Nucleotide sequences associated with increasing or reducing of ovulatory rate in mammalians

FIELD: biology.

SUBSTANCE: invention relates to nucleotide sequence associated with increasing or reducing of ovulatory rate in mammalians, namely GDF-9B. Mutated GDF-9B molecule useful in modulation of ovulatory rate in female mammalians is disclosed. Also disclosed are various methods for modulation of ovulatory rate and composition for method embodiment.

EFFECT: method for inducing of sterility or reduced fertility of female mammalians.

30 cl, 14 dwg, 6 tbl

 

The present invention relates to nucleotide sequences that are involved in the increase or decrease in the rate of ovulation in mammals.

In particular, the invention, in General relates to new mutations in the gene, which is involved in increasing the rate of ovulation in heterozygous females mammals; these mutations cause the sterility of homozygous females mammals. Knowledge mutant gene sequence can be used in the test for the identification of heterozygous or homozygous mammals, male and female, carrying the mutant gene. The above information on the biological function of the gene and its mutations can also be used to increase or decrease the rate of ovulation in females mammals, or in order to induce sterility or reduced fertility of female mammals.

The premise of the INVENTIONS

All references, including any patents or patent applications cited herein, incorporated herein by reference. No assumptions made that any reference constitutes prior art. During the discussion of the references States what you claim their authors, and applicants retain the right to Express doubts about the accuracy and relevance of the cited documents. Will Sauveur is i.i.d. clear although here are links to several publications of the prior art, this reference is not an admission that any of these documents forms part of the common core of knowledge in this field in New Zealand or any other country.

Gene high fertility Inverdale (FecXI) is a major gene for prolificacy in sheep, which was first identified in a herd of Romney (Inverdale), consisting of the descendants of Romney sheep (A), all of which consistently had a high number of offspring. Research on splitting genes showed that the gene carries an X chromosome (Davis et al., 1991). One copy of the gene in heterozygous sheep I+ increases the rate of ovulation by about one additional egg, and the number of offspring about 0.6 lambs at lambing sheep. However, homozygous sheep II, carrying two copies of the gene have a small non-functional ovaries and are infertile (Davis et al., 1992). Research on embryos of sheep I+ and II showed that ovarian development is normal until about 100 days of embryonic life: the development of embryonic cells, the formation of the ovarian follicles and the earliest stage of growth of the follicles are normal. However, in embryos II after 100 days of embryonic life disrupted follicular development after the initial stage of growth, and not discovered normally the e secondary follicles (Smith et al., 1997). Meanwhile, as the oocytes of animals II increase in diameter (>40 μm), there is no evidence of proliferation of granular cells, in contrast to proliferation, which would be observed in normal (Braw-Tal et al., 1993; McNatty et al., 1995a; Smith et al., 1997). Thus, the presence of infantile non-functional ovaries in embryos, newborn and adult animals II is a consequence of the blocking of follicular development after the initial stage of growth.

It also shows that the second prolific flock Romney (Hanna, 1995), for which we know a relationship with a flock Inverdale, carries an X-linked mutation with a phenotype that is similar to the Inverdale. Proof that animals Hanna carried the mutation (FecXHin Inverdale gene, obtained when crossing a RAM media Inverdale sheep carriers Hanna received homozygous sterile females (Davis et al., 1995). The line shown Hanna contained in Invermay in separate groups side by side with the original line Inverdale.

As part of the search for the gene responsible for the trait Inverdale, the inventors have constructed a genetic map of the coupling of the X-chromosome sheep (Galloway et al., 1996), and localized Inverdale gene in the region of 10 cm, flanked minisatellite markers (Galloway et al., 1999). Localization of a gene in the X chromosome of sheep narrowed the candidates to those genes that have been mapped in other X-chromosome of mammals, because, almost without exception, the genes, the presence of the plans in the X-chromosome and one mammal, also present in the X-chromosomes of other mammalian species (Ohno, 1973).

Inheritance Inverdale gene on the X chromosome provides a convenient way of obtaining fertile sheep - carriers of one copy of the Inverdale, because all daughters RAM media Inverdale will inherit the gene. Specialist breeding rams uses genetic marker to identify sheep vehicles for sale, and commercial specialists in breeding buy these rams to get prolific sheep, which then pair with the ultimate producer with offspring production for slaughter. It is shown that commercial use of the Inverdale gene is highly profitable in the current system end mating with the added value of $ 1760$ per purchased Inverdale sheep, compared with the conventional RAM (Amer et al., 1998). An elite sheep producers that carry the gene, it is necessary to distinguish non-native (++females or males +Y) and carriers of one copy (females I+ or males IY).

Test with a genetic marker was developed based on inheritance flanking minisatellite markers around the gene (i.e., the test haplotype) (Galloway et al., 1999); it is shown in figure 1. However, this test can only identify those animals that inherited the haplotype Inverdale from well-known media, and is not accurate to 10%, as in the test not detected Inverdale gene as such. Haplotype from the same region of the X chromosome sheep pedigree Hanna, which is unrelated option Inverdale, differed from haplotype observed in the offspring A.

In 1996 showed that the factor of growth and differentiation 9 (GDF-9), a member of the superfamily of transforming growth factor beta (TGF-β) - specific antigen is expressed in the oocyte adult mouse, where it is required for follicle Genesis (Dong et al., 1996). Messenger RNA GDF-9 is synthesized only in the oocyte, from the stage of primordial/primary single layer of follicle until the period after ovulation and female mice knocked out for GDF-9, sterile as a result of blocking the development of follicles at this stage the primary single layer of follicle. Animals homozygous for the Inverdale gene, with sterile phenotype similar to the phenotype of the mouse, knocked out by GDF-9 (McNatty et al., 1995b). Then GDF-9 mapped on chromosome 5 sheep, and therefore, the gene cannot be responsible for the phenotype Inverdale (Sadighi et al., 1998).

The second related member of the family, GDF-9B, also called VMR identified in the ovaries mouse and humans, and found that it is expressed together with GDF-9 (Laitinen et al., 1998; Dube et al., 1998). VMR mapped in mice on the X-chromosome, near Fsc1 (Dube et al., 1998). Fsc1 (component fibrous membrane) also known as Akap4 (anchor protein 4 kinase A),which was mapped to the X chromosome of the mouse at a distance of 1.6 cm from centromere database (mouse genome (MGD), October 1999) and in the band P11,2 X chromosomes person (Dube et al., 1998). Preliminary studies Inverdale sheep (genotypes ++, I+ and II) using a molecular probe, which does not distinguish between genotypes indicate that mRNA GDF-9B is expressed in oocytes of primary, but not primordial follicles, and that the expression of the indicated mRNAs in the ovary limited to oocytes (Galloway et al., 2000).

Members of the superfamily of TGF-β have a similar gene structure. The region encoding GDF-9B, is within two exons separated by an intron length of 4.2 KBP (man) and 3.5 TPN (mouse) (Dube et al., 1998). People have full coding sequence of 1176 BP produces preprepared of 392 amino acids, of which the first 17 amino acids correspond to secretory signal. Full sized preprepared human and mouse contains the website processing for proteolytic cleavage to release the Mature active C-terminal peptide of 125 amino acids and N-terminal product propeptide (Laitinen et al., 1998; Dube et al., 1998). The sequence of the intron is in the domain of propeptide, so full of Mature coding region found in exon 2.

The sequence of the gene VMR (GDF-9B) human wild type described in U.S. patent 5728679 and 5635372. Protein wild type described as suitable for the treatment of bone defects and cartilage and/or other connective TC is her and in wound healing and tissue repair.

The inventors have now identified a mutant form of the gene GDF-9B sheep in sheep expressing the phenotype Inverdale or Hanna, and for the first time found that this mutant form of GDF-9B responsible for increased ovulation observed in these sheep, and for sterility observed in homozygous sheep.

This invention, in General, directed to the mutant sequence and the respective encoded protein.

The INVENTION

Thus, in the first aspect of this invention relates to the selected mutant molecule of nucleic acid GDF-9B containing the nucleotide sequence selected from the group consisting of:

a) SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7;

b) a sequence capable of gibridizatsiya in harsh conditions with the molecule(s) in (a);

(C) sequence, which is a functional variant or fragment of the molecule(St), defined in (a);

d) a sequence complementary to the molecule(s), defined in (a), (b) or (C); and

e) antisense sequence corresponding to any molecule(s) in (a) - (d).

The molecule of nucleic acid can be a RNA molecule, krnk, genomic DNA or cDNA, and may be single - or double-stranded. The nucleic acid molecule is also not necessarily on the part of one or more synthetic non-natural or altered nucleotide bases, or a combination of both.

This invention also relates to a method of identifying a mammal that carries mutant molecule of nucleic acid GDF-9B, with the specified method includes the following stages:

(i) obtaining a sample of tissue or blood from the mammal;

(ii) isolation of DNA from the sample;

(iii) optionally a DNA isolation GDF-9B of the DNA obtained in stage (i);

(iv) optional study DNA using a probe, complementary to the mutant DNA GDF-9B according to the invention;

(v) optional amplification of the number of mutant DNA GDF-9B and

(vi) determining, does the DNA sequence of GDF-9B obtained in stage (ii), the mutation associated with sterility or increase or decrease ovulation.

Preferably stage of amplification (v) can be performed by any conventional method, such as polymerase chain reaction or ligase chain reaction.

According to another aspect of this invention relates to a genetic marker associated with DNA selection in relation to increased ovulation, or the sterility of the mammal containing a nucleic acid molecule that is specific hybridizes with the nucleotide sequence according to the first aspect of the invention, or with genomic DNA that includes or is associated with a mutant nucleic acid molecule is GDF-9B.

The mammal can be male or female and may be human or domestic, living together with humans, zoo or wild mammals. Preferably the mammal is selected from humans, sheep, cattle, goats, deer, horses, camels, possums, pigs, mice, rats, weasels, rabbits, hares, ferrets, cats and dogs.

The following aspect of this invention relates to the selected polypeptide encoded by a nucleic acid molecule having the sequence shown above in (a)-(d). Preferably the polypeptide has an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8, or a functional variant or fragment.

In another aspect the invention relates to the selected polypeptide having the amino acid sequence comprising SEQ ID NO:10, or a functional variant or fragment.

In an additional aspect, the invention relates to the selected nucleic acid molecule having the nucleotide sequence comprising SEQ I NO:9, or a functional fragment or variant.

In another aspect the invention relates to the selected nucleic acid molecule that encodes a polypeptide that is essentially the same as described above.

The following aspect of the invention relates to sposobu modulation speed ovulation in the female mammal, while this method involves the step of introducing a specified mammal an effective amount of a mutant polypeptide GDF-9B polypeptide GDF-9B wild-type or functional fragment or variant of each.

The invention also relates to a method of increasing the speed of ovulation in the female mammal, which shall not be a mutant nucleic acid molecule GDF-9B, including the stage of introduction of a given mammal an effective amount of a mutant polypeptide GDF-9B or its functional variant or fragment.

In addition, the invention also relates to a method of increasing the speed of ovulation in sterile females mammal that carries two copies of the mutant nucleic acid molecule GDF-9B, including the stage of introduction of a given mammal an effective amount of the polypeptide of GDF-9B wild-type.

In another aspect the invention relates to a method of increasing or decreasing the speed of ovulation or the induction of sterility in females mammal, comprising the stage of introducing an effective amount of an agent selected from the group consisting of:

(a) effective immunizing amount of the polypeptide of GDF-9B wild or mutant type, or a functional fragment or variant;

(b) antisense molecule nucleic sour is s, directed against DNA that encodes a polypeptide GDF-9B wild or mutant type or its functional fragment or variant;

C) a ligand that binds to or is an antigen to the polypeptide GDF-9B wild or mutant type, or functional fragment or variant;

so as to inhibit the biological activity of the polypeptide GDF-9B mutant or wild-type.

In another aspect the invention relates to compositions containing an effective amount of a mutant polypeptide GDF-9B or its functional fragment or variant, together with a pharmaceutically or veterinary acceptable carrier or diluent.

In another aspect the invention relates to compositions containing an effective amount of an agent selected from the group consisting of:

(a) mutant polypeptide GDF-9B according to the invention;

b) polypeptide GDF-9B wild type according to the invention;

(C) the antisense nucleic acid molecule directed against a polypeptide GDF-9B wild or mutant type according to the invention;

d) a ligand that binds to or is an antigen to the polypeptide GDF-9B wild or mutant type according to the invention;

together with a pharmaceutically or veterinary acceptable carrier or diluent.

According to another aspect of the invention relates to the con is e.g. or vector containing the nucleic acid molecule is essentially such as described above.

This invention also relates to the cell host transformed by the vector or construct containing the nucleic acid molecule according to the invention.

According to further aspect the invention relates to the selected nucleic acid molecule containing the nucleotide sequence selected from the group consisting of SEQ ID NO:12 or SEQ ID NO:14, or a functionally active fragment or variant.

The invention also relates to a selected polypeptide containing the amino acid sequence selected from the group consisting of SEQ ID NO:13 and SEQ ID NO:15.

In another aspect the invention relates to the selection of functionally active variant of the polypeptide presented in SEQ ID NO:11.

According to further aspect of the present invention presents the selected nucleic acid molecule containing a nucleic acid sequence, which is presented in SEQ ID NO:16.

This invention also relates to a selected polypeptide containing the amino acid sequence of which is presented in SEQ ID NO:17.

The invention also encompasses a method of reducing the speed of ovulation or the induction of sterility in the opossum, which includes a step of introducing an effective kolichestvennaia, having the amino acid sequence of which is presented in SEQ ID NO:17, or its functional variant or fragment.

Although the invention is broadly as defined above, specialists in this field will be clear that it is not limited, and that the invention also includes preferred options, which are listed below as examples.

BRIEF DESCRIPTION of DRAWINGS

In particularly preferred aspects of the invention will be described in connection with the accompanying drawings, where:

The figure 1 shows the map of the genetic coupling of the X-chromosome sheep. Genetic distances are given in cm (cm) Kosamabi. Inverdale gene mapped in the area indicated by the shaded column.

Figure 2A shows the nucleotide sequence of exon 2 GDF-9B Inverdale sheep. Position the replacement of nucleotide T at And Inverdale (at a distance of 92 nucleotides from the site of processing) are shown in bold. Triplet codon that were affected by this replacement, underlined. Site processing for proteolytic cleavage of propeptide from Mature fragment and the stop codon TGA framed. The coding sequence of the Mature peptide is located between the two frames.

Figure 2b shows the nucleotide sequence of exon 2 GDF-9B in sheep Hanna. Position the replacement of nucleotide C to T in Hanna (at a distance of 67 nucleotides on the site processing) are shown in bold. Triplet codon that were affected by this replacement, underlined. Site processing for proteolytic cleavage of propeptide from Mature fragment and the stop codon TGA framed. The coding sequence of the Mature peptide is located between the two frames.

Figure 2C shows the nucleotide sequence 394-599 P.N. figure 2A.

Figure 2d shows the nucleotide sequence 394-599 P.N. figure 2b.

Figure 2e shows the nucleotide sequence 472-486 P.N. figure 2A.

Figure 2f shows the nucleotide sequence 448-462 P.N. figure 2b.

Figure 3A shows the deduced amino acid sequence of the protein GDF-9B Inverdale encoded by the nucleotide sequence depicted in figure 2A. Mature GDF-9B shown in normal font, and the part of propeptide shown in italics. Amino acid (aspartic acid, D), obtained by replacing the base Inverdale marked in bold.

Figure 3b shows the deduced amino acid sequence of the truncated protein GDF-9B Hanna encoded by the nucleotide sequence depicted in figure 2b. The Mature peptide GDF-9B shown in normal font, and the part of propeptide shown in italics. Amino acid wild-type (glutamine, Q) turns into a stop codon (END) of a mutant Hanna.

The figure 4 shows the comparison of the derived amino acid serial is a major GDF-9B sheep with protein between human and mouse. Numbers in parentheses above the line indicate positions of amino acid Mature peptide. Where there's no shading triangle shows the position of the polymorphism on Leu, and the dark triangle shows the position of a single intron. The proposed site processing RRAR and conservative cysteine shaded in grey. The position of the mutations FecXIand FecXHin terms of amino acids 23 and 31 are shown in bold.

The figure 5 shows the chromatogram sequence of GDF-9B Inverdale sheep, Hanna and wild type, showing the area where mutations occur.

The figure 6 shows the comparison of the mutant region of the predicted protein FecXI with members of the superfamily of TGFβ other species.

The figure 7 shows the map of the coupling region of the X chromosome sheep containing GDF9 gene-B.

The figure 8 shows the results of the analysis identify SNP variant in sheep carrying the mutation FecXIInverdale, and not the media, using splitting artificial XbaI PCR fragment. Split DNA carriers containing allele A. Splintered fragments of non-native ++, heterozygous I+ and homozygous II carriers are shown in comparison with fragments from heterozygous females (samples A1, A2), sheep-media (samples A5, a10) and sheep - no media (samples A3, A4, A6, A7, A8, A11, A12 and A13).

DETAILED description of the INVENTION

For the first time shown that mutations in the gene GDF-9 in sheep Inverdale and Hanna responsible for the speed boost ovulation in heterozygous animals and sterility in homozygous animals.

For purposes of this description is quite clear that the word "including" means "containing, but not limited to this, and that the word "comprises" has a corresponding value.

The term "isolated" means substantially separated or purified away from contaminating sequences in the cell or the organism from which the nucleic acid occurs under natural conditions, and includes nucleic acid, purified by standard purification methods, and nucleic acid obtained through recombinant technology, including PCR method, and nucleic acids were synthesized. Preferably the nucleic acid molecule isolated from the genomic DNA of sheep expressing the phenotype Inverdale or Hanna.

The term "modulating ovulation" means an increase or decrease in the rate of ovulation compared with the rate observed in the intact mammal.

The term "ligand" refers to any molecule that can bind to another molecule such as a polypeptide or peptide, and it should be considered that the term includes, but is not limited to, antibodies and molecules of phage display.

The probe and primers used in this way are also part of the invention. These probes and primers may contain a fragment of a nucleic acid molecule according invented the Yu, can gibridizatsiya in stringent conditions with the sequence of the mutant gene GDF-9B. Such probes and primers are also applicable in the study of the structure and function of the mutant gene and to obtain homologues of the gene is not from sheep, and other mammals expressing phenotype Inverdale or Hanna.

The probes or primers in nucleic acid can be obtained on the basis of the nucleic acids according to this invention. "Probe" contains the selected nucleic acid associated with the registered label or reporter molecule. Conventional labels include radioactive isotopes, ligands, chemiluminescent or fluorescent agents and enzymes.

"Fragment" nucleic acid is part of a nucleic acid, which is shorter than the full length, and contains at least the minimal sequence capable of specific gibridizatsiya with the nucleic acid molecule according to the invention, or she complementary sequence in harsh environments, which are defined below. "Fragment" of a polypeptide is a portion of the polypeptide that is shorter than the full length, but which continues to preserve the biological function of either an increase or decrease speed ovulation in a mammal, or causes sterility in a mammal. Therefore, the fragment according to the invention today is, at least one of the biological activity of the nucleic acid or polypeptide according to the invention.

"Primers" are short nucleic acids, preferably DNA oligonucleotides with a length of 15 nucleotides or more, which parts are annealed with the complementary chain of target DNA by hybridization of nucleic acids, forming a hybrid between the primer and the DNA target, then extended along the chain of target DNA polymerase, preferably a DNA polymerase. Pairs of primers can be used to amplify nucleic acid sequence, for example polymerase chain reaction (PCR) or other methods of nucleic acid amplification are well known in this field. A pair of PCR primers can be obtained from the nucleic acid sequence according to this invention, for example, by using computer programs intended for that purpose such as Primer (version 0.5 of© 1991, Whitehead Institute for Biomedical Research, Cambridge, MA).

Methods of obtaining and using probes and primers are described, for example, in Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nded, vol.1-3, ed Sambrook et al., Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY, 1989.

Probes and primers can be free in solution or covalently or ecovalence associated with the solid substrate by standard methods.

"Stringent conditions" for amplifica the AI sequence of the nucleic acid target (e.g., by PCR) using specific pairs of primers for amplification are the conditions that allow a pair of primers to gibridizatsiya only with the sequence of the nucleic acid target, which would contact the primer having the corresponding sequence of the wild type (or its complement).

On the hybridization of nucleic acids is affected by such conditions as salt concentration, temperature, or organic solvents, along with the composition of the bases in length complementary circuits and the number of erroneous pairings nucleotide bases between the hybridization of nucleic acids that will be well understood specialists in this field.

In that case, when the term "specific for a target sequence)" refers to a probe or primer, it indicates that the probe or primer in harsh environments hybridizes only with a sequence of target in the sample containing the sequence of a target.

In one embodiment, the invention relates to a genetic marker for DNA-based breeding animals in relation to increased ovulation or sterility in sheep, goats, cattle, deer, mice, rats, or other commercially important mammals. The invention relates to devices for use molecules of nucleic sour is s, containing a sequence derived from mutant DNA sequences of GDF-9B or genomic DNA, which is associated with the mutant GDF-9B, in order to identify sequence variants in individual animals that are associated with increased ovulation or the sterility of the animal. Although these options are not necessarily directly can cause a characteristic sign of increased ovulation or sterility, they will be close enough related to them, in order to predict the presence of characteristic features. The ways in which identify these sequences, known in the field and include, but are not limited to, the polymorphism of the lengths of restriction fragments (RFLP), AFLP, direct DNA sequencing in the mutant gene GDF-9B or associated DNA, or the identification and characterization of variable number of tandem repeats (VNTR) or polymorphism of microsatellites (di - or trinucleotide repetitions), detection and characterization of single nucleotide polymorphism (SNP).

The polypeptide can be obtained by suitable expression vector containing the nucleic acid molecule according to the invention or a functional variant or fragment in a suitable cell host, which must be understood by the person skilled in the field.

The cloning vector can select the ü in accordance with your host or the host-cell. Suitable vectors are, as a rule, have the following characteristics:

(a) the ability or infect other programs;

(b) the possession of a single target for any specific restriction endonuclease; and

(C) preferably carry genes for easy breeding markers, such as antibiotic resistance.

Two main types of vectors possessing such characteristics are plasmids and bacterial viruses (bacteriophages or phages). Preferred in the present vectors may include the following vectors: pUC, pBlueScript, pGEM, PGEX, pBK-CMV, ZAP lambda, lambda GEM and a series pSP. However, this list should not be construed as limiting the scope of this invention.

DNA molecules according to the invention can Express, placing them in a functional connection with suitable regulatory sequences that can replicate in expressing vector. Regulatory sequences along with other may include the starting point of replication, a promoter, enhancer and sequence termination of transcription. The choice of regulatory sequences that you want to include in expressing vector, depends on the type of host or host cell that is intended to be used for expression of the DNA.

Generally, suitable hosts are prokaryotic, yeast glue the CI and mammalian cells. Also, the term "owners" included plasmid vectors. Suitable prokaryotic hosts include E. coli, Bacillus species, and various species of Pseudomonas. Commonly used promoters such as the promoter system β-lactamase (penicillata) and lactose (lac), well known in this field. You can use any available promoter system compatible with the selected host. The vectors used for yeast, is also available and well known. A suitable example is the 2-micron plasmid with the beginning of replication.

Similarly the vectors for use in mammalian cells are also well known. Such vectors include the well-known derivatives of SV-40, adenovirus, DNA sequences derived from retrovirus, herpes simplex viruses and vectors, the resulting combination of plasmid and ragovoy DNA.

In this area other known eukaryotic expressing vectors (for example, P.J.Southern and P. Berg, J. Mol. Appl. Genet. I, 327-341 (1982); S. Subramani et al., Mol. Cell. Biol. I, 854-864 (1981); R J. Kaufmann and P.A.Sharp, "Amplification and Expression of Sequences Cotransfected with a Modular Dihydrofolate Reducase Complementary DNA Gene, J. Mol. Biol. 159, 601-621 (1982); R J. Kaufmann and P.A.Sharp, Mol. Cell. Biol. 159, 601-664 (1982); S.I.Scahill et al., "Expressions and Characterization of the Product of a Human Immune Interferon DNA Gene in Chinese Hamster Ovary Cells," Proc. Natl. Acad. Sci. USA. 80, 4654-4659 (1983); G. Urlaub and L.A.Chasin, Proc. Natl. Acad. Sci. USA. 77, 4216-4220 (1980)a.

Applicable in this invention expr serwisie vectors contain, at least one sequence expression regulation, which is functionally linked to a DNA sequence or fragment that you want to Express. The regulatory sequence is embedded in the vector in order to control and regulate the expression of a cloned DNA sequence. Examples of suitable sequences regulating the expression is the lac system, the trp system, the tac system, the trc system, the major areas of the operator and promoter of phage lambda, the glycolytic promoters of acid phosphatase of yeast, e.g., Pho5, the promoters of the synchronizing factors alpha and yeast promoters derived from virus polyoma, adenovirus, retrovirus and the monkey virus, such as early and late promoters of SV40, and other sequences which control the expression of genes of prokaryotic and eukaryotic cells and their viruses or combinations thereof.

The design vector is also preferable to be able to distinguish a vector comprising foreign DNA, unmodified vectors through convenient and fast analysis. Reporter systems used in these analyses include reporter genes and other detected labels that give the measured color change, resistance to antibiotics, and the like. In one preferred use vector d is ortery gene β -galactosidase, and this gene is detected by clones exhibiting a blue phenotype on plates with X-Gal. This facilitates the selection. In one embodiment, the gene β-galactosidase can be replaced gene coding for poliakin; and the specified gene detected by clones exhibiting white phenotype staining with X-Gal. This breeding blue-white coloration may serve as a marker applicable for detection of recombinant vectors.

After selection vectors can be isolated from the culture using standard methods, such as extraction by freeze-thawing, followed by purification.

For expression vectors containing the DNA according to the invention and regulatory signals are inserted or introduced by transfection into the host or the cell host. Some suitable expressing cell hosts include the well-known prokaryotic and eukaryotic cells. Some suitable prokaryotic hosts include, for example, E. coli, such as E. coli SG-936, E. coli HB 101, E. coli W3110, E. coli X1776, E. coli X2282, E. coli DHT and E.coli MR01, Pseudomonas, Bacillus, such as Bacillus subtilis, and Streptomyces. Suitable eukaryotic cells include yeast and other fungi, insect cells, animal cells such as COS cells and CHO cells, human cells in tissue culture.

Depending on the master Tran the formation is carried out according to standard methods, appropriate to such cells. For prokaryotes or other cells that contain a strong cell wall, it is possible to apply the method of processing calcium (Cohen, S N Proceedings, National Academy of Science, USA 69 2110 (1972)). For mammalian cells without such cell walls, the preferred method of deposition of calcium phosphate Graeme and Van Der Eb, Virology 52: 546 (1978). Transformation of yeast according to the method of Van Solingen et al. J. Bact. 130: 946 (1977) and Hsiao et al. Proceedings, National Academy of Science, 76: 3829 (1979).

After transforming the selected host corresponding vector it is possible to produce the encoded polypeptide or peptide is often in the form of a fused protein by culturing the host cells. The polypeptide or peptide according to the invention can be detected by means of rapid analysis, as described above. Then polypeptide or peptide remove and clean as necessary. Extraction and purification can be achieved using any of the methods known in this field, for example, absorption by anion exchange resin and elution. This method of producing the polypeptide or peptide according to the invention is another aspect of the present invention.

Cell host transformed by the vector according to the invention, also form another aspect of the invention.

In addition, in the preferred embodiments can also be used nucleate the s and peptides, with significant identity with nucleotide and amino acid sequences according to the invention. In this description of "substantial identity" means that two sequences with optimal mapping, such as using the programs GAP or BESTFIT (nucleotides and peptides), using a measure spaces by default, or measured by the computer algorithm BLASTP (peptides) or BLASTX (nucleotide), reveal the identity of at least 60%, preferably 75% and most preferably 90-95% of the sequences.

Preferably the position of the residues that are not identical differ by conservative amino acid substitutions. For example, replacement of amino acids with similar chemical properties such as charge or polarity, should not affect the properties of the protein. Examples include replacement of asparagine to glutamine or aspartic acid to glutamic acid.

The term "variant" in the sense used here includes nucleic acid molecules and polypeptides, and peptides having "substantial identity to the sequences according to the invention. Option may be the result of modification of the native nucleotide or amino acid sequences such modifications as insertions, substitutions or deletions of one or more nucleotides or amino acid is, or may be a variant of natural origin. The term "variant" also includes homologous sequences that hybridize to the sequences according to the invention in a standard hybridization conditions, such as 2 × SSC at 65°With, or preferably stringent conditions of hybridization, such as 6 × SSC at 55°provided that the variant is able to modulate the rate of ovulation in female mammals. In cases where it is desired that option, the nucleotide sequence of amplified DNA change accordingly. This adjustment can be done by DNA synthesis or by modification of the native DNA, for example, site-specific or cassette mutagenesis. It is preferable in those cases where the necessary modifications of the sequences of parts cDNA or genomic DNA, apply the site-specific directed primer mutagenesis using standard in this area methods.

The term "protein or polypeptide" refers to a protein encoded by the nucleic acid molecule according to the invention, including fragments, mutations, and homologs having the same biological activity, i.e. the activity in the modulation of ovulation. The protein or polypeptide according to the invention can be isolated from a natural source, to get through the m expression of recombinant nucleic acid molecules or to synthesize by chemical means.

The following aspect of the invention relates to the use of the mutant polypeptide GDF-9B, which has the amino acid sequence represented in figure 3A or 3b, or its variant, or a fragment, essentially possessing its activity, the method of modulating the speed of ovulation in a mammal.

The method can include inserting the specified mammal an effective amount of a GDF-9B mutant or wild-type, or its antibodies, or antigen, or a variant.

Preferably the modulation speed of ovulation involves the induction of sterility in the female mammal by administration of a ligand or antigen mutant GDF-9B, in order to reduce the level of endogenous mutant GDF-9B.

In an additional aspect this invention relates to a ligand that binds to a polypeptide according to the invention. In most cases, the ligand is an antibody. It should be understood that the term "antibody" encompasses fragments or analogs of antibodies that retain the ability to bind to the polypeptide according to the invention, including, but not limited to, Fv, F(ab)2fragments, ScFv molecules, and the like. The antibody may be polyclonal or monoclonal, but preferably is a monoclonal. In some embodiments, the ligand can be a molecule of phage display.

p> According to a further aspect includes a composition containing, at least, the polypeptide according to the invention and a pharmaceutically or veterinary acceptable carrier or diluent. Of course, the composition can include more than one polypeptide according to the invention.

According to another aspect of the present invention presents a set to identify mammals, male and female, who have the only copy (heterozygotes) and/or females carrying two copies (homozygotes) mutant molecules of nucleic acid GDF-9B according to the invention, which includes:

- a pair of primers for amplification of the corresponding region of GDF-9B and optionally one or more of the following components;

- salt buffer solution for amplification, such as PCR amplification;

- a mixture of deoxynucleotides;

- thermostable enzyme DNA polymerase;

control DNA that is subjected to testing;

- relevant standards;

- the appropriate system detektirovaniya, which may contain one of the primers in each pair, labeled fluorescently or otherwise labeled probe for detektirovaniya product and

instructions and protocols for the amplification and subsequent detektirovaniya of amplification products and the interpretation of the results.

The invention t is the train belongs to the set for detektirovaniya circulating mutant protein GDF-9B in a mammal. This set may contain standard kit format ELISA or enzyme-linked immunosorbent assay, known to experts in the field; for example, the kit can contain a specific antibody directed to a mutant protein GDF-9B, and standard components of the amplification of the secondary antibodies for signal amplification. Antibodies can be konjugierte with fluorescent or radioactive or chemiluminescent label, or you can mark the second antibody. You can also add the appropriate solutions, controls, buffers, instructions, and protocols.

Now the invention will be described in detail only by reference to the following non-limiting examples and drawings.

Animals

Animals tested in this study were from breeding flocks AgResearch Inverdale, in Invermay Agricultural Centre and Woodlands Research Station, and from commercial flocks Arnold Gray, Orawia, Southland (Gray and Davis, 1995). All animals are carriers Inverdale were descendants of the original sheep Inverdale (A281), which was first identified Inverdale gene.

Evaluation of phenotype

The carrier status in sheep was determined by laparoscopy to identify sterile sheep II, or the rate of ovulation, to distinguish carriers I+ from non-native ++.

The carrier status in sheep was also determined on the basis of the rate of ovulation in their daughters. After the discovery of infertile ovaries in sheep II, used fast JV who own progeny testing of rams by pairing each sheep with seven-ten sheep I+ and laparoscopy, the daughters at the age of 6 months. Any resulting sterile offspring II confirms that the manufacturer is a carrier. The goal was to get five daughters from each sheep, as the probability that the RAM IY has no daughters with proskomide ovaries in the example with five daughters, is only 0,031 (Davis et al., 1994).

Purification and DNA sequencing

DNA was purified from leukocytes present in the amount from 5 to 10 ml of whole blood from each animal (Montgomery and Sise, 1990). Sequencing of all subclones and PCR products was performed commercial service, managed by the University of Otago Centre for Gene Research (automatic sequencing machine (ABI 373).

DNA markers

Microsatellite (dinucleotide repeats) markers that amplified DNA of sheep was developed in AgResearch Molecular Biology Unit, as described previously (Galloway et al., 1996), or taken from the literature on genetic mapping of cattle and sheep. New markers mapped on the X-chromosome of sheep, as described previously (Galloway et al., 1996).

PCR amplification and restriction cleavage products of the gene GDF-9B sheep

Used the standard conditions for the amplification of genomic DNA by polymerase chain reaction (PCR). The primers were designed based on the sequences of human and mouse (Galloway et al., 2000), and shows that they successfully amplified fragments of the gene from the DNA of sheep. roducti PCR, containing the mutation of a single nucleotide, were digested commercially available restrictase SpeI, BsrSI and/or XbaI, using standard conditions recommended by the manufacturer. The products of PCR products and restriction fragments identified by separation by electrophoresis in 2-3% agarose gels together with commercially available markers of DNA size.

Methods sequencing and detection of mutations

The inventors sequenced the gene GDF-9B sheep in all three genotypes (Inverdale FecXI, Hanna FecXHand FecX+wild type) of PCR fragments (Galloway et al., 2000), and sequencing was performed at the sequencing machine (ABI 373. The authors confirmed the replacement of a single reason by sequencing genomic DNA encompassing the complete coding region of at least six animals carrying each allele (FecXI, FecXHand FecX+). In addition to substitutions of bases FecXHor FecXI(figures 2a and 2b) revealed only one other change in the gene GDF-9B sheep, namely the deletion of a single codon Leu (CTT) in L10 or L11 in the signal sequence of some animals (see figures 4 and 5). The deletion of Leu is not associated with the allele FecXHor allele FecXIand, as it turned out, associated with the breed. Replace With→T FecXHleads to loss of restriction site BsrSI (actg/gn) and the acquisition of a SpeI site (a/ctagt). The authors confirmed the specified replacement of the grounds on which ASAV, what SpeI digests the PCR product length of 541 BP, covering the area of two fragment length 476 and 65 BP in females FecXH/FecXHand males FecXH/Ybut not FecXIand wild-type animals. In sheep carrying a copy of each allele (FecXI/FecXH)identified all three fragments (541, 476 and 65 BP). Similarly, fragments, split BsrSI occurred in the case of animals FecXIand wild-type animals, but not for speakers of FecXH. In PCR product length 154 BP DNA carriers FecXI(obtained with primers:

No. 12 (GAAGTAACCAGTGTTCCCTCCACCCTTTTCT) and

No. 13 (CATGATTGGGAGAATTGAGACC)) created an artificial restriction site XbaI. XbaI (t/ctaga) were digested PCR products obtained for females FecXI/FecXIand males FecXI/Ycarrying allele a (tctaga), but not products of PCR in wild type or FecXHcarrying the T allele (tctagt). Thus, XbaI were digested PCR product length 154 joined to the fragment length 124 P.N. removing the 30-nucleotide primer No. 12 only in carriers of FecXI. All restriction cleavage was performed in the aliquot of PCR products, as specified by the manufacturers, and the fragments were separated in 3% agarose gels (FMC Metaphor.

Methods mapping clutch

The authors have constructed a genetic map of the coupling of the X-chromosome of sheep by multipoint analysis using CRIMAP, as described previously (Galloway et al., 199), and mapped additional markers MAOA, McM551, OarMP1 and TIMP1 (Galloway et al., 2000). FecXIand GDF-9B mapped in families with Inverdale in the map of the clutch, resulting from the mating of nine males carriers (FecXI/Ywith female wild-type, receiving in the second generation offspring of 62 heterozygous females FecXI/FecX+. 62 received the females during mating with 10 males FecXI/Yproduced offspring of 96 homozygous FecXI/FecXIor heterozygous FecXI/FecX+the females. The authors determined the status of the media Inverdale laparoscopy to identify sterile females FecXI/FecXIand testing of offspring and laparoscopy female offspring to identify males FecXI/Y. The origin was confirmed using genetic markers, and all selected in the third generation females FecXI/FecX+were full siblings of sterile females FecXI/FecXI. In the first generation did not collect DNA from female wild-type. The authors mapped GDF-9B-based mutation T→A in the encoding region of the gene.

RESULTS

The sequencing

Sequenced PCR fragments encoding full of Mature peptide from genomic DNA Inverdale and Hanna. Sequenced region also contained most of propeptide in exon 2 (from 70 bases from the 3'side of the intron/exon boundaries of the human/mouse up to 30 base is after the stop codon tga). The sequence of these two lines of sheep was compared with the sequence of GDF-9B sheep wild type. On the basis of the sequence data revealed two separate replacement of a single base in the Mature peptide GDF-9B, one of fissile in the pedigree Inverdale and one in the pedigree Hanna (figure 2).

Animals Hanna nucleotide C at position at a distance of 67 nucleotides from the site of processing of the Mature peptide is replaced by T. This makes the CAG codon (encoding the amino acid glutamine (G)) in codon TAG (encoding termination) and causes the formation of shortened Mature protein (figure 3b).

Animals Inverdale nucleotide T at position 92 nucleotides later site of processing of the Mature peptide has turned into And turning codon GTC (amino acid valine (V)) in the GAC (amino acid aspartic acid (D)) (figure 3a).

Confirmation of single substitutions of bases

These single replacement bases confirmed by sequencing at least 6 animals, bearing each genotype (Inverdale, Hanna and not the native wild-type). For each animal sequencing was performed at least once (table 1). In this subgroup of animals revealed no replacement no Inverdale, nor Hanna animals wild type were observed replacement Inverdale animals Hanna and Vice versa.

Table 1

Identification of single substitutions of bases in animals Inverdale and Hanna of through the m sequence.

Animals have known phenotype of well characterized pedigrees (+ = wild-type allele, I = allele Inverdale, H = allele Hanna, Y = Y chromosome). The figures indicate the number of times of occurrence of independent sequences of that animal, which identified the corresponding change in the sequence.

2
GenotypeAnimalHannaInverdale
IDCag(wt)TaggTc(wt)gAc
Sheep IY66722
Sheep IY343211
Sheep II266311
RAM HY951333
RAM HY486411
Sheep NN713322
Sheep HI7141222
Sheep HI48651111
Sheep H+7151111
Sheep I+2682111
+Y Romney-marsh761022
++ Romney-marsh288422
++ Romney-marsh295822
+Y Romney-marsh107911
+Y Merino10022
++ Merino12111
where wt - wild type

The study restrictase showed that the replacement of the base Hanna causes the cleavage site of the restriction enzyme SpeI (a/ctagt) and remove the website BsrSI (actg/gn) around this replacement. Specified sites of cleavage confirmed, showing that the enzyme SpeI able to cleave frag the UNT PCR length of 541 BP, covering this area, with clips of 476 BP and 65 BP in animals and HY HH, but not in animals IY and +Y. In sheep carrying one copy each of the two genes Inverdale and Hanna (HI)identified both fragment length 541 P.N. and 476 BP

Similarly it is shown that BsrS1 breaks down the parts of animals IY +Y, but not HY and sheep HI found a mixture of both bands.

Around the site of the replacement base Inverdale not created and not deleted sites of cleavage by enzymes, so artificial RFLP primer that introduces the site of cleavage Xba1 (t/ctaga) in the PCR product, created on the basis of allele Inverdale, but not the wild-type allele. The PCR product containing the entered Xba1 site, get only when there is a mutation And Inverdale, and no animals Hanna or wild-type animals. In this case, the PCR product is cleaved with Xba1 removing 30 bases, leading to changes in the length of the final product.

DNA chain Inverdale..TTTCAAGACAGCTT..

The end of the 30-nucleotide PCR primer - tttct

causes the receiving site cutting Xba1 tctaga in the final PCR product.

When using this method, the PCR fragments 2 HY, 1 HH, 2 +Y 3 ++ animals did not split Xba1, whereas fragments from 36 animals II and 12 IY was cut. In one animal HI and 47 animals I+ revealed a mixture of split and unsplit fragments, as expected for heterozygotes.

Sequencing of elektrownie mutations

The authors sequenced the gene sequence of GDF-9B sheep from cDNA and genomic DNA, using primers designed based on the sequences of human, mouse and sheep (Galloway et al., 2000). Gene sheep are similar to the genes of human, mouse and rat (Laitinen et al., 1998; Dube et al., 1998; Aaltonen et al., 1999; Jaatinen et al., 1999), and this gene has properties typical of other members of the TGF superfamily,β. Full sequence of 1179 BP encodes preprepared of 393 amino acids (figure 4), spanning two exons separated by an intron of approximately 5,4 TPN Calculated signal peptide with a length of 25 amino acids precedes priyono of 244 amino acids and its C-terminal region of the Mature peptide of 125 amino acids after the cleavage site by the protease RRAR. Encoding district sheep $ 82.9% homologous region of human and 78.8% of the area of the mouse and 78.4% of the area of the rats at the level of nucleotides.

The authors also sequenced genomic DNA from media Inverdale (FecXI) and Hanna (FecXH) (figure 5). The only transition With→T at nucleotide position 67 the coding region of the Mature peptide from the native FecXHintroduces a premature stop codon instead of glutamic acid (Q) at amino acid residue 23 (residue 291 reprezentirovannoe protein). Premature interruption of the Mature peptide from the native FecXHin this early laid and, apparently, leads to a complete loss of function of GDF-9B. Separate single transition T→And occurs in carriers of FecXIat nucleotide position 92 of the Mature peptide. The mutation replaces valine (V) aspartic acid (D) residue 31 (remainder 299 reprezentirovannoe protein). Mutation FecXIrepresents a non-conservative substitution in a highly conservative region of the protein. All other members of the FGF superfamily,β from a wide range of species kept in this position only conservative hydrophobic amino acids valine, isoleucine or leucine (figure 6).

Mapping GDF-9B in sheep

In order to localize FecXIthe authors have created a genetic map of the coupling of the X-chromosome sheep (Galloway et al., 1996), and the authors mapped the locus FecXIbetween flanking markers at a distance of 10 cm from the center of the X-chromosome sheep (figure 7). The relationship of group cohesion with the phenotype Inverdale observed in the family of 177 animals, has a structure consisting of three generations, with a maximum of informative Maazou in females, equal to 96. Mapping clutch showed that FecXIwere mapped in the area containing TIMP1 and MAOA (sentence region Xp11.2-11.4 person), but not in the area containing PHKA1, XIST and ATP7A (Xq13 person). Point break near OarMP1 sheep, apparently, separates these two groups of genes related to individual sin is eninem groups in X-chromosomes of human and mouse. GDF-9B mapped in Xp11.2 person and sentencing region of the X chromosome of the mouse (Dube et al., 1998; Aaltonen et al., 1999). The authors mapped GDF-9B sheep in the same interval of 10 cm and FecXIin a pedigree in which they mapped Inverdale, and found no recombinants between phenotype FecXIand BMP15 in any of the 78 conformation of Maazou in females are shown in table 2.

Table 2
Clutch FecXIgenes and markers on the X chromosome of sheep
MarkerThe number of recombinantsConformative MaozRecombinant fraction (θ)The Lod score (females)
TGLA6871760,174,20
MAOA21430,151,49
McM55191960,07to 11.61
GDF-9B0213023,18
TIMP10177012,34
TGLA540170010,54
OarMP112060,01 18,79
ATP7A11470,082,08
XIST21480,132,20
PHKA141760,08of 8.47
OarAE13352110,07of 14.57

Analysis of coupling in two points CRIMAP c phenotype FecXIin a pedigree, mapped by Inverdale.

No significant differences in sequences between the coding DNA TIMP1 sheep wild-type and FecXIand when you identify the following additional recombinants media FecXITIMP1 is excluded from candidates for FecXI.

The application of the selected polypeptide and antibodies in order to manipulate an ovulation

Derived from E.coli Mature protein GDF-9B containing the sequence of the wild type, is presented in SEQ ID NO:10, chemically conjugatively with protein hemocyanin slug (KLH), and the antigen in complete Freund's adjuvant (FCA) subcutaneously (s/C) were injected with 10 sheep Romney marsh in anestrus (0.4 mg/sheep). Another 9 sheep of the Romney marsh in anestrus were injected with only KLH (p/C) in FCA, serves as control (0.4 mg/sheep). Then all the animals at monthly intervals were injected with booster antigen (0.2 mg/sheep KLH-GDF9B or 0.2 mg/sheep KLH) mmaslano Freund, containing span and twin. As sheep entered in the breeding season, some 3-4 months after the start of immunization, animals exhibiting astrosnap behavior that were detected using vasectomypenis sheep labeled with a leash, was subjected to the procedure of laparoscopy in order to visualize the number of corpora lutea (i.e. places ovulation) on the surface of the ovaries. Seven out of 10 animals treated with KLH-GDF-9B, and all 9 animals treated with KLH showed astrosnap behavior. The average speed of ovulation in sheep immunized with KLH-GDF9B and KLH, which showed estrosoy activity, shown in table 3.

Table 3
The average rate of ovulation in sheep showing estrosoy activity after repeated immunization hemocyanine slug (KLH) or KLH, conjugated with antigen GDF9B, expressed in E.coli
ProcessingThe average geometric rate of ovulation (95% confidence interval)The number of sheep exhibiting estrosoy activity
KLH1,4 (1,2; 1,7)9
KLH-GDF9B4,5 (2,7; 7,5)7

Animals treated with KLH-GDF-9B showed a highly significant increase in the rate of ovulation compared to the control animals, treated KLH (p<0,001) ANOVA.

+ Evidence that the increased rate of ovulation in animals treated with KLH-GDF-9B, which showed estrus associated with humoral response to GDF-9B, shown in table 4.

Table 4
The average of the extreme levels of antibodies in the plasma of sheep before and after re-immunization of sheep female KLH or KLH, conjugated with Mature peptide GDF-9B was obtained from E. coli. The values presented show the optical density at 490 nm, which means the levels of antibodies against GDF-9B
ProcessingBefore immunizationAfter immunization
KLH<0,3<0,3
KLH-GDF-9B (Mature protein, expressed in E. coli)<0,31,932 (1,454-2,613)

Antibody levels were measured by ELISA method after cultivation plasma of sheep 1:5000. The ELISA method involved coating 96-well tablet 100 ng/well full-GDF-9B, expressed in E. coli, and incubated with 100 μl of the diluted plasma of sheep and 100 μl of buffer for analysis, after appropriate blocking processing and subsequent leaching. After incubation with plasma of sheep and a few washings were added to the rabbit Antiochia antibody conjugated with HRP for 1 h the C at 37° C. Then the wells were washed and showed using o-phenylenediamine plus hydrogen peroxide, the manifestation was stopped with sulfuric acid.

In a separate study in order to show that a functional variant of GDF-9B sheep will affect the development of the ovarian follicles, 10 female mice intraperitoneally (b) were immunized Mature protein GDF-9B sheep obtained from E. coli (0.2 mg) in FCA (0,22 ml), and the other 10 female mice were immunized alpha-lactalbumin cows (0.2 mg) in FCA (0,22 ml, V/b), serving as a control. Then at intervals of 2 weeks spent 3 booster injections of the relevant antigen (0.1 mg at the first booster immunization and 0.05 mg in the second and third booster immunization) in a mixture of span/twin/oil, and animals were scored after 1 week after the last booster immunization. After that, the ovaries were fixed in aqueous release of Boina and processed for morphometric analysis. The total number of growing preantral and antral follicles in the ovary was determined using the method of systematic random sampling. The data are summarized in table 5.

Table 5
The average number preantral and antral follicles in the ovaries of mice after immunization GDF9B or bovine alpha-lactalbumin
ProcessingPreantral or antral folliclesThe geometric mean number of follicles (95% confidence interval)
Bullish α-lactalbuminPreantral329 (291, 371)
Antral80 (55, 115)
GDF9BPreantral261 (233, 292)
Antral84 (57, 124)

The number preantral follicles in animals treated GDF9B, significantly lower than the number in mice treated bullish α-lactalbumin, p<0,005 (ANOVA). No significant differences between treatment groups in the number of antral follicles.

Evidence that differences in the number preantral follicles is associated with humoral response to GDF-9B, is the following. The average from the maximum level of antibodies in the serum of mice, diluted 1:50000, after the second immunization was 2,18 (1,28-2,90), whereas all mice immunized α-lactalbumin, there was no response (i.e., <0,1). Values for antibodies, are presented as optical density at 490 nm was measured by ELISA method.

In the following study, the authors induced sterility in animals-recipients introduction of the antigen corresponding to the sequence the peptide GDF-9B sheep. To achieve sterility, a 15-dimensional amino acid sequence of the peptide that corresponds to the variation of the Mature region of GDF-9B sheep mutant or wild-type, synthesized with C-terminal cysteine for conjugation with hemocyanin slug (KLH), to create the antigen. The peptide sequence used by the authors, consisted of the following: SEVPGPSREHDGPESC. In this study, 10 sheep Romney marsh in anestrus were injected with 0.4 mg/sheep peptide antigen KLH-GDF-9B in complete Freund's adjuvant, and 9 sheep of the Romney marsh in anestrus were injected with 0.4 mg/sheep antigen KLH, as the control group. Then at monthly intervals 6 times spent booster immunization of animals additional antigen (0.2 mg/sheep in each case) in a mixture of span/twin/oil (p/C), and estrosoy activity was registrirovali 2-3 times weekly, using vasectomany sheep. The rate of ovulation, estimated laparascopically, was identified in approximately 1 week prior to the last booster-processing.

All 9 of sheep treated with KLH showed regular cyclical estrosoy activity, whereas only 1 of 10 animals treated with peptide KLH-GDF-9B showed estrosoy activity. Geometric average (and 95% confidence intervals) speed ovulation in control animals treated with KLH, was 1.5 (1,1; 1,9), whereas the 9 animals treated what aptidon KLH-GDF-9B, which did not show estruses activity, the rate of ovulation was equal to zero. In one animal treated with peptide KLH-GDF-9B, showing estrosoy activity, the rate of ovulation was 5. The data obtained clearly show that sterility can be induced by introduction of antibodies or mutant antigen GDF-9B or option.

The evidence to support the claim that induction of ovulation in 9 animals treated with peptide KLH-GDF-9B (16-Mer) (i.e. 15-Mer + C-terminal cysteine), is presented in SEQ ID NO:11, which did not show estrus associated with humoral response to GDF-9B, shown in table 6.

Table 6
The average of the extreme levels of antibodies in the plasma of sheep before or after repeated immunization of sheep female KLH or KLH, conjugated with 16-dimensional peptide GDF-9B. The values presented show the optical density at 490 nm, which indicates the level of antibodies against GDF-9B
ProcessingBefore immunizationAfter immunization
KLH<0,3<0,3
KLH-GDF-9B (16-dimensional peptide)<0,3had 2,392 (1,085-3,000)

Antibody levels were measured by ELISA method, which in General describes the n table 4.

Taken together, the results indicate that the resulting injection of antigen GDF-9B production of antibodies in the recipient animals can lead to altered activity of the ovarian follicles and thus cause the modulation speed of ovulation.

A DNA test for the mutation

Variants of the sequences in the gene GDF-9B can be defined in different ways, well known to experts in this field, which are specially designed in order to identify differences between alleles of the gene. In particular, these methods can be used to identify single nucleotide polymorphism (SNP) Inverdale (FecXI) and Hanna (FecXH), namely the transition C→T occurs in carriers of FecXHand a transition T→has A place in carriers of FecXIbut such methods can also be applied to other alleles of this gene, which may be present in other mammals. Samples can be obtained either from DNA or directly from punctata whole blood, caused by the spots directly on the paper FTA®or follicles of hair or wool.

One such method involves the use of restricts for DNA cleavage, in one specific allele, but not in another, or for cleavage of the PCR fragment, containing the primer, which was construire is N. thus, to contain a cleavage site in combination with one or with the other allele.

After replacing With→T FecXHis the loss of the restriction site BsrSI (actg/gn) and the acquisition of SpeI site (a/ctagt). The authors confirmed the specified replacement of the base, showing that the enzyme SpeI PCR product length of 541 BP covering the specified area into fragments of length 476 and 65 BP in females FecXH/FecXHand males FecXH/Ybut not FecXIand wild-type animals. In sheep carrying a copy of each allele (FecXI/FecXH)identified all three fragments (541, 476 and 65 BP). Similarly BsrSI were digested fragments in the case of FecXIand wild-type animals, but not media FecXH.

In PCR product length 154 BP DNA carriers FecXI(obtained with primers:

No. 12 (GAAGTAACCAGTGTTCCCTCCACCCTTTTCT) and

No. 13 (CATGATTGGGAGAATTGAGACC)) created an artificial restriction site XbaI. XbaI (t/ctaga) were digested PCR products obtained for females FecXI/FecXIand males FecXI/Ycarrying allele a (tctaga), but not products of PCR in wild type or FecXHcarrying the T allele (tctagt). Thus, XbaI were digested PCR product length 154 joined to the fragment length 124 P.N. removing the 30-nucleotide primer No. 12 only in carriers of FecXIfigure 8.

The products were identified by electrophoresis in 3% agarose gels (FMC Metaphor, containing ethidium, and visualized in ultra the purple light.

Another method of detecting SNP includes the use of fluorescently labeled primers together with the method of artificial RFLP described above, and visualization of products in the device for sequencing, such as ABI377.

Other methods of SNP detection include the use of either method detection Taqman allele®or set for primer extension SnaPshot ddNTP (here insert from the detailed description manufacturers). In the method of recognition of the alleles used Taqman technology probes, which use a 5'-3'-nuclease activity of DNA polymerase AmpliTaq Gold ®to provide direct detection of PCR product due to the release of a fluorescent reporter in the PCR. In the analysis of recognition alleles using two probes, one probe for each allele, with each probe contains a special reporter dye. System SnaPshot based on the elongation using one dideoxynucleotide (fluorescently labeled) unlabeled oligonucleotide primer for detecting single nucleotide polymorphism (SNP). In another method of SNP detection using mass spectrometry, while the region around the SNP or mutation is amplified by PCR, and oligonucleotide primer extend along SNP or mutation in the presence of dideoxynucleotides. Options SNP identified on the basis of the time is ice mass.

The person skilled in the art will understand that although the invention is described with some detail for purposes of clarity and understanding, it is possible to carry out various modifications and changes described here to the ways of not going beyond the concept of the invention described in this description and the attached claims.

Cited here links listed on the following pages and incorporated herein by reference.

THE LIST OF REFERENCES.

Aaltonen, J., Laitinen, M.P., Vuojolainen, K., Jaatinen. R., Horelli-Kuitunen, N., Seppa, L., Louhio, H., Tuuri, T., Sjoberg, J., Butzow, R., Hovata, O., Dale, L. and Ritvos, O. (1999) Human growth differentiation factor 9 (GDF-9) and its novel homolog GDF-9b are expressed in oocytes during early folliculogenesis. J.Clin Endocrinol Metab 84: 2744-2750.

Amer, P.R., McEwan, J.C., Dodds, K.G. and Davis, GH 1998: Cost benefit analysis of commercial use of the Inverdale prolificacy gene in sheep. Proceedings of the New Zealand Society of Animal Production 58: 157-160.

Braw-Tal, R., McNatty, K.P., Smith, P., Heath, D.A., Hudson, N.L., Phillips, D.J., McLeod, B.J. and David, GH 1993: The ovaries of ewes homozygous for the X-linked Inverdale gene (FecX1) are devoid of secondary and tertiary follicles but contain many abnormal structures. Biology of Reproduction 49: 895-907.

Davis, GH, McEwan, J.C., Fenneasy, P.F., Dodds, K.G. and Farquhar, P.A. 1991: Evidence for the presence of a major gene influencing ovulation rate on the X-chromosome of sheep. Biology of Reproduction 44: 620-624.

Davis, GH, McEwan, J.C., Fennessy, P.F., Dodds, K.G., McNatty, K.P. and O, W-S. 1992: Infertility due to bilateral ovarian hypoplasia in sheep homozygous (FecXIFecX1) for the Inverdale prolificacy gene located on the X-chromosome. Biology of Reproduction 46: 636-640.

Davis, GH, Bruce, G.D. and Reid, P.J. 1994: Breeding implications of the strak ovary condition in homozygous (FecX IFecX1) Inverdale sheep. Proceedings of the 5thWorld Congress on Genetics Applied to Livestock Production. 19:249-252.

Davis, GH, McEwan, J.C., Fennessy, P.F., Dodds, K.G. 1995: Discovery of the Inverdale gene (FecX). Proceedings of the New Zealand Society of Animal Production 55:289-290.

Dong J., D.F. Albertini, K. Nishimori, Rajendra Kumar T., Lu, N. & Matzuk M.M. 1996: Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature 383:531-535.

Dube, J.L., Wang, P., Elvin. J., Lyons, KM., Celeste. A.J. and matzuk, M.M. 1998: The bone morphogenic protein 15 gene is X-linked and expressed m oocytes. Molecular Endocrinology 12:1809-1817.

Galloway, S.M., Hanrahan, V., Dodds, K.G., Potts, M.D., Crawford, A.M. and Hill, D.F. 1996: A linkage map of the ovine X chromosome. Genome Research 6:667-677.

Galloway, S.M., Cambridge, L.M., Henry, H.H., van Stijn, T.C. and Davis, GH 1999; A genetic test to identify carriers of the ovine Inverdale fecundity gene. Proceedings of the New Zealand Society of Animal Production 59:114-116.

Galloway, S.M., McNatty, K.P., Cambridge, L.M., Laitinen. M.P.E., Juengel. J.L., Jokiranta, T.S., McLaren. R.J., Luiro, K., Dodds, K.G., Montgomery, G.W., Beattie, A.E., Davis, GH, and Ritvos, O. (2000) Mutations in an oocyte-derived growth factor gene (BMP 15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nature Genetics 25:279-283 of.

Gray, A.J. and Davis, GH Commercial performance of sheep carrying the Inverdale gene (FecX). Proceedings of the New Zealand Society of Animal Pioduction 55:294-295.

Hanna, M.M. 1995: Living witn the Inverdale gene (FecX) in a Romney flock. Proceedings of the New Zealand Society of Animal Production 55:296-297.

Jaatinen, R., Laitinen, M.P., Vuojolainen, K., Aaltonen, J., Louhio, H., Heikinheimo, K., Lehtonen, E. and Ritvos, O. (1999) Localisation of growth differentiation factor-9 (Gdf-9) mRNA and protein in rat ovaries and cDNA cloning of rat GDF-9 and its novel homolog GDF-9B.Mol Cell Endocrinol 156:189-193.

Laitinen, M, Vuojolainen, K., Jaatinen, R., Ketola. L. Aaltonen, J., Lehtonen, E., Heikinheimo. M. and Ritvos, O. 1998: A novel growth differentiation factor-9 (GDF-9) related factor is co-expressed with GDF-9 in mouse oocytes uring folliculogenesis. Mechanisms of Development 78:135-140.

McNatty, K.P., Smith, P., Hudson, N.L., Heath, DA., Tisdall, D.J., O, W-S., Braw-Tal, R. 1995: Development of the sheep ovary during foetal and early neonatal life and the effect of fecundity genes. Journal of Reproduction and Fertility, Supplement 49:123-135.

McNatty, K.P., Smith, P., Hudson, N.L., Lun, S., Heath, D., Sbackell, G and Corrigan, K. 1995: Ovarian characteristics in Inverdale ewes heterozygous (I+) and homozygous (II) for the Inverdale gene (FecX). Proceedings of the New Zealand Society of Animal Production 55: 301-303.

Montgomery, G.W. and Sise, J.A. 1990: Extraction of DNA from sheep white blood cells. New Zealand Journal of Agricultural Research 33:437-441.

Mouse Genome Database (MGD), Mouse Genome Informatics, The Jackson Laboratory, Bar Harbor, Maine (October 1999).

The World Wide Web (URL: http://www.informatics.iax.org/).

Ohno, S. 1973: Ancient linkage groups and frozen accidents. Nature 244:259-262.

Sadighi. M., Montgomery, G.W., Bodensteiner, K.J., and Galloway, S.M. 1998; The growth differentiation factor-9 maps to sheep chromosome 5. Proceedings of the 26tfa International Conference on Animal Genetics, Auckland, New Zealand, abstract C020.

Smith, P., O, W-S., Corrigan. K.A., Smith, T., Lundy, T., David, GH and McNatty, K.P. 1997: Ovarian morphology and endocrine characteristics of female sheep foetuses that are heterozygous or homozygous for the Inverdale prolificacy gene (FecX1). Biology of Reproduction 57; 1183-1192.

1. The selected mutated molecule nucleic acid GDF-9B, is used to modulate the speed of ovulation in the female mammal and containing the nucleotide sequence selected from the group consisting of

a) SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7;

b) a sequence capable of gibridizatsiya in tough conditions with a molecule defined in (a);

c) a sequence that is functional is the first variant or fragment of the molecule, defined in (a);

d) a sequence that encodes a polypeptide selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 or SEQ ID NO:8;

e) SEQ ID NO:9;

f) SEQ ID NO:12 or SEQ ID NO:14, and

g) SEQ ID NO 16

h) a sequence which is a functional variant or fragment of the molecule defined in (d)-(f).

2. The nucleic acid molecule according to claim 1, used to identify sequence variants in an individual mammal associated with increased ovulation, reduced ovulation or the sterility of this mammal.

3. The nucleic acid molecule according to claim 1, used for the production of drugs to modulate the speed of ovulation in the female mammal.

4. The nucleic acid molecule according to claim 3, wherein the female mammal is selected from the group consisting of humans, sheep, cattle, goats, deer, horses, camels, possums, pigs, mice, rats, rabbits, hares, weasels, ferrets, cats and dogs.

5. Genetic marker associated with DNA selection in relation to enhanced ovulation or the sterility of the mammal containing at least 15 consecutive nucleotides of SEQ ID NO:1 and is capable of gibridizatsiya in stringent conditions with the nucleic acid molecule according to claim 1, or genomic DNA, kodiruyushchimi associated with the mutated gene GDF-9B.

6. Genetic marker according to claim 5, characterized in that the mammal is selected from the group consisting of humans, sheep, cattle, goats, deer, horses, camels, possums, pigs, mice, rats, rabbits, hares, weasels, ferrets, cats and dogs.

7. The probe containing at least 15 consecutive nucleotides of SEQ ID NO:1 and is capable of gibridizatsiya in stringent conditions with the nucleic acid molecule according to claim 1, for the identification and breeding of animals with enhanced ovulation or sterility.

8. Primer containing at least 15 consecutive nucleotides of SEQ ID NO:1 and is capable of gibridizatsiya in stringent conditions with the nucleic acid molecule according to claim 1, for the identification and breeding of animals with enhanced ovulation or sterility.

9. The vector comprising the nucleic acid molecule according to claim 1, used for transformation of a host cell.

10. Design that includes a nucleic acid molecule according to claim 1, used for transformation of a host cell.

11. The selected polypeptide, is used to modulate the speed of ovulation in the female mammal and comprising the amino acid sequence selected from the group consisting of

a) SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or

b) a functional variant or fragment posledovatelno and, defined in (a).

12. The polypeptide according to claim 11, characterized in that the polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10 or a functional variant or fragment is used for the production of drugs to modulate the speed of ovulation in the female mammal.

13. The polypeptide according to claim 11, characterized in that the polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or a functional variant or fragment is used for the manufacture of a medicinal product to increase the speed ovulation in the female mammal, which does not bear the mutated nucleic acid molecule GDF-9B.

14. The polypeptide according to claim 11, characterized in that the polypeptide comprising the amino acid sequence of SEQ ID NO:10 or a functional variant or fragment is used for the manufacture of a medicinal product to increase the speed of ovulation in sterile female mammal that carries two copies of the mutated nucleic acid molecule GDF-9B.

15. The polypeptide according to any one of p-14, wherein the female mammal is selected from the group consisting of humans, sheep, cattle, goats, deer, horses, camels, possums, pigs, mice, rats, rabbits, hares, weasels, ferrets,cats and dogs.

16. A method for identifying a mammal that carries the mutated nucleic acid molecule that encodes a GDF-9B, which includes the following stages:

(i) obtaining a sample of tissue or blood of a mammal;

(ii) isolation of DNA from the sample; and optional

(iii) DNA isolation GDF-9B of the DNA obtained in stage (i);

(iv) sensing the specified DNA probe, complementary to the mutated DNA GDF-9B according to claim 1;

(v) the amplification of the number of mutated DNA GDF-9B; and/or

(vi) determining, does the DNA sequence of GDF-9B obtained in stage (ii), the mutation associated with sterility or increased or decreased ovulation.

17. The method according to item 16, wherein the mammal is a mammal, male or female, and carries a single copy of the mutated nucleic acid molecule GDF-9B.

18. The method according to 17, wherein the mammal is a mammal of the female sex, and carries two copies of the mutated nucleic acid molecule GDF-9B.

19. The method according to any of PP-18, characterized in that the mammal is selected from the group consisting of humans, sheep, cattle, goats, deer, horses, camels, possums, pigs, mice, rats, rabbits, hares, weasels, ferrets, cats and dogs.

20. The method of modulating the speed of oval is of the female mammal, including the stage of introduction of a given mammal an effective amount of an agent that represents the polypeptide according to item 11.

21. The method according to claim 20, used to speed up ovulation in the female mammal, which shall not be mutated nucleic acid molecule GDF-9B, including the introduction of a given mammal an effective amount of a polypeptide comprising the amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or a functional variant or fragment.

22. The method according to claim 20, used to speed up ovulation in sterile female mammal that carries two copies of the mutated nucleic acid molecule GDF-9B, including the introduction of a given mammal an effective amount of a polypeptide comprising the amino acid sequence of SEQ ID NO:10 or a functional variant.

23. The method according to claim 20 that is used to increase or decrease the speed of ovulation or induce sterility in the female mammal, comprising introducing an effective amount of an agent selected from the group consisting of

a) an effective immunizing amount of the polypeptide of GDF-9B wild or mutant comprising the amino acid sequence according to claim 11;

b) antimicrob the second nucleic acid molecule, directed against a nucleic acid that encodes a polypeptide GDF-9B wild or mutant comprising the amino acid sequence according to claim 11;

c) a ligand that binds to or is an antigen to the polypeptide GDF-9B wild or mutant comprising the amino acid sequence according to claim 11,

thereby inhibiting the biological activity of the polypeptide GDF-9B mutated or wild-type.

24. The method according to item 22 or 23, wherein the female mammal is selected from the group consisting of humans, sheep, cattle, goats, deer, horses, camels, possums, pigs, mice, rats, rabbits, hares, weasels, ferrets, cats and dogs.

25. The composition for modulating the speed of ovulation in the female mammal, comprising an effective amount of an agent selected from the group consisting of

a) a polypeptide comprising amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or a functional variant or fragment;

b) polypeptide GDF-9B wild or mutant comprising the amino acid sequence according to claim 11;

c) the antisense nucleic acid molecule directed against a polypeptide as defined in (b);

d) a ligand that binds to or is what nigena to the polypeptide, defined in (b),

and pharmaceutically or veterinary acceptable carrier or diluent.

26. The ligand constituting the antibody or antibody fragment including an antigen-binding domain that binds to a polypeptide comprising the amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8 or a functional variant or fragment that is used to modulate the speed of ovulation in the female mammal.

27. The ligand for p, characterized in that it is a monoclonal antibody.

28. The ligand for p used for the manufacture of a medicinal product to increase or decrease the speed of ovulation or to induce sterility in the female mammal.

29. The ligand for p, wherein the female mammal is selected from the group consisting of humans, sheep, cattle, goats, deer, horses, camels, possums, pigs, mice, rats, rabbits, hares, weasels, ferrets, cats and dogs.

30. Kit for the identification of mammals that carry the mutated nucleic acid molecule GDF-9B, including

a) a pair of primers of claim 8 for amplification of the corresponding plot GDF-9B;

and optionally one or more of the following components:

b) a buffer solution for ampli the paths DNA;

c) a mixture of deoxynucleotides;

(d) means for amplifying the DNA;

e) a control DNA test type;

f) appropriate standards; and

g) detection system.



 

Same patents:

FIELD: veterinary virology.

SUBSTANCE: invention relates to 5 strains of II type porcine circovirus (PCV II) which represents causative agent of porcine post-wealing multy-systemic wasting syndrome (PMWS). Disclosed are various immunogenic compositions and vaccine based on said strains for PMWS prophylaxis and/or treatment. Also disclosed are vectors, viral preparations, cell extracts, cell culture supernatants, containing PCV II or nucleotide or protein components thereof; method for PCV II diagnosis, as well as diagnostic composition and kit.

EFFECT: new agent for treatment of porcine PMWS.

178 cl, 7 dwg, 5 tbl, 19 ex

FIELD: medicine, hematology.

SUBSTANCE: the present innovation deals with isolating DNA out of lymphocytes of peripheral venous blood due to phenol-chloroform extraction, carrying out the procedure of genotyping polymorphism of promoter area of gene CYP1A1 in site - Ile 462 Val due to polymerase chain reaction of DNA synthesis and subsequent restriction. At detecting genotype Ile-Val one should predict high risk for the development of toxic medicinal hepatitis.

EFFECT: higher accuracy of prediction.

1 tbl

FIELD: medicine, phthisiology.

SUBSTANCE: one should carry out molecular typing the genes of HLA family due to polymerase chain reaction and at detecting the allele HLA-DRB1*01 it is possible to predict resistance to tuberculosis.

EFFECT: higher accuracy of prediction.

1 dwg

FIELD: medicine, biotechnology.

SUBSTANCE: invention relates to antibodies specifically binding to new human extracellular matrix polypeptides called as RGI; immunoconjugate containing the same and method for selective cell degradation; method for treatment of prostates cancer and metastasis in patients suffering from prostates cancer.

EFFECT: new method for treatment of prostates cancer.

28 cl, 7 ex, 7 dwg

FIELD: medicine, hematology.

SUBSTANCE: it is necessary to isolate DNA out of lymphocytes of peripheral venous blood due to phenolic-chloroform extraction followed by genotyping polymorphism C3435T of promoter area of multidrug resistance gene MDR 1 due to polymerase chain reaction of DNA synthesis with subsequent restriction. At detecting genotype CT in a patient one should predict favorable flow of the disease due to the absence of toxic lesion of inner organs.

EFFECT: higher accuracy of prediction.

2 ex, 1 tbl

FIELD: biotechnology, medicine, pharmaceutical industry, genetic engineering.

SUBSTANCE: method involves the following steps: destruction of gene devR in plasmid pJT53.34, construction of plasmid pJQ2000KdevR : kan from the destructed gene and its insertion into M. tuberculosis H37Rv cells followed by selection of transformants in Middlebruck medium 7H10 with kanamycin. Then transformants are checked for the presence of sequences of genes devR, KmR and gene determining resistance to sucrose (SacB) and M. tuberculosis Dup devR comprising copy of wild type and destructed copy of locus devR are detected. After carried out analysis these mycobacteria are grown in the same medium in the presence of kanamycin and sucrose and the following multiplication of mycobacteria under the same culturing conditions. The strain M. tuberculosis with mutation with respect to devR is checked for confirming allel change, destruction of gene devR : kan, among them and its functional destruction, and its growth properties are evaluated also. Then analysis for the presence of transcripts obtained from operon Rv 3134c - devR - devS is carried out and also their scanning and testing the virulence of the obtained mutant by devR strain in guinea pigs. Analysis involves histopathological analysis of infected organs of guinea pigs, isolation of identified mutant mycobacteria from spleens of infected animals and quantitative analysis of bacterial charge. Use of invention allows carrying out the identification of both a target responsible for relapse/reactivation of this diseases in patient and a target that allows adaptation of organism to hypoxia, and, respectively, to develop therapeutic formulations and medicinal agents for effective treatment of tuberculosis.

EFFECT: improved identifying method of target.

6 cl, 4 dwg

FIELD: medicine, oncology.

SUBSTANCE: method involves study of gene GP3a and predisposition to oncological diseases being among them to invasive and metastatic forms is established in detection alleles PL-A1 and PL-A2 in this gene. Study of gene GP3a is carried out by isolation of DNA by the polymerase chain reaction method and this gene is analyzed in blood dry drop on a paper carrier. As primers for polymerase chain reaction the method involves using nucleotide sequences 5'-GCTCCAATGTACGGGGTAAA and 5'-CTCCTCAGACCTCCACCTTG, and DNA product with length 384 nucleotide pairs is synthesized that is cleaved then with restriction endonuclease Msp I to form DNA fragments, and allele PL-A1 is identified by fragment with length 290 and 80 nucleotide pairs, and allele PL-A2 - by fragments with length 175, 120 and 80 nucleotide pairs. Method provides rapid and with great reliability and safety to determine predisposition to oncological diseases in urogenital system.

EFFECT: improved assessment method.

2 cl

FIELD: molecular biology, biotechnology, in particular genetic typing.

SUBSTANCE: invention relates to method for fingerprinting of eucariotic organism. Nucleic acid sequence of eucariotic organism is amplified by primer, hybridizing in severe requirements with either transposable microelement or fragment of derivative thereof. Amplification products are fractionated on the base of mass and used for eucariotic organism determination.

EFFECT: fingerprinting of high effectiveness and resolution capability.

8 cl, 3 tbl, 18 dwg

FIELD: biotechnology.

SUBSTANCE: invention relates to proteins and polynucleotides, which stimulate enzyme cleavage and releasing of TNF receptors. Also disclosed are methods for identification of additional agents, which influence on TNF receptor releasing from cells. Products of present invention containing in pharmaceutical compositions as active ingredients increase or decrease TNF signal transduction and consequently abate disease pathology.

EFFECT: new pharmaceutical compositions.

27 cl, 8 ex, 3 tbl, 5 dwg

FIELD: genetics, animal husbandry.

SUBSTANCE: invention relates to a method for identification of carriers of recessive gene of complex vertebral malformations in cattle. Proposed method involves identification of the presence of a genetic marker localized in VTA3 chromosome in cattle in the region of flanking and comprising polymorphous microsatellite markers BM 4129 and BSM 1266. These markers are associated with the complex vertebral malformation (CVM) in cattle. Also, invention proposes a diagnostic set for realization of this method. Method provides identifying animals carrying the recessive gene CVM, and also animals as carriers of this disease.

EFFECT: improved and valuable genetic test.

27 cl, 7 dwg, 4 tbl, 7 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to isolated nucleic acid sequence encoding of polypeptide with nitrilase activity, wherein nitriles are converted to carboxylic acids in presence of said nitrilase.

EFFECT: method for production of chiral carboxylic acids with high effectiveness and low cost.

10 cl, 4 dwg, 2 tbl, 1 ex

FIELD: veterinary virology.

SUBSTANCE: invention relates to 5 strains of II type porcine circovirus (PCV II) which represents causative agent of porcine post-wealing multy-systemic wasting syndrome (PMWS). Disclosed are various immunogenic compositions and vaccine based on said strains for PMWS prophylaxis and/or treatment. Also disclosed are vectors, viral preparations, cell extracts, cell culture supernatants, containing PCV II or nucleotide or protein components thereof; method for PCV II diagnosis, as well as diagnostic composition and kit.

EFFECT: new agent for treatment of porcine PMWS.

178 cl, 7 dwg, 5 tbl, 19 ex

FIELD: immunobiotechnology.

SUBSTANCE: invention relates to soluble CTLA4, which represents mutant variant of wild type CTLA4 and conserves binding ability to CD80 and/or CD86. Molecules of soluble CTLA4 have the first amino acid sequence containing extracellular CTLA4 region, which includes some mutant amino acid residues in S25-R33 region and M97-G107 region. According the present invention mutant molecules also may include second amino acid sequence, enhancing solubility of mutant molecule. Nucleic acid (NA) molecules encoding said CTLA4 and including NA-vectors also are described. Invention also relates to method for production of mutant CTLA4 and uses thereof in controlling of interaction between T-cell and CD80 and/or CD86-positive cell; suppression of graft-versus-host reaction; and treatment of immune system diseases. Soluble mutant CTLA4 according to present invention binds to CD80 and/or CD86 antigen with higher avidity than wild type CTLA4 or non-mutant CTLA41g.

EFFECT: new preparation for treatment of immune system diseases.

65 cl, 19 dwg, 2 tbl, 2 ex

FIELD: biotechnology and gene engineering.

SUBSTANCE: invention relates to recombinant plasmide encoding hybrid GST-ESAT-6 polypeptide having activities of species-specific mycobacterial ESAT-6 antigen. Plasmide has molecular mass of 3.45 MD and size of 5315 n.p. Recombinant E.coli polypeptide containing such plasmide and recombinant GST-ESAT-6 polypeptide also are disclosed. Recombinant protein has activities of species-specific antigen protein Mycobacterium tuberculosis ESAT-6. Method of present invention makes in possible to simplify purification process of recombinant polypeptide and to produce protein of high purity hawing activities of mycobacterial ESAT-6 antigen without degradation thereof.

EFFECT: earlier species-specific diagnosis of tuberculosis infection.

3 cl, 3 dwg, 4 tbl, 5 ex

FIELD: biotechnology.

SUBSTANCE: method for production L-histidine includes culturing of Escherichia genus bacteria, containing DNA fragment encoding of mutant bacterial phosphoribozyl pyrophosphate synthetase (FRPP-synthetase), and collection of produced and accumulated L-histidine from cultural liquid, wherein in mutant FRPP-synthetase L-amino acid residue, corresponding to 115-position of amino acid sequence in natural FRPP-synthetase from Escherichia coli is replaced by serine residue.

EFFECT: high effective method for production of L-histidine.

11 cl, 1 tbl, 2 ex

FIELD: biotechnology, genetic engineering, amino acids.

SUBSTANCE: invention relates to a method for preparing L-methionine by culturing the microorganism strain transformed with plasmid comprising gene yjeH or gene with homology with its by above 30% and used as a producer of L-methionine. Prepared L-methionine is isolated from medium. The claimed invention provides preparing L-methionine with high degree of effectiveness.

EFFECT: improved preparing method.

11 cl, 1 tbl, 6 ex

FIELD: genetic engineering, virology, medicine.

SUBSTANCE: invention relates to method for production of modified Vaccinia virus Ankara (MVA). Claimed method includes contamination of mammalian continuous cell line with Vaccinia virus Ankara (MVA) of wild type, followed by viruses cultivation and collection. Further fresh cells of the same cell line are infected with newly formed viruses. Abovementioned steps optionally are repeated. Also disclosed are strains of modified Vaccinia virus Ankara (MVA) and utilization thereof. Said strains are capable to growth in continuous cell lines.

EFFECT: strains having decreased virulence in relates to mammalians.

20 cl, 5 tbl

FIELD: biotechnology.

SUBSTANCE: invention relates to method for stable cell transduction of hematopoesis system or hematopoesis stem cells. Claimed method includes simultaneous cell in vivo or in vitro contact with lentivirus vector and molecule bonding to cell surface. Method of present invention allows stable transduction more 75 % of cells over 14 days. Method for introduction of gene material into cell also is disclosed.

EFFECT: new method useful in medicine, virology, and gene engineering.

40 cl, 28 dwg, 9 ex

FIELD: molecular biology.

SUBSTANCE: invention relates to isolated DNA fragment encoding horse GM-CSF, and isolated horse GM-CSF protein. Also disclosed are vectors and various compositions containing thereof. GM-CSF is useful as adjuvant for horse vaccination as well as non-specific immunity stimulator in veterinary.

EFFECT: new compositions for gorse vaccination.

18 cl, 2 dwg, 1 tbl, 7 ex

FIELD: biotechnology, medicine.

SUBSTANCE: the present innovation deals with CFP10-ESAT6 hybrid protein that is able to induce Mycobacterium tuberculosis-specific hypersensitivity reaction of delayed type. This hybrid protein contains complete protein CFP10 out of M.tuberculosis combined with complete protein ESAT6 out of M.tuberculosis through linker amino acid sequence. It is, also, [presented a recombinant plasmid DNA pTBD16 for expression of hybrid protein CFP10-ESAT6. The latter should be obtained due to applying DLT1270 E.coli strain transformed with the obtained recombinant plasmid DNA pTBD16. The innovation suggests to apply the above-mentioned protein as a diagnostic kit of tuberculous infection both in mammalians and human beings. The method for predicting tuberculous infection has been revealed. Tuberculous infection should be predicted due to induction of hypersensitivity reaction of delayed type in case of subcutaneous injection of hybrid protein. Application of the present innovation enables to obtain a Mycabacterium tuberculosis-referring diagnostic kit, at specificity being 100%, sensitivity - 80%, not less.

EFFECT: higher accuracy and efficiency of diagnostics.

6 cl, 4 dwg, 4 ex

FIELD: molecular biology, gene engineering, medicine.

SUBSTANCE: disclosed is part of nucleotide sequence disposed upstream from encoding sequence of CARP gene having promoter activity providing specific expression of gene operably linked therewith in cardiac cells in vivo. Detected promoter sequence is accepted to mouse CARP gene sequence from nucleotide in (-2266) site to nucleotide in (+92) site. Also disclosed are cassette and vectors for expression of therapeutically valuable target protein in cardiac tissue containing therein said regulatory sequence.

EFFECT: genetic constructs useful in pharmaceutical compositions.

19 cl, 10 dwg, 10 ex

Up!