used to clone the 5'-side of the cDNA of porcine fVIII. Thus, the lack of success using this method was not due to lack of cDNA, sootvetstvujushej the exon 26.

The PCR procedure "walks" gene target [Parker, J.D. et al. (1991) Nucleic. Acids. Res. 19:3055-3060] was used for cloning the 3'half of the C2-domain. Specific for swine sense primer, SEQ ID NO:17 5'-TCAGGGCAATCAGGACTCC-3' (nucleotides 6904-6924) was synthesized based on the initial sequence of C2-domain and used in PCR reactions with non-specific "walking" primers selected from oligonucleotides that are available in the laboratory. Then PCR products were tested as targets, using the analysis of primer extension [Parker et al. (1991) BioTechniques 10:94-101] using32P-labeled at the end of the specific pig inner primer, SEQ ID NO: 18 5'-CCGTGGTGAACGCTCTGGACC-3' (nucleotides 6932-6952). Interestingly, out of the 40 tested nonspecific primers only two gave positive products in the analysis, primer extension, and these two primers corresponded to the exact and degenerate sequences person on the 3'side of the C2-domain: SEQ ID NO:19 5'-GTAGAGGTCCTGTGCCTCGCAGCC-3' (nucleotides 7030-7053) and SEQ ID NO:20 5'-GTAGAGSTSCTGKGCCTCRCAKCCYAG-3' (nucleotides 7027-7053). These primers were originally designed for producing the product of conventional RT-PCR, but was not successful in generating sufficient quantity of the product, which could be visualized by binding of the dye ethidium bromide. However, the PCR product was able to identify more sensitive methods for the om analysis primer extension. This product was purified from the gel and directly sequenced. This allowed to extend the sequence of porcine fVIII 3' (right) to the nucleotide 7026.

Additional sequence was obtained by analysis of the primer extension product of PCR with built-in primer generated using the library legirovannykh with adaptor double-stranded cDNA used in Protocol 5'-RACE, described earlier. The reaction of the first round had used the exact primer pigs SEQ ID NO:21 5'-CCTCGCATGGAGTTGATGGGCTGT-3' (nucleotides 6541-6564) and AP1 primer. The reaction of the second round used SEQ ID NO:22 5'-ACCESSACCESS-3'(nucleotides 6913-6934) and A primer. Direct PCR sequencing was extended this sequence 3" (right) to the end of the C2 domain (nucleotide 7053). The sequence of the C2 domain was unique except for the nucleotide at 7045 near the 3'-end of the C2 domain. The analysis is repeated several times PCR reactions gave an A or A G, or a double reading of A/G in this site.

Sequencing was extended in the 3'UTR using two complementary primers, SEQ ID NO:23 5'-GGA TCC ACC CCA CGA GCT GG-3' (nucleotides 6977-6996) and SEQ ID NO:24 5'-CGC CCT GAG GCT CGA GGT TCT AGG-3' (nucleotides 7008-7031). Got about 15 BP sequence 3'-UTR, although this sequence was unclear in several sites. Then synthesised several antisense primers based on the best preblei is the R estimates 3'-noncoding sequence. These primers comprises the reverse complement of the stop codon TGA at their 3'-ends. PCR products were obtained from both genomic DNA of pig spleen, and spleen cDNA pigs, and visualized using agarose gel electrophoresis and staining with ethidium bromide using specific sense primer SEQ ID NO:25 5'-AAT CAG GAC TCC TCC ACC CCC G-3' (nucleotides 6913-6934) and antisense primer 3'-UTR, SEQ ID NO:26 5'-CCTTGCAGGAATTCGATTCA-3'. To obtain sufficient quantities of material for the purpose of cloning the second round of PCR was performed using the built sense primer, SEQ ID NO:27 5'-CCGTGGTGAACGCTCTGGACC-3' (nucleotides 6932-6952) and the same antisense primer. The PCR product 141 BP cloned in EcoRV cut pBluescript II KS-. Received in both directions, the sequence of three clones derived from genomic DNA, and three clones derived from cDNA. This sequence was unambiguous except for the provisions of the nucleotide 7045, where genomic DNA has always had a, a cDNA always had a G.

Mapping of multiple DNA sequences of human, porcine, and murine fVIII (figa-1N)

Mapping regions of the signal peptide, the areas A1, A2, A3, C1 and C2 were performed using the program CLUSTALW [Thompson, J.D. et al. (1994) Nucleic. Acids. Res. 22:4673-4680]. Fines (penalties) opening gap and extension gap was 10 and 0.05, respectively. is sopostavlenija In the domains of man, mice and pigs have been described previously [Elder et al. (1993) supra]. The sequence A2 of the person corresponds to amino acids 373-740 in SEQ ID NO:2. Amino acid sequence of the porcine A2 is presented in SEQ ID NO:4, and amino acid sequence of murine A2-domain is presented in SEQ ID NO:28, amino acids 392-759.

Example 6: Expression of active recombinant containing no In-domain of porcine factor VIII (PB-)

Materials

Citrate plasma of a person with hemophilia a and healthy person bought from George King Biomedical, Inc. Fetal calf serum, geneticin, penicillin, streptomycin, DMEM/F12 and medium AIM-V was purchased from Life Technologies, Inc. DNA Taq polymerase was purchased from Promega. DNA polymerase Vent purchased from New England Biolabs. DNA polymerase Pfu and fahmida pBluescript II KS-purchased from Stratagene. Synthetic oligonucleotides were purchased from Life Technologies or Cruachem, Inc. Restriction enzymes were purchased from New England Biolabs or Promega. Upon receipt of PCR products for cloning were used 5'-phosphorylated primers. Nucleotide (nt) the numbering of the oligonucleotides used as primers for amplification using the polymerase chain reaction (PCR) cDNA or genomic DNA porcine fVIII, uses fVIII cDNA person in reference [Wood et al. (1984) Nature 312:330-337]. Expressing fVIII vector, named HB' /This was obtained from Biogen, Inc. HB'/This contains the genes of the sustainability the spine to ampicillin and geneticin and fVIII cDNA person, which is not just a domain that is determined by the fragment cleavage Ser741-Arg1648 produced by thrombin. To facilitate mutagenesis of cDNA C2 domain of fVIII, which is located on the 3'end of the inserts fVIII in This, input the Notl site of two base 3' (right) relative to the stop codon HB'/This through mutagenesis with splicing and subsequent overlapping extension (SOE) [Horton, R. et al. (1993) Methods Enzymol. 217:270-279]. This design was named HB'This/Notl.

Total RNA was isolated using extraction with a mixture of sour guanidinylation-phenol-chloroform [Chomczynski, P. et al. (1987) Anal. Biochem. 162:156-159]. cDNA was synthesized from mRNA using reverse transcriptase (FROM) leukosis virus, Malone mice and random hexamers according to the instructions supplied by the manufacturer (kit for the synthesis of the first chain cDNA, Pharmacia Biotech). Plasmid DNA was purified using makinalari for the Qiagen plasmid ((Qiagen, Inc.). PCR reactions were performed using thermal cycler Hybaid OmniGene and DNA polymerase Taq, Vent or Pfu. PCR products were purified from the gel, precipitated with ethanol and ligated into the DNA plasmid using DNA T4 ligase (set to fast ligating DNA (Boehringer Mannheim). Containing insert of the plasmid used to transform cells of E. Epicurean coli XL1-Blue. All new DNA sequences fVIII generated using PCR confirmed dideoxy-sequencer the requirement using automated DNA sequencing machine a Applied Biosystems and set for termination with PRISM dye.

Designing expressing vector hybrid fVIII, HP20 containing C2-domain pigs

cDNA of porcine fVIII, the corresponding 3'-side of the C1 domain and the entire C2 domain, was cloned into pBluescript using RT-PCR from total spleen RNA using primers based on the known cDNA sequence of porcine fVIII [Healey, J.F. et al. (1996) Blood 88:4209-4214]. This design and HBVReNeo used as matrices to construct a merged product of C1 and person - C2 pigs in pBluescript using SOE-mutagenesis. C1-C2-fragment in this plasmid was removed using Apal and Notl and ligated into the cut Apal/Notl HBVReNeo/Notl obtaining HP20/This/Notl.

Design devoid of In-domain hybrid fVIII human/pig containing porcine light chain (NR)-

Light chain of fVIII person consists of amino acid residues Asp1649-Tug. The corresponding residues in the cDNA of porcine fVIII replaced the area HB' with obtaining hybrid fVIII molecule man/pig named NR. This was done by replacing the PCR product corresponding to the A2 area A3 domain, C1-domain and C2 domain pigs, the corresponding area in the HP20. To facilitate obtaining designs synonymous Avrll site was introduced in nt 2273 at the junction of the A2 - and A3-domains HP20 by SOE-mutagenesis.

Design devoid of In-domain hybrid fVIII human/pig containing a signal peptide, A1-the house is n and A2-domain pigs (NR)-

Signal peptide fVIII human A1 domain and the A2-domain consists of amino acid residues Met(-19)-Arg740. The corresponding residues in the cDNA of porcine fVIII replaced the area HB' getting molecule called NR. In addition, the synonymous Avrll site was introduced in nt 2273 at the junction of the A2 - and A3-domains NR by SOE-mutagenesis. NR designed by the fusion of the signal peptide-A1-fragment-A2 partial fragment pigs in pBluescript [Healy et al. (1996) supra] deprived of In-domain hybrid fVIII human/pig containing the A2-domain of the pig, named HP1 [Lubin et al. (1994) supra].

Design devoid of In-domain porcine fVIII-(PB-)

Spel/Notl fragment HP18/BS (+ Avrll) were digested Avrll/Notl and ligated in split Avrll/Notl HP22/BS (+ Avrll) to obtain the design PB-/BS (+ Avrll), which consists of porcine fVIII, devoid of all In-domain. RV - cloned in This by legirovaniem Xba/Notl fragment PB-/BS (+ Avrll) in H22/This/Notl (+ Avrll).

Expression of recombinant fVIII molecules

PB-/This/Notl (+ Avrll) and H22/This/Notl (+ Avrll) was temporarily transfusional in COS cells and expressed as described previously [Lubin, I.M. et al. (1994) J. Biol. Chem. 269:8639-8641]. HB-/This/Notl and without DNA (false transfection) was transfusional as a control.

The activity of fVIII PB-, NR and HB-was measured using a chromogenic analysis as follows. Sample fVIII in supernatant cell culture advance is ovali 40 nm thrombin in 0.15 M NaCl, 20 mm HEPES, 5 mm cACl2, in 0.01% Tween-80, pH 7.4, in the presence of 10 nm of factor IX, 425 nm factor X, and 50 μm single layer of bubbles (vesiculo) phosphatidylserine-phosphatidylcholine (25/75 weight/weight). After 5 min the reaction was stopped 0.05 M EDTA and 100 nm recombinant desulfatohirudin and the resulting factor XA was measured by analysis with a chromogenic substrate. In the analysis with the chromogenic substrate was added to 0.4 mm Spectrozyme XA and the rate of release of para-nitroanilide was determined by measuring the absorbance of the solution at 405 nm.

The results of supernatant cell cultures independently transfected dual replicates cells (absorbance at 405 nm/min)

NV-: 13,9

PB-: 139

NR:100

false transfetsirovannyh: <0,2

These results indicate that porcine devoid of In-domain and devoid of fVIII B-domain of fVIII, consisting of pork subunits A1 and A2 are active, and assume that they have a higher activity compared to devoid of b-domain of fVIII man.

PB-partially purified and concentrated from the environment for growing chromatography on heparin-Sepharose. Heparin-Sepharose (10 ml) was balanced of 0.075 M NaCl, 10 mm HEPES, 2.5 mm CaCl2, of 0.005% Tween-80, 0.02% of sodium azide, pH 7,40. Wednesday (100-200 ml) from expressing cells was applied to a heparin-Sepharose, which was then washed with 30 ml of a buffer to balance without azide n is sodium. PB-was suirable 0.65 M NaCl, 20 mm HEPES, 5 mm CaCl2, in 0.01% Tween-80, pH 7.4, and stored at -80°C. the output of the coagulating activity of fVIII was usually 50-75%.

Stable expression of swine bereft of In-domain of fVIII (PB-)

Transfetsirovannyh cell lines were maintained in modified, Dulbecco environment, Needle-F12 containing 10% fetal calf serum, 50 u/ml penicillin, 50 µg/ml streptomycin. Fetal calf serum iactiveaware by heating at 50°C for one hour before use. HB-/This and PB-This/Notl (+ Avrll) consistently had transfusional cells KSS and selected for resistance to geneticin using a common Protocol, which was described previously [Lubin et al. (1994) Biol. Chem. 269:8639-8641], except that expressing cells maintained in culture medium containing 600 μg/ml of geneticin. Cells from the flasks Corning T-75, grown to confluently, was transferred to a triple Nunc flasks in a medium containing 600 μg/ml of geneticin, and grew up confluently. The medium was removed and replaced with serum-free medium AIM-V (Life Technologies, Inc.) without geneticin. The expression of factor VIII were subjected to monitoring by one-stage analysis of the clotting activity of factor VIII (vide supra) and collected 100-150 ml of medium once a day for four or five days. The maximum levels of expression in the environment for HB -and PB-there were 102 units per ml and 10-12 units per ml clotting activity of factor VIII, respectively.

Clean PB-

PB-besieged from the culture supernatant using 60% saturated ammonium sulfate and then purified W3-3 immunoaffinity chromatography and mono Q-liquid chromatography high pressure, as described previously for the purification obtained from plasma porcine factor VIII [Lollar et al. (1993) Factor VIII/factor VIIIa. Methods Enzymol. 222:128-143]. Specific coagulating activity PB-was measured by one-stage coagulation analysis [Lollar et al. (1993) supra], and it was similar to the activity obtained from plasma porcine factor VIII.

In the analysis using gel electrophoresis in the LTO-PAG medication PB-contained three bands with an average molecular mass of 160 kDa, 82 kDa and 76 kDa. Strip 82 kDa and 76 kDa were previously described as heterodimer containing A1-A2 - AP-A3-C1-C2 domains (where ar denotes the peptide activation) ['toole et al.(1984) Nature 312:342-347]. Band of 160 kDa were transferred to PVDF membrane and subjected to NH2-terminal sequencing, which gave Arg-Ile-XX-XX-Tyr (where XX stands for "not determined"), which is the NH2-terminal sequence of single-chain factor VIII ['toole et al. (1984) supra]. Thus, PB-partially processed by cleavage between domains A2 and A3, so he's SOS is the RTO of two forms, single-chain protein A1-A2-ar-C1-C2 and heterodimer A1-A2/AP-A3-C1-C2. Such processing of recombinant HB-it was reported [Lind et al. (1995) Eur. J. Biochem. 232:19-27].

Characterization of porcine factor VIII

The inventors have determined cDNA sequence of porcine fVlll corresponding to 137 BP 5'-UTR, codereuse signal peptide region (57 BP) and the domains A1 (1119 BP), A3 (990 BP), C1 (456 BP) and C2 (483 BP). Together with previously published sequence of In-domain and districts activation of the light chain peptide ['toole et al. (1986) supra] and A2 domain [Lubin et al. (1994) supra] sequence reported here terminates the definition cDNA of porcine fVIII corresponding to the broadcast product. The fragment, which included the region of the 5'-UTR, cDNA of the signal peptide and the A1 domain, was cloned using the Protocol RT-PCR 5'-RACE. Primer based on the sequence C2 man was successful in getting the RT-PCR product, which led to the cloning A3, C1 and 5'-half of the C2-domain. Difficult was the cloning of the cDNA corresponding to the 3'-half of the C2 domain and the cDNA 3'-UTR. The rest of the C2-domain in the end was cloned by using the following procedure walks through the gene-target [Parker et al. (1991) supra].

The sequence presented herein as SEQ ID NO:29 is unambiguous except codon at nt 7045 near the 3'-end of the C2 domain, which is either a or G, as the description is however higher. The corresponding codon is a GAC (Asp) or AAC (Asn). The codons of human and mouse codons are GAC and CAG (Gin), respectively. Unknown, does this mean polymorphism or reproducible PCR artifact. Recombinant cDNA hybrid (human-pig) devoid of In-domain of fVIII containing replacement pork C2-domain, as appropriate to the codon GAC and the codon AAC, were stably expressed no detected differences in procoagulant activity. It shows that between these two options C2-domain no functional differences.

Comparison of the predicted amino acid sequence of a full-sized porcine fVIII SEQ ID NO:30 with the published sequences [Wood et al. (1984) supra] and mouse [Elder et al. (1993) supra] is shown in figa-1H together with sites for posttranslational modifications, proteolytic cleavage and recognition of other macromolecules. As noted earlier, In the domains of these species are more divergent than the domains a or C. This is consistent with the observation that In a domain has no known function, despite its large size [Elder et al. (1993) supra; 'toole et al. (1986) supra]. The results of this invention show that In the domain of porcine fVIII is not necessary for activity. Based on the sequence information presented here, porcine fVIII having a deletion of the entire In-house is on or part of the In-domain can be synthesized by expression of the coding porcine fVIII DNA, in which deleterows whole pork In a domain or part of codons pork In the domain. There is also a higher divergence of sequences corresponding to peptide cleavage ARS A1-domain/factor IXa (residues 337-372) and peptide activation of the light chain. The site of cleavage by thrombin in position 336 to generate peptide 337-372, apparently lost in the mouse because this residue is a glutamine instead of arginine [Elder et al. (1993) supra]. Relatively rapid divergence of peptide cleavage by thrombin (or in murine fVIII, perhaps rudimentary peptide activation 337-372) previously noted for fibrinopeptides [Creighton, I.E. (1993) In Proteins: Struvtures and Molecular Properties, W.H. Freeman, New York, pp.105-138]. The absence of the biological functions of these peptides after cleavage was interpreted as a possible cause rapid divergence. It has been suggested that Arg562 in fVIII person is more important cleavage site for activated protein C during inactivation of fVIII and fVIIIa [Fay, P.J. et al. (1991) J. Biol. Chem. 266:20139-20145]. This website is conservative in fVIII human, pig and mouse.

Potential N-linked glycosylation sites (NXS/T, where X is not Proline) can be seen on figa-1H. There are eight conservative N-linked glycosylation sites: one located in the A1 domain, one in A2-a house is not, four-domain, one in the A3 domain and one in the C1 domain. 19 cysteine A - and C-domains are conservative, while there is a divergence cysteines In the domain. Six of the seven disulfide bonds in fVIII was detected in homologous sites in the factor V and ceruloplasmin, and both disulfide bond With domain found in the factor V [McMullen, B.A. et al. (1995) Protein Sci. 4:740-746]. fVIII person contains sulfated tyrosines at positions 346, 718, 719, 723, 1664 and 1680 [Pittman, D.D. et al. (1992) Biochemistry 31:3315-3325; Michnick, D.A. et al. (1994) J. Biol. Chem. 269:20095-20102]. These residues are conservative in murine and porcine fVIII fVIII (figure 1), although the program CLUSTALW was not able to map the mouse tyrosine, corresponding Tyr346 in fVIII person.

Murine and porcine plasma is able to correct the clotting defect in plasma of a person with hemophilia A, which is consistent with the level of conservatism residues in domains a and C of these species. Procoagulant activity of porcine fVIII exceeds the procoagulant activity of human fVIII [Lollar, P. et al. (1992) J. Biol. Chem. 267:23652-23657]. Recombinant porcine factor VIII (devoid of In-domain), expressed and purified as described here, also exhibits higher specific coagulating activity than human fVIII, when compared with those obtained from plasma porcine fVIII. This may be due to a reduced rate of spontaneous dissociation of subunit A2 from active getentry the EPA A1/A2/A3-C1-C2 fVIIIa. It is unknown whether this reflects a difference in the procoagulant activity of an evolutionary change in the function as an example of adaptation of species [Perutz, M.F. (1996) Adv. Protein Chem. 36:213-244]. Now, when cDNA sequence of porcine fVIII, corresponding to broadcast the product is complete, the scan homology mutagenesis [Cunningham, B.C., et al. (1989) Science 243:1330-1336] can provide a way of identifying structural differences between factors fVIII humans and pigs, which are responsible for the superior activity of the latter.

Usually porcine fVIII is less reactive with any abscopal (inhibitory) antibodies, which occur in patients with hemophilia who were transfusional fVIII, or which arise in the form of autoantibodies in the entire population. This is the basis for the application of the concentrate of porcine fVIII in patients with inhibitory antibodies [Hay and Lozier (1995) supra]. The majority of inhibitors directed against epitopes localized in the A2 domain or C2-domain [Fulcher, C.A. et al. (1985) Proc. Natl. Acad. Sci. USA 82:7728-7732; Scandella, D. et al. (1988) Proc. Natl. Acad. Sci. USA 85:6152-6156; Scandella, D. et al. (1989) Blood 74:1618-1626]. Was additionally identified the epitope of unknown function, which is either an A3 or C1 domain [Scandella et al. (1989) supra; Scandella, D. et al. (1993) Blood 82:1767-1775; Nakai, H. et al. (1994) Blood 84:224a]. The A2 epitope was mapped to residues 484-508 scanning homology by mutagenesis [Healey et al. (1995 supra]. In this segment of the 25 residue has a relatively low share identical sequences (16/25, 64%). Interestingly, this area, which, apparently, is functionally important based on the fact that antibodies to it are inhibitory, obviously, have had relatively more rapid genetic drift. The mapping of the porcine A2 domain and A3-domains show that the epitope A2 has no detectable homology with the corresponding region in the A3-domain.

On the basis of deletion mapping was assumed that the inhibitory epitope C2 human fVIII residues localized in 2248-2312 [Scandella, D. et al. (1995) Blood 86:1811-1819]. fVIII humans and pigs are identical to 83% in this segment of the 65 residues. However, the scan homology mutagenesis of this region to characterize the C2 epitope found that the main determinant of C2 epitope suddenly was localized in the region corresponding to amino acids 2181-2243 human (SEQ ID NO:2) and fign.

Received hybrid proteins (human-porcine) factor VIII, in which different parts of the C2 domain of human factor VIII were replaced with the corresponding parts of the porcine factor VIII using the strategy described here (example 5). The synthesis of various C2-hybrid factor VIII was accompanied by the construction of hybrid coding DNA using nucleotide after the outermost, coding pork C2-district represented in SEQ ID NO:30. Each hybrid DNA expressed in transfected cells, so that the hybrid factor VIII could be partially purified from the medium for cultivation. The activity in the absence of any inhibitor was measured in one-step analysis of coagulation.

A group of five inhibitors man used to test each hybrid factor VIII. Previously it was shown that inhibition of plasma containing antibody against factor VIII, aimed against the C2 domain of man on the basis of the ability of recombinant C2 domain of human neutralize this inhibition. In all these test plasmas (test plasmas) the titer of the inhibitor was kind of balanced out by more than 79%, and C2-domain or a light chain, but less than 10%, the recombinant A2 domain of human rights. In addition, C2-hybrid factor VIII was tested against murine monoclonal antibody that binds the C2 domain, and like C2-inhibitory antibodies person it inhibited the binding of factor VIII to phospholipid and factor a background of Villebranda.

By comparing the titer of inhibitory antibodies against C2-hybrid factor VIII has been shown that the main determinant of C2-inhibitory epitope is a region of residues 2181-2243 (SEQ ID NO:2, see fign). Antibodies against C2, aimed at the COOH-end of RA is it to balance 2253, not been identified in four of the five patients ' sera. Compared to hybrids with pork sequence corresponding to the non-amino acid residues of human 2181-2199 and 2207-2243, it was obvious that both areas contribute to the binding of the antibody. Porcine amino acid sequence corresponding to residues of human 2181-2243 has a non 1982-2044 in SEQ ID NO:30. The sequence of porcine DNA encoding amino acids 1982-2044 has a non 5944-6132 in SEQ ID NO:29.

On fign you can see that in the area 2181-2243 has 16 amino acid differences between the sequences of human and pig. Differences were found in the residues 2181, 2182, 2188, 2195-2197, 2199, 2207, 2216, 2222, 2224-2227, 2234, 2238 and 2243. Can be changed amino acids at one or more residues corresponding to the specified numbers to make factor VIII human non-reactive with inhibitory antibodies against C2-person. Alanine-scanning mutagenesis provides a convenient way to generate alanine substitutions naturally occurring residues, as described previously. For replacement can be used other than alanine, amino acids, as described herein. Alanine substitutions of individual amino acids, in particular those that are not identical between human/pig or human/mouse or who is most likely to contribute to the binding of the antibody, mo the ut to give a modified factor VIII with reduced reactivity against inhibitory antibodies.

Figa-1H, taken together, provide a comparison of matched amino acid sequence of the factor VIII of human, pig and mouse. Figa compares the areas of signal peptides (human, SEQ ID NO:31; pigs, SEQ ID NO:30, amino acids 1-19; mouse, SEQ ID NO:28, amino acids 1-19). Note that the amino acid at figa-1H numbered, provided that the first Alanine of the Mature protein is number 1, so that the amino acids of the signal peptide are given negative numbers. The sequence of human fVIII in SEQ ID NO:2 also starts with the first Alanine of the Mature protein, with the number 1. The amino acid sequences of murine fVIII (SEQ ID NO: 28) and porcine fVIII (SEQ ID NO:30) the first amino acid (alanine) of the Mature sequence is amino acid number 20. Figa-1H shows the mapping of the corresponding fVIII sequences of human, mouse and pig in such a way that regions of high amino acid identity map. The number of amino acids in figa-1H apply only to human fVIII. Figv provides amino acid sequences for the A1 domain of human (SEQ ID NO:2, amino acids 1-372), pig (SEQ ID NO:30, amino acids 20-391) and mouse (SEQ ID NO:28, amino acids 20-391). Figs provides amino acid sequences for the A2 domain of factor VIII from human (SEQ ID NO:2, amino acids 373-740), pig (SEQ ID NO:30, amino acids 392-759) and mouse (SEQ ID NO:28, aminoxy is lots 392-759). Fig.1D provides amino acid sequences of the b-domain of human factor VIII (SEQ ID NO:2, amino acids 741-1648), pig (SEQ ID NO:30, amino acids 760-1449) and mouse (SEQ ID NO:28, amino acids 760-1640). File compares the amino acid sequences of peptides activate the light chain of factor VIII, human, pig and mouse (SEQ ID NO:2, amino acids 1649-1689; SEQ ID NO:30, amino acids 1450-1490 and SEQ ID NO:28, amino acids 1641-1678 respectively). Fig.1F allows for the comparison of sequences for the A3-domain of factor VIII, human, pig and mouse (SEQ ID NO:2, amino acids 1690-2019; SEQ ID NO:30, amino acids 1491-1820 and SEQ ID NO:28, amino acids 1679-2006 respectively). Fig.1G provides amino acid sequences of C1 domain of factor VIII, human, pig and mouse (SEQ ID NO:2, amino acids 2020-2172; SEQ ID NO:30, amino acids 1821-1973 and SEQ ID NO:28, amino acids 2007-2159 respectively). Fign provides sequence data for the C2 domain of factor VIII C2 domain of human, pig and mouse (SEQ ID NO:2, amino acids 2173-2332; SEQ ID NO:30, amino acids 1974-2133 and SEQ ID NO:28, amino acids 2160-2319 respectively).

Diamonds indicate the sites of sulfation of tyrosine, proposed sites for factor IXa, phospholipid and Protein are underlined double feature, and the regions involved in the binding of inhibitory antibodies against A2 and against C2, are shown in italics. Asterisks indicate amino acid sequences, which are the two who are conservative. Cm. also SEQ ID NO:29 (cDNA of porcine factor VIII) and SEQ ID NO:30 (decoded amino acid sequence of porcine factor VIII). The numbering system of the person is used as a reference [Wood et al. (1984) supra]. Domains A1, A2 and determined the sites of cleavage by thrombin at positions 372 and 740 and the site of cleavage by an unknown protease in 1648 in the form of residues 1-372, 373-740 and 741-1648 respectively [Eaton, D.L et al. (1986) Biochemistry 25:8343-8347]. Domains A3, C1 and C2 are defined as residues 1690-2019, 2020-2172 and 2173-2332 respectively [Vehar et al. (1984) supra]. The cleavage sites for thrombin (factor), factor IXa, factor XA and ARS [Fay et al. (1991) supra; Eaton, D. et al. (1986) Biochemistry 25:505-512; Lamphear, B.J. et al. (1992) Blood 80:3120-3128] shows the location of the name of the enzyme over the reactive arginine. The acidic peptide is cleaved from the light chain of fVIII by thrombin or factor XA in position 1689. Putative binding sites for factor IXa [Fay, P.J. et al. (1994) J. Biol. Chem. 269:20522-20527; Lenting, P.J. et al. (1994) J. Biol. Chem. 269:7150-7155), phospholipid (Foster, P.A. et al. (1990) Blood 75:1999-2004) and protein (Walker, F.J. et al. (1990) J. Biol. Chem. 265:1484-1489] double underlined below. The regions involved in the binding of antibodies against A2 [Lubin et al. (1994) supra; Healey et al. (1995) supra] and previously proposed for inhibitory antibodies against C2, shown in italics. The inhibitory epitope C2, identified as described herein (amino acids 2181-2243 person), shown as underlined by one line on fign. The site is whatilove tyrosine [Pittman et al. (1992) supra; Michnick et al. (1994) supra] are shown by diamond ◆.

Example 7: Construction of POL1212 and expression in the kidney cells baby hamster

POL1212 is a partially stripped In the domain of porcine factor VIII, which has a deletion In the domain, except that these are 12 amino acids NH2-end-To-domain and 12 amino acids of the COOH-end.

cDNA coding sequence for domains A1, A2, AP-A3-C1 and C2 porcine fVIII, obtained as described in example 5. The nucleotide sequence of DNA and produced amino acid sequence of porcine factor VIII presented as SEQ ID NO:29 and SEQ ID NO:30, respectively. Amplificatoare fragments were separately cloned into plasmid pBluescript II KS (pBS).

POL1212 refers to a cDNA encoding porcine fVIII, devoid of much In the domain, but contains a DNA sequence encoding the linker of 24 amino acids between domains A2 and ar (peptide activation). POL1212 designed in expressing vector mammals, This, which was obtained from Biogen. This can be replicated in bacteria, be replicated in the form of an episome in COS cells for temporal expression of factor VIII or stably integrated into various mammalian cells. It consists of 1) sequences derived from the plasmid pBR322, which include the start of replication and the gene of resistance to ampicillin, 2) stable gene is ivoti to neomycin, expressie which is under the control of regulatory elements of the promoter/enhancer SV40 small t intron SV40 and SV40 polyadenylation signal, 3) a site for the insertion of fVIII and its signal peptide, the expression of which is under control of the SV40 enhancer, the major late promoter of adenovirus type 2 and tripartite leader sequence of adenovirus type 2. Any vector having similar functional components, can be used instead of This vector.

POL1212/This was received in several stages. First, the cDNA encoding the heavy chain of porcine fVIII (A1-A2), and cDNA encoding the light chain of porcine fVIII (AP-A3-C1-C2)were collected separately in pBS. From these constructs, DNA encoding devoid of In-domain porcine fVIII, collected in pBS (PB-/pBS). This form of porcine fVIII was not just a domain defined by amino acids corresponding to residues 741-1648 in human fVIII (nucleotides person 2278-5001). Then this DNA that encodes a porcine A2, A2 replaced man in containing devoid of b - domain of fVIII person expressing This vector (HB-/This). The DNA that encodes the rest of the porcine heavy chain and DNA encoding porcine light chain was replaced with the domains of human rights in two additional stages using designs heavy chain pigs/pBS and PB-/pBS prepared in advance. The selection In the domain of man, encoding 5-con is of evah and 9 N-terminal amino acids, built between domains A2 and A3 with the formation of structures called PSQ/This [Healey et al. (1998) 92:3701-3709]. The remains Glu2181-Val2243 contain the main determinant of the inhibitory epitope in the C2 domain of human factor VIII. This design was used as a matrix to obtain a slice of pork In-domain encoder 12 C-terminal and 12 N-terminal amino acids. This fragment was embedded between domains A2 and A3 with the final design POL1212/This.

The linker of the 24 amino acids POL1212 consists of the first 12 and last 12 residues In domain porcine fVIII. The linker POL1212 has the following sequence:

SFAQNSRPPSASAPKPPVLRRHQR (SEQ ID NO:32)

The nucleotide sequence corresponding to the linker 1212 and the surrounding amino acids, represents:

GTC ATT GAA CCT AGG AGC TTT GCC CAG AAT TCA AGA CCC CCT AGT GCG

(SEQ ID NO:33)

V I E P R S F A Q N S R P P S A

AGC GCT CCA AAG CCT CCG GTC CTG CGA CGG CAT CAG AGG GAC ATA

S A P K P P V L R R H Q R D I

AGC CTT CCT ACT

S L R T

The linker POL1212 synthesized by mutagenesis with splicing and subsequent overlapping extension (SOE) as follows:

The PCR reactions used to obtain products SOE, were as follows:

REACTION No. 1

Outer primer: Rev 4, which is a primer pork A2, nucleotides 1742-1761 SEQ ID NO:29. This sequence represents:

5'-GAGGAAAACCAGATGATGTCA-3'(SEQ ID NO:34)

Internal primer: OL12 that education is the major pork primer, includes the first (5') 15 amino acids OL1212 and the last (3') 5 amino acids of porcine A2. This sequence is: 5'-CTTTGGAGCGCTCGCACTAGGGGGTCTTGAATTCTGGGCAAAGCTCCTAGGTTCAAT

GAC-3' (SEQ ID NO:35)

Matrix: PSQ/This

Product: DNA pigs from nucleotide 1742 in the A2 domain to nucleotide 2322 in OL1212, 580 BP

REACTION No. 2

Outer primer: R represents swiney reverse primer A3, nucleotides 2998-3021 SEQ ID NO:29. This sequence is: 5'-GGTCACTTGTCTACCGTGAGCAGC-3' (see SEQ ID NO:29).

Internal primer: OL12+, pork primer that includes the last (3') 16 amino acids OL1212 and the first (5') 6 amino acids of the activation peptide, nucleotides 2302-2367 SEQ ID NO:29. This sequence represents:

5'-CCTAGTGCGAGCGCTCCAAAGCCTCCGGTCCTGCGACGGCATCAGAGGGACATAAGCC TSTEST-3' (SEQ ID NO:36).

Matrix:PSQ/This.

Product: DNA pigs from nucleotide 2302 in OL1212 to nucleotide 3021 in the A3 domain, 719 BP

The REACTION SOE

Primers: Rev 4, R-

Matrix: a Fragment of rxn #1 (BP) and a fragment with a low melting point of rxn #2 (P.N.).

Product: DNA pigs from nucleotide 1742 in the A2 domain to nucleotide 3021 in the A3 domain (SEQ ID NO:29), including OL1212, 1279 gel the reaction Product is precipitated with ethanol.

This linker 1212 embedded in the PSQ/This cutting product SOE (inserts) and PSQ/This (vector) BsaBI. The vector and insert ligated using T4 ligase and this product was used to transform cells of E. coli XL1-Blue. Plasmas is dnow DNA was obtained from several colonies and sequence of the linker 1212 and other PCR-generated sequences were confirmed by analysis of DNA sequencing.

CULTIVATION of CELLS CRL-1632 KIDNEY BABY HAMSTER (KSS)

Cell line KSS received from ATS identification number access CRL-1632 and kept frozen at -20°C until further use. The cells were thawed at 37°and was placed in 10 ml of complete medium, named DMEM/F12 containing 50 u/ml penicillin, 50 µg/ml streptomycin plus 10% fetal calf serum (FCS). FCS was purchased from Hyclone, Logan Utah. Cells were centrifuged for 2 minutes at 300 Rev/min the Medium was aspirated and cells resuspendable in two ml of complete medium in the flask T-75 containing 20 ml of complete medium.

POL1212 expressed in the kidney cells baby hamster (KSS), and in cells of the Chinese hamster ovary (Cho). Used two lines KSS line CRL-1632 from ATS and another line KSS received from R. Mcgillivray, University of British Columbia [Funk, et al. (1990) Biochemistry 29:1654-1660]. Last subculturally without selection in the laboratory of the inventors and it was named VNC (Emory). The cell line Cho was a line Cho-K1, the access number of ATSS CCL-61. The expression of the average clone of the cell line Emory and from cells Cho-K1 was slightly higher than the expression of the cells CRL-1632, as assessed by activity in the chromogenic test.

Cells grown in a flask T-75, formed confluently monolayer. Received 60 ml culture of cells of E. coli XL-1-Blue in LB/ampicillin (50 mg/ml), chosen to replace the OL1212/Re[MEO-plasmid.

TRANSFECTION of KSS-CELLS CRL-1632 by PLASMID POL1212/This

DNA from overnight culture POL1212/This-KneTOK E. coli XLI-Blue was obtained with the use of a set Qiagen, Valencia, CA Spin Miniprep kit. One flask of cells CRL-1632 distributed between the flask with the initial solution with 0.2 ml and the flask transfection with 0.3 ml of total volume of 2 ml. Another flask was supplied with fresh medium. The medium was DMEM/F12 + 10% FCS (Hyclone FBS) + 50 u/ml penicillin, 50 µg/ml streptomycin. CRL-1632 distributed in 6-well plates to achieve 50-90% confluently for transfection (0.3 ml of cells from a flask T-75 in 2 ml of 1:5000 Versene [Life Technologies, Gaithersburg, MD] in each well) using fresh medium DMEM/F12 + 10% FCS (Hyclone FBS) + 50 u/ml penicillin, 50 µg/ml streptomycin.

In sterile test-tubes 1-2 ml was prepared from the following solutions:

A) 48 ál (10 ág) minipreparation DNA POL1212/This plus ál medium without serum (DMEM/F12 plus 10 ál Lipofectin™ (Life Technologies, Gaithersburg, MD).

B) 10 µl Lipofectin plus 190 ál of medium (false transfection) was carefully mixed and DNA and Lipofectin was allowed to interact for 15 minutes at room temperature. At this time, cells were washed twice with 2 ml of DMEM/F12. Then the cells were added to 1.8 ml of DMEM/F12. To these cells was added dropwise complex DNA/Lipofectin and stirred gently to mix. The cells were left in the incubator overnight. DNA/Lipofectin was removed and added to 3 ml of medium with Siva odoi to the cells. Cells were incubated for 30-48 hours. Geneticin were purchased from Life Technologies, Gaithersburg, MD. Cell culture was diluted 1:20, 1:50 and 1:100, 1:2450, 1:500 the Cup 10 cm in 10 ml of medium with serum containing 535 µg/ml geneticin. Over the next few days the cells that are not absorbed plasmid POL1212/This, were killed due to the presence of geneticin. The remaining cells continue to replicate, forming a visible monolayer colonies on plates.

EXPRESSION AND ANALYSIS POL1212 FROM KSS-CELLS CRL-1632

Around the colonies were placed in small plastic cylindrical rings. The colony was carefully aspirated separately using complete medium and transferred into test tubes. These colonies were called cloned in rings colonies. Cloned in rings colonies were sown separately in 24-hole plates and were grown in complete medium.

ANALYSIS WITH a CHROMOGENIC SUBSTRATE FOR the EXPRESSION of FACTOR VIII TRANSFITSIROVANNYKH CELLS CRL-1632

Sample POL1212 from supernatants cell cultures were mixed with 50 nm purified porcine factor IXa and 0.05 mm vesicles of phosphatidylcholine/phosphatidylserine (PCPS) in 0.15 M NaCl, 20 m M HEPES, 5 mm CaCl2, of 0.01% Tween 80, pH 7.4. As control was used environment culture monocrystalline cells. Added both thrombin and factor X to final concentrations of 40 and 425 nm, respectively. Thrombin activates the fact the p VIII, which then, together with PCPS, serves as a cofactor for factor IXa in the activation of factor X.

After 5 min the activation of factor X by the mixture of factor IXa/factor VIIIa/PCPS were stopped by adding EDTA to a final concentration of 50 mm. At the same time the activation of factor VIII by thrombin was stopped by addition of an inhibitor of thrombin, recombinant desulfatohirudin, to a final concentration of 100 nm. Sample 25 µl of reaction mixture was transferred into a microtiter plate well to which was added 74 μl of Spectrozyme Xa (America Diagnostica, Greenwich, CT), which is a chromogenic substrate for factor Xa. The final concentration of Spectrozyme Xa was 0.6 mm. The absorption at 405 nm caused by the splitting of Spectrozyme Xa factor Xa, was observed continuously for 5 minutes using a tablet reader Vmax Kinetic Plate Reader (Molecular Devices, Inc., Menio park, CA). Results were expressed As405/min

Chromogenic analysis of factor VIII ten cloned in the rings of the colonies:

51,3
The number of colonyAnd405/min (×103)
The buffer0,2
12,1
28,4
36,4
410,7
512,5
67,6
7
8139,5
9the 3.8
108,4

These results show that all ten colonies that were selected, Express the activity of factor VIII, which is at least 10 times greater than the background.

The activity of the environment colonies 8, which is the most vysokoaktivnye colony, researched advanced using single-stage analysis for coagulation factor VIII. In this assay, 50 ml of sufficient factor VIII plasma (George King Biomedical Overland Park, KA), 5 ml of sample or standard and 50 ml of activated reagent for the partial thromboplastin time (Organon Teknika, Durham, NC) were incubated 3 min at 37°C. the Samples include the environment of the colony 8 diluted in 0.15 M NaCl, mm HEPES, pH 7,4) (HBS) or, as control, a complete environment. Clotting was initiated by adding 50 ml of 20 mm CaCl2. The clotting time was measured using the instrument for coagulation ST4 10 Coagulation Instrument (Diagnostica Stago, Parsippany, NJ). A standard curve was obtained by preparing a dilution United, citrate plasma of a healthy person, party 0641 (George King Biomedical Overland Park, KA). The concentration of factor VIII standard was 0.9 units/ml

Standard curve:

Breeding U/mlThe clotting time
1)Undiluted0,9645,2
2)1/3 (HBS)0,3253,7
3)1/11 (HBS)0,08762,5
4)1/21 (HBS)0,04668,9

Linear regression of clotting times against the logarithm of concentration of the standard gave a correlation coefficient 0,997.

Test substance gave the following values clotting time, which was transformed in units per ml using a standard curve.

SampleClotting time (sec)Units/ml
1) Colony 8 (24 h), 1/10 in HBS40,61,74×10=17,4
2) Colony 8 (24 h), 1/10 in HBS41,11,63×10=16,3
3) Colony 8 (24 h), 1/20 in HBS47,70,69×20=13,8
4) Colony 8 (24 h), 1/20 in HBSto 47.20,73×20=14,6
5) Full environment82,90,007
6) Full environment83,30,006

These results show that the activity of coagulation colony 8 is when listello 2000 times greater than the activity of coagulation control sample.

The DNA sequence encoding POL1212 represented as SEQ ID NO:37. The encoded amino acid sequence POL1212 presented as SEQ ID NO:38. May be an additional cleaning POL1212 using various known methods, such as immunoaffinity chromatography and jhud - see examples 2 and 3.

GENERAL CONCLUDING REMARKS

It should be clear that minor variations in the amino acid sequence or DNA encoding the following sequence related to POL1212, can be introduced without affecting the important characteristic functions. For example, the length of the sequence In domain stored as a linker between the A2 domain and the activation peptide may be increased or decreased within the boundaries of the known in this field. Sequences can be entered in this linker region while maintaining the functional equivalent of the characteristic features of POL1212 described here, and swine bereft of In-domain of factor VIII, as described herein and as known in this field. On the basis of comparisons of known amino acid sequences of factor VIII with coagulating activity in human blood, can be obtained variants of the sequences in the primary amino acid sequence POL1212, the replacement of individual amino acids or replacement of peptide segments known functional variants, while maintaining its functional equivalent characteristic features. Previous types of variations are not exhaustive and are only examples of modifications of the sequence that could be made by the person of ordinary skill in this field, essentially without modification of the functional characteristic properties of this protein. Understood that all such variations and modifications are included in the scope of this invention defined by the claims or their equivalents. The list of sequences with the specified ID numbers:

SEQ ID NO:Identification
1cDNA of human factor VIII. Encoding amino acid 1 of the Mature protein begins at the number of nucleotide 208.
2Amino acid sequence of human factor VIII
3cDNA A2 domain of porcine factor VIII
4The amino acid sequence of the A2 domain of porcine factor VIII
5-27The sequence of oligonucleotide primer (example 5)
28The amino acid sequence of the murine factor VIII
29cDNA of porcine factor VIII
30Amino acid sequence of porcine factor VIII
31Amino acid sequence of the signal peptide of human factor VIII
32-36Oligonucleotide primer (example 7)
37Coding DNA POL1212
38Amino acid sequence POL1212

1. Recombinant DNA molecule encoding a modified porcine factor VIII (POL 1212) and characterized by nucleotide sequence that determines the amino acid sequence represented in SEQ ID NO:38.

2. Recombinant DNA molecule according to claim 1, having the nucleotide sequence of SEQ ID NO:37.

3. Expressing a vector containing a DNA molecule according to claim 1, operatively linked with regulatory sequences.

4. Expressing a vector containing a DNA molecule according to claim 2, operatively linked with regulatory sequences.

5. Expressing the vector according to claim 3 or 4 for use in mammalian cells.

6. Modified porcine factor VIII with amino acid sequence SEQ ID NO:38.

7. A therapeutic composition comprising an effective amount of a modified porcine factor VIII according to claim 6 for the treatment of patients with deficiency of factor VIII, and a physiologically acceptable carrier.

8. The method of obtaining protein modified porcine factor VIII with amino acid on sledovatelnot SEQ ID NO:38. providing:

a) transforming a host cell expressing a vector containing a DNA molecule encoding a modified porcine factor VIII (POL1212);

b) culturing the specified host cell under optimal conditions for expression of the indicated DNA, obtaining a modified porcine factor VIII.

9. The method of obtaining protein modified porcine factor VIII with amino acid sequence SEQ ID NO:38 and a signal peptide, including:

a) transforming a host cell expressing a vector containing a DNA molecule encoding a modified porcine factor VIII (POL1212) and signal sequence;

b) culturing the specified host cell under optimal conditions for expression of the indicated DNA, obtaining a modified porcine factor VIII, which is exported from the host cell.

10. The method according to claim 9, where the signal peptide has the sequence of amino acids 1-19 SEQ ID NO:30.

11. Cell line KSS CRL-1632 (ATSS) to obtain a modified porcine factor VIII, including replicate expressing vector according to claim 3, 4 or 5.

12. Cell line KSS 1632 to obtain a modified porcine factor VIII, including replicate expressing vector according to claim 3, 4 or 5.

13. The cell line Cho-K1 for Modific is one of porcine factor VIII, including replicates expressing vector according to claim 3, 4 or 5.



 

Same patents:

FIELD: immunobiotechnology.

SUBSTANCE: invention relates to soluble CTLA4, which represents mutant variant of wild type CTLA4 and conserves binding ability to CD80 and/or CD86. Molecules of soluble CTLA4 have the first amino acid sequence containing extracellular CTLA4 region, which includes some mutant amino acid residues in S25-R33 region and M97-G107 region. According the present invention mutant molecules also may include second amino acid sequence, enhancing solubility of mutant molecule. Nucleic acid (NA) molecules encoding said CTLA4 and including NA-vectors also are described. Invention also relates to method for production of mutant CTLA4 and uses thereof in controlling of interaction between T-cell and CD80 and/or CD86-positive cell; suppression of graft-versus-host reaction; and treatment of immune system diseases. Soluble mutant CTLA4 according to present invention binds to CD80 and/or CD86 antigen with higher avidity than wild type CTLA4 or non-mutant CTLA41g.

EFFECT: new preparation for treatment of immune system diseases.

65 cl, 19 dwg, 2 tbl, 2 ex

FIELD: biotechnology, in particular medical and biological industry.

SUBSTANCE: invention relates to new polypeptides namely precursors of insulin or analogs thereof, whish are characterized by increased structure stability and high expression levels during production thereof in recombinant forms in yeast cells. Polypeptides of present invention unlike natural form of insulin precursors contain shortened C-peptide including aromatic amino acid group and have general formula B (1-27)-X2-X3-X1-Y-A (1-21), wherein X1 is peptide sequence of 1-3 amino acid rests, wherein aromatic acid rest is in close vicinity with Y; X2 represents Pro or Asp; X1 represents Lys, Y-Lys, or Arg; A (1-21) is A-chain of human insulin; B(1-27) is the first 27 amino acid rests of human insulin D-chain rests.

EFFECT: method for production of new insulin precursors by recombinant DNA technology followed by conversion thereof in active hormone.

9 cl, 10 dwg, 6 tbl, 5 ex

FIELD: biotechnology and virology.

SUBSTANCE: strain of hybrid culturing Rattus norvegicus 122H9 cells is disclosed. Said strain is obtained by fusion of rat myeloma cells 210RC.Y3-Ag1.2.3 with rat spleen cells LOU, immunized with purified ectromelia virus of K-1 strain. Said strain is producer of cross-reactive neutralizing monoclonal antibodies against pathogenic for human orthopoxviruses.

EFFECT: vaccines for prophylaxis and therapy of diseases associated with pathogenic for human orthopoxviruses.

2 tbl, 5 ex

FIELD: biotechnology.

SUBSTANCE: dipeptide is produced from L-amino acid ester and L-amino acid using protein with dipeptide production enzyme activity. Said protein is obtained by culturing of transformed bacterial cell.

EFFECT: simplified method for dipeptide production of decreased cost.

11 cl, 1 dwg, 4 tbl, 14 ex

Lantibiotic // 2279481

FIELD: biotechnology, in particular antibacterial protein salivaricine B belonging to lantibiotics.

SUBSTANCE: antibacterial protein is expressed by strain Streptococcus salivarius K12 (DSM N 13084), has molecular weight of about 2733 Da, contains N-terminal amino acid sequence (AS) representing in SEQ ID NO:1, as defined in description, or AS representing in SEQ ID NO:3, and has bactericide activity against S. pyogenes. Both protein and microorganism producing thereof are useful as active ingredients in antibacterial and antibacterial therapeutic compositions, wherein the latter one may additionally contain salivaricine A2 (AS SEQ ID NO:5, as defined in description). Also invention relates to polynucleotide, encoding protein (salivarius B) optionally including nucleotide sequence (NS) (NS SEQ ID NO:2), as defined in description). Polynucleotide optionally includes DNA sequence encoding antibacterial protein, representing genome part of strain K12 (DSM 13084). Strain S. salivarius K12 (DSM N 13084) and S. salivarius K30 (DSM N 13085) being producers of protein salivaricine B also are described.

EFFECT: new protein having both antibacterial and bactericide activity.

29 cl, 3 dwg, 1 tbl

FIELD: chemistry of peptides, microbiology, biotechnology.

SUBSTANCE: L-alanyl-L-glutamine is prepared by incubation of a mixture containing a microorganism able to produce L-alanyl-L-glutamine from L-alanine ester and L-glutamine, L-alanine ester and L-glutamine, and isolation of the end product. Using the invention allows simplifying the process for preparing L-alanyl-L-glutamine. Invention can be used in pharmacy and food processing industry.

EFFECT: improved preparing method of dipeptide.

3 cl, 3 tbl, 1 ex

FIELD: chemistry of peptides, microbiology, biotechnology.

SUBSTANCE: L-alanyl-L-glutamine is prepared by incubation of a mixture containing a microorganism able to produce L-alanyl-L-glutamine from L-alanine ester and L-glutamine, L-alanine ester and L-glutamine, and isolation of the end product. Using the invention allows simplifying the process for preparing L-alanyl-L-glutamine. Invention can be used in pharmacy and food processing industry.

EFFECT: improved preparing method of dipeptide.

3 cl, 3 tbl, 1 ex

FIELD: biotechnology, medicine.

SUBSTANCE: the present innovation deals with CFP10-ESAT6 hybrid protein that is able to induce Mycobacterium tuberculosis-specific hypersensitivity reaction of delayed type. This hybrid protein contains complete protein CFP10 out of M.tuberculosis combined with complete protein ESAT6 out of M.tuberculosis through linker amino acid sequence. It is, also, [presented a recombinant plasmid DNA pTBD16 for expression of hybrid protein CFP10-ESAT6. The latter should be obtained due to applying DLT1270 E.coli strain transformed with the obtained recombinant plasmid DNA pTBD16. The innovation suggests to apply the above-mentioned protein as a diagnostic kit of tuberculous infection both in mammalians and human beings. The method for predicting tuberculous infection has been revealed. Tuberculous infection should be predicted due to induction of hypersensitivity reaction of delayed type in case of subcutaneous injection of hybrid protein. Application of the present innovation enables to obtain a Mycabacterium tuberculosis-referring diagnostic kit, at specificity being 100%, sensitivity - 80%, not less.

EFFECT: higher accuracy and efficiency of diagnostics.

6 cl, 4 dwg, 4 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to a method for preparing foodstuff containing hypotensive peptides and it using as an anti-hypertensive agent that can be used as a foodstuff. Method involves stages for fermentation of casein-containing fermenting material with lactobacillus microorganism, nanofiltration of the prepared peptide-containing fermentation product and isolation of the product. Prepared product is used as an anti-hypertensive agent and as a foodstuff also. Invention provides preparing a foodstuff with the high content of hypotensive peptides enriched by bivalent ions.

EFFECT: improved preparing method of foodstuff.

22 cl, 1 dwg, 4 ex

FIELD: molecular biology, genetic engineering, polypeptides, medicine.

SUBSTANCE: in using the double-hybrid yeast system DNA sequences encoding polypeptides (55.1 and 55.3) have been found that elicit ability for binding with intracellular domain p-55 (p-55IC) of TNF-receptor. It has been established that these polypeptides represent fragments of amino acid sequences p-55IC, respectively, from 338 to 426 and from 277 to 426 residues. As result of insertion of DNA fragments with a sequence encoding polypeptide 55.1 or 55.3 into the structure of expressing vector and transformation suitable host-cells by this vector recombinant form of indicated polypeptides have been prepared. Using this invention provides the possibility for modulating the function of intact p-55 of TNF-receptor. Invention can be used in medicine in treatment of diseases associated with transfer of TNF-signal.

EFFECT: improved preparing method and valuable properties of polypeptide.

9 cl, 17 dwg, 3 tbl, 6 ex

FIELD: genetic engineering, virology, medicine.

SUBSTANCE: invention relates to method for production of modified Vaccinia virus Ankara (MVA). Claimed method includes contamination of mammalian continuous cell line with Vaccinia virus Ankara (MVA) of wild type, followed by viruses cultivation and collection. Further fresh cells of the same cell line are infected with newly formed viruses. Abovementioned steps optionally are repeated. Also disclosed are strains of modified Vaccinia virus Ankara (MVA) and utilization thereof. Said strains are capable to growth in continuous cell lines.

EFFECT: strains having decreased virulence in relates to mammalians.

20 cl, 5 tbl

FIELD: genetic engineering, medicinal virology, medicine.

SUBSTANCE: invention proposes recombinant RNA molecules, methods for preparing recombinant eukaryotic cell, methods for preparing chimera RNA virus, vaccine preparations and immunogenic compositions. The recombinant matrix NDV-viral RNA with negative chain has been constructed that can be used in viral RNA-dependent RNA polymerase for expression of products of heterologous genes in corresponding host-cells. Proposed group of inventions can be used against pathogens and antigens of broad row.

EFFECT: valuable properties of expression systems.

145 cl, 11 dwg

FIELD: genetic engineering, virology, pharmacy.

SUBSTANCE: invention proposes the recombinant modified virus OF VACCINE Ankara able to express structural antigens of hepatitis C virus. Virus comprises DNA sequences encoding structural antigens of hepatitis C virus or their functional regions or epitopes of hepatitis C virus structural antigens. Also, invention proposes a pharmaceutical composition comprising such virus, eucaryotic cell infected with such virus, a method for preparing such virus and a method for preparing hepatitis C virus structural polypeptides. Invention can be used in virology and medicine for preparing hepatitis C virus antigen.

EFFECT: valuable properties of virus.

20 cl, 14 dwg, 1 tbl

FIELD: biotechnology, immunology, molecular biology, medicine, pharmacy.

SUBSTANCE: invention describes the isolated human antibody or its antigen-binding fragment able to bind the human tumor necrosis factor (TNF-α). Amino acid sequence is given in the description. Invention discloses nucleic acid encoding heavy and light chain of isolated human antibody. Nucleotide sequences are given in the description. Invention describes recombinant vector expressing variable region of heavy and light chains of isolated human antibody, Chinese hamster ovary cells CHO dhfr- carrying vector. Invention discloses a method for synthesis of isolated human antibody. The isolated human antibody or its antigen-binding fragment can be used as an active component of pharmaceutical composition used in treatment of disturbances when activity of TNF-α is harmful. Using the invention allows neutralization of effect of TNF-α in case when its activity is harmful. Invention can be used in medicine.

EFFECT: valuable medicinal properties of antibody, improved method for synthesis.

17 cl, 11 dwg, 17 tbl, 4 ex

FIELD: biotechnology, in particular biosensors.

SUBSTANCE: claimed method includes production of sensitive cells producing in exited state signals being detectable by peripheral device. In one embodiment cells cultivated in cell cultures prepared form animal receptor cells are used as sensitive cells. In another embodiment as sensitive cells receptor cells which are functionally analogous to animal receptor cells cultivated in cell cultures prepared form animal stem cells are used. As peripheral device electrical signal receiver is used, wherein said electrical signal is generated by cell in exited state. Claimed invention is useful both in investigations and in industry.

EFFECT: biosensors with increased sensitivity, accuracy and integrity.

14 cl, 1 dwg, 4 ex

FIELD: biology, genetic engineering, biotechnology, medicine.

SUBSTANCE: invention relates to preparing glycosylated polypeptide (glycoprotein) as a component of human erythropoietin by using the technology of recombinant DNAs. This polypeptide shows ability to increase production of reticulocytes and erythrocytes, to enhance the level of hemoglobin synthesis and consumption of iron by marrow cells and characterized by the higher molecular mass as compared erythropoietin isolated from human urine. Invention describes variants DNA sequences encoding this polypeptide that comprise vector constructions with these sequences, a method for preparing transformed mammalian cell lines producing the recombinant human erythropoietin, and a method for its preparing and purification. Also, invention proposes pharmaceutical compositions comprising glycosylated polypeptide (glycoprotein) of erythropoietin as an active component. Applying this invention provides scaling the process for preparing active human erythropoietin useful for its using in medicine.

EFFECT: improved preparing method, valuable properties of polypeptide.

10 cl, 4 dwg, 21 tbl, 12 ex

FIELD: biotechnology, molecular biology.

SUBSTANCE: method involves transfection of cells HKB with vector pCIS25DTR comprising a selective marker and a sequence encoding protein eliciting procoagulating activity of factor VIII. Cells are selected using the selecting agent and clones with high level for expressing protein eliciting procoagulating activity of factor VIII are isolated. Invention provides preparing the protein eliciting activity of factor VIII with high yield, and strain of cells HKB with improved production under protein-free conditions also. Invention can be used for preparing the protein eliciting activity of factor VIII in industrial scale.

EFFECT: improved preparing and isolating methods.

8 cl,, 6 dwg, 1 tbl, 5 ex

FIELD: genetic engineering, immunology, medicine.

SUBSTANCE: invention relates to new antibodies directed against antigenic complex CD3 and can be used in therapeutic aims. Antibody IgG elicits the affinity binding with respect to antigenic complex CD3 wherein heavy chain comprises skeleton of the human variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 2, 4 and 6 and their corresponding conservatively modified variants. Light chain comprises skeleton of the rodent variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 8, 10 and 12 and their corresponding conservatively modified variants. Antibody is prepared by culturing procaryotic or eucaryotic cell co-transformed with vector comprising recombinant nucleic acid that encodes antibody light chain and vector comprising recombinant nucleic acid that encodes antibody heavy chain. Antibody is administrated in the patient suffering with malignant tumor or needing in immunosuppression in the effective dose. Invention provides preparing chimeric antibodies against CD3 that are produced by expression systems of procaryotic and eucaryotic cells with the enhanced yield.

EFFECT: improved preparing methods, valuable medicinal properties of antibody.

33 cl, 5 dwg, 1 ex

FIELD: biology, genetic engineering.

SUBSTANCE: invention relates to preparing immortalized cellular lines from health human skin tissues and can be used in immunological, pharmacological, photo- and chemical-toxicological analysis of cutaneous response, for expression of heterologous genes and for construction of artificial skin. Keratinocytes are immortalized by infection of keratinocytes of health human. The human skin sample is isolated and prepared its for culturing in vitro. Keratinocytes are prepared from this prepared human skin sample and plated in serum-free medium for growing keratinocytes in cultural plates with cover alleviating attachment and growth of cells. In the process for culturing keratinocytes the serum-free medium is replaced to provide preparing the optimal confluent growth of cells in culture with continuous maintenance of cup cover. Keratinocytes are transferred in selective serum-free medium in cultural cups with cover and infected with vectors pLXSHD + SV40(#328) and pLXSHD + E6/E7. Then prepared immortalized keratinocytes are transferred in cultural cups with cover to useful medium for proliferation. Then prepared proliferated keratinocytes are transferred in medium with high calcium content for differentiation in cultural chambers with cover. Invention provides preparing the human keratinocyte cellular line that has no oncogenic property and retains capacity for differentiation and expression of proteins and enzymes expressing by normal differentiated keratinocytes being even after increased number of passages in culture. Also, this cellular line forms lamellar and polarized epithelium with keratinized layer (stratum corneum) consisting of ortho-keratinocytes in the process for culturing in organotypical culture in serum-free medium and without layer of feeding cells.

EFFECT: improved immortalizing method, valuable biological properties of cellular line.

7 cl, 2 dwg, 4 ex

FIELD: biotechnology, medicine.

SUBSTANCE: invention relates to new recombinant allergens that represent mutants of allergens of the natural origin and comprising at least four mutations. Examples of recombinant allergens are allergens Bet v1 and Ves v1. The primary mutations in recombinant allergen are separated of one another by interval for at least 15 Å and is location is characterized by that at least one circle region of surface of size 800 Å doesn't comprise mutations. Recombinant allergens are used as a pharmaceutical agent as a component of pharmaceutical composition that represents vaccine against allergic response reactions. Invention describes methods for using recombinant allergens in pharmaceutical composition for producing the immune response in subject. Invention represents DNA sequences given in the invention claim that encode recombinant allergens, expressing vector comprising DNA and cell-host for providing the recombinant allergen. Also, invention describes methods for preparing pharmaceutical composition and recombinant mutant allergen. Using recombinant allergen allows decreasing the specific IgE-binding capacity as compared with IgE-binding capacity of the natural allergen. Invention can be used in medicine for preparing vaccine against allergic response reactions.

EFFECT: valuable medicinal properties of allergens.

33 cl, 62 dwg, 10 ex

Up!