Dna, proteins, expressing vectors and immunogenic, vaccine, and stimulating compositions, containing horse gm-csf

FIELD: molecular biology.

SUBSTANCE: invention relates to isolated DNA fragment encoding horse GM-CSF, and isolated horse GM-CSF protein. Also disclosed are vectors and various compositions containing thereof. GM-CSF is useful as adjuvant for horse vaccination as well as non-specific immunity stimulator in veterinary.

EFFECT: new compositions for gorse vaccination.

18 cl, 2 dwg, 1 tbl, 7 ex

 

The technical field

The present invention relates to the field of molecular biology, in particular to the nucleotide sequence of the gene encoding the cytokine GM-CSF horses, to contain her expressing vectors, to its use as an adjuvant in vaccination of horses and as a non-specific stimulator of the immune system.

The invention

The first opening granulocyte-macrophage colony-stimulating factor (Granulocyte-Macrophage Colony-Stimulating Factor, or GM-CSF) dated 1977 (Burgess A.W., and others, J. Biol. Chem., 252, 1998-2003 (1977)). We are talking about GM-CSF mouse, isolated in pure form from the culture of supernatant the lungs of mice.

The biological activity of GM-CSF have been shown in research and GM-CSF mouse and humans (Clark, S.C., and others, 230, 1229 (1987); Grant S.M. and other, Drugs, 53, 516 (1992)).

GM-CSF is involved in various physiological processes (Dy M. in the book "Cytokines" Cavaillon, J. - M., 1996, ed. Masson, Paris, France, 43-56). In particular, GM-CSF stimulates the production, development and formation of colonies of granulocytes, macrophages, eosinophils and megakaryocytes. GM-CSF induces, in particular, makropoulou cytotoxicity, stimulates antibody-dependent cytotoxic activity (ADCC) and causes the recruitment of leukocytes at the level of areas of inflammation.

Currently identified GM-CSF various species of animals.

Nucleotide sequence codereuse the GM-CSF of various kinds, typically have a length of from 381 to 432 nucleotides. The homology between the nucleotide sequences of GM-CSF mouse and man is 69%. Homology of amino acid sequences is 54% (M.A. Cantrell and others, Proc/ Natl. Acad. Sci. USA, 82, 6250-6254 (1985)). However, despite the high homology, cross-physiological activity between GM-CSF human and mouse not detected (D. Metcalf and others, Blood, 67, 37-45 (1986)).

The introduction of heterologous GM-CSF, that is derived from other than the processed kind, it is not possible to achieve optimal adjuvant action, in particular the stimulation of the activity hemopoietic cells, and a significant strengthening of the immune response.

To date GM-CSF horse was not identified. However, this cytokine is of considerable interest for use in therapy and vaccination in the case of horses.

The aim of the invention was the selection and sequencing of the gene for GM-CSF horses. This gene was isolated by PCR with the use described in the examples of oligonucleotides.

The length of the gene GM-CSF horse is 432 nucleotide (sequence No. 8 and figure 1) and encodes a protein of 144 amino acids (sequence No. 9 and figure 1). Encoded by this gene protein has a homology of at least 75% amino acid sequence of GM-CSF other species.

Therefore, the object of nastoyascheevremya is a DNA fragment, encoding GM-CSF horses, for example, a fragment comprising the sequence No. 8. The object of the present invention is a DNA fragment comprising the sequence or essentially consisting of her.

The object of the present invention is a DNA fragment that encodes the amino acid sequence of No. 9.

The invention encompasses homologous to the nucleotide sequence of a horse or obtained synthetically, that is, a nucleotide sequence encoding a protein with functional activity and specificity, equivalently those of the horses. Of course, this includes nucleotide sequences that occur, taking into account the degeneracy of the genetic code. In particular, are equivalent DNA sequences having homology greater than or equal to 90%, preferably 92%, more preferably 95%, with an identified sequence No. 8.

The object of the present invention are DNA fragments that include the nucleotide sequence encoding GM-CSF horses, such as sequence No. 8, or a sequence encoding the amino acid sequence of No. 9, associated with a nucleotide sequence encoding at least one immunogen or at least one immunologically active fragment or men is our least one epitope of the immunogen. In this case, the DNA fragment does not contain a stop codon between the sequence encoding GM-CSF, and encoding the immunogen sequence. For example, in the case of sequence No. 8 built-in coding sequence ends with nucleotide 432 and does not include the stop codon.

The object of the present invention is also an isolated protein or fragment GM-CSF horses, for example, which is encoded by a nucleotide sequence No. 8 or homologous sequences, such as described above.

The object of the present invention is a protein GM-CSF horses, having amino acid sequence of No. 9.

Length GM-CSF horse is 144 amino acids. However, the present invention relates also to proteins and their fragments, of natural or synthetic origin, having a length of more, less or equal to 144 amino acids, and recombinant proteins (having one or more substitutions, deletions or insertions) and fused proteins, while their biological activity (General part with GM-CSF) is essentially equivalent to that of natural GM-CSF horse in vivo. As equivalent included amino acid sequence encoded by any of the homologous nucleotide sequences defined above.

The object of the present invention is the selection and PTS is stce protein GM-CSF horses.

The object of the present invention are also expressing vectors comprising one of the DNA fragments or one of the nucleotide sequences defined above, in particular gene GM-CSF horses (sequence No. 8) or its homologs, as indicated above, as well as any nucleotide sequence encoding any amino acid sequence, such as the above. Similarly, the vector can also include a nucleotide sequence encoding at least one immunogen, or at least one immunologically active fragment, or at least one epitope of the immunogen, which may not necessarily be associated by the merger, as described above.

The nucleotide sequence may be embedded in a classical expression systems in vitro, for example viral origin, such as baculovirus, propagated in insect cells, or prokaryotic cells (e.g. Escherichia coli) or eukaryotic origin, in particular yeast, preferably Saccharomyces cerevisiae, mammalian cells, preferably cells of the hamster (e.g., Cho cells and horses. The invention therefore also relates to expression systems, transformed sequence according to the invention, thus producing GM-CSF horses and their application is as an adjuvant in vaccination and non-specific stimulator of the immune system.

The sequence according to the invention preferably embedded in expressing vectors, ensuring expression in vivo functional GM-CSF horses and the expression of a nucleotide sequence encoding at least one immunogen, or at least one immunologically active fragment, or at least one epitope of the immunogen. Expressing the vector can be a plasmid vectors, viral vectors, such as poxviruses, such as vaccinia virus, pox viruses of birds (pox Canaries, chicken pox), including species-specific poxviruses (smallpox swine pox raccoons and camel pox), adenoviruses and herpes viruses, such as herpesvirus horses.

The term "plasmid" and realize any transcription unit DNA in the form of a polynucleotide sequence comprising the sequence of a gene GM-CSF horses and the elements necessary for its expression in vivo. Form the plasmid preferably circular, "superscreen" or not. In the scope of the present invention also includes a linear form.

Each plasmid comprises a promoter, capable of providing in the cell host gene expression. It is usually a strong eukaryotic promoter and, in particular, about the early promoter of cytomegalovirus CMV-IE human or mouse, or other species such as rat or SIDS, is the first pig. For the most part chosen by the promoter or viral or cellular origin. As a viral promoter, other than CMV-IE, you can specify early or late promoter of SV40 virus or the promoter region LTR of the rous sarcoma virus. It may also be the promoter of the virus, which is derived from a gene, for example, inherent in the gene promoter. As a cellular promoter, you can specify the promoter of the gene of the cytoskeleton, such as, for example, despinoy the promoter or actin promoter. When the same plasmid contains several genes, they can be in the same transcriptional unit, or in two different transcription units.

The plasmids may also include other elements in the regulation of transcription, such as, for example, introns, preferably intron II gene β-globin rabbit (van Ooyen and other Science, 206, 337-344 (1979)), the signal sequence of the protein encoded by the genome of the tissue plasminogen activator (tPA; Montgomery and others, Cell. Mol. Biol., 43B 285-292 (1997)), and the polyadenylation signal (poly), preferably the polyadenylation signal of the gene growth hormone bull (bGH) (application for a U.S. patent And is 5122458) or gene β-globin rabbit.

The invention relates to immunogenic compositions and vaccines comprising GM-CSF horses according to the invention and at least one immunogenic or vaccinology the drug is of Athena horses, acceptable in the veterinary field excipient or filler. The term "immunogenic preparation" here covers any medicine, is capable, in a single horse, to induce immune directed against the considered pathogen response, which is enhanced by the presence of the protein GM-CSF. It is preferably about vaccine preparation, is able to induce effective protection or some degree of protection against the pathogen, the degree of protection which increases in the presence of GM-CSF horses. Immunogenic and vaccine preparations provided according to the invention, encompass all known types, such as inactivated, attenuated live, subunit and recombinant vaccines (using expressively in vivo vector, preferably a viral or plasmid origin). As mentioned above, GM-CSF may be added to the immunogenic or vaccine preparation to obtain, in the presence of an acceptable veterinary excipient or filler, ready-to-eat immunogenic or vaccine composition. You can also provide a combination of GM-CSF with prolonged release system designed for gradual release protein.

According to a more preferred variant of the invention, however, preferably Express GM-CSF in vivo, use the Zuya expressing in vivo vector, such as described above. In this case it is preferred to immunogenic or vaccine formulation was also recombinant type, based on the use of expressing the vector in vivo, the same or different type. You might also consider using the same expressing in vivo vector comprising and expressing at least one immunogen pathogen of horses and GM-CSF horses.

The benefits of using GM-CSF when vaccination is especially the reduction of the dose of immunogen or vector or used DNA. Moreover, some animals do not respond to the introduction of routine vaccines, the use of GM-CSF stimulates the immune response and enhance it to the level of protection.

Therefore, the present invention preferably relates to immunogenic compositions and vaccines, including:

- expressing in vivo a vector containing a nucleotide sequence encoding a GM-CSF horses, under conditions that allow to place the expression in the horse's body functional protein GM-CSF;

at least one expressing in vivo a vector containing at least one nucleotide sequence encoding at least one immunogen of the horse, keeping in mind that vector, or some, or all of the vectors (when there are multiple vectors, the code is different immunogen) can also be a vector of GM-CSF (including at least one sequence of GM-CSF and immunogenic sequence); and

- filler or excipient acceptable in veterinary medicine.

According to a preferred variant of the invention, the invention relates to immunogenic compositions and vaccines based on DNA, including one plasmid encoding and expressing GM-CSF horses, according to the invention, and at least one other plasmid encoding and expressing the immunogen of the horse or its immunologically active fragment originating from the latter. Examples of the constructions of plasmids used according to the invention, which contain the immunogen horses presented in the International patent application WO-A-98/03198. The invention also relates to vaccines based on DNA comprising a plasmid encoding and expressing at the same time GM-CSF horses and at least one immunogen of the horse.

The invention relates to all pathogens of horses. In particular, one can call: herpesvirus horse type 1 or type 4 (preferably the invention relates to the combination of these two types); virus equine influenza virus, tetanus; Borrelia burgdorferi; encephalitis viruses horses Est, Quest, Venezuela; the rabies virus. For subunit vaccines and recombinant vaccines immunogenic preferably selected from the group consisting of glycoproteins gB, gC, gD herpesvirus horses type 1 or type 4, hemagglutinin (ON) and nucleoprotein (NP) of influenza virus horses, Nepal the capacity of a single fragment of tetanus toxin, protein OspA of Borrelia burgdorferi, E2 genes and viruses encephalitis horses Est, Quest, Venezuela; gene G of rabies virus.

Another object of the present invention are compositions that stimulate non-specific immunity, that is used as a General stimulator of immunity in horses. Such composition is administered as in the presence and in the absence of obvious pathology, usually regardless of any vaccine to enhance the immune protection of the horse. Such compositions include GM-CSF, according to the invention, in any of the above forms of protein or recombinant, preferably recombinant (expressed in vivo, viral or plasmid vector), and a filler or excipient acceptable in veterinary medicine. The characteristics of these vectors already described.

Nonspecific stimulating compositions and immunogenic compositions and vaccines according to the invention may also include one or more adjuvants, preferably selected among those commonly used for vaccination of horses against the considered or considered pathogens (valences). Stimulating compositions and immunogenic compositions and classical (inactivated, attenuated live, subunit) vaccines can also be included as classical adjuvant connection type carbomer, aluminum oxide, or can be prepared in the form of emulsions of oil-in-water. For stimulating compositions and immunogenic compositions and recombinant vaccines based on expressing viral vector preferably the emulsion oil-in-water.

According to one preferred variant of the invention for stimulating compositions plasmid type and immunogenic compositions and vaccines plasmid type plasmid encoding and expressing GM-CSF horses, and a plasmid encoding and expressing at least one immunogen horses, as well as mixtures of these plasmids can be mainly obtained in a fundamentally new way with a cationic lipid containing a salt of the Quaternary ammonium of the formula:

in which

R1means a linear, saturated or unsaturated aliphatic radical with 12 to 18 carbon atoms;

R2means another aliphatic radical with 2 or 3 carbon atoms; and

X represents a hydroxyl or amino group.

Preferably we are talking about DMRIE (N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecanoic)-1-propanamine; WO-A-9634109), preferably associated with a neutral lipid; DOPE (dioleoylphosphatidylcholine), for education preferably DMRIE-DOPE. The mixture of recombinant vector with this adjuvant is preferably prepared just before use and preferably before the introduction of the animal, the order for some time for the formation of the complex, for example, during the time from 10 to 60 minutes, preferably about 30 minutes.

When DOPE is present, the molar ratio of DMRIE: DOPE is preferably from 95:5 to 5:95, more preferably 1:1.

The mass ratio of plasmid: adjuvant DMRIE or DMRIE-DOPE is from 50:1 to 1:10, preferably from 10:1 to 1:5, more preferably from 1:1 to 1:2.

According to another preferred variant of the invention for stimulating compositions of recombinant type and immunogenic compositions and vaccines recombinant type (viral or plasmid vector) as an adjuvant can be used polymers of acrylic acid or methacrylic acid or copolymers of maleic anhydride and alkenylphenol derived. It is preferable to use polymers of acrylic or methacrylic acid, in particular sewn using a simple polyacetylenic ethers of sugars or polyalcohols. These connections are known as the "carbomer" (Pharmeuropa, vol. 8, No. 2, June 1996). The specialist may also refer the application to the U.S. patent And 2909462 (incorporated in the present description by reference), which describes acrylic polymers, crosslinked with polyhydroxyalkane compounds containing at least 3 hydroxyl groups, preferably not more than 8, the hydrogen atoms of at least three hydroxyl groups is replaced with unsaturated aliphatic radicals with at least 2 carbon atoms. Preferably radicals contain 2-4 carbon atoms, such as vinyl, allyl and other groups with ethylene bond. Unsaturated radicals can contain other substituents, such as methyl. Particularly applicable are the products sold under the name Carbopol® (BF Goodrich, Ohio, USA). They are made using allilohreos or using allintitle. As an example Carbopol® R, R and R.

From copolymers of maleic anhydride and alkenylphenol derived preferable EAT® (Monsanto), which are linear or cross-linked copolymers of maleic anhydride and ethylene, for example, made using deviceloop ether. You can refer to J. Fields and others, Nature, 186, 778-780, June 1960 (incorporated in the present description by reference). In terms of their structure, the polymers of acrylic or methacrylic acid and EMA®formed preferably the major components of the following formula:

in which:

R1and R2identical or different, denote H or CH3;

x is 0 or 1, preferably x=1;

I mean 1 or 2;

moreover, (x+y)=2.

For EMA® x=0 and y=2. For carbonero (x+y)=1.

The dissociation of these polymers in water leads to the acid solution, which needs to be neutralized, preferably until the physiologically the ski pH values, to receive adjuvant solution, which will be included vaccine. The carboxyl group of the polymer, then, are partly in the form of COO-.

Preferably get the solution carbomer or EMA® in distilled water, preferably in the presence of sodium chloride, and the resulting solution has an acidic pH value. The solution carbomer diluted with NaCl solution, preferably physiological saline (9 g/l NaCl), in one or several stages, with simultaneous or subsequent neutralization (pH of 7.3 to 7.4), preferably with NaOH. The resulting solution with physiological pH value is used for mixing with the immunogenic or vaccine product, preferably stored in lyophilized, liquid or frozen form.

The concentration of polymer in the final vaccine composition is 0.01-2% weight/volume, more preferably 0.06 to 1% weight/volume, preferably 0.1 to 0.6% weight/volume.

Another object of the invention is a method of stimulating the immune system, and/or immunization and/or vaccination equine, according to which nepamatotiem, and in particular horses, introducing stimulating immunogenic and/or vaccine composition according to the invention. The introduction is preferably carried out parenterally, and in particular, intramuscularly, intradermally or subcutaneously. The composition of introducing the one or more times. In particular, in the case of vaccination, the introduction is carried out each time with the vaccine.

The amount of DNA used in stimulating compositions and immunogenic compositions and vaccines according to the invention, is from about 10 μg to about 2000 μg, and preferably from about 50 μg to about 1000 μg of this plasmid. The specialist has the necessary knowledge to accurately determine the effective dose of the DNA used for therapeutic or vaccination Protocol.

If you use vector, doses can range from 104up to 1010PFU (plaque-forming unit), preferably from 106up to 108FIGHT.

In the case of compositions containing GM-CSF, doses can range from 1 μg to 5 mg, preferably from 50 μg to 1 mg

The volume of the dose preferably can be from 0.5 ml to 5 ml, preferably 2-3 ml.

Sequence listing

Sequence No. 1: oligonucleotide JP705

Sequence No. 2: oligonucleotide JP706

Sequence No. 3: oligonucleotide JP729

Sequence No. 4: oligonucleotide JP730

Sequence No. 5: oligonucleotide JP731

Sequence No. 6: oligonucleotide JP734

Sequence No. 7: oligonucleotide JP735

Sequence No. 8: the sequence of the equine gene GM-CSF horses (figure 1)

The sequence is 9: sequence of the protein GM-CSF horses (figure 1)

List of figures

Figure 1: sequence of the gene and the protein GM-CSF horses.

Figure 2: restriction map of plasmid pJP097

All plasmids were constructed using standard molecular biology techniques (cloning, restriction, synthesis of single-stranded cDNA, PCR, elongation of the oligonucleotide with a DNA polymerase...), described in Sambrook J. and others (Molecular Cloning: A Laboratory Manual, second edition, Cold Spring Harbor Laboratory. Cold Spring Harbor, new York, 1989). All restrictive fragments, and the DNA fragments obtained by PCR were isolated and purified using a set of "Geneclean®" (BI0101 Inc. La Jolla, Canada).

Information confirming the possibility of carrying out the invention

The invention is further described with the aid of embodiments given as non-limiting to the scope of protection of the invention of examples and with reference to the figures.

Example 1

Obtaining total RNA lymphocytes horses, stimulated in vitro by mitogens

The blood of horses was collected in a test tube containing Ethylenediamine-tetraoxane acid (EDTA), by taking blood from the jugular vein. Mononuclear cells were collected by centrifugation in a Ficoll gradient, and then cultured in Petri dishes with a diameter of 60 mm Mononuclear cells horses then stimulated either with the help of concanavalin A (ConA) (final concentration of approximately 5 μg/ml), is for use phytohemagglutinin (NSS) (final concentration of about 10 μg/ml). After stimulation, the lymphoblasts "ConA" and "RNA" scraped from the culture plates, the total RNA was extracted using a set of "selection of mRNA of cells" (Boehringer Mannheim / Roche Cat # 1934325).

Example 2

The selection of the gene encoding GM-CSF horses

Were synthesized oligonucleotides JP075 and JP076 having the following structure:

JP705 (20 NT) (sequence No. 1)

5' TGGGCACTGTGGYCTGCAGC 3'

JP706 (17 NT) (sequence No. 2)

5' AGCATGTGRATGCCATC 3'.

The oligonucleotides used in the set of 5' / 3' RACE (Boehringer Mannheim / Roche Cat # 1734792) and got the clones 3'RACE 6S4, 6W6 and 6W7. the 3'sequence, based on these structures clones, was used for the synthesis of oligonucleotides JP729, JP730 and JP731 to obtain the corresponding clones 5'RACE:

JP729 (21 NT) (sequence No. 3)

5' AGCTCCCAGGGCTAGCTCCTA 3'

JP730 (21 NT) (sequence No. 4)

5' CCCTGTTTGTACAGCTTCAGG 3'

JP731 (21 NT) (sequence No. 5)

5' TGTTGTTCAGAAGGCTCAGGG 3'.

Received 5'RACE clones 7D2 and 7D10. The General sequence synthesized on the basis of the 3'RACE and 5'RACE, clones were used for amplification of the gene sequence of GM-CSF horses PCR with reverse transcriptase. As a matrix for the synthesis of the first complementary DNA strands used total RNA extracted from the cells horses, ConA stimulated or RNA (example 1). First strand complementary DNA sex the Ali by elongation of the oligonucleotide p(dT)15 (Boehringer Mannheim /Roche Cat # 814270). The obtained single-stranded complementary DNA was then used as template for PCR with the following oligonucleotides:

JP734 (44 NT) (sequence No. 6)

5' CATCATCATGTCGACGCCACCATGTGGCTGCAGAACCTGCTTCT 3' and

JP735 (41 NT) (sequence No. 7)

5' CATCATCATGCGGCCGCTACTTCTGGGCTGCTGGCTTCCAG 3'

to amplify a fragment of approximately 500 base pairs. This fragment was purified by agarose gel electrophoresis (= fragment A).

Example 3

Obtaining plasmids pJP097 and sequence of the gene GM-CSF horses

Fragment A (example 2) was restrictively NotI and SalI and the fragment NotI-SalI ligated with the plasmid pVR1012 (Hartikka J. and others, Human Gene Therapy, 7, 1205-1217 (1996)), pre restrictional NotI and SalI, the result of which was obtained plasmid pJP097 (5334 base pair figure 2). Fragment NotI - SalI, and cloned into this plasmid was completely sequenced. This sequence (sequence No. 8) encodes a protein of 144 amino acids (sequence No. 9), representing the cytokine GM-CSF horses (figure 1).

Example 4

Biological activity in vitro of the product encoded by the genome of GM-CSF horses

Cells Cho-K1 cells hamster ovary obtained from the library of American cell culture collection under the number CCL-61) were cultured in minimal medium MEM (Gibco-BRL), in Petri dishes 60 mm in diameter and was transfusional 5 µg plasmid pJP097 in the form of pre-floor is i.i.d. complex with 10 μl LipofectAmine PLUS® (Cat # 10964-013, Gibco-BRL, Cleveland, Ohio, USA). The formation of complexes of DNA/LipofectAmine®and the transfection of cells was performed according to the manufacturer's recommendations (Gibco-BRL). After 48 hours after transfection supernatant cultures were collected and froze.

The bone marrow cells of pigs were cultured in semi-solid medium Methocult (Cat # H4230 StremCell Technologies). These cultures were then added (or not added in the case of negative control), 10 μl of the supernatant of cells transfected with plasmid pJP097, culture, cells were independently transfusional plasmids pJP097 T1 and pJP097 T2. Each supernatant (10 ál, diluted ten-fold) were tested in parallel in 3 culture cups. The negative control consisted of a supernatant of the culture SNO. After cultivation for 14 days Cup investigated on the formation of colonies of macrophages and counted the number of formed colonies.

For supernatant cells SNO, transfected with the plasmid pJP097, the results were as follows:

Plasmid / dilution of the supernatantCupsThe average number of colonies in a CupThe standard deviation
control300
pJP097 T1312 2
(GM-CSF horses)
pJP097 T23150
(GM-CSF horses)

The results show that the product encoded by the genome of GM-CSF horses, cloned in the plasmid pJP097, has the activity of GM-CSF-type cells in vitro.

Example 5

Obtaining plasmids according to the invention

To obtain plasmids intended for vaccination of horses, you can use any method to obtain purified plasmids.

Such methods are well known in the art. The plasmid was obtained by culturing bacteria Escherichia coli K12, transformed with plasmids according to the invention. It is most preferable to use the method of alkaline lysis with two consecutive ultracentrifugation in the density gradient of cesium chloride in the presence of ethidiumbromid as described in Sambrook J. and others (Molecular Cloning: A Laboratory Manual, second edition. Cold Spring Harbor Laboratory. Cold Spring Harbor, new York, 1989). You can also refer to the International application WO-A-95/21250 and WO-A-96/02658, which describes methods of production in industrial scale plasmid used for vaccination. To obtain vaccines, plasmid was prepared in the form of highly concentrated Rast the Directors (> 2 mg/ml), for easy storage. For this purpose, the plasmid was dissolved in either ultrapure water or in buffer TE (10 mm Tris-HCl, 1 mm EDTA; pH 8.0).

Example 6

Preparation of a vaccine according to the invention and introduction

Plasmid pJP097 bred in THE buffer, saline or PBS and mixed with various vaccine plasmids expressing protective immunogen. As such plasmids can be used, for example, indicated in the examples of PCT International application WO-98/03198.

Horses were vaccinated with 100 μg, 250 μg or 500 μg on a plasmid.

Various mixtures "immunogenic" plasmids and plasmids pJP097 GM-CSF horses together were injected intramuscularly (syringe + needle) in the muscles of the neck or chest. The amount of vaccine doses was 2 ml.

For intramuscular injection is also possible to use liquid jet needleless injector, through which you can enter the dose volume of approximately 0.5 ml If necessary, the same animal can be done several consecutive injections of 0.5 ml of Serial injections are conducted by moving to areas injections were separated from each other by about 1-2 cm

Intradermal injections can also be carried out using a liquid jet needleless injector that allows you to get a dose of 0.2 ml in 5 different points (0.04 ml per point of introduction) (e.g. the measures the apparatus PIGJET®" Endoscoptic, Laon, France).

Horses usually Vaccinium by two injections of mixtures of plasmids according to the invention, carried out with an interval of 4-5 weeks.

Example 7

Preparation of a medicinal product on the basis of the plasmids according to the invention

The mixture is "immunogenic" plasmids and plasmids pJP097 bred in THE buffer, saline or PBS thus, to obtain a concentration of 1 mg/ml 0.75 mm solution of DMRIE-DOPE was prepared by dissolving freeze-dried DMRIE-DOPE in the required amount of sterile water.

DNA lipide complexes were obtained by mixing equal volumes of 0.75 mm solution DMRIE-DOPE and DNA solution with a concentration of 1 mg/ml of the DNA Solution was added slowly through a 26G needle on the inner wall of the tubes containing the solution of the cationic lipid in order to avoid the formation of foam. The resulting solution was slowly stirred. The result is a solution containing 0,375 mm DMRIE-DOPE, and 500 μg/ml DNA.

Preferably the DNA-lipid complexes (DNA / DMRIE-DOPE) receive at room temperature for 30 minutes before immunization of animals as described in example 6.

It should be clear that the invention described in the attached claims, is not limited to the individual variants of implementation indicated in the above description, but encompasses variations is you, which do not fall in the scope, no inventive step of the present invention.

1. The selected DNA fragment encoding GM-CSF horses, comprising the nucleotide sequence No. 8.

2. The selected DNA fragment encoding the protein of GM-CSP horses, having amino acid sequence of No. 9.

3. Isolated protein of GM-CSF horses, having amino acid sequence of No. 9.

4. Isolated protein having the activity of GM-CSF horses encoded by the DNA fragment of claim 2.

5. Isolated protein having the activity of GM-CSF horses encoded by the DNA fragment according to claim 1.

6. Expressing in vitro vector comprising a DNA fragment according to claim 1, providing the expression of the indicated DNA fragment in vitro.

7. Expressing in vivo a vector comprising a DNA fragment according to claim 1, providing the expression of functionally active GM-CSF horses in the horse's body.

8. The vector according to claim 7, which represents a plasmid vector.

9. The vector according to claim 7, representing the viral vector.

10. The vector according to claim 9, selected from the group consisting of poxviruses, adenoviruses and herpes viruses.

11. The vector of claim 10, which represents a poxvirus selected from the group consisting of vaccinia virus, pox Canaries, chicken pox, small pox swine pox raccoons who smallpox camels.

12. Immunogenic or vaccine composition for horses, including protein GM-CSF horses, immunogenic or vaccine formulation against pathogen of horses and excipient or filler acceptable in veterinary medicine.

13. Immunogenic or vaccine composition according to item 12, in which the immunogenic or vaccine formulation is chosen from the group consisting of inactivated, attenuated live, subunit and recombinant drug.

14. Immunogenic or vaccine composition for horses, comprising expressing in vivo the vector according to any one of claims 7-11, immunogenic or vaccine formulation against pathogen of horses and excipient or filler acceptable in veterinary medicine.

15. Immunogenic or vaccine composition according to 14, in which the immunogenic or vaccine formulation is chosen from the group consisting of inactivated, attenuated live, subunit and recombinant drug.

16. Immunogenic or vaccine composition comprising a plasmid expressing GM-CSF horses; plasmid expressing the immunogen pathogen of horses; a filler or excipient acceptable in veterinary medicine.

17. Nonspecific stimulating composition comprising the protein GM-CSF horses and excipient or filler acceptable in veterinary medicine.

18. Nonspecific stimulating composition comprising providing expressyou the in vivo vector according to any one of claims 7-11 and excipient or filler, acceptable in veterinary medicine.



 

Same patents:

FIELD: biotechnology, medicine.

SUBSTANCE: the present innovation deals with CFP10-ESAT6 hybrid protein that is able to induce Mycobacterium tuberculosis-specific hypersensitivity reaction of delayed type. This hybrid protein contains complete protein CFP10 out of M.tuberculosis combined with complete protein ESAT6 out of M.tuberculosis through linker amino acid sequence. It is, also, [presented a recombinant plasmid DNA pTBD16 for expression of hybrid protein CFP10-ESAT6. The latter should be obtained due to applying DLT1270 E.coli strain transformed with the obtained recombinant plasmid DNA pTBD16. The innovation suggests to apply the above-mentioned protein as a diagnostic kit of tuberculous infection both in mammalians and human beings. The method for predicting tuberculous infection has been revealed. Tuberculous infection should be predicted due to induction of hypersensitivity reaction of delayed type in case of subcutaneous injection of hybrid protein. Application of the present innovation enables to obtain a Mycabacterium tuberculosis-referring diagnostic kit, at specificity being 100%, sensitivity - 80%, not less.

EFFECT: higher accuracy and efficiency of diagnostics.

6 cl, 4 dwg, 4 ex

FIELD: biotechnology, biochemistry, amino acids.

SUBSTANCE: L-glutamic acid is produced in culturing corynebacterium possessing ability to produce L-glutamic acid. This microorganism shows reduced ability for synthesis of trehalose or its absence as result of destruction of gene encoding trehalose-6-phosphate synthase, or gene encoding maltooligolysyltrehalose synthase, or by addition of mutations in these genes. Invention provides preparing L-glutamic acid with high degree of effectiveness.

EFFECT: improved method and enhanced effectiveness for preparing amino acid.

6 cl, 1 tbl, 3 ex

FIELD: immunology, biotechnology.

SUBSTANCE: invention describes antibody and its fragments neutralizing rabies virus and a method for treatment of patient subjected for effect of rabies virus by using indicated antibody and its fragment. Invention discloses variants of isolated nucleic acids encoding polypeptides carrying light and heavy chain of antibody, respectively. Also, invention describes expressing vector carrying at least one of indicated nucleic acids. Using this invention enhances span-life of patients after effect with rabies virus on them and can be used in corresponding prophylactic therapy of such patients.

EFFECT: valuable medicinal properties of antibody and nucleic acid.

14 cl, 1 dwg, 1 tbl, 2 ex

FIELD: genetic engineering, medicinal virology, medicine.

SUBSTANCE: invention proposes recombinant RNA molecules, methods for preparing recombinant eukaryotic cell, methods for preparing chimera RNA virus, vaccine preparations and immunogenic compositions. The recombinant matrix NDV-viral RNA with negative chain has been constructed that can be used in viral RNA-dependent RNA polymerase for expression of products of heterologous genes in corresponding host-cells. Proposed group of inventions can be used against pathogens and antigens of broad row.

EFFECT: valuable properties of expression systems.

145 cl, 11 dwg

FIELD: biotechnology, veterinary science.

SUBSTANCE: invention proposes nucleic acid molecule GDF-9B of wild and mutated types, polypeptide encoding by these nucleic acids, vector, construction, ligand and methods for using such nucleic acids and polypeptides. Proposed group o invention provides carrying out the modulation of the ovary follicle growth via activity of homodimers of GDF-9B and heterodimers of GDF-9B/GDF-9 both in vivo and in vitro. Invention can be used in animal husbandry for aim of active and passive immunization against these polypeptides for the follicle growth change.

EFFECT: valuable properties of factors.

35 cl, 9 dwg, 4 tbl, 4 ex

FIELD: biotechnology, light industry.

SUBSTANCE: invention relates to protease variants obtained by substitution in subtilisin amino acid sequence from Bacillus amyloliquefaciens, Baccilus subtilus, Baccilus licheniformis, and Baccilus lentus of amino acid residues in 103, 236 and/or 245 sites and in one ore more other sites followed by selection of mutants having improved washing action. DNA fragments encoding said protease variants and expression vector also are disclosed.

EFFECT: detergent compositions with improved washing action.

24 cl, 7 dwg, 5 tbl, 3 ex

FIELD: genetic and cellular engineering, veterinary science and animal husbandry.

SUBSTANCE: invention proposes a capsule for implantation in animal representing a semi-penetrating membrane made of alginate-poly-L-lysine-alginate wherein rat myoblast cells are included (L6). These cells secrete porcine somatostatin owing to the expression cassette incorporated into cells consisting of a nucleotide sequence encoding the insulin secretory signal and a nucleotide sequence encoding active form of porcine somatostatin operatively associated with its. Invention provides the development of the safety and highly technological method for provides animal with necessary amount of the growth hormone involving intramuscular administration of one or more capsules in the pig neck region or ear base.

EFFECT: improved administration method, valuable properties of capsule.

4 cl, 13 dwg, 3 tbl, 3 ex

FIELD: biotechnology, biochemistry, genetic engineering.

SUBSTANCE: invention proposes a method for construction of genetically modified strains of microorganisms able to destroy steroids. These strains comprise multiple inactivated genes, for example, genes encoding enzymes steroid dehydrogenases implicated in destroying the steroid ring. The gene kstD1 is an example of such genes. Strains comprising the multiple amount of inactivated genes encoding enzymes destroying steroids provides the enhanced effectiveness with respect to accumulation of intermediate steroid compounds. The preferable product of steroid accumulation if 9α-hydroxy-4-androstene-3,17-dione.

EFFECT: improved method for construction of strain.

8 cl, 5 dwg, 7 ex

FIELD: biotechnology, immunology, molecular biology, medicine, pharmacy.

SUBSTANCE: invention describes the isolated human antibody or its antigen-binding fragment able to bind the human tumor necrosis factor (TNF-α). Amino acid sequence is given in the description. Invention discloses nucleic acid encoding heavy and light chain of isolated human antibody. Nucleotide sequences are given in the description. Invention describes recombinant vector expressing variable region of heavy and light chains of isolated human antibody, Chinese hamster ovary cells CHO dhfr- carrying vector. Invention discloses a method for synthesis of isolated human antibody. The isolated human antibody or its antigen-binding fragment can be used as an active component of pharmaceutical composition used in treatment of disturbances when activity of TNF-α is harmful. Using the invention allows neutralization of effect of TNF-α in case when its activity is harmful. Invention can be used in medicine.

EFFECT: valuable medicinal properties of antibody, improved method for synthesis.

17 cl, 11 dwg, 17 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method involves increasing receptor activity, that is activated with proliferating agent of peroxis, by introducing NADP+-dependent isocitrate dehydrogenase (IDPc), IDPc gene or NADPH, selecting antisense molecule inhibiting fat deposit or nitroglycerides and cholesterol production using IDPc gene, and treating metabolism disorder diseases like adiposity, hyperlipiemia or hepatic fat infiltration by introducing antisense molecule of IDPc gene or IDPc gene inhibitor like oxalomalic acid or methyl isocitric acid.

EFFECT: enhanced effectiveness of treatment; reduced NADP level in cells.

5 cl, 10 dwg

FIELD: biotechnology, microbiology, genetic engineering.

SUBSTANCE: invention describes construction of recombinant plasmid DNA pFGM17 encoding constitutive synthesis of polypeptide of human granulocytic-macrophagal colony-stimulating factor (GM-CSF) and consisting of Kpn I/Eco RI-fragment of plasmid pSPF1 DNA and artificial DNA sequence encoding signal peptide of the protein Caf1 from Yersinia pestis, and also Kpn I/Eco RI-fragment of intermediate plasmid pSK-GM comprising the synthetic human gene GM-CSF. Escherichia coli cells are transformed with plasmid DNA pFGM17 and strain E. coli BL21(DE3)/pFGM17 is prepared that is a producer of human polypeptide GM-CSF. Invention provides enhancing technological effectiveness and economy of process for preparing recombinant FM-CSF due to excluding the induction stage in biosynthesis process and in simultaneous increasing the yield of the end product by 2 times. Invention can be used for preparing human granulocytic-macrophagal colony-stimulating factor.

EFFECT: valuable properties of plasmid DNA and microorganism strain.

2 cl, 4 dwg, 4 ex

FIELD: genetic engineering, in particular production of human granulocyte colony-stimulating factor.

SUBSTANCE: Recombinant plasmid DNA pES3-7 with molecular weight of 3.63 MDa (5907 b.p.) is constructed. Said DNA consists DNA Ndel/Notl-fragment containing sequence of recombinant G-CSF artificial gene, β-lactamase gene; and plasmid pET22b(+) DNA Ndel/Notl-fragment containing promoter and terminator of T-RNA-polymerase transcription, amplifier of 17 phage 10 gene translation. Plasmid pES3-7 contains as genetic marker β-lactamase gene which determines resistance of E.coli cells transformed with plasmid pES3-7 to ampicillin, and unique restriction endonuclease recognition sites existing on the next distance to the right from Ndel-site: Xbal - 38 b.p.; Hpal - 1332 b.p.; Pstl - 4065 b.p.; Pvul - 4190 b.p.; Xhol - 5363 b.p. Obtained plasmid is used in transformation of Escherichia coli cells to produce strain E.coli BL21(DE3)/pES3-7 as subproducer of recombinant G-CSF. Method of present invention makes in possible to produce recombinant G-CSF with high yield (20-30 % based on total cell protein content).

EFFECT: simplified method for production of recombinant G-CSF with high yield.

2 cl, 2 dwg, 2 ex

The invention relates to biotechnology, in particular genetic engineering, and can be used to produce secreted modified colony-stimulating factor granulocyte person (hG-CSF)

The invention relates to biochemistry and biotechnology and can be used for isolation and purification of physiologically active recombinant granulocyte colony-stimulating factor human (RCG-CSF)

The invention relates to biotechnology and Microbiology and is a method of obtaining biomass of recombinant strains of E. coli containing plasmid DNA encoding the biosynthesis of cytokines with the properties of factors, tumor necrosisand(TNF-alpha and TNF-beta), granulocyte colony-stimulating factor (G-CSF) and granulocyte-macrophage colony-stimulating factor (GM-CSF) human and bearing as a selective marker gene bla (resistance to ampicillin)

The invention relates to biotechnology and can be used in the production of recombinant granulocyte-macrophage colony-stimulating factor (GM-CSF) in industrial scale

The invention relates to genetic engineering

The invention relates to biotechnology, in particular genetic engineering, and can be used to produce secreted modified colony-stimulating factor granulocyte person (hG-CSF)
Up!