Soluble mutant ctla4 and uses thereof

FIELD: immunobiotechnology.

SUBSTANCE: invention relates to soluble CTLA4, which represents mutant variant of wild type CTLA4 and conserves binding ability to CD80 and/or CD86. Molecules of soluble CTLA4 have the first amino acid sequence containing extracellular CTLA4 region, which includes some mutant amino acid residues in S25-R33 region and M97-G107 region. According the present invention mutant molecules also may include second amino acid sequence, enhancing solubility of mutant molecule. Nucleic acid (NA) molecules encoding said CTLA4 and including NA-vectors also are described. Invention also relates to method for production of mutant CTLA4 and uses thereof in controlling of interaction between T-cell and CD80 and/or CD86-positive cell; suppression of graft-versus-host reaction; and treatment of immune system diseases. Soluble mutant CTLA4 according to present invention binds to CD80 and/or CD86 antigen with higher avidity than wild type CTLA4 or non-mutant CTLA41g.

EFFECT: new preparation for treatment of immune system diseases.

65 cl, 19 dwg, 2 tbl, 2 ex

 

The present invention relates to a soluble CTLA4, which is a mutant variant of wild-type CTLA4, which retains the ability to bind CD80 and/or CD86.

BACKGROUND of INVENTION

Antigen-non-specific intercellular interactions between T-lymphocytes and antigen presenting cells (APC) is called T - cell co-stimulating signals, causing T-cell response to antigen (Jenkins and Johnson (1993) Curr. Opin. Immunol. 5:361-3 67). Co-stimulating signals to determine the magnitude of T-cell response to antigen and activates or inactivates the answer subsequent reaction to an antigen (Mueller et al. (1989) Annu. Rev. Immunol. 7:445-480).

Activation of T cells in the absence of costimulation stops T-cell response or anergicakimi T-cell response (Schwartz,R.H. (1992) Cell 71:1065-1068). One of the key co-stimulating signal is formed by the interaction of the receptor T-cell surface CD28 with related B7 molecules on antigen presenting cells (e.g., also known as B7-1 and B7-2, or CD80 and CD86, respectively) (P.Linsley and J.Ledbetter (1993) Annu.Rev. Immunol. 11:191-212). The substance currently known as CD80 (B7-1), was originally described as an activation antigen associated with human b-cells (Yokochi,T. et al. (1981) J. Immunol 128:823-827; Freeman, G.J. et al.(1989) J. Immunol. 143:2714-2722) and respectively identified as protivorechitto in respect of the related T-cell molecules CD28 and CTLA4 (Linsley, R., et al. (1990) the OEWG. Natl. Acad. Sci. USA 87:5031-5035; Linsley, P.S. et al. (1991a) J. Exp. Med. 173:721-730; Linsley, P.S. et al. (1991b) J. Exp. Med. 174:561-570).

Later on antigen presenting cells was identified another protivorechitto for CTLA4 (Azuma.N. et al. (1993) Nature 366:76-79; Freeman (1993a) Science 262:909-911: Freeman. G.J. et. al. (1993b) J. Exp. Med. 178:2185-2192: Hathcock.K.L.S., et al. (1994) J. Exp. Med. 180:631-640: Lenschow, D.J. et al., (1993) Proc. Natl. Acad. Sci. USA 90:11054-11058; Ravi-Wolf. Z., 0993) Proc. Natl. Acad. Sci. USA 90:11182-11186: Wu, Yet al., (1993) J. Exp. Med. 178:1789-1793). This substance, now known as CD86 (Caux, C., et al. (1994) J. Exp. Med. 180:1841-1848), but also called B7-0 (Azuma et al. (1993, see above) or B7-2 (Freeman et al. (1993a), see above), has a sequence of about 25% identical to the sequence of CD80 on its extracellular segment (Azuma et al. (1993), see above; (Freeman et al. (1993a), see above, (1993b), see above). Cells transfinitely CD86, initiate mediated CD86 T-cell responses (Azuma et al. (1993), see above; Freeman et al. (1993a), (1993b), see above).

Comparison of the expression of CD80 and CD86 was the subject of several studies (Azuma et al. (1993), see above; Hathcock et al. (1994), see above; Larsen, S.R., et al. (1994) J. Immunol. 152:5208-5219; Stack, R., et al., (1994) J. Immunol 152:5723-5733). Current data show that the expression of CD80 and CD86 is regulated differently and suggest that the expression of CD86 tends to precede the expression of CD80 in the process of immune response.

Soluble forms of CD28 and CTLA4 were created by merging variable (v)-like extracellular wher is th CD28 and CTLA4 with constant regions of immunoglobulin (Ig), resulting in CD28Ig and CTLA4Ig. CTLA4Ig binds both CD80-positive, CD86-positive cells more strongly than CD28Ig (Linsley, P., et al. (1994) Immunity 1:793-80). Many of dependent T - cell immune responses are blocked CTLA4Ig both in vitro and in vivo (Linsley, et al., (1991b), see above; Linsley, P.S. et. al. (A) Science 257:792-795: Linsley, P.S. et al. C1992bU.Exp.Med. 176:1595-1604: Lenschow, D.J. et al., (1992), Science 257:789-792; Tan, P. et al., (1992) J. Exp. Med. 177:165-173; Turka, L.A., Proc. Natl. Acad. Sci. USA 89:11102-11105).

Peach et al., (J. Exp. Med. (1994) 180:2049-2058) identified areas extracellular region of CTLA4, which are important for strong binding to CD80. Specifically Hexapeptide motif (MYPPPY) in the field, such hypervariable segment 3 (CDR3), was identified as fully conserved region among all family members CD28 and CTLA4. Mutagenesis scanning alanine using the MYPPPY motif in CTLA4 and selected residues CD28Ig weakens or stops binding to CD80.

We have also created a chimeric molecule that interacts with homologous regions of CTLA4 and CD28. Molecules HS4 HS4-A and HS4-B were designed by the "change" CDR3-like plots CTLA4, which contained also a part of the carboxyl end, continued to include certain non-conservative amino acid residues on CD28Ig. These homologous mutants showed a higher avidity of binding to CD80 than CD28Ig.

In the other group chimeric homologous mutants CDR1 under the ing area CTLA4, which is not conservative in CD28 and, as predicted, spatial adjacent to the CDR3-like plot, "transplanted" in HS4 and HS4-A. These chimeric homologous mutant molecules (indicated by HS7 and HS8) showed even greater avidity of binding to CD80 than CD28Ig.

Chimeric homologous mutant molecules were also obtained via HS7 and HS8 CDR2-like plot CTLA4, but this combination is not further enhances the avidity of binding to CD80. Consequently, it was determined the MYPPPY motif of CTLA4 and CD28, but some non-conservative amino acid residues of CDR1 and CDR3-like areas are also responsible for increased avidity of binding of CTLA4 with CD80.

It was shown that CTLA4Ig effectively blocks due to CD80 T-cell additional stimulation (costimulation), but not effective for the blockade of CD86-positive immune responses. Were created molecules soluble CTLA4 mutant, in particular, have a higher avidity for CD86 than wild type CTLA4, as may be more able to block premirovanii antigen-specific activated cells than CTLA4Ig.

There remains a need for improved CTLA4 to create an improved pharmaceutical compositions for suppressing the immune response and cancer therapy than previously known soluble form of CTLA4.

The INVENTION

The COO is responsible invention provides soluble CTLA4 mutant, molecules which bind to CD80 and/or CD86. Mutant molecules of the invention include molecules that can recognize any of CD80 and CD86 or both, and to contact any of CD80 and CD86, or with both. In some embodiments of the invention the mutant molecules of the invention bind CD80 and/or CD86 with higher avidity than CTLA4.

One example of a mutant CTLA4 molecule is L104EA29YIg (7)presented in this description. Another example of a mutant CTLA4 molecule is L104EIg (Fig)presented in this description. L104EA29YIg and L104EIg contact CD80 and CD86 with higher avidity than CTLA4Ig.

BRIEF DESCRIPTION of FIGURES

Figure 1 shows the analysis of equilibrium binding L104EA29YIg, L104EIg and CTLA4Ig wild-type CD86Ig.

Figures 2A and 2B illustrates data of FACS analysis showing the binding of L104EA29YIg, L104EIg and CTLA4Ig with human CD80 - and CD86-transfitsirovannykh Cho cells as described in example 2, below.

In figures 3A and 3B shows the inhibition of proliferation CD80-positive and CD86-positive Cho cells, as described below in example 2.

In figures 4A and 4B shows that L104EA29YIg more effectively inhibits the proliferation of primary and secondary allostimulatory T cells than CTLA4Ig, as described below in example 2.

Figures 5A-C illustrate that L104EA29YIg is more effective than CTLA4Ig, inhibits the production of cytokines IL-2 (figa, IL-4 (pigv) and γ-interferon (figs) allostimulatory human T cells, as described below in example 2.

In figure 6 it is shown that L104EA29YIg is more effective than CTLA4Ig inhibits proliferation of phytohemagglutinin(RNA)-stimulated T cells of monkeys, as described below in example 2.

The figure 7 depicts the nucleotide and amino acid sequence of mutant molecules CTLA4 (L104EA29YIg), containing a signal peptide; extracellular mutant CTLA4 region, beginning with methionine at position +1 to aspartic acid at position +124, or starting with alanine at position -1 to aspartic acid at position +124; and the region of the Ig, as described below in example 1.

The figure 8 shows the nucleotide and amino acid sequence of mutant molecules CTLA4 (L104EIg), containing a signal peptide; extracellular mutant CTLA4 region, beginning with methionine at position +1 to aspartic acid at position +124, or starting with alanine at position -1 to aspartic acid at position +124; and the region of the Ig, as described below in example 1.

Figure 9 depicts the nucleotide and amino acid sequence of CTLA4Ig containing signal peptide; amino acid sequence of the extracellular region of wild-type CTLA4, beginning with methionine at position +1 to aspartic acid at position +124, or the beginning of the Naya with alanine at position -1 to aspartic acid at position +124; and region Ig.

In figures 10A-C presents the results PAGE in SDS-gel (figa) for CTLA4Ig (lane 1), L104EIg (lane 2) and L104EA29YIg (track 3A): results by size exclusion chromatography for CTLA4Ig (pigv) and L104EA29YIg (figs).

In figures 11A and 11B depicts a ribbon diagram of the V-like folds extracellular CTLA4 Ig derived solution structure by NMR spectroscopy. On FIGU Dan expanded view of the area of the S25-R33 and area MYPPPY, showing the position and orientation of the side chain mutations that increase the avidity, L104 and A29.

Figure 12 provides a schematic diagram of the vector, piLN-LEF29Y, with the insertion of L104EA29YIg.

DETAILED description of the INVENTION

DEFINITION

The following words and phrases used in this description have the following values.

Used in this description of the "wild-type CTLA4 has the amino acid sequence of natural full-CTLA4 (U.S. Patent 5434131, 5844095, 5851795) or its extracellular region, which binds CD80 and/or CD86, and/or interferes with CD80 and/or CD86 to contact their ligands. In specific embodiments of the invention extracellular region of wild-type CTLA4 begins with methionine at position +1 and ending with aspartic acid at position +124, or the extracellular region of wild-type CTLA4 begins with alanine at position -1 and ending aspartic acid at position +124. CTLA4 D. the type who is a protein found on the cell surface, contains N-terminal extracellular region, a transmembrane region and a C-terminal cytoplasmic region. The extracellular region binds to the target antigen (targets), such as CD80 and CD86. In natural cell CTLA4 protein of the wild type is transmitted in the form of immature polypeptide that includes a signal peptide at N-end. Immature protein undergoes posttranslational that includes cleavage and removal of the signal peptide with the formation of the cleavage product CTLA4 with the newly formed N-end, which is different from the N-Terminus of immature forms. Specialist in the art understands that may occur additional post-translational processing in which of the newly formed N-Terminus of the cleavage product CTLA4 removes one or more amino acids. Molecule Mature forms of CTLA4 comprises the extracellular region of CTLA4 or any part thereof, binding to CD80 and/or CD86.

"CTLA4Ig" is a soluble protein containing the extracellular region of wild-type CTLA4 or part thereof, which binds CD80 and/or CD86 connected to the end of the Ig. A special variant of the invention contains an extracellular region of wild-type CTLA4, beginning with methionine at position +1 to aspartic acid at position +124; or beginning with alanine at position -1 and ending at aspartic acid at position 124; the site of connection amino acid residue glutamine at position +125; and immunoglobulin area, covering the area from glutamic acid at position +126 to lysine at position +357 (figure 9).

Used in this description, the term "fused protein" is defined as one or more amino acid sequences are connected to each other by means well known in the art techniques and methods described in U.S. patent 5434131 or 5637481. While the United amino acid sequences form a single protein.

Used in this description, the terms "molecule CTLA4 mutant" ("mutant CTLA4") may designate a full-sized molecule CTLA4 (full-CTLA4) or his (her) part (derivatives or fragments), which contain a mutation or multiple mutations in CTLA4 (preferably in the extracellular region CTLA4), so that it (he) becomes similar to(-th), but not identical(nd) molecule CTLA4 wild-type (wild-type CTLA4). Molecules CTLA4 mutant may include biologically or chemically active non-CTLA4 molecule or the molecule can be attached to the molecule CTLA4 mutant. The mutant molecules of the compounds may be soluble (i.e., circulating) or may be associated with the surface. Molecules CTLA4 mutant may include the entire extracellular region of CTLA4 or a part thereof, e.g. the fragments or derivatives. Mutant CTLA4 can be obtained synthetically or methods rekombinantnoi DNA.

As used in this description, the term "mutation" refers to a change in a nucleotide or amino acid sequence of the polypeptide of the wild type. In this case, it indicates a change in the extracellular region of wild-type CTLA4. The change may be a change in amino acids, which includes substitutions, deletions, additions or truncate (shorten). Mutant molecule can contain one or more mutations. Mutations in nucleotide sequences can induce or not induce mutations in the amino acid sequence, which is very clear from the prior art. Namely, some of the nucleotide codons encode the same amino acid. Examples include codons CGU, CGG, CGC and CGA encoding the amino acid arginine (R); or codons GAU and GAC encoding the amino acid is aspartic acid (D). Therefore, the protein may be encoded by one or more nucleic acid, which differ in the specific nucleotide sequence, but still encode proteins with identical sequences. Below given sequence encoding the amino acid:

Alanine
Amino acidSymbolA one-letter symbolCodons
A1AAGCU, GCC, GCA, GCG
CysteineCysUGU, UGC
Aspartic
acidAspDGAU, GAC
Glutamic acidGluEGAA, GAG
PhenylalaninePheFUUU, UUC
GlycineGlyGGGU, GGC, GGA, GGG
HistidineHisHCAU, CAC
IsoleucineHeIAUU, AUC, AUA
LysineLysToAAA, AAG
LeucineLeuLUUA, UUG, CUU, CUC,
CUA, CUG
MethionineMetMAUG
AsparagineAsnNAAU, AAC
ProlineProPCCU, CCC, CCA, CCG
GlutamineGinQCAA, CAG
ArginineAg RCGU, CGC, CGA, CGG, AGA,
AGG

9
SerineSerSUCU, UCC, UCA, UCG,
AGU, AGC
ThreonineThrTACU, ACC, ACA, ACG
ValineValVGUU, GUC, GUA, GUG
TryptophanTrpwUGG
TyrosineTightYUAU, UAC

As used in this description, the term "extracellular region CTLA4" means the portion of CTLA4, which recognizes CD80 and/or CD86 and communicates with them. For example, the extracellular region of CTLA4 comprises an area from methionine at position +1 to aspartic acid at position +124. Or the extracellular region of CTLA4 comprises an area from alanine at position -1 to aspartic acid at position +124 (figure 9). The extracellular region consists of fragments or derivatives of CTLA4 that are associated with CD80 and/or CD86.

As used in this description, the term "non-CTLA4 protein sequence," or "not-mole CTLA4 the ula" refers to any molecule, which is not associated with CD80 and/or CD86 and does not prevent the binding of CTLA4 with its purpose. The sample includes, without limitation, the constant region of immunoglobulin (Ig) or its part. Preferably, the constant region of the immunoglobulin is a constant region of a human Ig or Ig monkeys, for example human (gamma) 1, including a hinge region, CH2 and CH3. Constant region Ig can mutate, weakening its effector functions (U.S. Patent 5637481 and 6132992).

As used in this description, the expression "fragment of the mutant CTLA4 molecule" refers to a part of the mutant CTLA4 molecule, preferably the extracellular region of CTLA4 or a site that recognizes a target, such as CD80 and/or CD86, and associated with her.

As used in this description, the expression "derived mutant CTLA4" ("molecule CTLA4 mutant") refers to a compound having a sequence at least 70% similar to the sequence of the extracellular region of CTLA4, and functions similar to the functions of this area, i.e., it recognizes CD80 and/or CD86 and communicates with them.

As used in this description, "part (section) of the CTLA4 molecule" includes fragments and derivatives (molecules) CTLA4, which are associated with CD80 and/or CD86.

For a more complete understanding of the present invention are presented below following the description.

The composition of the INVENTION

The present invention provides soluble CTLA4 mutant, which recognizes CD80 and/or CD86 and communicates with them. In some embodiments of the invention the soluble CTLA4 mutant exhibit higher avidity for CD80 and/or CD86 than CTLA4Ig.

Examples mutantnogo CTLA4 include L104EA29YIg (Figure 7). Amino acid sequence of L104EA29YIg can begin with alanine at position -1 amino acids and end with lysine at position +357 amino acids. Or amino acid sequence of L104EA29YIg may begin with methionine at position +1 amino acids and end with lysine at position +357 amino acids. CTLA4-plot L104EA29YIg covers the methionine at amino acid position +1 up to aspartic acid at position +124 amino acids. L104EA29YIg contains the connection - amino acid residue glutamine at position +125 plot of immunoglobulin, covering the area from glutamic acid at position +126 to lysine at position +357 (figure 7). The avidity L104EA29YIg when binding to CD80, about twice the avidity CTLA4Ig wild-type (hereinafter referred to as CTLA4Ig) and approximately 4 times higher when binding to CD86. This stronger binding leads to the fact that L104EA29YIg more effectively blocks the immune response than CTLA4Ig.

Molecules CTLA4 mutant contain at least the extracellular region of CTLA4 or her plot of land, which suasive is consistent with CD80 and/or CD86. The extracellular region of the molecule CTLA4 mutant contains the amino acid sequence from methionine at position +1 to aspartic acid at position +124 (7 or 8). Or the extracellular region of CTLA4 may include amino acid sequence beginning with alanine at position -1 up to aspartic acid at position +124 (7 or 8).

In one embodiment of the invention the soluble CTLA4 mutant is a protein comprising the extracellular region of CTLA4 having one or more mutations in the region of amino acid sequence from serine at position +25 and ending with lysine at position +33 (S25-R33). For example, the alanine at position +29 wild-type CTLA4 can be replaced by a tyrosine (codons: UAU, UAC). Or alanine can be replaced by a leucine (codons: UUA, UUG, CUU, CUC, CUA, CUG), phenylalanine (codon: UUU, UUC), tryptophan (codon: UGG) or threonine (codons: ACU, ACC, ACA, ACG). As can be easily understood by experts in this field, uracil (U), the nucleotide sequences of RNA corresponds Cimino (T), the nucleotide sequence of DNA.

In another embodiment of the invention the soluble CTLA4 mutant is a protein containing the extracellular region of CTLA4 having one or more mutations in or near the region of amino acid sequence beginning with methionine at position +97 and ending with glycine at position +107 (M97-G107). N the example, leucine at position +104 wild-type CTLA4 can be replaced by glutamic acid (codon: GAA, GAG). Mutant CTLA4 containing such replacement, called in this description L104EIg (Fig).

In another embodiment of the invention the soluble CTLA4 mutant is a protein containing the extracellular region of CTLA4 containing one or more mutations in the areas S25-R33 and M97-G107. For example, in one embodiment of the invention CTLA4 mutant contains at position +29 tyrosine instead of alanine; and at position +104 of glutamic acid instead of leucine. Mutant CTLA4 containing such replacement, called in this description of L104EA29YIg (Fig.7). Nucleic acid that encodes L104EA29YIg, contained in pD16 L104EA29YIg and deposited on June 19, 2000 American Collection of Cell Cultures (ATSS), 10801 University Blvd., Manasas, VA 20110-2209 (ATSS No. PTA-2104). Vector pD16 L104EA29YIg is derived from the vector pcDNA3 (INVITROGEN).

The invention further includes a soluble CTLA4 mutant containing the extracellular region of CTLA4 as shown in Fig.7 and 8, or its part (s), and the fragment that alters the solubility, affinity and/or valency of the mutant CTLA4.

In accordance with the practice of the invention, the fragment may be a constant region of an immunoglobulin or a part of it. For use in vivo preferably, the constant region of immunoglobulin did not cause the Reden immune response in the subject. For example, in the clinical Protocol may be preferred that the molecules of the specimen consisted of a constant region of a human or monkey immunoglobulin. One example of a suitable region of the immunoglobulin is human (gamma) 1 containing the hinge, CH2 and CH3 region. Other isotypes. In addition, other constant region (preferably other weakly or non-immunogenic constant region of immunoglobulin).

Other fragments include a polypeptide tag. Examples of suitable labels include, without limitation, molecules R, env gp120, E7 and ova (Dash, B., etal. (1994) J.Gen. Virol. 75:1389-97: Ikeda, T., et al. (1994) Gene 138:193-6; Falk, K., et al. (1993) Cell. Immunol 150:447-52: Fujisaka, K. et al. (1994) Virology 204:789-93). It is possible to apply other molecules as labels (Gerard, C. et al. (1994) Neuroscience 62:721-739; Byrn, R. et al. J. Virol. (1989) 63:4370-4375; Smith, D, et al. (1987) Science 238:1704-1707; Lasky, L., (1996) Science 233:209-212).

The invention further includes a soluble mutant fused protein CTLA4Ig, preferably more reactive against the antigen CD80 and/or CD86 compared with wild-type CTLA4. One example is L104EA29YIg, as shown in Fig.7.

In another embodiment of the invention, the molecule of soluble mutant protein CTLA4 includes connecting amino acid residue located between the site CTLA4 and plot immunoglobulin. The stretch of amino acids can be Liu the second amino acid, including glutamine. Connecting amino acid (wiring) can be introduced by methods of molecular genetics or synthetic chemical methods known from the prior art.

In another embodiment of the invention, the molecule of soluble mutant protein CTLA4 comprises an area of immunoglobulin (for example, the hinge CH2 and CH3 regions), where any residual cysteine or all of the cysteine residues in the hinge region of immunoglobulin plot is replaced by serine, for example cysteine residues at positions +130, +136 +139 (7 or 8). Mutant molecules may also include a Proline at position +148, replaced by a serine, as shown in Fig.7 and 8.

The molecule soluble mutant protein CTLA4 may include the sequence of the signal peptide associated with the N-end of the extracellular region L4-site mutant molecules. The signal peptide may be any sequence that allows the mutant molecule to secrete, including the signal peptide oncostatin M (Malick, et al. (1989) Molec. Cell. Biol. 9:2847-2853), or CD5 (Jones, N.H. et al., (1986) Nature 323:346-349), or the signal peptide of any extracellular protein.

The mutant molecule compounds may include the signal peptide oncostatin M, associated with the N-end of the extracellular region of CTLA4, and a molecule of the human immunoglobulin (e.g., hinge, CH2 and CH3 on the Asti), associated with the end of the extracellular region of CTLA4. This molecule consists of a signal peptide oncostatin M, covering amino acid sequence beginning with methionine at position -26 and up to alanine at position -26, plot CTLA4, covering amino acid sequence from methionine at position +1 to aspartic acid at position +124, a stretch of amino acids - glutamic residue at position 125 and plot immunoglobulin covering the amino acid sequence of glutamic acid at position +126 to lysine at position +357.

Soluble CTLA4 mutant protein can be obtained by the methods of recombinant DNA (molecular) or chemical synthetic methods. Molecular methods include the following stages: the introduction of a suitable host cell with a nucleic acid molecule that expresses and encodes a molecule soluble CTLA4 mutant; cultivation of introduced thus host cell under conditions that allow the cell to the host to Express the mutant molecule; and the allocation of expressing the mutant protein. The site of the signal peptide mutant molecules makes possible the expression of the protein on the cell surface and secretion him the host-cell. Broadcast mutant molecules can undergo posttranslational option is of, including cleavage of the signal peptide with the formation of a Mature protein containing areas of CTLA4 and immunoglobulin. The cleavage may be carried out after the alanine at position -1, which gives the molecule a Mature mutant proteins containing methionine at position +1 as the first amino acid (7 or 8). Or cleavage can be carried out after the methionine at position -2, which gives the molecule a Mature mutant proteins containing alanine at position -1 as the first amino acid.

The preferred option of the invention is a molecule soluble mutant CTLA4 protein that contains the extracellular region of human CTLA4 associated with a whole immunoglobulin molecule or part of it (e.g., hinge, CH2 and CH3 regions). The molecule preferably the protein comprises CTLA4-portion of the molecule soluble protein encompassing amino acid sequence from methionine at position +1 to aspartic acid at position +124, a stretch of amino acids - glutamic residue at position +125, and the plot immunoglobulin covering the amino acid sequence of glutamic acid at position +126 to lysine at position +357. The area containing the extracellular region of CTLA4, mutates so that the alanine at position +29 is replaced with tyrosine, and leucine at position +104 is substituted with glutamine the second acid. Immunoglobulin plot mutant molecules may mutate so that cysteine residues at positions +130, +136 +139 are replaced with serine, and Proline at position +148 is replaced with serine. This mutant protein (mutant molecule) are identified in the description of L104EA29YIg (Fig.7).

Another option mutant molecule L104EA29YIg according to the invention is a mutant molecule having the amino acid sequence from alanine at position -1 and to aspartic acid at position +124, a stretch of amino acids - glutamic residue at position +125, and the plot immunoglobulin encompassing glutamic acid at position +126 (e.g., from +126 to lysine at position +357). The area containing the extracellular region of CTLA4, mutates so that the alanine at position +29 is replaced with tyrosine, and leucine at position +104 is substituted with glutamic acid. Immunoglobulin plot mutant molecule is mutated so that the cysteine residues at positions +130, +136 +139 are replaced with serine, and Proline at position +148 is replaced with serine. This mutant protein (mutant molecule) are identified in the description of L104EA29YIg (Fig.7). After removal of the signal sequence L104EA29YIg can either start with methionine at position +1 or with alanine at position-1.

Another mutant molecule of the invention is a soluble molecule mutant is about protein CTLA4, have extracellular region of human CTLA4 associated with a molecule of the human immunoglobulin (e.g., hinge region, CH2 and CH3). This molecule is part of the amino acid sequence encoding CTLA4, beginning with methionine at position +1 to aspartic acid at position +124, a stretch of amino acids - glutamic residue at position +125, and the plot immunoglobulin covering the amino acid sequence of glutamic acid at position +126 to lysine at position +357. The area containing the extracellular region of CTLA4, mutates so that the leucine at position +104 is substituted with glutamic acid. The hinge portion of the molecule is mutated so that the cysteine residues at positions +130, +136 +139 are replaced with serine, and Proline at position +148 is replaced with serine. This mutant protein (mutant molecule) are identified in this description L104EIg (Fig).

An alternative L104EIg molecule is a soluble CTLA4 mutant containing the extracellular region of CTLA4-related molecule of human immunoglobulin (e.g., hinge region, CH2 and CH3). This preferred molecule is part of the amino acid sequence from alanine at position -1 and to aspartic acid at position +124, a stretch of amino acids - glutamic residue at position +125, and the participants is to immunoglobulin, covering the area from glutamic acid at position +126 to lysine at position +357. The area containing the extracellular region of CTLA4, mutates so that the leucine at position +104 is substituted with glutamic acid. The hinged section mutant molecule is mutated so that the cysteine residues at positions +130, +136 +139 replaced by series, and Proline at position +148 is replaced with serine. This mutant protein (mutant molecule) are identified in this description L104EIg (Fig).

In addition, the present invention includes a molecule soluble CTLA4 mutant with: (a) a first amino acid sequence of membrane glycoprotein, such as CD28, CD86, CD80, CD40 and gp39, which blocks the proliferation of T-cells, merged with a second amino acid sequence; (b) a second amino acid sequence being a fragment of the extracellular region of CTLA4 mutant, which blocks the proliferation of T-cells, such as, for example, amino acid molecule, comprising the area from the methionine at position +1 to aspartic acid at position +124 (7 or 8); and (C) a third amino acid sequence, which acts as an identification tag or increases the solubility of the molecule. For example, the third amino acid sequence may consist solely of amino acid residues of the hinge region, CH2 and CH3-region is the capacity of the non-immunogenic molecule of the immunoglobulin. Examples of suitable immunoglobulin molecules include, without limitation, human or monkey immunoglobulin, for example With (gamma) 1. There might also be other isotypes.

In addition, the invention includes a nucleotide molecule having a nucleotide sequence encoding the amino acid sequence corresponding to the molecules of the soluble CTLA4 mutant according to the invention. In one embodiment of the invention has a nucleotide molecule is a DNA (e.g. cDNA) or a hybrid. Or nucleotide molecules are RNA or hybrids.

In addition, the invention includes a vector that contains a nucleotide sequence according to the invention. Also is covered by a system of vector-host. The system of vector-host includes a vector according to the invention in a suitable cell host. Examples of suitable host cells include, without limitation, cells of prokaryotes and eukaryotes.

The invention includes pharmaceutical compositions for the treatment of diseases of the immune system, containing a pharmaceutically effective amount of soluble CTLA4 mutant. In some embodiments of the invention, diseases of the immune system mediated by the interaction of CD28 and/or L4-positive cells with CD80 - and/or D86-positive cells. Molecules soluble CTLA4 mutant preferably presented Aut a CTLA4 molecule, containing one or more mutations in the extracellular region of CTLA4. The pharmaceutical composition may include a soluble CTLA4 mutant protein and/or nucleic acid and/or encoding them, vectors. In preferred embodiments of the invention the soluble CTLA4 mutant has the amino acid sequence of the extracellular region of CTLA4 as shown in one of figures 7 or 8 (L104EA29Y or L104E respectively). Even more preferably, when the soluble CTLA4 mutant is L104EA29YIg presented in this description. The composition can optionally contain other therapeutic agents, including, without limitation, drug toxins, enzymes, antibodies or conjugates.

The pharmaceutical compositions also preferably include suitable carriers or adjuvants containing any material in connection with compound (molecule) of the invention (for example, the soluble CTLA4 mutant, such as L104EA29Y or L104E) remains active molecules and is not reactive in relation to the immune system of the subject. Examples of suitable carriers and adjuvants include, without limitation, human serum albumin; ion exchangers; aluminum oxide; lecithin; buffers, such as phosphates; glycine; sorbic acid; potassium sorbate; and salts or electrolytes, such as preteenslut. Other examples include any of the conventional pharmaceutical carriers, such as saline solution with phosphate buffer; water; emulsions such as oil-water emulsion; and various moisturizers. Other media may also include sterile solutions; tablets, including coated tablets, and capsules. Typically such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acid or its salts, magnesium stearate or calcium, talc, vegetable fats or oils, gums, glycols, or other known excipients. Such carriers can also include flavorings and dyes or other ingredients. Compositions containing such carriers, prepare a well-known conventional methods. These drugs can also be placed in different lipid compositions, such as liposomes, as well as in various polymer compositions, such as polymer microspheres.

The pharmaceutical compositions according to the invention can be entered in the usual ways, including, but without limitation, intravenous (IV), intraperitoneal (intraperitoneally, WB), intramuscular (im), subcutaneous, and oral routes of administration, the introduction in the form of a suppository or local contact, or implantation device of prolonged action, such as a mini-osmotic pump, to the subject.

The pharmaceutical compositions according to the invention can be in the form of R is slichnih dosage forms, which include, without limitation, liquid solutions or suspensions, tablets, pills, powders, suppositories, polymeric microcapsules or microvesicles (micro-bubbles), liposomes and solutions for injection or infusion. The preferred form depends on the method of administration and therapeutic application.

The most effective dosing and regimen compositions according to the invention depend on the severity and course of the disease, health condition of the patient and the response to treatment and opinion of the attending physician. Accordingly, the dosage of the compositions should be adjusted for each patient.

Molecules soluble CTLA4 mutant, you can enter the subject in number and in time (e.g., length and/or number of times)sufficient to block the binding of endogenous 7 (for example, CD 80 and/or CD 86) with their respective ligands in the body of the subject. Thus, the blockade of the binding of endogenous B7/ligand inhibits the interaction of B7-positive cells (e.g., CD80 and/or CD86-positive cells with CD28 and/or STA-positive cells. The dosage of therapeutic agent depends on many factors, including, but without limitation, the nature of the fabric, which is injected agent, type of autoimmune (autoimmune) disease to be treated, the severity of the disease, health condition of the subject and the reaction is of byetta to treatment with agents. Accordingly, the dosage of the agents may vary depending on the subject and method of administration. Molecules soluble CTLA4 mutant can be introduced in an amount of 0.1-20.0 mg/kg of body weight of the patient per day, preferably 0.5 to 10.0 mg/kg/day. To enter the pharmaceutical composition through different periods of time. In one embodiment of the invention the pharmaceutical composition according to the invention can be entered within one hour or more. In addition, the introduction can be repeated depending on the severity of the disease, as well as other factors, as follows from the prior art.

The invention further includes methods of obtaining protein, consisting of the cultivation system, the host-vector according to the invention is thus to produce the protein in the host, and in the allocation of the resulting protein.

In addition, the invention includes methods of regulating the functional interaction of CTLA4 and/or CD28-positive T cells with CD80 and/or CD86-pozitivnij cells. The methods include contacting CD80 and/or CD86-positive cells with a molecule soluble CTLA4 mutant according to the invention is thus to form complexes of mutant CTLA4 / CD80 and/or mutant CTLA4/ CD86, and complexes inhibit the reaction of endogenous antigen to CTLA4 with CD80 and/or CD86, and/or complexes inhibit the reaction of endogenous antigen to CD28 with CD80 and/or CD86. In one embodiment, and is gaining molecule soluble CTLA4 mutant is a protein, which contains at least part of the extracellular mutant CTLA4. In another embodiment of the invention, the molecule soluble CTLA4 mutant contains: a first amino acid sequence comprising the extracellular region of CTLA4 from methionine at position +1 to aspartic acid at position +124, containing at least one mutation; and a second amino acid sequence that includes the hinge region, CH2 and CH3 region of a molecule of the human immunoglobulin gamma 1 (7 or 8).

In accordance with the practice of this invention CD80 and/or CD86-positive cells in contact with fragments or derivatives of the molecule soluble CTLA4 mutant according to the invention. Or soluble CTLA4 mutant according to the invention is a protein CD28Ig/CTLA4Ig having a first amino acid sequence corresponding to part of the extracellular region of the receptor CD28, merged with a second amino acid sequence corresponding to part of the extracellular mutant CTLA4 receptor, and a third amino acid sequence corresponding to the hinge region, CH2 and CH3 region of a molecule of the human immunoglobulin C-gamma-1 (7 or 8).

It is assumed that the soluble CTLA4 mutant exhibits inhibiting properties in vivo. In conditions when the interaction of T-cell/APC the years, for example, the interaction of the T-cell/b-cell, occurs as a result of contact of T cells and APC cells, the binding introduced to the reaction with CD80 and/or CD86-positive cells, for example, b-cells, molecules CTLA4 mutant can inhibit (i.e. inhibit) the interaction of the T-cell/APC-cell, calling the regulation of immune responses.

The invention encompasses methods of negative regulation (inhibition) immune responses. Negative regulation of (modulation) of the immune response molecules soluble CTLA4 mutant may occur through inhibition or blockade of the immune response is already in the development process or can prevent the induction of the immune response. Molecules soluble CTLA4 according to the invention can inhibit the function of activated T cells, such as proliferation of T-lymphocytes and the secretion of cytokines, suppressing T-cell responses or inducing specific tolerance in T-cells, or both ways simultaneously.

Additionally, this invention encompasses methods of treatment of diseases of the immune system and induction of tolerance. In particular embodiments of the invention, diseases of the immune system mediated by the interaction of CD28 and/or L4-positive cells with CD80/CD86-positive cells. In another embodiment of the invention T-cell interaction is inhibited. Diseases of the immune system, the volumes include, but without limitation, autoimmune diseases, immunoproliferative diseases and diseases associated with transplantation. These methods include the introduction of the subject molecules soluble CTLA4 mutant according to the invention for regulation of T-cell interaction with CD80 and/or CD86-positive cells. Or you can enter the hybrid mutant CTLA4 containing membrane glycoprotein, which is connected with the molecule CTLA4 mutant. Examples of diseases associated with transplantation include caused by graft-versus-host (GVHD) (e.g., one that can be the outcome of bone marrow transplantation or in the induction of tolerance), disorders of the immune system due to graft rejection, chronic rejection, and ALLO - and xenografts tissues or cells, including dense tissue (organs), islets, muscles, hepatocytes, neurons. Examples immunoproliferative diseases include, without limitation, psoriasis, T-cell lymphoma; T-cell acute lymphoblastic leukemia; benign lymphocytic anghit; and autoimmune diseases such as lupus (e.g., systemic lupus erythematosus, lupus nephritis), Hashimoto thyroiditis, primary myxedema, graves ' disease, pernicious anemia, autoimmune atrophic gastritis, Addison disease, diabetes (for example, insulinsee the ' diabetes mellitus type I), syndrome?, heavy psevdomatematicheskoe male, disease, Crohn's disease, sympathetic ophthalmia, sympathetic uveitis, multiple sclerosis, autoimmune hemolytic anemia, idiopathic thrombocytopenia, primary biliary cirrhosis, chronic active hepatitis, ulcerative colitis syndrome Segren, rheumatic diseases (e.g. rheumatoid arthritis), polymyositis, scleroderma and mixed connective tissue disease.

The invention further includes a method of inhibiting rejection of a subject grafts homogeneous bodies and/or dense tissue, in this case the subject is a recipient of transplanted tissue. Typically, the transplantation of tissue graft rejection is initiated by the recognition of his T-cells as alien with subsequent immune response that destroys the graft. Molecules soluble CTLA4 mutant according to this invention, inhibiting the proliferation of T-lymphocytes and/or secretion of cytokines can lead to reduced degradation, and induction of antigen-specific immunological tolerance of T cells can lead to prolonged engraftment of the graft when it is not necessary in General immunosuppression. In addition, the molecules of the soluble CTLA4 mutant according to the invention can be used in conjunction with other formats vicesimo drugs, such as corticosteroids, cyclosporine, rapamycin, mycophenolate mofetil, azathioprine, tacrolimus, basiliximab and/or other biological compounds.

The present invention also includes methods of inhibiting homologous disease in the subject. This method consists of introducing the subject (molecules) soluble CTLA4 mutant according to the invention together with one or more ligands reactive with IL-2, IL-4 or γ-interferon. For example, the soluble CTLA4 mutant according to this invention can be supplied by the recipient of a transplant of bone marrow order to inhibit alloreactive donor T cells. Or donor T-cells of bone marrow transplant can take the immunogenicity against alloantigens recipient ex vivo prior to transplantation.

Inhibition of T-cell immune response soluble CTLA4 mutant may also be useful in the treatment of autoimmune disorders. Many autoimmune disorders are the result of inappropriate activation of T-cells reactive against autoantigens and promoting the production of cytokines and autoantibodies involved in the pathology of the disease. Introduction (molecules) soluble CTLA4 mutant to a subject suffering from an autoimmune disorder, can prevent the activation of self-reactive T cells and may reduce or remove symptomathology. This method can also be concluded in the introduction to the subject (molecules) soluble CTLA4 mutant according to the invention together with one or more ligands reactive with IL-2, IL-4 or γ-interferon.

The invention further encompasses the use of (molecules) soluble CTLA4 mutant together with other immunosuppressants, such as cyclosporine (see Mathiesen, in: "Prolonged Survival and Vascularization of Xenografted of Glioblastoma Cells in the Central Nervous System of Cyclosporin A-treated Rats" (1989) Cancer Lett., 44:151-156); prednisone, azathioprine, and methotrexate (R. Handschumacher "Chapter 53: Drugs Used for Immunosuppression" pages 1264-1276). Perhaps the use of other immunosuppressants. For example, in the treatment of rheumatoid arthritis (molecules), the soluble CTLA4 mutant can be entered with pharmaceutical drugs, including, but without limitation, corticosteroids, nonsteroidal anti-inflammatory drugs/inhibitors SOH-2, methotrexate, hydroxychloroquine, sulfasalazine, gold salts, etanercept, infliximab, anakinra, azathioprine and/or other biological agents, such as anti-THF-drugs. In the treatment of systemic lupus erythematosus molecules soluble CTLA4 mutant can be entered with pharmaceutical drugs, including, but without limitation, corticosteroids, cytoxan, azathioprine, hydroxychloroquine, mycophenolate mofetil and/or other biological products. The AOC is e, in the treatment of multiple sclerosis molecules soluble CTLA4 mutant can be entered with pharmaceutical drugs, including, but without limitation, corticosteroids, interferon beta-1A, interferon beta-1b, glatiramer acetate, mitoxantrone hydrochloride and/or other biological products.

Molecules soluble CTLA4 mutant (preferably L104EA29YIg) can also be used in combination with one or more of the following agents for the regulation of the immune response: soluble gp 39 (also known as CD40 ligand (CD40-L), CD-154, T-TRAP), soluble CD40, soluble CD80, soluble CD86, soluble CD28, soluble CD56, soluble Thy-1, soluble CD3, soluble TCR, soluble VLA-4, soluble VCAM-1, soluble LECAM-1, soluble ELAM-1, soluble CD44, antibodies, reactive against gp 39; antibodies reactive against CD40; antibodies reactive against V7; reactive against CD28; antibodies reactive against LFA-1; antibodies reactive against LFA-2; antibodies reactive against IL-2, antibodies reactive against IL-12, antibodies reactive against IFN-gamma; antibodies reactive against CD2; antibodies reactive against CD48; antibodies reactive against any of ICAM (e.g., ICAM-2); antibodies reactive against CTLA4; antibodies reactive against Thy-1; antibodies reactive against CD56; antibodies reactive against CD3; antibodies reactive against CD29; antibodies reactive against TCR; antibodies reactive against VLA-4; antibodies reactive against VCAM-1; antibodies reactive against LECAM-1; antibodies reactive against ELAM-1; antibodies reactive against CD44. In some embodiments of the invention preferred are monoclonal antibodies (mAbs). In other embodiments of the invention are preferred antibody fragments. All the specialists in the art will easily understand that the combination may include a soluble CTLA4 mutant according to the invention and another immunosuppressive drug, soluble CTLA4 mutant with two other immunosuppressants, the soluble CTLA4 mutant with three other immunosuppressants, etc. determine the optimal combination and dosage, you can define and optimize well izvestnimi in engineering methods.

Some specific combinations include the following: L104EA29YIg and CD80 mAbs; L104EA29YIg and CD86 mAbs; L104EA29YIg, CD80 and CD86 mAbs mAbs; L104EA29YIg and gp 39 mAbs; L104EA29YIg and CD40 mAbs; L104EA29YIg and CD28 mAbs; L104EA29YIg, CD80 and CD86 mAbs and gp 39 mAbs; L104EA29YIg, CD80 and CD86, and CD40 mAbs mAbs; L104EA29YIg, anti-LFA1 mAb and anti-gp 39 mAb. A concrete example of gp 39 mAb MR1 is. Other combinations will readily understand and appreciate the specialists in this field of technology.

Soluble CTLA4 mutant (molecules), for example L104EA29Y, you can enter as a single (independent) act is wny ingredient or together with other medicinal substances for immunomodulation or for treating or preventing acute or chronic rejection of ALLO - or xenograft, or inflammatory or autoimmune diseases, or for the induction of tolerance. For example, it can be used in combination with a calcineurin inhibitor, e.g. cyclosporin a or FK506; with immunosuppressive macrolide, such as rapamycin or its derivatives; for example, 40-O-(2-hydroxy)atrribution; with lymphocytic agent homing, for example, FTY720 or its analogue; corticosteroids; cyclophosphamide; azathioprine; methotrexate; Leflunomide or its analogue; mizoribine; mycophenolic acid; mycophenolate mofetil; with 15-desoxypeganine or its analogue; immunosuppressive monoclonal antibodies, for example monoclonal antibodies to receptors of leukocytes, for example, MHC, CD2, CD3, CD4, CD 11a / CD18, CD7, CD25, CD27, B7, CD40, CD45, CD58, CD 137, ICOS, CD150 (SLAM), H, 4-1BB or other ligands; or other immunomodulatory compounds, such as CTLA4/CD28-Ig, or other molecules of adhesion inhibitors, e.g. mAbs or low molecular weight inhibitors, including antagonists of LFA-1, Selectin antagonists and antagonists of VLA-4. The connection is particularly applicable in combination with a compound that inhibits CD40 and its ligand, for example, antibodies to CD40 and antibodies to CD40-L, to achieve the above indications, such as the induction of tolerance.

When the molecules of the soluble CTLA4 mutant according to the invention is administered in combination withother with immunosuppressive/immunomodulatory and anti-inflammatory therapies for example, such as described above, the dosage jointly commissioned immunosuppressive drug, immunomodulator or anti-inflammatory drugs, of course, depend on the type jointly entered medicinal substances, for example, from the fact that it is a steroid or cyclosporin, from concrete used medicinal substance, person, etc.

In accordance with the above, the present invention provides in an additional aspect of the above methods, consisting in the joint application, such as simultaneous (concomitant or sequential, a therapeutically effective amount (molecules) soluble CTLA4 mutant according to the invention, L104EA29YIg, in free form or in pharmaceutically acceptable salt, and a second drug substance, but such second drug is an immunosuppressive drug, an immunomodulator or anti-inflammatory drug, such as those listed above. Also covered therapeutic combination, e.g. a kit, for example, for use according to any one of the above methods, containing L104EA29YIg, in free form or in pharmaceutically acceptable salt, administered simultaneously or sequentially with at least one pharmaceutical composition comprising an immunosuppressant immunomodulator or anti-inflammatory drug. The kit may contain instructions for their use.

METHODS of OBTAINING MOLECULES ACCORDING to the INVENTION

The expression of molecules CTLA4 mutant can be done in prokaryotes. Most often prokaryotes represented by various strains of bacteria. Bacteria may be gram-positive and gram-negative. As a rule, preferred are gram-negative bacteria, such as E. coli. You can also use other strains of microbes.

Sequences encoding molecules CTLA4 mutant, can be embedded into a vector designed to ekspressirovali alien sequences in prokaryotes, such as E. coli. These vectors can include commonly used prokaryotic regular sequence, which, as presented in this description, include the promoters of transcription initiation, optionally with an operator, along with the binding sites of the ribosome, include such commonly used promoters as the promoter of beta-lactamase (penitsillinazy) and lactose (lac) (Chang, et al., (1977) Nature 198:1056), the promoter system of tryptophan (trp) (Goeddel, et al., (1980) Nucleic Acids Res. 8:4057) and the promoter PLand the binding site of ribosome N-gene of phage lambda (Shimatake, et al., (1981) Nature 292:128).

Such expression vectors also include origin replication and selective markers, such as gene beta-lactamase or neomycin-f is cotransfer, imparts resistance to antibiotics, so that the vectors can replicate in bacteria, and it is possible to select cells carrying plasmids grown in the presence of antibiotics, such as ampicillin or kanamycin.

Plasmid expression can be entered in the cells of prokaryotes using a variety of standard methods, including, but without limitation, CaCl2-shock (Cohen, (1972) Proc. Natl. Acad. Sci. USA 69:2110, and Sambrook et al. (eds.), "Molecular Cloning: A Laboratory Manual, 2ndEdition, Cold Spring Harbor Press, (1989), and electroporation.

In accordance with the practice of this invention the cells of eukaryotes are also suitable as host cells. Examples of eukaryotic cells include any animal cell, primary or immortalizing, yeast cells (e.g., Saccharomyces cerevisiae. Schizosaccharomyces pombe and Pichia pastoris), and plant cells. Myeloma cells, COS and Cho are examples of animal cells that can be used as host cells. Specific SNO-cells include, but without limitation, DG44 (Chasin, et la., 1986 Som. Cell. Molec. Genet. 12:555-556; Kolkekar 1997 Biochemistry 36:10901-10909), CHO-K1 (ATCCNo. CCL-61), CHO-K1 Tet-On cell line (Clontech), SNO, marked ESAS 85050302 (CAMR, Salisbury, Wiltshire, UK), SNO clone 13 (GEIMG, Geneva, IT), Cho clone (GEIMG, Geneva, IT), CHO-K1/SF indicated ESAS 93061607 (CAMR, Salisbury, Wiltshire, UK), and RR-CHOK1 marked ESAS 92052129 (CAMR, Salisbury, Wiltshire, UK). Examples of plant cells include cells of tobacco (whole plant, cell culture, is whether the callus), wheat, soy cultural and rice. Also applies seeds of wheat, soybeans, cultural and rice.

The nucleotide sequence encoding the molecule CTLA4 mutant can also be embedded into a vector designed for ekspressirovali alien sequences in eukaryotic cells. Regulatory elements of the vector can vary in accordance with specific eukaryotic cell host.

Commonly used eukaryotic regular sequence for use in expression vectors include promoters and regular sequences compatible with mammalian cells such as the CMV promoter (vector CDM8) and sarcoma virus birds (ASV) (vector πLN). Other usually used promoters include the early and late promoters of the green monkey virus (SV40) (Fiers, et al., Nature 273:113), or other viral promoters, such as viral promoters of polyoma, Adenovirus 2, and virus bovine papilloma. You can also use inducible promoter, such as hMTII (Karin, et al., (1982) Nature 299:797-802).

The expression vectors (molecules) mutant CTLA4 in eukaryotic cells may also be sequences called enhancers (enhancer region). They are important for the optimization of gene expression and are above (upstream) or below (downstream) of the promoter.

Examples of vectors for expression of eukaryotic host cells include, nobes restrictions, vectors, host cells of mammals (for example, BPV-1, pHyg, pRSV, hSV2, pTK2 (Maniatis); pIRES9 (Clontech); pRc/CMV2, pRc/RSV, pSFV1 (Life Technologies); the vectors pVPakc, vectors pCMV vectors pSG5 (Stratagene)), retroviral vectors (e.g., vectors pFB (Stratagene)), pCDNA-3 (Invitogene) or their modified forms, adenoviral vectors; vectors adenosine virus, baculovirus vectors, yeast vectors (for example, the pESC vectors (Stratagene)).

The nucleotide sequence encoding the molecule CTLA4 mutant, can be integrated into the genome of the eukaryotic host cell and replicate in the form of replicas of the genome of the host cell. Or the vector carrying molecule CTLA4 mutant may contain originy replication, making possible extrachromosomal replication.

For expression of the nucleotide sequences in Saccharomyces cerevisiae, you can use the origin of replication of endogenous yeast plasmid, spiral (ring) 2μ. (Broach, (1983) Meth. Enz. 101:307). Or you can use the sequence of the genome of yeast capable of promote Autonomous replication (see, for example, Stinchomb et al., (1979) Nature 282:39); Tschemper et al., (1980) Gene 10:157; and Clarke et al., Meth. Enz. 101:300).

Transcription control sequences of the yeast vectors include the promoters for synthesis of glycolytic enzymes (Hess et al., (1968) J Adv. Enzyme Reg. 7:149; Holland et al., (1978) Biochemistry 17:4900). Additional promoters known in the art, include the CMV-promoter, are created is in the vector CDM8 (Toyama and Okayama, (1990) FEBS 268:217-221); the promoter for 3-phosphoglycerate (HitzemanetaL, (1980) J. Biol. Chem.255:2073) and the other promoters of glycolytic enzymes.

Other promoters are inducible, as they may be regulated by stimuli from the environment or from the culture medium for cell cultivation. These inducible promoters include promoters of genes heat shock proteins, alcohol dehydrogenase 2, sociogram C, acid phosphatase, enzymes associated with the catabolism of nitrogen, and enzymes responsible for the utilization of maltose and galactose.

The regulatory sequence can be placed on the 3'end of coding sequences. These sequences can stabilize messenger RNA. Such terminators detected in 3' untranslated site following the coding sequences of several genes of the yeast and mammals.

Examples of vectors for plants and plant cells include, but are not limited to, plasmids Tiagrobacteria, the cauliflower mosaic virus (CaMV) and gold mosaic virus tomatoes (TGMV).

The General aspects of the transformation of the system of the host mammalian cells described Axel (U.S. Patent 4399216, issued August 16, 1983). Mammalian cells can be transformed by methods including, but without limitation, transfection in the presence of calcium phosphate, microinjection, electroporation Il the transduction with the participation of viral vectors.

Methods introduction sequence of the foreign DNA into the genomes of plants or yeast include (1) mechanical methods, such as microinjection of DNA into single cells or protoplasts, carried out by intensive mixing of the cells with glass beads in the presence of DNA, or "shot" of tungsten or gold balls into cells or protoplasts; (2) introduction of DNA by transformation of the cell membrane permeable to macromolecules processing them glycol or using electrical pulses at high voltage (electroporation); or (3) the use of liposomes (containing DNA), which fuse with the cellular membrane.

The expression of molecules CTLA4 mutant can be detected by methods known in the art. For example, mutant molecules can be detected by staining Kumasi blue gels SDS-PAGE or Western blot turns using antibodies that bind to CTLA4. The selection of the protein can be performed using standard methods of protein purification, for example, affinity chromatography, ion exchange chromatography, and getting almost pure product (R. Scopes in: "Protein Purification. Principles and Practice". Third Edition, Springer-Verlag (1994)).

The invention further encompasses molecules soluble CTLA4 mutant (soluble CTLA4 mutant), produced as described above in this specification.

MUTAGENESIS CTLA4Ig the BL IS USING CODONS

In one embodiment of the invention used site-directed mutagenesis and a new method of screening for the identification of several mutations in the extracellular region of CTLA4, which increase the avidity of binding to CD86. In this embodiment of the invention receives mutations in the residues at sites of extracellular region of CTLA4 from serine 25 to arginine 33,' chain (alanine 49 and threonine 51), F chains (lysine 93, glutamic acid 95 and leucine 96) and in the area from methionine to tyrosine 102, tyrosine 103 to glycine 107 and G chains in the provisions of glutamine 111, tyrosine 114 and isoleucine 115. These sites are selected on the basis of studies of fused proteins chimeric CD28/CTLA4 (Peach et al., J. Exp. Med., 1994, 180:2049-2058) and on the basis of the model to predict side chain of any amino acid residues exposed to the solvent, and the lack of identity or homology of amino acid residues in certain positions between CD28 and CTLA4. Next, any remaining balance, which is spatially located in close proximity (5-10 Å) to the identifiable remains, is considered part of the present invention.

The purpose of the synthesis and screening of molecules soluble CTLA4 mutant with altered affinity to CD80 and/or CD86 selected strategy involving two stages. The experiments entailed first create a library of mutations in specific codon extracellular region of CTLA4, and ZAT is m its screening method Biacore analysis to identify mutants with altered reactivity against CD80 or CD86. Analytical Biacore system (Pharmacia, Piscataway, N.J.) uses a detector system resonance of the surface plasmon, which mainly includes covalent binding of either CD80Ig or CD86Ig with the dextran-coated sensor chip that is located in the detector. Then the test substance (molecules of the test substance) can be injected into a chamber containing a sensor chip, and the number of binding complementary protein can be estimated on the basis of the change in molecular mass which is physically associated with the dextran-coated side of sensor chip; the change in molecular weight can be measured by a detector system.

The advantages of THIS INVENTION

As CTLA4 binding to CD80 and CD86 is characterized by high velocity flow ("on", "K") and high speed dissociation ("off "from"), and as complexes of CTLA4Ig - CD86 dissociate 5-8 times faster than the complexes CTLA4Ig-CD80, it is reasonable to assume that the slow dissociation of CTLA4Ig in its complex with CD80 and/or CD86 leads to compounds (molecules) with a stronger immunosuppressive properties. Therefore, it is expected that the molecules of a soluble CTLA4 mutant with a higher avidity against CD80 - or CD86-positive cells compared with wild-type CTLA4 or a mutant form CTLA4Ig, will block premirovanii antigen-spec is specific for the activated cells with higher efficiency, than wild type CTLA4 or a mutant form CTLA4Ig.

In addition, the cost of obtaining CTLA4Ig is very high. Mutant CTLA4Ig (molecules), with a stronger immunosuppressive properties, can be used in the clinic in much smaller doses than non-mutant CTLA4Ig, giving similar levels of immunosuppression. Consequently, the use of soluble CTLA4 mutant, such as L104EA29YIg, can be very effective from the point of view of value.

The following examples are provided to illustrate the invention and to assist those of ordinary skill in its implementation and application. Examples in no way claim to be any restriction of the scope of the invention.

EXAMPLES

EXAMPLE 1

This example describes methods of obtaining nucleotide sequences encoding the molecules of the soluble CTLA4 mutant according to the invention. "Single-site" mutant (mutant one site) L104EIg received and the kinetics of its binding to CD80 and/or CD86. The nucleotide sequence L104EIg used as a matrix to create sequence "dvuhsostavnogo" mutant (mutant at two sites) CTLA4, L104EA29YIg, and the kinetics of its binding to CD80 and/or CD86.

Mutagenesis CTLA4 using codons:

To identify mutant CTLA4Ig molecules with lower rates of dissol the tion (speed "on" ("off")) molecules CD80 and/or CD86 strategy of mutagenesis and screening. "Single-site" mutant nucleotide sequence receive, using CTLA4Ig (U.S. patent 5844095; 5851795; and 5885796; ATSS No. 68629) as matrix. Mutagenic nucleotide PCR primers designed for random mutagenesis of the codon-specific cDNA in positions 1 and 2 of the codon can be any base, but in position 3 is only guanine or thymine (XXG/T; also known as NNG/T). In this manner it is possible to carry out any specific mutation of the codon encoding the amino acid to encode all 20 amino acids. This mutagenesis HHP/T gives 32 potential codons encoding all 20 amino acids. PCR products encoding mutations in close proximity to-M97-G107 CTLA4Ig (see 7 or 8), otscheplaut using SacI/XbaI and subcloning into similarly cut vector expression of CTLA4IgπLN. This method is used to get the "single-site" TL4-mutant molecule, L104EIg (Fig). The purpose of mutagenesis in spatial proximity to the S25-R33 CTLA4Ig silent restriction site Nhel, first introduced 5' to the loop using a PCR primer-directed mutagenesis. PCR products were cleaved under the action of the NheI/XbaI and subcloning into similarly cut vector expression of CTLA4Ig or L104EIg. This method is used to produce molecules "dvuhsostavnogo" mutant CTLA4, L104EA29YIg (Fig.7). In particular, the nucleotide molecule, the code is the dominant "single-site" mutant CTLA4 molecule, L104EIg used as a matrix to obtain molecules "dvuhsostavnogo" mutant CTLA4, LI 04EA29YIg. Vector piLN containing L104EA29YIg, shown in Fig.

EXAMPLE 2

The following describes methods of screening used to identify "one" and "dvuhshipovyh" mutant CTLA4-polypeptides expressed using the constructs described in example 1, which exhibit higher avidity of binding to antigen CD80 and CD86 compared with molecules nematanthus CTLA4Ig.

Modern studies in vitro and in vivo show that CTLA4Ig itself is not able to completely block premirovanii antigen-specific activated T-cells. In vitro studies on the determination of the inhibition of proliferation of T cells, carried out with CTLA4Ig and any antibody that binds CD80 or CD86, show that a monoclonal antibody specific for CD80, does not increase the inhibition of CTLA4Ig. However, antibody to CD86 increases inhibition, it indicates that CTLA4Ig inefficient blocks interaction with CD86. These data confirm earlier opening Linsley et al. (Immunity. (1994), 1:793-801)that for inhibition mediated CD80 cellular responses require approximately 100 times lower concentrations of CTLA4Ig than for CD86-mediated reactions. Based on these discoveries, it has been assumed that the molecules of a soluble CTLA4 mutant with the more high avidity against CD86, than wild type CTLA4, are better able to block premirovanii antigen-specific activated cells than CTLA4Ig.

To this end, the molecules of the soluble CTLA4 mutant described above in example 1, is subjected to screening using a new methodology in order to identify some mutations in the extracellular region of CTLA4, which increase the avidity of binding to CD80 and CD86. This strategy of screening provides an effective method for the direct identification of mutants with relatively slower "on" ("off")-speeds that do not require protein purification or quantification, as the definition of "on" ("off")-the speed does not depend on concentration (O Shannessy et al., (1993) Anal. Biochem., 212:457-468).

Cells COS transferout using mini-preparation of purified plasmid DNA and cultured for several days. To BIAcore biosensor chips (Pharmacia Biotech AB, Uppsala, Sweden)coated with soluble CD80Ig or CD86Ig add three air-conditioned culture medium. Specific binding and dissociation of mutant proteins determined using surface plasmon resonance (O Shannessy et al., (1993) Anal. Biochem., 212:457-468). All experiments performed on the BIAcore biosensor™ and BIAcore™ 2000 at 25°C. Ligands immobilized on the touch chips NCM5 to search for compounds (Pharmacia)using standard binding with N-ethyl-N'-(dimethylaminopropyl)carbod the imide-N-hydroxysuccinimide (Johnsson, C., et al. (1991) Anal. Biochem. 198:268-277; Khiiko, S.N., et al. (1993) J. Biol. Chem. 268:5425-15434 (?)).

Method of screening

Of COS cells grown in 24-hole tablets for tissue cultures, transtorno transferout using DNA that encodes a mutant CTLA4Ig. After 3 days collect the culture medium containing the secreted soluble mutant CTLA4Ig.

Current air COS cell culture media is passed through biosensor BIAcore chips, derivateservlet when using CD80Ig or CD86Ig (as described in Greene et al., 1996 J.Biol. Chem. 271:26762-26771), or mutant molecules identify when "on" ("off")-speeds that are lower than the "from"-speed observed for CTLA4Ig wild type. cDNA corresponding to samples selected environments, is sequenced and get DNA for the implementation of transient transfection of COS cells on a large scale, using which the mutant protein CTLA4Ig after the removal of protein And cultural environment. Conditions BIAcore analysis and data analysis methods for equilibrium binding such as those described in Greene et al., 1996 J. Biol. Chem. 271:26762-26771 and as presented in this description.

Data analysis BIAcore

Chart sensitivity before analysis normalized to zero response (RU). To determine the background value of the response (RU) based on the large differences in the values of the coefficients of refraction of solutions of the samples passed the through the "mock-derivatized" flow-through cuvette. The equilibrium constants of dissociation (Kd) calculated from the plot of Reqfrom S, where Reqindicates the response (answer) in the steady state minus the response to the "mock-derivatized" chip, and denotes the molar concentration of the analyte. Curves linking analyzed using commercially available software for tracing nonlinear curves (Prism, GraphPad Software).

Experimental data is first approximated by the binding of a single ligand with a single receptor (1-site model, i.e. a simple Langmuir system, a+b↔AB), and the equilibrium constants of Association (Kd=[And]·[In][AB] is calculated by the equation R=Rmax·/(d+C). Then approximate the data to the simplest dvuhslotovoj model binding ligand (i.e. the receptor has two independent noninteracting binding site as described by the equation R=Rmax·With(Kd1+(C)+RmAh·With(Kd2+(C)).

Compliance (agreement, the suitability of the two models analyzed visually by comparing with experimental data, and statistically using F-test sum of squares. The simplest single-site model is chosen as the most appropriate, if dvuhshatrovaya model is not significantly better (p<0,1).

Analysis of Association and dissociation is carried out using the BIA evaluation 2.1Software (Pharmacia). The rate constant of Association koncalculated in two ways, taking into account both the homogeneous single-site interaction, and parallel dvukhshagovoi interaction. For single-site interactions, the values of koncalculated by the equation Rt=Req(1-exp-ks(t-t0), where Rtindicates the response (response) at a given time, t; Reqindicates the response (answer) in the steady state; toindicates the time at the initial time of injection; and ks=dR/dt=kon·Ckoffand where C denotes the concentration of the analyte, calculated as a function of monomer binding sites. For dvuhshipovyh interactions values of koncalculated by the equation Rt=Req1(1-exp-ks1(t-t0)+Req2(1-exp-ks2(t-t0). For each model, the values of kondetermine the tangent of an angle (approximately, 70% of the maximum Association) plot of ksfrom C.

Data dissociation analyze in accordance with single-site (AB=a+b) and dvuhslotovoj (AiBj=Ai+Bj) models, and the rate constant (koff) is calculated based on the respective curves. You can use model binding site, except in those cases where residues exceed the background computer (2-10 RU, depending on the computer (PC)), in this case, use the site model with two what wyzwaniami. The period of occupancy of the receptor is calculated from the relation t1/2=0,693/koff.

Flow cytometry:

Murine mAb L307.4 (anti-CD80) were obtained from Becton Dickinson (San Jose, California), a IT1.2 (anti-V7-0 [also known as CD86]) from Pharmingen (San Diego, California). The purpose of the immune staining CD80-positive and/or CD86-positive Cho cells extracted from blood vessels cultures, incubare in physiological solution with fosfatnym buffer (PBS)containing 10 mm add (EDTA). Cells Cho (1-10·105first incubated with mAbs or with fused protein of the immunoglobulin in DMEM containing 10% fetal bovine serum (FBS), then washed and incubated with the second stage reagents conjugated with fluoresceinisothiocyanate antibodies goat to human or mouse immunoglobulin (Tago, Burlingame, California). Cells are washed one last time and analyzed by FACScan (Becton Dickinson).

SDS-PAGE and chromatography on the size of molecules

SDS-PAGE exercise Tris/glycine 4-20% acrylamide gels (Novex, San Diego, CA). Analytical gels stained Kumasi blue, images of wet gels receive digital scanning. CTLA4Ig (25 µg) and L104EA29YIg (25 µg) analyze chromatography according to the size of molecules on a column of TSK-GEL G300 SWXL(7,8×300 mm, Tosohaas, Montgomeryville, PA), balanced phosphate buffered saline, containing 0.02% of NAN3when the speed of the current of 1.0 ml/min

CTLA4XC120Sand L10EA29YX C120S.

Single-stranded CTLA4XC120Sget to the described method (Linsley et al., (1995) J. Biol. Chem.. 270:15417-15424). In short, as a matrix using a plasmid expression oncostatin M CTLA 4 (OMCTLA4), "direct" primer, GAGGTGATAAAGCTTCACCAATGGGTGTACTGCTCACACAG chosen so that its sequence was aligned with the sequences of the vector; and "reverse" primer,

GTGGTGTATTGGTCTAGATCAATCAGAATCTGGGCACGGTTC

corresponds to the last seven amino acids (i.e. amino acids 118-124) the extracellular region of CTLA4 and contains the restriction site of the enzyme and the termination codon (TGA). Reverse primer defines the mutation C120S (cysteine to serine at position 120). In particular, the nucleotide sequence GCA (nucleotides 34-36) shown above, the reverse primer is replaced by one of the following nucleotide sequences: AGA, GGA, TGA CGA, ACT or GCT. It is understood by experts in the art, a nucleotide sequence G is the reverse complementary sequence to the codon TGC for cysteine. Similarly, nucleotide sequence AGA, GGA, TGA, CGA GCT ACT or are reverse complementary sequences of the codons for serine. The products of polymerase chain reactions were cleaved with HindIII/XbaI and directed subcloning in the expression vector πLN (Bristol-Myers Squibb Company, Princeton, NJ). L104EA29YXC120Sprepared in a similar manner. Each the design are controlled by DNA sequencing.

Identification and biochemical characterization of mutants with high avidity

For mutagenesis choose twenty-four amino acids and the resulting ˜2300 mutant proteins will be analyzed by linking CD86Ig by means of surface plasma resonance (SPR; as described above). The prevailing effects of mutagenesis on each site are summarized in table II. Random mutagenesis of amino acids in the S25-R33, apparently, does not change the binding ligand. Mutagenesis e and R33 and residues M97-Y102, apparently, to the weakening of the binding ligand. Mutagenesis of residues S25, A29, and T30, K93, L96, Y103, L104 and G105 causes proteins to slow "to" ("he") and/or delayed "on" ("off"') velocities. These results confirm the previous finding that remains in the field S25-R33 and remains in or near the area M97-Y102 affect the binding of ligand (Peach et al., (1994) J. Exp. Med., 180:2049-2058.

Mutagenesis sites S25, T30, K, L96, Y103 and G105 allows the identification of some mutant proteins with slower speeds from CD86Ig. However, in these examples, slow speed from compensated slow speed "K", the resulting mutant proteins with the overall avidity for CD86Ig, which seems similar to the overall avidity observed in CTLA4Ig. In addition, mutagenesis K leads to significant aggregation, which may be responsible for the observed kinetic changes.

With usiny mutagenesis L104 followed COS cell transfection and screening method SPR samples of the culture media over immobilized CD86Ig gives six samples of environments, containing mutant proteins having approximately twice smaller speed "from"than CTLA4Ig wild type. In the sequencing of the corresponding cDNA of these mutants was found that each encodes a mutation of leucine to glutamine (L104E). Apparently, the substitution of leucine for aspartic acid (L104D) does not affect the binding CD86Ig.

Then mutagenesis repeat in each site listed in table II, this time as a PCR template (matrix) instead of CTLA4Ig wild-type use L104E, as described above. SPR analysis again using immobilized CD86Ig network (defines) six drugs culture medium obtained by alanine mutagenesis 29, with the protein at a speed of from about 4 times smaller than CTLA4Ig wild type. Two slowest are replaced with tyrosine (L104EA29Y), two are substitutions for leucine (L104EA29L), one to be replaced with tryptophan (L104EA29W) and one to be replaced with threonine (L104EA29T). Apparently, no mutants with slow speed "from the" not identified when randomly mutates a single alanine 29 CTLA4Ig in wild-type.

The relative molecular mass and the state of aggregation of purified L104E and L104EA29YIg evaluate method SDS-PAGE and chromatography on particle size. L104EA29YIg (˜1 μg; lane 3) and L104EIg (˜1 μg; lane 2), apparently, have the same electrophoretic mobility, and CTLA4Ig (˜1 μg; lane 1) p is outstay reductant (˜ 50 kDa; +βIU; plus 2-mercaptoethanol) and without recovery (˜100 kDa; -βIU) (figa). Chromatography on particle size shows that L104EA29YIg (figs), apparently has the same mobility as dimeric CTLA4Ig (pigv). The main peaks correspond to the dimer of the protein, whereas the faster eluting minor peak at figv corresponds to aggregates of higher molecular weight. Approximately 5.0% of CTLA4Ig represents aggregates of higher molecular weight, but there is no evidence for the presence of aggregation or L104EA29YIg L104EIg. Therefore, more durable binding CD86IG observed for L104EIg and L104EA29YIg, cannot be attributed to aggregation induced by mutagenesis.

Analysis of the equilibrium and kinetics of binding

Analysis of the equilibrium and kinetics of binding is carried out on purified from protein And CTLA4Ig, L104EIg and L104EA29YIg using surface plasma resonance (SPR). The results are shown in table I. the Observed equilibrium constants of dissociation (Kd; table I) is calculated on the basis of the binding curves obtained in the concentration range (5.0 to 200 nm). L104EA29YIg stronger associated with CD86Ig than L104EIg and CTLA4Ig. A lower value To adfor L104EA29YIg (3,21 nm)than for L104EIg (6,06 nm) or CTLA4Ig (to 13.9 nm), indicates a higher avidity binding with L104EA29YIg CD86Ig. A lower value To adL104EA29YIg (3,66 nm)than L104EIg (4,47 nm) or CTLA4Ig (6,51 nm), in which it shows to a higher avidity binding with L104EA29YIg CD80Ig.

The kinetics of binding indicates that the relative speed "to" binding CTLA4Ig, L104EIg and L104EA29YIg with CD80 same as speed "to" for CD86Ig (table I). However, the speed "of" (off) for these molecules are not equivalent (table I). Compared with CTLA4Ig speed L104EA29YIg "on" ("off") CD80Ig about 2 times slower, and the speed from CD86Ig, about 4 times slower. Since the introduction of these mutations has little effect on speed "to" ("on"), increasing the avidity to CD80Ig and CD86Ig observed for L104EA29YIg, first of all, apparently caused by a decrease in the velocity "of" (off).

To find out the cause for the increase the avidity L104EA29YIg to CD80Ig and CD86Ig mutations that affect how each monomer is associated dimer, or increase the avidity of the structural changes in each monomer, get stranded structures of the extracellular regions of CTLA4 and L104EA29YIg and subsequent mutagenesis of cysteine 120 on serine, as described above and in (Linsley et al., (1995) J. Biol. Chem., 270:15417-15424). As was shown by gel-filtration (Linsley et aL (1995). see above), purified proteins CTLA4X120Sand L104EA29YXC120Sare Monomeric before their properties to contact the ligands are analyzed by SPR method. The results show that the binding affinity of both Monomeric proteins with CD86Ig about 35-80 times less than the affinity of binding observed for their respective dimers (table is and I). This confirms previously published data stating that for high avidity binding to ligand requires dimerization of CTLA4 (Greene et al., (1996) J. Biol. Chem., 271:26762-26771).

The binding affinity of L104EA29YXC120Sas with CD86Ig and CD861g approximately 2 times higher than the binding affinity of them CTLA4XC120Sthe increase in affinity caused more than 3 times slow rate of dissociation from both ligands. It is therefore probable that the stronger binding of L104EA29YIg with ligand caused by increasing the avidity of the structural changes that are introduced in each Monomeric chain, rather than changes, causing dimerization of the molecule.

The location and structural analysis of mutations that increase the avidity

The structure of the extracellular IgV-like region of CTLA4 recently determined by NMR spectroscopy (Metzler et al., (1997) Nature Struct. Biol., 4:527-531. This allows you to find the exact location of leucine 104 and alanine 29 in the three-dimensional fold (figa-In). Leucine 104 is located near the highly conserved amino acid sequence MYPPPY. Alanine is located near the end of the segment S25-R33 which is spatially close to the site MYPPPY. Although remnants of these two areas there is a significant interaction, there seems to be no direct interaction between L104 and A29, although both contain some of the neighboring hydrophobin the th nucleus in the protein. The influence of the two mutants that increase the avidity, the structure is assessed through a model. Mutation A29Y easily located in the pocket between the site S25-R33 and plot MYPPPY and may serve to stabilize the conformation plot MYPPPY. In wild-type CTLA4 between L104 and L96 and V94 about plot MYPPPY there is a strong hydrophobic interaction. For two reasons it is unlikely that mutation of glutamic acid acquires a conformation similar to the conformation L104. First: without significant perturbations" on the site S25-R33 has too little space for the location of the longer side chain of glutamic acid. Second: it is the energy required to "carry" the negative charge of the side chain of glutamic acid in the hydrophobic region. On the contrary, research models allow us to predict that the side chain of glutamic acid is popped to the surface, where the charge can be stabilized by solvation. This conformational change can easily accommodate about G105 with minimal distortion of the other residues in these areas.

Binding mutants with high avidity cells SNO expressing CD80 or CD86.

The FACS analysis (figure 2) binding and mutant CTLA4Ig molecules with stable transfiziologii cells CD80+ and CD86+CHO carried out as presented in this description. CD80-positive cells SNO and cuberoot with increasing concentrations of CTLA4Ig, L104EA29YIg, or L104EIg, and then wash it off. Associated protein immunoglobulin find when using conjugated with fluoresceinisothiocyanate antibodies goat to human immunoglobulin.

As shown in figure 2, CD-positive or CD-positive Cho cells (1,5·105) incubated with the indicated concentrations of CTLA4Ig (dark squares), L104EA29YIg (circles) or L104EIg (triangles) for 2 h at 23°C, washed and incubated with conjugated with fluorescein antibodies goat to human immunoglobulin. Linking in General with 5000 viable cells analyzed (only definition) on a FACScan and the average fluorescence intensity (MFI) determined from the histogram data using PC-LYSYS. Data adjusted for background fluorescence measured in cells incubated only with the reagent of the second stage (MFI=7). Control L6 mAb (80 µg/ml) gives MFI<30. These results are representative for four independent experiments.

Linking L104EA29YIg, L104EIg and CTLA4Ig with human CD80-transfitsirovannykh SNO-cells approximately equivalent. L104EA29YIg and L104EIg associated more strongly with Cho cells, stably transfiziologii with human CD86 than CTLA4Ig (pigv).

Functional analysis:

Human CD4-positive T-cells secrete immunomagnetic negative selection (Linsley et al., (1992) J. Exp. Med.176:1595-1604). Selected CD4-positive T-cells stimulate formal-myristate-acetate (PMA) plus CD80-positive or CD86-positive Cho cells in the presence of "tetraoxa" concentrations of inhibitor. CD-positive T cells (8-10·104/well) were cultured in the presence of 1 nm PMA in the presence or in the absence of irradiated stimulators Cho cells. The proliferative response was measured by adding 1 µci/well [3H]thymidine for the last 7 hours of the 72 hours of cultivation. Inhibition of T cells stimulated with PMA plus CD80-positive CHO, or CD86-positive CHO, carried out with the use of L104EA29YIg and CTLA4Ig. The results are shown in figure 3. L104EA29YIg inhibits the proliferation of processed RMA SNO-cells stronger than CTLA4Ig (figa). L104EA29YIg is also more effective than CTLA4Ig at inhibiting proliferation of processed RMA S-positive Cho cells (pigv). Therefore, L104EA29YIg is a more potent inhibitor mediated as CD80 and CD-86 costimulate T cells.

Figure 4 shows inhibition with L104EA29YIg and CTLA4Ig allostimulatory human T cells obtained as described above and additionally stimulated when using the line of human B-lymphoblastoid cells (LCL), called the RM, which expresses CD80 and CD86 (the number of T-cells 3,0·104/well and RM 8,0·103/well). Primary allaste ulacia is carried out for 6 days the cells are then incubated in pulse mode with3H-thymidine during the 7 days before the definition introduced a radioactive label.

Secondary allostimulatory as follows. After seven days, the primary allostimulatory T cells collect on the environment for fractionation of lymphocytes (LSM) (ICN, Aurora, OH) and leave for 24 hours T-cells again stimulate (again) in the presence of mitrousis quantities of CTLA4Ig and L104EA29YIg adding RM in the same ratios, which are listed above. The stimulation should be performed within 3 days, the cells are then incubated in pulse mode, with a radioactive label and harvested as described above. The effect of L104EA29YIg on the primary allostimulatory cells shown in figa. The effect of L104EA29YIg on the secondary allostimulatory cells shown in Figv. L104EA29YIg inhibits the proliferative response of both primary and secondary T-cell better than CTLA4Ig.

For measuring the production of cytokines (figure 5) put the duplicates tablets for secondary allostimulatory. After 3 days of culture medium analyzed using ELISA kits (Biosource, Camarillo, CA), under conditions recommended by the manufacturer. Found that L104EA29YIg is more effective than CTLA4Ig, blocks the production of T-cells IL-2, IL-4 and γ-IFN cytokines after secondary allogeneic stimulus (figa-C).

The effect of L104EA29YIg and CTLA4Ig on the response of lymphocytes on the Asian in a mixed culture (MLR) is shown in Fig.6. Mononuclear cells from peripheral blood (PBMC'S; to 3.5·104cells/well from each monkey) from 2 monkeys purify the environment for fractionation of lymphocytes (LSM) and mixed C2 μg/ml of phytohemagglutinin (RNA, PHA). Cells are stimulated for 3 days, and then for 16 h and incubated with a radioactive label in pulse mode before collecting. L104EA29YIg inhibits the proliferation of T-cells monkeys better than CTLA4Ig.

Table I
The equilibrium constants and apparent kinetic constants are given in the following table (average ± standard deviation (deviation) from three different experiments):
Immobilized proteinAnalytekon(x·105)M-1S-1koff(x·10-3) S-1KdnM
CD80IgCTLA4Ig3.44±0.292.21±0.186.51±1.08
CD80IgL104EIg3.02±0.051.35±0.084.47±0.36
CD80IgL104EA29YIg2.96±0.201.08±0.053.66±0.41
CD80IgCTLA4X120S12,0±1.0 230±10195±25
CD80IgL104EA29YX120S8.3±0.2671±585.0±2.5
CD86IgCTLA4Ig5.95±0.578.16±0.5213.9±2.27
CD86IgL104EIg7.03±0.224.26±0.116.06±0.05
CD86IgL104EA29YTg6.42±0.402.06±0.033.21±0.23
CD86IgCTLA4XC120S16.5±0.5840±55511±17
CD86IgL104EA29YXC120S11.4±1.6300±10267±29

Table II
The effect of mutagenesis CTLA4Ig in these sites on a binding CD86Ig determined by the method of SPR (SPR), described above. The predominant effect is shown as "+"
Site mutagenesisThe lack of apparent actionThe effects of mutagenesisReduced binding to the ligand
Slow speed "to"/
slow speed "from"
S25+
R+
G27+
K28+
A29+
T30+
E+
R33+
K93+
L96+
M+
Y98+
P99+
R+
R+
Y102+
Y103+
L104+
G105Ȁ +
I106+
G107+
Q111+
Y113+
I115+

Specialists in the field of engineering that applies the present invention, it is understood that the invention may be embodied in other ways than described above without departing from the essence and main characteristics of the invention. Therefore, the above specific variants of the invention should be considered as illustrating, but not limiting.

1. Molecule CTLA4 mutant, which binds to CD80 and/or CD86, containing the extracellular region of CTLA4, amino acid sequence of which is shown in Fig.9, beginning with alanine at position -1 or methionine at position +1 and ending with aspartic acid at position +124, and in which the alanine at position +29 replaced with an amino acid selected from the group consisting of tyrosine, leucine, tryptophan and threonine, and leucine at position +104 is substituted for glutamic acid.

2. Molecule CTLA4 mutant according to claim 1, characterized in that it further contains an amino acid sequence which alters the solubility, affinity or valence molecules CTLA4 mutant.

3. Molecule CTLA4 mutant according to claim 1, characterized in that the amino acid sequence further comprises a constant region of human immunoglobulin or portion thereof, while the constant region may contain one or more mutations to attenuate effector functions.

4. Molecule CTLA4 mutant according to claim 2, characterized in that it further comprises the amino acid sequence, which allows the secretion of the molecules are CTLA4 mutant.

5. Molecule CTLA4 mutant according to claim 4, characterized in that the amino acid sequence, which allows the secretion of the molecules are CTLA4 mutant contains a signal peptide oncostatin M

6. Molecule CTLA4 mutant according to claim 1, containing the amino acid sequence beginning with methionine at position +1 and ending with aspartic acid at position +124, as shown in figure 7.

7. Molecule CTLA4 mutant according to claim 1, containing the amino acid sequence beginning with alanine at position -1 and ending with the TSA is rainaway acid at position +124, as shown in figure 7.

8. Molecule CTLA4 mutant according to claim 3, characterized in that the constant region of human immunoglobulin metirovan thus, to enable replacement of the cysteine at positions +130, +136 +139 in series and the replacement of Proline at position +148 in series, as shown in figure 7.

9. Molecule CTLA4 mutant, which binds to CD80 and/or CD86, containing the extracellular region of CTLA4, amino acid sequence which alanine at position +29 is replaced by tyrosine and leucine at position +104 is substituted for glutamic acid, as shown in figure 7.

10. Molecule CTLA4 mutant according to claim 9, characterized in that it further contains an amino acid sequence which alters the solubility, affinity or valence molecules CTLA4 mutant.

11. Molecule CTLA4 mutant of claim 10, wherein the amino acid sequence contains a constant region of human immunoglobulin or portion thereof, while the constant region may contain one or more mutations to attenuate effector functions.

12. Molecule CTLA4 mutant of claim 10, characterized in that it further comprises the amino acid sequence, which allows the secretion of the molecules are CTLA4 mutant.

13. Molecule CTLA4 mutant indicated in paragraph 12, characterized in that the amino acid sequence, to which I allow the secretion of a molecule CTLA4 mutant, contains a signal peptide oncostatin M

14. Molecule CTLA4 mutant according to claim 9, containing the amino acid sequence beginning with methionine at position +1 and ending with aspartic acid at position +124, as shown in figure 7.

15. Molecule CTLA4 mutant according to claim 9, containing the amino acid sequence beginning with alanine at position -1 and ending with aspartic acid at position +124, as shown in figure 7.

16. Molecule CTLA4 mutant according to claim 11, characterized in that the constant region of human immunoglobulin metirovan thus, to enable replacement of the cysteine at positions +130, +136 +139 in series and the replacement of Proline at position +148 in series, as shown in figure 7.

17. Molecule CTLA4 mutant, which binds to CD80 and/or CD86, containing the extracellular region of CTLA4 in amino acid sequence, which leucine at position +104 is substituted for glutamic acid, as shown in figure 8.

18. Molecule CTLA4 mutant according to 17, characterized in that it further contains an amino acid sequence which alters the solubility, affinity or valence molecules CTLA4, and the immunoglobulin portion, which may contain one or more mutations to attenuate effector functions.

19. The molecule is a nucleic acid that contains nucleotide the second sequence, encoding amino acid sequence corresponding to the molecule CTLA4 mutant according to claim 1.

20. The nucleic acid molecule containing the nucleotide sequence encoding the amino acid sequence corresponding to the molecule CTLA4 mutant according to claim 9.

21. The nucleic acid molecule encoding the amino acid sequence corresponding to the molecule CTLA4 mutant on 17 containing the nucleotide sequence beginning with adenine at nucleotide position +1 and ending with the adenine at position +1071, as shown in figure 8, or starting with guanidine in position -3 and ending with the adenine at position +1071, as shown in figure 8.

22. The nucleic acid molecule encoding the amino acid sequence corresponding to the molecule CTLA4 mutant according to claim 9, containing the nucleotide sequence beginning with adenine at nucleotide position +1 and ending with the adenine at position +1071, as shown in figure 7, or starting with guanidine in position -3 and ending with the adenine at position +1071, as shown in figure 7.

23. The nucleic acid molecule encoding the amino acid sequence corresponding to the molecule CTLA4 mutant on 17 containing the nucleotide sequence beginning with adenine at nucleotide put the +1 and ending with the thymine at position +372, as shown in figure 8, or starting with guanidine in nucleotide position -3 and ending with the adenine at position +1071, as shown in figure 8.

24. The nucleic acid molecule encoding the amino acid sequence corresponding to the molecule CTLA4 mutant according to claim 9, containing the nucleotide sequence beginning with adenine at nucleotide position +1 and ending with the thymine at position +372, as shown in figure 7, or starting with guanidine in nucleotide position -3 and ending with the adenine at position +1071, as shown in figure 7.

25. Expressing a vector containing a nucleotide sequence according to any one of p-24.

26. Expressing the vector pD16 L104EA29YIg, containing the nucleotide sequence encoding the mutant molecule CTLA4-L104EA29Yig, and deposited under the number of ATSS no MOUTH-2104.

27. Method to get the vector-host, which consists in the introduction of the vector on p. 25 or 26 in the corresponding cell of the host.

28. The method according to item 27, wherein the corresponding cell host is a bacterial cell or a eukaryotic cell.

29. The method according to p, wherein the host-cell is a eukaryotic cell.

30. The method according to clause 29, wherein the eukaryotic cell is a COS cell.

31. The method according to clause 29, characterized in that the eukaryotic cell is a cell in the ovary of the Chinese hamster (Cho).

32. The method according to p, characterized in that the cell SNO selected from the group consisting of DG44, Cho-K1, Cho-K1 Tet-On cell line, Cho, marked ESAS 85050302, SNO clone 13, SNO clone B, CHO-K1/SF and RR-CHOK1.

33. A method of obtaining a mutant CTLA4 protein, consisting of the cultivation system, the vector-host, obtained by the method according to item 27 in terms of providing the opportunity to produce in the cell-master CTLA4 mutant protein, and the discharge produced when this protein.

34. A method of obtaining a mutant protein L104EA29YIg, consisting of the cultivation system, the vector-host, obtained by the method according to item 27, using a vector as p in terms of providing the opportunity to produce in the cell-host protein L104EA29YIg, and in the allocation of produced protein.

35. The way the regulation of the interaction of T cells with CD80 and/or CD86-positive cells, which consists in contacting CD80 and/or CD86-positive cells with a molecule CTLA4 mutant according to claim 1 under conditions ensuring formation of complex CTLA4/CD80 or complex CTLA4/CD86, and complex prevents interaction between T-cell and CD80 and/or CD86-positive cell.

36. The way the regulation of the interaction of T cells with CD80 and/or CD86-positive cells, which consists in contacting CD80 and/or CD86-positive cells with a molecule CTLA4 mutant according to claim 9 under conditions ensuring formation of complex CTLA4/CD80 elikapeka CTLA4/CD86, moreover, the complex prevents interaction between T-cell and CD80 and/or CD86-positive cell.

37. The way the regulation of the interaction of T cells with CD80 and/or CD86-positive cells, which consists in contacting CD80 and/or CD86-positive cells with a molecule CTLA4 mutant on 17 under conditions ensuring formation of complex CTLA4/CD80 or complex CTLA4/CD86, and complex prevents interaction between T-cell and CD80 - and/or D86-positive cell.

38. The method according to PP, 36 or 37, characterized in that CD80 - and/or D86-positive cell in contact with a fragment or derivative molecules CTLA4 mutant.

39. The method according to PP, 36 or 37, characterized in that the CD80 and/or CD86-positive cell is an antigen-presenting cell.

40. The method according to PP, 36 or 37, characterized in that the interaction L4-positive T cells with CD80 and/or CD86-positive cells inhibited.

41. The method of treatment of diseases of the immune system, mediated by the interaction of T cells with CD80 and/or CD86-positive cells, which consists in the introduction of the subject of the molecules are CTLA4 mutant according to claim 1 for the regulation of T-cell interaction with CD80 and/or CD86-positive cells.

42. The method of treatment of diseases of the immune system, mediated by the interaction of T cells with CD80 and/or CD86-positive cells, which consists in the introduction to the subject of molecules mutant the th CTLA4 according to claim 9 for the regulation of T-cell interaction with CD80 and/or CD86-positive cells.

43. The method of treatment of diseases of the immune system, mediated by the interaction of T cells with CD80 and/or CD86-positive cells, which consists in the introduction to the subject of mutant molecules CDLA4 on 17 to regulate T-cell interaction with CD80 and/or CD86-positive cells.

44. The method according to PP, 42 or 43, characterized in that the T-cell interaction is inhibited.

45. The method of suppressing graft versus host", which consists in the introduction of the subject of the molecules are CTLA4 mutant according to claim 1 and a ligand reactive against IL4.

46. The method of suppressing graft versus host", which consists in the introduction of the subject of the molecules are CTLA4 mutant according to claim 9 and ligand reactive against IL4.

47. The method of suppressing graft versus host", which consists in the introduction of the subject of the molecules are CTLA4 mutant on 17 and ligand reactive against IL4.

48. The DNA sequence encoding a mutant CTLA4 sequence contained in the vector deposited as ATSS no MOUTH-2104.

49. Molecule CTLA4 mutant containing the amino acid sequence depicted in figure 7, which begins with methionine at position +1 and ending with lysine at position +357 or begins with alanine at position -1 and ending with lysine at position +357.

50. Molecule nucleic key is lots coding molecule CTLA4 mutant according to § 49.

51. Molecule CTLA4 mutant according to claims 1, 9, 17 or 49, which is soluble.

52. Nucleotide molecule containing a fragment of the nucleotide molecule that encodes a mutant CTLA4 molecule and contained in the vector deposited in ATSS no MOUTH-2104, and a fragment of a molecule encodes the entire extracellular region mutant CTLA4 molecule that binds to CD80 and/or CD86.

53. Nucleotide molecule according to paragraph 52, characterized in that it further comprises a nucleotide sequence that encodes the Ig-part.

54. The way the regulation of the interaction of T cells with CD80 and/or CD86-positive cells, which consists in contacting CD80 and/or CD86-positive cells with a molecule soluble CTLA4 mutant according to § 49 in conditions ensuring formation of complex CTLA4/CD80 or complex CTLA4/CD86, and complex prevents interaction between T-cell and CD80 and/or CD86-positive cell.

55. The method according to item 54, wherein the CD80 and/or CD86-positive cell in contact with a fragment or derivative molecules CTLA4 mutant.

56. The method according to item 54, wherein the CD80 and/or CD86-positive cell is an antigen-presenting cell.

57. The method according to item 54, wherein the interaction of CTLA4-positive T cells with CD80 and/or CD86-positive cells inhibited.

58. Sposobleny diseases of the immune system, mediated interaction of T-cells and/or CD86-positive cells, which consists in the introduction of the subject of the molecules are CTLA4 mutant according to § 49 to regulate T-cell interaction with CD80 and/or CD86-positive cells.

59. The method of suppressing the reaction of "graft versus host", which consists in the introduction of the subject of the molecules are CTLA4 mutant in § 49 and ligand reactive against IL4.

60. Pharmaceutical composition for treating diseases of the immune system, containing a pharmaceutically acceptable carrier and a molecule CTLA4 mutant according to claims 1, 9 or 17.

61. Molecule CTLA4 mutant, which binds to CD80 and/or CD86, containing the extracellular region, the amino acid sequence of which is shown in Fig.9, beginning with alanine at position -1 or with methionine at position +1 and ending with aspartic acid at position +124, or part thereof, that binds to CD80 and/or CD86, and in which the alanine at position +29 in the extracellular region or its parts replaced by Teresina, leucine at position 104 is replaced by glutamic acid, and optionally containing an amino acid sequence which alters the solubility, affinity or valence molecules CTLA4 mutant.

62. Molecule CTLA4 mutant on p, wherein the amino acid sequence further comprises a constant region of a human who ski immunoglobulin or portion thereof, while constant region can contain one or more mutations to attenuate effector functions.

63. Molecule CTLA4 mutant containing

(a) amino acid sequence shown in Fig.7, beginning with methionine at position +1 and ending with aspartic acid at position +124, or part thereof, that binds to CD80 and/or CD86, or

b) the amino acid sequence shown in Fig.7, beginning with alanine at position -1 and ending with aspartic acid at position +124, or part thereof, that binds to CD80 and/or CD86, and

optionally containing amino acid sequence which alters the solubility, affinity or valence molecules CTLA4 mutant.

64. Molecule CTLA4 on p, wherein the amino acid sequence further comprises a constant region of human immunoglobulin or portion thereof, while the constant region may contain one or more mutations to attenuate effector functions.

65. The CTLA4 molecule according to any one of p-64, which is soluble.

Priority items:

26.05.2000 according to claims 1 to 24, 26-47, 49-51, 54-65;

26.06.2000 on PP, 48, 52, 53.



 

Same patents:

FIELD: biotechnology, in particular medical and biological industry.

SUBSTANCE: invention relates to new polypeptides namely precursors of insulin or analogs thereof, whish are characterized by increased structure stability and high expression levels during production thereof in recombinant forms in yeast cells. Polypeptides of present invention unlike natural form of insulin precursors contain shortened C-peptide including aromatic amino acid group and have general formula B (1-27)-X2-X3-X1-Y-A (1-21), wherein X1 is peptide sequence of 1-3 amino acid rests, wherein aromatic acid rest is in close vicinity with Y; X2 represents Pro or Asp; X1 represents Lys, Y-Lys, or Arg; A (1-21) is A-chain of human insulin; B(1-27) is the first 27 amino acid rests of human insulin D-chain rests.

EFFECT: method for production of new insulin precursors by recombinant DNA technology followed by conversion thereof in active hormone.

9 cl, 10 dwg, 6 tbl, 5 ex

FIELD: biotechnology and virology.

SUBSTANCE: strain of hybrid culturing Rattus norvegicus 122H9 cells is disclosed. Said strain is obtained by fusion of rat myeloma cells 210RC.Y3-Ag1.2.3 with rat spleen cells LOU, immunized with purified ectromelia virus of K-1 strain. Said strain is producer of cross-reactive neutralizing monoclonal antibodies against pathogenic for human orthopoxviruses.

EFFECT: vaccines for prophylaxis and therapy of diseases associated with pathogenic for human orthopoxviruses.

2 tbl, 5 ex

FIELD: biotechnology.

SUBSTANCE: dipeptide is produced from L-amino acid ester and L-amino acid using protein with dipeptide production enzyme activity. Said protein is obtained by culturing of transformed bacterial cell.

EFFECT: simplified method for dipeptide production of decreased cost.

11 cl, 1 dwg, 4 tbl, 14 ex

Lantibiotic // 2279481

FIELD: biotechnology, in particular antibacterial protein salivaricine B belonging to lantibiotics.

SUBSTANCE: antibacterial protein is expressed by strain Streptococcus salivarius K12 (DSM N 13084), has molecular weight of about 2733 Da, contains N-terminal amino acid sequence (AS) representing in SEQ ID NO:1, as defined in description, or AS representing in SEQ ID NO:3, and has bactericide activity against S. pyogenes. Both protein and microorganism producing thereof are useful as active ingredients in antibacterial and antibacterial therapeutic compositions, wherein the latter one may additionally contain salivaricine A2 (AS SEQ ID NO:5, as defined in description). Also invention relates to polynucleotide, encoding protein (salivarius B) optionally including nucleotide sequence (NS) (NS SEQ ID NO:2), as defined in description). Polynucleotide optionally includes DNA sequence encoding antibacterial protein, representing genome part of strain K12 (DSM 13084). Strain S. salivarius K12 (DSM N 13084) and S. salivarius K30 (DSM N 13085) being producers of protein salivaricine B also are described.

EFFECT: new protein having both antibacterial and bactericide activity.

29 cl, 3 dwg, 1 tbl

FIELD: chemistry of peptides, microbiology, biotechnology.

SUBSTANCE: L-alanyl-L-glutamine is prepared by incubation of a mixture containing a microorganism able to produce L-alanyl-L-glutamine from L-alanine ester and L-glutamine, L-alanine ester and L-glutamine, and isolation of the end product. Using the invention allows simplifying the process for preparing L-alanyl-L-glutamine. Invention can be used in pharmacy and food processing industry.

EFFECT: improved preparing method of dipeptide.

3 cl, 3 tbl, 1 ex

FIELD: chemistry of peptides, microbiology, biotechnology.

SUBSTANCE: L-alanyl-L-glutamine is prepared by incubation of a mixture containing a microorganism able to produce L-alanyl-L-glutamine from L-alanine ester and L-glutamine, L-alanine ester and L-glutamine, and isolation of the end product. Using the invention allows simplifying the process for preparing L-alanyl-L-glutamine. Invention can be used in pharmacy and food processing industry.

EFFECT: improved preparing method of dipeptide.

3 cl, 3 tbl, 1 ex

FIELD: biotechnology, medicine.

SUBSTANCE: the present innovation deals with CFP10-ESAT6 hybrid protein that is able to induce Mycobacterium tuberculosis-specific hypersensitivity reaction of delayed type. This hybrid protein contains complete protein CFP10 out of M.tuberculosis combined with complete protein ESAT6 out of M.tuberculosis through linker amino acid sequence. It is, also, [presented a recombinant plasmid DNA pTBD16 for expression of hybrid protein CFP10-ESAT6. The latter should be obtained due to applying DLT1270 E.coli strain transformed with the obtained recombinant plasmid DNA pTBD16. The innovation suggests to apply the above-mentioned protein as a diagnostic kit of tuberculous infection both in mammalians and human beings. The method for predicting tuberculous infection has been revealed. Tuberculous infection should be predicted due to induction of hypersensitivity reaction of delayed type in case of subcutaneous injection of hybrid protein. Application of the present innovation enables to obtain a Mycabacterium tuberculosis-referring diagnostic kit, at specificity being 100%, sensitivity - 80%, not less.

EFFECT: higher accuracy and efficiency of diagnostics.

6 cl, 4 dwg, 4 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to a method for preparing foodstuff containing hypotensive peptides and it using as an anti-hypertensive agent that can be used as a foodstuff. Method involves stages for fermentation of casein-containing fermenting material with lactobacillus microorganism, nanofiltration of the prepared peptide-containing fermentation product and isolation of the product. Prepared product is used as an anti-hypertensive agent and as a foodstuff also. Invention provides preparing a foodstuff with the high content of hypotensive peptides enriched by bivalent ions.

EFFECT: improved preparing method of foodstuff.

22 cl, 1 dwg, 4 ex

FIELD: molecular biology, genetic engineering, polypeptides, medicine.

SUBSTANCE: in using the double-hybrid yeast system DNA sequences encoding polypeptides (55.1 and 55.3) have been found that elicit ability for binding with intracellular domain p-55 (p-55IC) of TNF-receptor. It has been established that these polypeptides represent fragments of amino acid sequences p-55IC, respectively, from 338 to 426 and from 277 to 426 residues. As result of insertion of DNA fragments with a sequence encoding polypeptide 55.1 or 55.3 into the structure of expressing vector and transformation suitable host-cells by this vector recombinant form of indicated polypeptides have been prepared. Using this invention provides the possibility for modulating the function of intact p-55 of TNF-receptor. Invention can be used in medicine in treatment of diseases associated with transfer of TNF-signal.

EFFECT: improved preparing method and valuable properties of polypeptide.

9 cl, 17 dwg, 3 tbl, 6 ex

FIELD: biotechnology, biochemistry.

SUBSTANCE: invention represents enzyme glycosyl hydrolase (variants) produced by hyphamycetes, in particular, by Chrysosporium lucknowense and nucleic acid construction for expression of glycosyl hydrolase also. Invention provides preparing glycosyl hydrolase by culturing fungus Chrysosporium under optimal conditions providing expression and isolation of enzyme with high degree of effectiveness.

EFFECT: valuable biological and biochemical properties of sequences.

19 cl, 2 dwg, 4 tbl, 1 ex

FIELD: biotechnology and gene engineering.

SUBSTANCE: invention relates to recombinant plasmide encoding hybrid GST-ESAT-6 polypeptide having activities of species-specific mycobacterial ESAT-6 antigen. Plasmide has molecular mass of 3.45 MD and size of 5315 n.p. Recombinant E.coli polypeptide containing such plasmide and recombinant GST-ESAT-6 polypeptide also are disclosed. Recombinant protein has activities of species-specific antigen protein Mycobacterium tuberculosis ESAT-6. Method of present invention makes in possible to simplify purification process of recombinant polypeptide and to produce protein of high purity hawing activities of mycobacterial ESAT-6 antigen without degradation thereof.

EFFECT: earlier species-specific diagnosis of tuberculosis infection.

3 cl, 3 dwg, 4 tbl, 5 ex

FIELD: biotechnology.

SUBSTANCE: method for production L-histidine includes culturing of Escherichia genus bacteria, containing DNA fragment encoding of mutant bacterial phosphoribozyl pyrophosphate synthetase (FRPP-synthetase), and collection of produced and accumulated L-histidine from cultural liquid, wherein in mutant FRPP-synthetase L-amino acid residue, corresponding to 115-position of amino acid sequence in natural FRPP-synthetase from Escherichia coli is replaced by serine residue.

EFFECT: high effective method for production of L-histidine.

11 cl, 1 tbl, 2 ex

FIELD: biotechnology, genetic engineering, amino acids.

SUBSTANCE: invention relates to a method for preparing L-methionine by culturing the microorganism strain transformed with plasmid comprising gene yjeH or gene with homology with its by above 30% and used as a producer of L-methionine. Prepared L-methionine is isolated from medium. The claimed invention provides preparing L-methionine with high degree of effectiveness.

EFFECT: improved preparing method.

11 cl, 1 tbl, 6 ex

FIELD: genetic engineering, virology, medicine.

SUBSTANCE: invention relates to method for production of modified Vaccinia virus Ankara (MVA). Claimed method includes contamination of mammalian continuous cell line with Vaccinia virus Ankara (MVA) of wild type, followed by viruses cultivation and collection. Further fresh cells of the same cell line are infected with newly formed viruses. Abovementioned steps optionally are repeated. Also disclosed are strains of modified Vaccinia virus Ankara (MVA) and utilization thereof. Said strains are capable to growth in continuous cell lines.

EFFECT: strains having decreased virulence in relates to mammalians.

20 cl, 5 tbl

FIELD: biotechnology.

SUBSTANCE: invention relates to method for stable cell transduction of hematopoesis system or hematopoesis stem cells. Claimed method includes simultaneous cell in vivo or in vitro contact with lentivirus vector and molecule bonding to cell surface. Method of present invention allows stable transduction more 75 % of cells over 14 days. Method for introduction of gene material into cell also is disclosed.

EFFECT: new method useful in medicine, virology, and gene engineering.

40 cl, 28 dwg, 9 ex

FIELD: molecular biology.

SUBSTANCE: invention relates to isolated DNA fragment encoding horse GM-CSF, and isolated horse GM-CSF protein. Also disclosed are vectors and various compositions containing thereof. GM-CSF is useful as adjuvant for horse vaccination as well as non-specific immunity stimulator in veterinary.

EFFECT: new compositions for gorse vaccination.

18 cl, 2 dwg, 1 tbl, 7 ex

FIELD: biotechnology, medicine.

SUBSTANCE: the present innovation deals with CFP10-ESAT6 hybrid protein that is able to induce Mycobacterium tuberculosis-specific hypersensitivity reaction of delayed type. This hybrid protein contains complete protein CFP10 out of M.tuberculosis combined with complete protein ESAT6 out of M.tuberculosis through linker amino acid sequence. It is, also, [presented a recombinant plasmid DNA pTBD16 for expression of hybrid protein CFP10-ESAT6. The latter should be obtained due to applying DLT1270 E.coli strain transformed with the obtained recombinant plasmid DNA pTBD16. The innovation suggests to apply the above-mentioned protein as a diagnostic kit of tuberculous infection both in mammalians and human beings. The method for predicting tuberculous infection has been revealed. Tuberculous infection should be predicted due to induction of hypersensitivity reaction of delayed type in case of subcutaneous injection of hybrid protein. Application of the present innovation enables to obtain a Mycabacterium tuberculosis-referring diagnostic kit, at specificity being 100%, sensitivity - 80%, not less.

EFFECT: higher accuracy and efficiency of diagnostics.

6 cl, 4 dwg, 4 ex

FIELD: biotechnology, biochemistry, amino acids.

SUBSTANCE: L-glutamic acid is produced in culturing corynebacterium possessing ability to produce L-glutamic acid. This microorganism shows reduced ability for synthesis of trehalose or its absence as result of destruction of gene encoding trehalose-6-phosphate synthase, or gene encoding maltooligolysyltrehalose synthase, or by addition of mutations in these genes. Invention provides preparing L-glutamic acid with high degree of effectiveness.

EFFECT: improved method and enhanced effectiveness for preparing amino acid.

6 cl, 1 tbl, 3 ex

FIELD: immunology, biotechnology.

SUBSTANCE: invention describes antibody and its fragments neutralizing rabies virus and a method for treatment of patient subjected for effect of rabies virus by using indicated antibody and its fragment. Invention discloses variants of isolated nucleic acids encoding polypeptides carrying light and heavy chain of antibody, respectively. Also, invention describes expressing vector carrying at least one of indicated nucleic acids. Using this invention enhances span-life of patients after effect with rabies virus on them and can be used in corresponding prophylactic therapy of such patients.

EFFECT: valuable medicinal properties of antibody and nucleic acid.

14 cl, 1 dwg, 1 tbl, 2 ex

FIELD: genetic engineering, medicinal virology, medicine.

SUBSTANCE: invention proposes recombinant RNA molecules, methods for preparing recombinant eukaryotic cell, methods for preparing chimera RNA virus, vaccine preparations and immunogenic compositions. The recombinant matrix NDV-viral RNA with negative chain has been constructed that can be used in viral RNA-dependent RNA polymerase for expression of products of heterologous genes in corresponding host-cells. Proposed group of inventions can be used against pathogens and antigens of broad row.

EFFECT: valuable properties of expression systems.

145 cl, 11 dwg

FIELD: medicine, biotechnology.

SUBSTANCE: invention relates to antibodies specifically binding to new human extracellular matrix polypeptides called as RGI; immunoconjugate containing the same and method for selective cell degradation; method for treatment of prostates cancer and metastasis in patients suffering from prostates cancer.

EFFECT: new method for treatment of prostates cancer.

28 cl, 7 ex, 7 dwg

Up!