Enhancement of immune response wherein fused protein antibody-cytokine is mediator by combined treatment with agents increasing immunocytokine absorption

FIELD: medicine, immunology, oncology.

SUBSTANCE: invention relates to development of a method and composition promoting to enhancing absorption of immunocytokines in tumors. Compositions are based on combination of cytokine with agent enhancing absorption of immunocytokine. Invention provides the enhanced effectiveness of therapy of tumors and metastasis in mammals.

EFFECT: improved and valuable medicinal method of treatment.

27 cl, 10 dwg, 11 ex

 

Related applications

This application provides the priority and uses the information disclosed in the application 60/215038, registered on June 29, 2000, from which the data entered here by reference.

The scope of the invention

The present invention relates to fused proteins with antibody-cytokine, a useful target for immunotherapy. In General, the invention relates to the use of agents that enhance the absorption immunocytokine, in combination therapy, aimed at strengthening the immune response, the mediator which is fused protein antibody-cytokine, against pre-selected targets, such as cells in the tumor. In particular, the invention relates to the appointment of the fused protein antibody-cytokine in combination with chemotherapeutic agents such as taxanes and/or alkylating agents, for the treatment of tumor cells and other cancer or diseased cells.

Rationale inventions

Effective treatment of diseases such as cancer, requires strengthening the immune reactions of one or more types of effector cells such as natural killer (NK), macrophages and T-lymphocytes. In animals and people with tumors of the immune system is unable to respond effectively to the growth of the tumor, mainly due to the fact that in the tumor involved specific mechanisms to suppress the immune R. the action. In many cases, potentially capable of destroying the tumor monocyte cells, i.e. macrophages, migrate to the site of tumor growth, but the tumor cells secrete factors such as prostaglandins, TGF-β and IL-10, which reduce their cytotoxic activity (see, for example, Sharma et al., 1999, J. IMMUNOL. 163:5020-5028). Similarly limfocitna cells, such as NK and T cells that migrate into tumors can be suppressed by factors that secretes the tumor, as well as interactions with receptors that are expressed on the surface of tumor cells and trigger apoptosis of immune cells (see, for example, Villunger et al., 1997, BLOOD 90: 12-20). These lymphocytes, which are immunosuppressive effects monocytic cells in the vicinity of the tumor, may further decrease the capacity for effective antitumor response.

Attempts to overcome the immunosuppressive effects of the tumor microenvironment include directional immunostimulation, such as the treatment of the fused protein antibody-cytokine, which has specific affinity to the tumor. Effective treatment on the basis of this approach was demonstrated in several models of metastatic tumors in mice, however, this treatment becomes less effective with increasing tumor size. This is probably due to the increase in larger masses of the tumor, the level of secretion of suppressive factors, as well as other reasons such as the increase of interstitial fluid pressure in tumors (Griffon-Etienne et al. 1999, CANCER RES. 59: 3776-3782), which prevents the penetration into the solid tumor therapeutic agents.

While for the treatment of most cancer patients are still designate one or more courses of chemotherapy, it is well known that cytotoxic cancer therapy poses a threat to the immune system. In the human body immune cells divide faster than the vast majority of other cell types, and any treatment that kills proliferating cells will also kill and immune cells. Therefore, all treatment options, including radiation, damaging DNA chemical inhibitors of DNA synthesis and inhibitors of microtubular function, destroy the immune system. Bone marrow transplantation as a complement to the cancer therapy is required because you need to restore due to anticancer drugs disorders of the immune system. Methotrexate and other anticancer drugs are often used as immunosuppressants. It is also clear that anticancer destination can specifically inhibit the function of cells So for Example, patients who were treated for Hodgkin's disease by irradiation of the whole body, art is adout from the constant loss of simple T cells (Watanabe et al., 1997, Blood 90: 3662).

Based on current knowledge, it becomes apparent that conventional treatments (chemotherapy and radiation) and local immunostimulation may not be useful combined approach to effective cancer therapy. Therefore, there is a need to develop ways to enhance the immune response, the mediator which is fused protein antibody-cytokine directed against pre-selected types of cells, such as tumor cells, and compositions that can be used for this purpose.

Brief description of the invention

It has been found that the appointment of the fused protein antibody-cytokine (immunocytokine) mammal with a tumor or tumor metastases can cause a stronger antitumor response when it is administered before, simultaneously or after treatment with an agent that increases the absorption immunocytokine, which increases or enhances therapeutic effect of the fused protein antibody-cytokine due to gain or increase its absorption by the tumor. It was found that the number of useful agents that enhance the absorption immunocytokine include alkylating chemotherapeutic agents and taxanes, such as paclitaxel. In particular, it was found that such combinations are useful as mediators of the immune destruction of the pre is selected types of cells, such as tumor cells virus-infected cells.

In one aspect of the embodiment of the invention provides a method of stimulating in mammals killing cells of the immune reaction against the pre-selected cell types. The method includes the appointment of a mammal (i) immunocytokine containing binding antibody website that can link the cells were pre-selected type, and cytokines, which can induce such an immune response against cells pre-selected type, and (ii) an agent that increases the absorption immunocytokine, in a quantity sufficient to enhance the immune response, similar to the immune response, which stimulates himself immunocytokine used independently.

In the preferred embodiment of the invention the cells of the pre-selected type can be cancer cells that are present, for example, in a solid tumor, more preferably a solid tumor larger (i.e. more than 100 mm3). Alternative cells pre-selected type can be cancer cells present in the form of small metastases.

In another preferred embodiment of the invention, the agent that increases the absorption immunocytokine, can be coadministered with immunocytokines. Alternative agent that increases the absorption immunocyto the ina, you can assign up to destination immunocytokine. Moreover, it is assumed that immunocytokine can be combined with many different agents that enhance the absorption immunocytokine. The alternative assumes that the agent that increases the absorption immunocytokine, can be combined with many different immunocytokines.

In another aspect the invention provides a composition for stimulating the mammalian killing cells of the immune reaction. This composition includes a combination of: (i) immunocytokine containing binding antibody website that can link the cells were pre-selected type, and cytokines, which can induce such an immune response against cells pre-selected type in a mammal, and (ii) an agent that increases the absorption immunocytokine, in a quantity sufficient to enhance killing of the cell reaction, which stimulates immunocytokine from a combination similar to the killing of cells reactions that immunocytokine encourages self-directed.

In the preferred embodiment of the invention binding antibody website immunocytokine preferably includes a high-molecular chain of the immunoglobulin or its fragment, antigen binding. Macromolecular chain immunoglobulin preferably includes, at the end and what kinogruppoy towards the end with carboxypropyl, the domain of the variable region (VH) of an antibody, capable of binding a preselected antigen, high-molecular domain of the constant region of immunoglobulin 1 (SN), high-molecular domain of the constant region of immunoglobulin 2 (CH2) and can also include high-molecular domain of the constant region of immunoglobulin 3 (CH3). In a more preferred embodiment of the invention immunocytokine is a fused protein comprising a high-molecular chain of the immunoglobulin or its fragment, antigen binding, merged with the cytokine polypeptide through communication. Therefore, the preferred fused protein antibody-cytokine includes, at the amino-end in the direction of the carboxy-end, (i) binding the antibody website, which contains a variable region of an antibody that can bind antigen cell surface pre-selected cell type, domain SN of immunoglobulin CH2 domain of the immunoglobulin (perhaps CH3 domain), and (ii) a cytokine. Methods of obtaining and application of such fused proteins are described in detail in the work of Gillies et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1428-1432; Gillies et al. (1998) J. Immunol. 160: 6195-6203, and US Patent No. 5650150.

The domains of the constant region of immunoglobulin (i.e. domains CN, CH2 and/or CH3) can be a domain of a constant region, which are usually associated with the domain variable regions found in the origin of antibodies. Alternative one or more domains of the constant region of the immunoglobulin can be derived from antibodies other than antibodies, which are used as the source domain of the variable region. In other words, the domain of the variable and constant regions of immunoglobulin can be derived from different antibodies, such as antibodies isolated from various species. See, for example, US Patent No. 4816567. Moreover, the variable regions of immunoglobulin can include sequence region (FR)derived from other species, such as humans, and sequence region that defines additionality (CDR), placed between the FR sequences extracted from a second, different type, such as a mouse. Methods of obtaining and application of such chimerical variable regions of the immunoglobulin disclosed, for example, in US patents No. 5225539 and 5585089.

Based on the antibody immunocytokine preferably include, in addition, low-molecular chain of the immunoglobulin, which is preferably covalently linked to the macromolecular chain of the immunoglobulin through, for example, disulfide bonds. Variable regions linked high-molecular and low-molecular chains of the immunoglobulin together define a unique and complete binding site for binding pre-selected antigen. In d the natives embodiments of the invention immunocytokine include two chimerical chain each of which contains at least part of the macromolecular chain of the immunoglobulin, merged with the cytokine. Two chimerical chain preferably linked together covalently, for example, one or more interchain disulfide bonds.

The invention thus provides fused proteins, in which the binding specificity of antigen and activity of the antibodies combined with high biological activity of the cytokine. Fused protein according to the present sobrinini can be used for selective delivery of the cytokine to the target cell in vivo, so that the cytokine can exert a localized biological activity in the vicinity of target cells. In the preferred embodiment of the invention the component antibodies fused protein specifically binds the antigen, which is on the surface or inside of the cancer cells, and the resulting fused protein exhibits localized anticancer activity. In an alternative preferred embodiment of the invention the component antibodies fused protein specifically binds to viral-infected cells, such as HIV-infected cells, and the resulting fused protein exhibits localized antiviral activity.

Among the cytokines that can be included in immunocytokine according to this invention, includes, e.g. the measures factors tumor necrosis, interleukins, colony-stimulating factors and lymphokines, as well as other currently known cytokines. A preferred group of factors tumor necrosis includes, for example, a factor of tissue necrosis α (TNFα). A preferred group includes interleukins, such as interleukin-2 (IL-2), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-7 (IL-7), interleukin-12 (IL-12), interleukin-15 (IL-15) and interleukin-18 (IL-18). Preferred colony-stimulating factors include, for example, granulocyte-macrophage-colony-stimulating factor (GM-CSF) and macrophage-colony stimulating factor (M-CSF). In a preferred group of lymphokines such as lymphotoxin (LT). Other useful cytokines include interferons, including IFN-α, IFN-β and IFN-γ, each of which exhibits immunological effects, as well as antiangiogenic action, which does not depend on their antiviral activities.

It was found that some types of chemotherapeutic agents are effective agents to increase the absorption of immunocytokine. In particular, the number of useful agents that enhance the absorption immunocytokine include taxanes and alkylating chemotherapeutic agents. Some taxanes are known in this area (see Bissery and Lavelle, 1997, in Cancer Therapeutics: Experimental and Clinical Agents, Chapter 8, B. Teicher, ed.). In before Occitania embodiment of the invention taxonom is Taxol, also known as paclitaxel. Other embodiments of the invention include synthetic Texan, docetaxel, which in some models of tumors and in some clinical indications were more effective than paclitaxel. Further embodiments of the invention include additional derivatives taxane, such as isolated from natural source material 10-deazetil Baccatin III, extracted from the needles of the European yew. One such example is the connection for oral administration IDN5109, which is also a poor substrate for P-glycoprotein and in General more active against tumors exhibiting high resistance to many drugs. In addition to its suitability for oral administration, this compound is tolerant at higher doses and is less neurotoxic side effects (Polizzi et al., 1999, Cancer Res. 59: 1036-1040).

In the invention are also preferred dosing courses and assignments for the purpose of immunocytokines in combination with agents that increase the absorption immunocytokine.

Description of the drawings:

figure 1 - schematic representation of the cytokine;

figure 2 - effect of paclitaxel and immunocytokine change of tumor volume, LLC/KSA over time;

figure 3 - the effect of multiple doses of p is clitical and immunocytokine change average tumor volume over time;

figure 4 - effect of paclitaxel and immunocytokine on the weight of the tumor on the results of the analysis of lung metastases;

figure 5 - effect of paclitaxel and immunocytokine to change the volume of the tumor CT26/KSA over time;

6 - effect of paclitaxel and immunocytokine on the weight of the tumor on the results of the analysis of liver metastases;

figa and 7B - effect of paclitaxel on the absorption immunocytokine in the tumor;

Fig - effect of cyclophosphamide on the absorption immunocytokine in the tumor;

figa - effect of cyclophosphamide and immunocytokine on the weight of the tumor on the results of the analysis of lung metastases;

figb - effect of cyclophosphamide and immunocytokine on tumor volume according to the results of the analysis of tumor growth;

figw: the effect of cyclophosphamide and immunocytokine on tumor volume according to the results of the analysis of tumor growth;

figure 10: influence carboplatin and immunocytokine on tumor volume according to the results of the analysis of tumor growth.

Detailed description of the invention

Studies show that solid tumors of large size are much more resistant to therapeutic intervention by antibodies and immunotherapy in General, the dispersed metastatic education (Sulitzeanu et al. (1993) Adv. Cancer Res. 60: 247-267). It is considered poor response to therapy based on antibodies, partially due to the fact, is that tumors produce immunosuppressive factors.

Although the mechanism of tumour destruction is not yet fully known, it is assumed that the response of cytotoxic T lymphocytes (CTL) can lead to the destruction of cancer cells and to provide immune memory. Moreover, it is assumed that, under certain circumstances, cells natural killer (NK) responsible for the destruction of the tumor in the absence of CTL. Various immune reactions may be due to the fact that some tumors produce different types and amounts of substances able to inhibit T cells. This is more true for solid tumors than for micrometastatic formations, i.e. for those that have reached critical mass and is able to generate and secrete immunosuppressive factors at levels sufficient to reduce the immune response against the tumor.

Now discovered that the immune reactions leading to the destruction of tumor cells, initiated by immunocytokines against pre-selected types of cells can be significantly strengthened through the appointment immunocytokine together with the agent, enhances the absorption immunocytokine. Combination therapy is especially effective in facilitating the immune destruction of the tissues of patients, such as an established tumor. Without attempting to create the connection with theory assumes that the agent that increases the absorption immunocytokine, valitsimet penetration immunocytokine in the microenvironment of the tumor, that allows him to overcome the immunosuppressive action and be more efficient in terms of activation of the cellular immune response against the tumor. Similarly, it is assumed that this method can be poleznim for the treatment of certain viral diseases, in which similar immunosuppressive mechanism prevents effective manifestation of cell-mediated immunity, for example, when HIV infection. It is assumed that the agent that increases the absorption immunocytokine, together with immunocytokines has a synergistic effect as a mediator of the immune destruction of the tissues of patients, such as established tumor or viral infected cells. The present invention also describes methods of making and applying useful immunocytokines and analysis, suitable for testing in preclinical animal models in vivo their pharmacokinetic activities when combined with suitable agents, which increase the absorption immunocytokine.

Used herein, the term "agent that increases the absorption immunocytokine" should be understood as any agent that enhances the immune response leading to the destruction of tumor cells, initiated by immunocytokines against pre-selected cell type. More specifically, the preferred agent that increases the POG is owenie immunocytokine, this agent, which increases the absorption of tumor immunocytokine and, thus, increases its penetration into the tumour. Examples of agents that increase the absorption immunocytokine include, but are not limited to, chemotherapeutic agents such as taxanes, agents that destroy DNA, including alkylating chemotherapeutic agents, agents, radiation therapy, and agents that reduce blood pressure. Preferred taxonomy are Taxol, docetaxel, 10-deazetil Baccatin III and their derivatives. Preferred alkylating agents are cyclophosphamide, carboplatin, cisplatin and derivatives thereof. The preferred form of radiation is gamma radiation. The preferred agent, lowers blood pressure, is an agonist of angiotensin II, such as angiotensin II, preferably assigned periodically in accordance with the General principles described in the works Netti et al. (Cancer Research [1995] 55: 5451-8) and Netti et al. (Proc. Nat. Acad. Sci. [1999] 96: 3137-3142). The immune response can be determined by known methods and/or method described here.

Used herein, the term "immune response leading to the destruction of tumor cells" should be understood as any immune response in mammals either humoral or cellular nature, which is stimulated by immunocytokines and which either kills,or otherwise reduces the viability of the pre-selected cell type in mammals. The immune response may include one or more types of cells, including T cells, NK cells and macrophages.

Used herein, the term "immunocytokine" means the merger (i) binding the antibody site having specificity for binding to the pre-selected antigen and its ability to bind, for example, specific antigen cell type, and (ii) cytokine that is able to initiate or stimulate an immune response leading to the destruction of tumor cells, usually against cancer or viral infected cells. Examples are pre-selected surface antigens of the cells such that are present on cancer cells or virus infected cells and insoluble intracellular antigens, for example, necrotic cells, which can be prisoedinennymi to the cell membrane. The preferred target antigens are antigens that are characteristic of tumor cells, such as specific for tumor antigens. Therefore, immunocytokine can be selectively deliver the cytokine to a target (which is usually the cell) in vivo in such a way that the cytokine may serve as a mediator localized immune response against the target cells. For example, if the component antibodies immunocytokine selectively binds an antigen on the cancer cell, such as cancers the I cell in solid tumors, in particular in most solid tumors, the size of which exceeds 100 mm, immunocytokine localized increases anticancer activity, if the component antibodies immunocytokine selectively binds an antigen on viral infected cell, such as a cell infected with HIV, immunocytokine localized increases antiviral activity.

Used herein, the term "site linking antibody" should be understood as at least part of the macromolecular chain of the immunoglobulin, such as the variable region of an antibody, capable of binding a pre-selected antigen type cell antigen. Website linking antibody, also preferably includes at least a portion of constant region of immunoglobulin, including, for example, CH1 domain, CH2 domain, and, perhaps, a CH3 domain, or at least the CH2 domain, or one or more parts thereof. Moreover, the macromolecular chain of the immunoglobulin may be linked either covalently or ecovalence of the molecular chain of the immunoglobulin, including, for example, the variable region of low molecular weight chain immunoglobulin and possibly permanent area of low molecular weight chains. Accordingly, it is assumed that the site linking the antibody can contain a whole antibody or a fragment or a single chain antibody capable of binding a preselected antigen.

Relatively immunocytokine it is assumed that the fragment of the antibody may be associated with cytokine many well-known ways. For example, the website linking antibody, preferably linked via a polypeptide bond or a linker with the cytokine in the structure of the fused protein. Alternative site that binds the antibody may be chemically coupled with cytokine via a reactive group, such as sulfhydryl groups, the side chains of amino acids present in the website linking antibody and cytokine.

Used herein, the term "cytokine" is to be understood as any protein or peptide, analog, or functional fragment, which is able to stimulate or initiate an immune response leading to the destruction of cells against pre-selected types of cells, such as cancer cells or virus infected cells in mammals. Therefore, it is assumed that immunocytokine according to this invention may include a variety of cytokines. In the group of useful cytokines include, for example, the factors of tumor necrosis (TNF), interleukins (IL), lymphokines (L), colony-stimulating factors (CSF), interferons (IFN), including options for species and their truncated counterparts, which are able to stimulate or initiate an immune response leading to the destruction of cells. Among the approach is General factors tumor necrosis includes, for example, TNFα. Among the suitable lymphokines include, for example, LT. In a number of suitable colony-stimulating factors include, for example, GM-CSF and M-CSF. In a number of suitable substances include, for example, IL-2, IL-4, IL-5, IL-7, IL-12, IL-15 and IL-18. In a number of suitable interferons include, for example, IFN-α, IFN-β and IFN-γ. The gene encoding the cytokine, which is of particular interest can be cloned de novo obtained from available sources or synthesized by standard DNA synthesis from the known nucleotide sequences. For example, the DNA sequence LT-known (see, for example, Nedwin et al. (1985) Nucleic acids res. 13: 6361), also known sequence for IL-2 (see, e.g., Taniguchi et al. (1983) NATURE 302: 305-318), GM-CSF (see, for example, Gasson et al. (1984) Science 266: 1339-1342) and TNF α (see, for example, Nedwin et al. (1985) NUCLEIC ACIDS RES. 13: 6361).

In the preferred embodiment of the invention immunocytokine represent a recombinant fused protein obtained through conventional recombinant DNA methodologies, i.e. by forming patterns of nucleic acid that encodes a chimerical immunocytokine. Construction of recombinant fused protein antibody-cytokine has been described in the prototype. See, for example, Gillies et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1428-1432; Gillies et al. (1998) J. Immunol. 160: 6195-6203, and US patent No. 5650150. Preferably, the gene construct encoding immunocytokine to nomu the invention, includes, in the direction from 5' to 3'DNA segment that encodes a domain variable regions of macromolecular chains of immunoglobulin, a DNA segment that encodes a domain of a constant region of a macromolecular chain of an antibody and DNA encoding the cytokine. Fused gene is mounted or inserted into the expression vector for transfection into an appropriate cell-recipient, in which the fused gene Express. Hybrid polypeptide chain preferably combined with low molecular weight chain immunoglobulin in such a manner that the variable region of macromolecular chains (VH) of an antibody and the variable region of low molecular weight chains (VL) immunoglobulin together formed a single, comprehensive site for binding pre-selected antigen. In the preferred embodiment of the invention high molecular weight and low molecular weight chain immunoglobulin covalently linked, for example, through interchain disulfide bonds. Moreover, the macromolecular chains of the two antibodies, one or both of which merged with the cytokine, can be covalently linked, for example, by one or more interchain disulfide bonds.

Therefore, the methods according to this invention is suitable for enhancing antitumor activity immunocytokine used in terapeuticamente treatment of tumors, including immunocytokine compositions and methods disclosed in WO 99/29732, WO 99/43713, WO 99/52562, WO 99/53958 and WO 01/10912, and based on the antibody fused protein with an altered amino acid sequence in the region of the binding. In one of the embodiments of the methods according to this invention are useful in combination with the merged Fc proteins such as Fc-interferon-α.

Figure 1 shows a schematic view of a typical immunocytokine 1. In this embodiment the cytokine molecules 2 and 4 peptide linked to carboxy-ends 6 and 8 CH3 regions 10 and 12 of the macromolecular chains of the antibody 14 and 16. Region 26 and 28 VLshown paired with regions 18 and 20 VHin a typical configuration IgG, which ensures the presence of two antigen binding sites 30 and 32 at the amino-end immunocytokine 1 and two linking the cytokine receptor sites 40 and 42 at the carboxy-end immunocytokine 1. Of course, in the broader aspects is not necessary to pair immunocytokine, as shown, or you want to merge with the molecule cytokine only one of the two macromolecular chains of the immunoglobulin.

Immunocytokine according to this invention can be regarded as chimerical because of two aspects of their structure. First, immunocytokine is chimerical that includes a high molecular chain of the immunoglobulin containing linking antigen specificity, tied to this cytokine. Secondly, immunocytokine according to this invention can be chimerical in the sense that it includes a variable region (V) of an antibody and a constant region (C) immunoglobulin, each of which is extracted from different antibodies, so that the resulting protein is a chimeric V/C. for Example, variable and constant region can be extracted from molecules naturally occurring antibodies that can be extracted from different species. See, for example, US patent 4816567. Also acceptable are structures in which either or both variable regions of immunoglobulin include sequence region framework (FR) and a sequence region that defines additionality (CDR)derived from different species. Such constructions are disclosed, for example, in the work of Jones et al. (1986) Nature 321: 522-525, Verhoyen et al. (1988) SCIENCE 239: 1534-1535, and in US patents No. 5225539 and 5585089. In addition, it is assumed that the sequence of variable regions can be obtained by skanirovaniya libraries, such as libraries of phages, for sequences of variable regions that bind the pre-selected antigen with desired degree of affinity. How to create and libraries of phages are disclosed, for example, in the works of Huse et al. (1989) Science 246: 1275-1281, and Kang et al. (1991) Proc. Natl. Acad. Sci. USA 88: 1120-11123.

The domains of the constant region of a macromolecular chain immunoglobulin immunocytokine can be selected from any of the five classes of immunoglobulin, which are quoted as IgA (Igα), IgD (Igδ), IgE (Igε), IgG (Igγ) and IgM (Igμ). However, the constant region of the high-molecular chain immunoglobulin of the IgG class are preferred. In addition, it is assumed that the macromolecular chains of the immunoglobulin can be extracted from any of the subclasses of IgG antibodies, which are known as IgG1, IgG2, IgG3 and IgG4. As you know, each constant region of a macromolecular chain immunoglobulin includes four or five domains. Domains are called in the following sequence: SN-hinge-CH2-CH3-(-CH4). CH4 is present in the IgM, which does not contain areas of the hinge. The DNA sequence of a domain of high molecular weight chains are overlapping homology among the classes of immunoglobulin, e.g., CH2 domain of IgG is homologous to the CH2 domain of the IgA and IgD and the CH3 domain of IgM and IgE. Low-molecular chains of the immunoglobulin may have a continuous chain or Kappa (κ)or lambda (λ). The sequence and location of the sequences of these regions of immunoglobulins are well known (see, for example, Kabat et al., "Sequences of Proteins Immunological Interest, "U.S. Department of Health and Human Services, third edition, 1983, fourth edition 187, and Huck et al. (1986) NUC. ACIDS RES. 14: 1779-1789).

In preferred embodiments of the present invention variable regions extracted from antibodies specific to the antigen surface pre-selected cells (antigen associated with diseased cells such as cancer cells or virus infected cell), and the constant region include domains CN and CH2 (and perhaps CH3) of antibodies, which is the same or different antibodies, which is the source of variable regions. In the practical implementation of the present invention is related to the antibody part immunocytokine is preferably non-immunogenic or weakly immunogenic in the planned recipient. Respectively, related to the antibody portion, to the maximum extent possible, preferably extracted from the same species as the intended recipient. For example, if immunocytokine is expected to appoint people to the domains of the constant region is preferably derived from a human source. See, for example, US patent No. 4816567. Moreover, if variable region of immunoglobulin extracted from species other than the intended recipient, for example, when the source sequences of the variable regions are the mouse and the intended recipient is a person, then the variable region preferably includes the sledovatelnot FR human and mouse sequences CDR, placed between sequences of FR, so to chimerical variable region, which has specificity for binding to the pre-selected antigen, but still minimizes the immune activity of the intended host. Design and synthesis of such chimerical variable regions described in Jones et al. (1986) Nature 321: 522-525, Verhoyen et al. (1988) SCIENCE 239: 1534-1535, and US patents No. 5225539 and 5585089. Cloning and expression fit for human fused protein antibody-cytokine, KS-1/4 anti-Arsam antibody-EL-12 fused protein, as well as its ability to destroy an established colony of metastatic carcinoma was described by Gillies et al. (1998) J. Immunol. 160: 6195-6203.

The gene encoding the cytokine, attached, either directly or through a linker, for example, through a linker (Gly4-Ser)3coding DNA in the frame, to the end 3' of the gene encoding the constant region of immunoglobulin (i.e., the exons CH2 or CH3). In certain embodiments of this invention, the linker can include the nucleotide sequence encoding the site of proteolytic cleavage. This website, if it is placed between the constant region of immunoglobulin and cytokine may be designed to provide proteolytic release of the cytokine at the site of the target. For example, it is well known that plasmin and three the Shin hatshepsuts after radical lysine and arginine on sigah, which are suitable for proteases. Many other specific to the site endoprotease and amino acid sequences, they otscheplaut, is well known. Preferred sites of proteolytic cleavage and proteolytic enzymes active with such cleavage sites are disclosed in US patents No. 5541087 and 5726044.

The structure of the nucleic acid optionally may include endogenous promoter and enhancer for the gene encoding the variable region to regulate the expression of a chimerical chain immunoglobulin. For example, the genes encoding the variable region can be obtained in the form of DNA fragments, including the leading peptide gene VJ (functionally rearranged variable region (V) segment joining (J)) for low-molecular chain, or VDJ gene for macromolecular chains and endogenous promoter and enhancer for these genes. Alternative gene that encodes a variable region, can be obtained without endogenous regulatory elements, and it can be used in the expression vector, which provides these elements.

The genes of the variable regions can be obtained by the usual method of cloning DNA from cells that produce the desired antibodies. Screening libraries of genes for specific functional peergroupadvertisement region can be produced by means of suitable DNA samples, such as segments of DNA containing the region J DNA sequence further apart in the sequence. Identification and confirmation of the correct clones obtained by sequencing of cloned genes and comparison of the sequence with the corresponding sequence of the full length, in fact, splashingeven mRNA.

Antigen-target may be a surface antigen of tumor cells, the surface of cancer cells, viral infected cells or other diseased cells. Antigen-target can also be insoluble intracellular antigen necrotic cells (see, for example, US patent No. 5019368). The genes encoding the appropriate variable regions can in General be obtained from the generating immunoglobulin colonies of lymphoid cells derived from a single common ancestor. For example, colonies of cells hybridomas generating immunoglobulin specific for the associated tumor antigens or viral antigens can be obtained by well-known standard method of hybridization of somatic cells (see, for example, US patent No. 4196265). These generating immunoglobulin colonies provide a source of gene variable regions in a functionally rearranged form. The genes of the variable regions are usually murine origin, since this murine system adapts the generation of a wide variety of antibodies of a desired specificity. In addition, sequences of variable regions can be obtained by screening libraries, such as libraries of phages, for sequences of variable regions that bind the pre-selected antigen with adjustable affinity. Methods for creating and screening samples libraries of phages described, for example, in the works of Huse et al. (1989) Science 246: 1275-1281, and Kang et al. (1991) Proc. Natl. Acad. Sci. USA 88: 11120-11123.

The DNA fragment that encodes a functionally active gene variable regions linked to a DNA fragment containing the gene encoding the desired constant region (or part thereof). The constant region of immunoglobulin (high and low molecular weight chain) can be obtained from the generating antibodies cells by conventional methods of gene cloning. Were cloned genes for two classes of low molecular weight chains man (κ and λ) and five classes of macromolecular chains man (α, δ, ε, γ and μ), and, thus, the constant region of human origin can be easily obtained from these clones.

Fused gene that encodes a hybrid macromolecular chain of the immunoglobulin, is mounted or inserted into an expression vector for introduction into a recipient cell. Introduction genetic structure in plasmid vectors can be performed according to conventional methods of splicing genes. Chimerica the kind of high-molecular chain immunoglobulin can co-Express in the same cage, with appropriate low molecular weight chain immunoglobulin, so full immunoglobulin can Express and be mounted simultaneously. To this end, the structure of high-molecular and low-molecular chains in the same or different vectors.

Colonies of cells-recipients are in General lymphoid cells. Preferred cell-recipient is myeloma (or hybridoma). Myeloma can synthesize, assemble and secrete immunoglobulins encoded transfectional genes, and they are able to glycosylate proteins. In a particularly preferred group of recipients or host cells include myeloma Sp2/0, which in the normal state does not generate endogenous immunoglobulin, and the mouse myeloma NS/0.

After transfection, the cell produces immunoglobulin encoded transfectional gene structure. Transfection myeloma can be grown in culture or in the peritoneum of a mouse, where the secreted immunocytokine can be derived from ascitic fluid. Other lymphoid cells, such as lymphocytes, can be used as cells of the recipient.

There are several ways transfection of lymphoid cells with vectors containing the structure of nucleic acids encoding chimerical chain immunoglobulin. For example, vectors in which the contain in lymphoid cells by merging spheroplasts (see, for example. Gillies et al. (1989) BIOTECHNOL. 7: 798-804). Other suitable methods include electroporation, or the deposition of calcium phosphate (see, for example, Sambrook et al. eds (1989) "Molecular Cloning: A Laboratory Manual" Cold Spring Harbor Press).

Other suitable methods of obtaining immunocytokines include preparation of RNA sequences, coding structure, and its translation into an appropriate expression system in vivo or in vitro. It is assumed that the methodology of recombinant DNA for the synthesis of genes encoding the fused protein antibody-cytokine, for introducing genes into cells-hosts for the expression of genes in the host and to collect the resulting fused protein, are well known and are described in detail in the literature. Specific protocols are described, for example, in Sambrook et al. eds (1989) "Molecular Cloning: A. Laboratory Manual" Cold Spring Harbor Press.

It is clear that chemically coupled immunocytokine can be obtained using a wide variety of well known techniques. For example, the antibody or antibody fragment can chemically associate with cytokine using chemically reactive side chains of the amino acids in the antibody or fragment of antibody and cytokine. The side chains of amino acids can be covalently linked, e.g., through a disulfide bond or by means of Homo - or heterobifunctional structure-forming reagents, including, for example, N-Succinimidyl 3(--pyridyldithio)propionate, m-maleimidomethyl-N-hydroxysuccinimidyl ether, m-maleimidomethyl-N-hydroxycarbonylmethyl ether and 1,4-di-[3'-(2'-pyridylthio)propionamido]butane, each of which can be purchased from the Pierce company, Rockford, IL.

According to the method of this invention the combination of immunocytokines with agents that enhance the absorption immunocytokine suitable for intensive stimulation of the immune system, and, thus, leads to cytotoxic response of cells of the target type, for example, tumor cells or other diseased cells. We should expect that the combination of immunocytokine and agent that increases the absorption immunocytokine, will not lead to joint or synergistic antitumor effect in vitro, because the individual immunocytokine is not cytotoxic.

Without regard to any specific theory, it is assumed that the effects of combination therapy in vivo may include increased absorption of one of the agents in the result of the actions of others, which leads to the manifestation of one of the two or both effects: (1) improving chemotherapeutic cytotoxicity (if immunocytokine increases the absorption of chemotherapeutic agent that increases the absorption immunocytokine in tumor cells) and/or (2) the strengthening of the immune (if the agent that increases the absorption immunocytokine, not the which way increases the absorption immunocytokine tumor). In terms of the mechanism (1), previous research has shown that you can improve the absorption of the antibody with a radioactive label (and presumably, small molecule drugs) tumor using pre-treatment with high doses immunoconjugate antibody-IL2, which initiates local vascular permeability (see, for example, Homick et al., 1999, CLIN CANCER RES. 5: 51-60). If this specific mechanism involved in the combination therapy immunocytokine and agents that enhance the absorption immunocytokine, it should be necessary to first treat the animal is a carrier of the tumors immunocytokines. However, if a single dose of an agent that increases the absorption immunocytokine, entered before treatment immunocytokines, leads to a synergistic effect in relation to antitumor activity, such a mechanism may not be involved. Rather, a more plausible explanation will be that the treatment agent that increases the absorption immunocytokine, increases the absorption of immunocytokine mechanism (2). This hypothesis may be further supported by the demonstration of the fact that joint appointment with the agent that increases the absorption immunocytokine, increases the absorption of tumor immunocytokine with a radioactive label.

According to the method of this invention advantage is estvo combination therapy is what purpose immunocytokine enhances the cytotoxic effect of chemotherapeutic agent that acts as an agent that increases the absorption immunocytokine. Therefore, the patient can be assigned smaller doses of chemotherapeutic agent. Accordingly, it is possible to reduce the suppression of some aspects of the immune system of the patient associated with the treatment with a chemotherapeutic agent. In one of the embodiments of the present invention a single dose of a chemotherapeutic agent that increases the absorption immunocytokine, assign the patient to the destination immunocytokine. Chemotherapeutic agent that increases the absorption immunocytokine, appoint preferably for a period of from about 4 days to about 4 hours, most preferably for about 24 to 48 hours prior to the appointment immunocytokine. In another embodiment of the present invention prior to appointment immunocytokine patient is prescribed a few doses of chemotherapeutic agent that increases the absorption immunocytokine. In other embodiments of the invention the chemotherapeutic agent that increases the absorption immunocytokine, you can assign up to, simultaneously and/or after immunocytokine.

Paclitaxel is an example of a chemotherapeutic agent that increases the absorption immunocytokine, which can suppress to lipodial hazard aspects of the immune system of the patient. While a large part of the immunostimulating action of paclitaxel via mediators - cells of the macrophage/monocyte, numerous studies linfocitos functions indicate harmful effects of paclitaxel on this subsystem. For example, it was found that treatment with paclitaxel and poses a serious danger to the ability of lymphocytes to proliferation as a normal mouse, and mouse-media tumors (Mullins et al., 1998, IMMUNOPHARMACOL IMMUNOTOXICOL 20: 473-492) and weakens as the cytotoxicity of NK cells and the generation of activated lymphokines cytotoxicity in cell cultures containing IL-2 (Chuang et al., 1993, GYNECOL ONCOL 49: 291-298). In fact, data show that limfocitna subsystem cells is the most important factor driving population in the antitumor activity of immunocytokines (Lode et al, 1998, PHARMACOL THER 80: 277-292). The experimental data contained in the present invention, lead to some new conclusions that could not be predicted in the prototype, especially with respect to the order prescription.

Taxanes can be coadministered with immunocytokines or assign separately, with different ways of reception. The compositions of the present invention can be administered in any method that is compatible with specific molecules. So what if appropriate, the appointment may be oral or parenteral, including intravenous and intraperitoneal assign.

The compositions of the present invention can enter the animal by any suitable means, directly (i.e. locally, as by injection, implantation or local assignment in the tissues) or systemically (i.e. parenterally or orally). If the composition is administered parenteral, e.g. intravenous, subcutaneous, ophthalmic, intraperitoneal, intramuscular, oral, rectal, vnutrivlagalischno, intraocular, intracerebral, intracranial, vnutrispinalnaya, intraventricular, vnutrioblastnom, intracavitary, intracapsular, intranasal or aerosol purpose, the compositions preferably include water part or physiologically compatible fluid suspension or solution. Therefore, the carrier or the carrier is a physiologically acceptable, so in addition to the delivery of patient desirable composition it is, in other respects, is not adversely on the electrolyte and/or volume balance of the patient. Thus, the fluid agent may include normal saline (i.e 9,85% aqueous solution of NaCl, 0.15 M, pH 7-7,4). For many taxan recipes much more complex, due to their in General unfavorable characteristic is eristic in terms of solubility. For example, usually paclitaxel, use the following formula: 10% cremophor, 10% ethanol and 80% saline solution (0.9% NaCl), and the recipe for docetaxel includes a mixture of ethanol : ether polyoxyethylene fatty acids 80 in the ratio of 1:1, which was then before assigning diluted to 1:10 solution of 5% glucose (Bissery and Lavelle, 1999). However, you may be aware of other recipes, including taxanes and their vnos synthesized analogs or experts it is easy to develop.

The preferred dosage in the appointment of immunocytokine are in the range of 0.1 - 100 mg/m2more preferably in the range of 1 - 20 mg/m2and most preferably in the range of 2 to 6 mg/m2. The preferred dose of the agent that increases the absorption immunocytokine, depends generally on the type of agent that increases the absorption immunocytokine, however, the optimal dose can be determined using the standard experiments. The purpose immunocytokine and/or the agent that increases the absorption immunocytokine, can be done by injecting portions medication or by continuous intravenous or intraperitoneal destination from the external tank (for example, from a package for intravenous infusion) or internal (for example, from borislavova implant). In addition, envisages the W that immunocytokine according to this invention can also be assigned to the planned patient instead of with many different agents that enhance the absorption immunocytokine. It is assumed however that the optimal combination of immunocytokines and agents that enhance the absorption immunocytokine, methods of appointment and the dose can be determined by commonly known standard experimental methods.

To assess the impact on the immune response of combination therapy with the use of fused protein antibody-cytokine and agents that enhance the absorption immunocytokine, you can use many different techniques. For example, as described in the examples below, models of animals or other suitable animal models can be used for testing, which will allow you to determine which of the agents that enhance the absorption immunocytokine, or combination of agents that enhance the absorption immunocytokine, most effective for synergistic action with immunocytokines (for example, fused protein antibody-IL2) to strengthen the immune destruction of established tumors. The agent that increases the absorption immunocytokine, or combination of agents that enhance the absorption immunocytokine, you can assign up to or simultaneously with the treatment immunocytokines and effect for the e on the tumor can be easily monitored through the measurement volume. Next, after the identification of new agents that enhance the absorption immunocytokine, professionals will be able to apply the methods described here to assess the potential of these new compounds in terms of gain or other modification of anticancer activity of the fused protein antibody-cytokine.

Alternative after treatment of the tumor can be cut to partition and painted by standard histological techniques or by using specific immunohistological reagents to assess the impact of combination therapy on the immune response. For example, a simple staining hematoxiline and eosin may reveal differences in infiltration of lymphocytes in solid tumors, which is an indicator of cellular immune response. Moreover, immunoablative sections with antibodies for specific classes of immune cells may reveal the nature caused by the reaction. For example, antibodies that are associated with CD45 (common leukocyte marker), CD4 and CD8 (to identify the subclass of T cells and NK1.1 (a marker of NK cells) can be used to assess the type of immune response mediators which are immunocytokine according to this invention.

An alternative type of immune response mediators which are immunocytokine, can be estimated by the usual method of removing the subclasses of cells are described, for example, Lode et al (1998) Blood 91: 1706-1715. The exhaustive examples of antibodies include those antibodies that react with markers of T cells CD4 and CD8, as well as those that form connections with markers of NK - NK1.1 and asialo GM. Briefly, these antibodies is administered to the animal prior to treatment with protein antibody-cytokine, in fairly high doses (for example, at doses of about 0.5 mg/mouse), and subsequently give with weekly intervals until completion of the experiment. This technique allows to identify the types of cells needed to determine the observed immune response in mammals.

In another approach, the cytotoxic activity of splenocytes isolated from animals that were subjected to combination therapy, can be associated with the cytotoxic activity of splenocytes isolated from other groups of animals that were subjected to different processing. Culture of splenocytes prepared by mechanical grinding recovered sterile spleen by standard methods described in many manuals for immunological laboratories. See, for example, Coligan et al. (eds) (1988) "Current Protocols in Immunology, John Wiley & Sons, Inc. The resulting cells are then cultivated in a suitable cell culture medium (e.g., DMEM from the company GIBCO)containing serum, antibiotics and low concentrations of IL-2 (˜10 U/ml). For example, to map the activity of NK, optimalen the th term cultivation is usually 3 days, however, in order to compare the cytotoxic activity of T-cells is optimal to cultivation for 5 days. Cytotoxic activity can be measured using radioactive labeling of tumor target cells (e.g. cells LLC) isotope51Cr within 30 minutes After removal of excess radioactive marker labeled cells are mixed in various concentrations with cultured spleen cells for 4 hours. At the end of the incubation released from cells51Cr was measured using a gamma counter particles and these data are then used to quantify the degree of cell lysis caused by immune cells. This technique is traditionally measured the activity of cytotoxic T-lymphocytes (or CTL).

Further the invention is illustrated in the following not limiting examples.

Example 1. The animal models.

To study the effect of the combination of immunocytokines and taxan on their action as mediators of effective cytotoxic response against tumor models were developed cancer mouse. Immunocytokine used in the following examples, tied Ersam, the antigen is a tumor of the person, which is found on most learned of epithelial tumors (see Perez and Walker (1989) J. Immunol. 142: 3662-3667). To test the effectiveness in immunotest is sustained fashion mouse model it was necessary to Express the antigen on the cell surface of tumor mouse which would be a syngeneic mouse host. Cell carcinoma, Lewis lung (LLC), commonly known culture cell lung cancer mouse were the first culture cells, selected for this purpose. This cell line is known that it generates high levels of inhibitors of the immune system and triggers the production of IL-10 from immune cells in the tumor microenvironment, which leads to localized suppression of the immune response (Sharma et al., 1999, J. IMMUNOL 163: 5020-5028). The antigen of human tumor Ersem (also called KSA), was expressed on the cell surface of the LLC so that it is possible in vivo to target immunocytokine isolated from mouse antibodies anti-Arsam, KS-1/4. This is carried out by converting the sequence of cDNA Ersam with recombinant retroviral vector according to known methods (Gillies, patent application US 09/293042)that led to obtaining the target cell line LLC/KSA. These cells are maintained in DMEM, supplemented with heat inactivated 10% fetal bovine serum, L-glutamine, a mixture of penicillin/streptomycin and geneticin (GIBCO) at 37°and 7.0% CO2.

Additional cell lines, representing carcinoma from different tissue sources, designed in a similar way. Non-immunogenic cell line breast carcinoma mouse T gave Dr. Paul Sondel (Univ. of Wisconsin). This line is arsiwala slowly and gradually after subcutaneous implantation, and spontaneously spreads in many organs even before surgical removal of the primary tumor. You can also be induced experimental lung metastases by intravenous injection. Colony cell line murine carcinoma CT, selected by intrarectal injection of N-nitroso-N-methylurethane in BALB/C mice, have provided Dr. I.J.Fidler (MD Anderson Cancer Center, Houston, TX). Cells T and ST were transfection EP ITSELF by well-known methods (Gillies et al., 1998, J. IMMUNOL 160: 6195-6203). Cells 4T1/KSA stood in RPMI, were added heat inactivated 10% bovine serum, L-glutamine, a mixture of penicillin/streptomycin and geneticin (GIBCO) at 37°and 7.0% CO2. Cells CT26/KSA stood in DMEM, added heat inactivated 10% bovine serum, L-glutamine, vitamins, sodium salt of pyruvic acid, a secondary amino acids, penicillin/streptomycin and geneticin (GIBCO, Gaithersberg, MD) at 37°and 7.0% CO2. Geneticin added to the cells to maintain the expression of KSA. All transfection cell line grew gradually, in the form of skin tumors after subcutaneous injection) or in the form of metastases after intravenous injection), and killed the mice, although they are on the cell surface was the expression of molecules Arcam person (potential foreign antigen).

For studies of tumor growth tumor LLC/KSA or CT26/KSA implanted odnosno on the backs of mice. In research LLC/KSA tumor was transplanted from multiple classes of tumors that were injected in a single cell suspension of 1×106cells in 100 µl PBS. About two weeks later, tumors were aseptically collected and passed through a sieve with cell 150 μm. Then the cells were passed through a syringe and needle 23 size two or three times, washed twice and re-suspended in PBS. A single cell suspension of 1×106cells LLC/KSA in 100 μl PBS were injected subcutaneously needle size 301/2on the backs of mice. In studies CT26/KSA cells that grow in culture exponentially, was administered as a single cell suspension of 1×10 cells in 100 µl PBS. When the tumor was formed, about two weeks after implantation, at Day 0 was given medication. Tumors were measured with calipers in three dimensions twice a week. The volume of tumor was calculated by the following equation:

Volume=½×4/3π(L/2×W/2×N), where L = length, W = width and H = height of the tumor.

Animals were weighed and monitored overall health throughout the study. When the tumor was necrotic or when the animals began to die, they were subjected to euthanasia by means of asphyxia CO2.

Data are presented in graphical form. Charts reflect the individual or the average volume of tumors (+/- SEM) n the during and after drug administration. In addition, data are expressed as percentage of the observed average volume of tumors in mice that received the drug relative to the data for mice that were injected media. To determine significant differences in the volume of individual tumors produced student t test.

For experimental studies of hepatic metastases mouse anestesiologi using 80 mg/kg ketamine HCl (Fort Dodge Animal Health, Fort Dodge, IA) and 5 mg/kg of xylazine (Voeg, Shawnee Mission, KS). A single cell suspension of 1×105cells CT26/KSA in 100 μl of DMEM containing 25 mm HEPES (GIBCO), were injected with a needle size 27 ½ splenic membrane after 60 seconds on Day 0. After another 2 minutes the splenic vessels were counterservice thermocautery (Roboz, Rockville, MD) and the spleen was removed, the animals had stitches using avtoparkov. Three weeks after inoculation, animals were omertvlenie; their livers were removed and weighed. Then these organs were fixed and stained in Bouin solution (Sigma, St. Louis MO).

Data are presented in graphical form. The chart displays the average weight of tumor (+/- SEM) at the time of the killing. The tumor weight was determined by subtracting the weight of normal liver from the weight of experimental samples. In addition, data are expressed as percentage of the observed mean weight of the tumors of mice treated with medication, the average tumor weight of mice treated with the carrier. For about the determine significant differences in the weight of individual tumors produced student t test.

For experimental studies of lung metastases single cell suspension of 2.5×105cells 4T1/KSA in 100 µl PBS was slowly introduced needle size 27 ½ in the side-arm tail vein on Day 0. Three weeks after inoculation of animals put to death; their lungs were removed and weighed. Then the lungs were fixed and stained in Bouin solution (Sigma). Data are presented in graphical form. The following chart shows the average weight of tumors (+/- SEM) at the time of the killing. The tumor weight was determined by subtracting the weight of the normal lung weight of experimental samples. In addition, data are expressed as percentage of the observed mean weight of the tumors of mice treated with medicine from the average tumor weight of mice treated with the carrier. To determine significant differences in the weight of individual tumors produced student t test.

Example 2. Cooking fused with the antibody proteins (immunocytokine).

Some fused proteins antibody-cytokine discussed in the examples below.

huKS-huγ1-huIL2 (abbreviation KS-IL2)

The gene encoding fused protein huKS-huγ1-huIL2, prepared and expressed broadly in line with the methodology described in Gillies and others (1998) J. Immunol. 160: 6195-6203, and US patent No. 5650150. Did the following: humanized variable regions of the mouse antibody KS1/4 (Varki the other, (1984) Cancer Res. 44: 681-687) was modeled according to the method described by Jones and others (1986) Nature 321: 522-525, which includes the attachment CDRs of each variable regions KS 1/4 in structure generalizing typical sequences of human variable regions with a high degree of gomologichnosti. Molecular modeling using a Silicon Graphics Indigo program BioSym confirmed that form the CDR were saved. Then protein sequence was subjected to a relay and constructed genes by merging overlapping oligonucleotides.

Derived variable regions were inserted into the expression vector containing the constant region of the human low-molecular-weight chain κ and human high-molecular chain Withγ1 adhering to, mainly, the methods described in Gillies et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1428-1432, except that the promoters of metallothionein and enhancers of macromolecular chains of immunoglobulin were replaced by promoters/enhancers for CMV expression of both chains. The fusion of the Mature sequences of IL-2 with carboxy ends of human high-molecular chains produced adhering to, mainly, the methods described in Gillies et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1428-1432, except that netransliruemye region 3' of the gene IL-2 were extracted from poly(A) region of SV40.

Fused protein of IL-2 who was b expressed by transfection of the resulting plasmids in the cell line myeloma NS/0 with the choice environment, containing 0.1 μm methotrexate (MTX). To obtain stable transfection clones, DNA plasmids were introduced into cells, NS/0 murine myeloma by electroporation. Cells, NS/0 were grown in medium Dulbecco-modified Eagle medium, supplemented with 10% fetal bovine serum. About 5×106cells once washed PBS and re-suspended in 0.5 ml PBS. Then, 10 μg of linearized DNA plasmid were incubated with cells in a Gene Pulser Cuvette (electrode distance of 0.4 cm, BioRad) on ice for 10 minutes Electroporation produced by using the apparatus Gene Pulser (BioRad, Hercules, CA)set at 0.25 and 500 μf. The cells provided an opportunity to recover for 10 minutes on ice, then re-suspended in an environment of growing and placed on two plates with 96 wells each. Stable transfection clones were selected by growing in the presence of 100 nm methotrexate, which was introduced two days after transfection. Cells were fed every 3 days over three times more time, and MTX-resistant appeared within 2 to 3 weeks.

Expressing clones were identified by ELISA with Fc or cytokine, using appropriate antibodies (see, e.g., Gillies et al. (1989) Biotechnol. 7: 798-804). The obtained fused protein was purified by binding to protein A Sepharose (Pharmacia) and blueraven the eat in accordance with the manufacturer's instructions.

huKS-huγ4-huIL2

The gene encoding fused protein huKS-huγ4-huIL2, constructed and expressed, adhering to, mainly, the techniques described in the application U.S.S.N. 09/256156, registered on February 24, 1999, which claims the priority of application U.S.S.N. 60/075887, registered on February 25, 1998

Version Igγ4 described above fused protein huKS-huγ1-huIL2 prepared by removing a fragment of the gene Withγ1 constant region of immunoglobulin from the expression vector of huKS-huγ1-huIL2 and its replacement by the corresponding sequence of the human gene Withγ4. The sequence and the order of the sequences of the constant regions Withγ1,γ2,γ3 andγ4 high-molecular chains of a person described in Huck et al. (1986) Nuc. ACIDS RES. 14: 1779-1789.

The exchange of fragments Cγ1 andγ4 produced by digestion of source DNA plasmid containing Cγ1, using Hind III and Xho I and purification of the large fragment of 7.8 kb agarose gel electrophoresis. The second DNA plasmid containing the gene Withγ4, digitially using Hind III and Nsi I and purified fragment size of 1.75 kb. A third plasmid containing a human cDNA of IL-2 and the poly a site SV40, merged with carboxyl ends of the human gene Withγ1, digitially using Xho I and Nsi I, and cleared a small piece 470 bp. All three fragments were linked together in approximately the same malariacasest. Product link used for the transformation of the corresponding E. coli and selected colonies by growing on plates containing ampicillin. Correctly mounted recombinant plasmids were identified using restriction analysis of DNA preparations of plasmids from the selected transformants and for differentiation gene insertsγ1 (without Fsp I) andγ4 (one site) used digitalone using Fsp I.

The final vector containing the replacement of the macromolecular chains Withγ4-IL2, introduced into the cells of the mouse myeloma NS/0 by means of electroporation (0,25 V and 500 μf) and transfectants were selected by growing in a medium containing methotrexate (0.1 ám). Identified clones of cells expressing high levels fused proteins huKS-huγ4-huIL2, increased and purified fused protein from the supernatant of the culture by chromatography on protein A Sepharose. The purity and integrity of the fused protein Withγ4 were determined by SDS-polyacrylamide gel electrophoresis. The activity of IL-2 was measured by analyzing the proliferation of T-cells (Gillis et al. (1978) J. Immunol. 120: 2027-2032) and found that it is identical to the same feature structre γ1.

huKS-muγ2a-muIL2

The gene encoding fused protein huKS-muγ2a-muIL2, was constructed by replacing in the above method of constant regions of a human antibody and a human is ical IL-2 fused protein huKS-huγ 1-huIL2 the corresponding sequences of the mouse. Specifically, human DNA Cγ1-IL2 was replaced by a fragment of mouse cDNA Withγ2A, fused with murine IL-2 coding DNA. The VH region huKS connected to the frame of the genetic code with the mouse cDNA γ2A by holding the overlapping polymerase chain reactions (PCR) using overlapping oligonucleotide primers:

(Sens)5' SS GTC TCC TCA GCC AAA ACA ACA GCC CCA TCG GTC(th. ID No. 3);

(antisense)5'GG GGC TGT TGT TIT GGCTGA GGA GAC GGT GAC TGA CG(th. ID No. 4);

(Sens)5' TTA AGC CAG ATC CAG TTG GTG CAG(th. ID No. 5) and

(antisense)5' SS CGG GGT CCG GGA GAA GCT CTT AGT(th. ID No. 6).

The oligonucleotides of sequence ID No. 3 and 4 were designed for hybridization with the connection domain VHhuKS and the constant region of a murine cDNA γ2A (italics). In the first round PCR was conducted two separate reactions. In one reaction VHfrom DNA huKS was used as template with oligonucleotides of sequence ID No. 4 and 5. Primer sequence ID No. 5 introduced restriction site AfIII (CTTAAG) in the beginning of the sequence encoding the Mature amino-all VNhuKS (bold). In another reaction murine cDNA γ2A was used as template with oligonucleotides of sequence ID No. 3 and 6. Primer sequence ID No. 6 was hybridisable with cDNA that encodes a region around the C-ends #x003B3; 2A, and introduced restriction XmaI site (CCCGGG) for subsequent crosslinking with cDNA muIL2. The PCR products from these two reactions were mixed and subjected to the second cycle of PCR, using the oligonucleotides of sequence ID No. 5 and 6. The PCR products were cloned and, if the verification sequence, the fragment AfIII-XmaI encoding VHhuKS and the constant region γ2A mouse used for blending with DNA that encodes a signal peptide on the website AfIII and cDNA muIL2 on the XmaI site.

Murine IL2 cDNA cloned from tRNA mononuclear cells of peripheral blood of the mouse using oligonucleotides, placed fourth in sequence ID No. 7 and 8, namely:

(sense) 5' GGC CCG GGT AAA GCA CCC ACT TCA AGC TCC (PEFC. ID No. 7) and

(antisense) 5' CCCTCGAGTTATTGAGGGCTTGTTG (PEFC. ID No. 8).

Primer sequence ID No. 7 fits muIL2 (sequence in the blood) to join muγ2a restriction on the XmaI site (CCCGGG). Primer sequence ID No. 8 introduced restriction site XhoI (CTCGAG) immediately after the termination of the codon (antisense in the blood).

Similarly, variable low-molecular-weight (VLdomain huKS attached to the cDNA sequence mu κ using overlapping PCR. Used overlapping oligonucleotides, including

(sense) 5' G GAA ATA AAA CGG GCT GAT GCT GCA CCA ACT G (th. ID No. 9);

(antisense) 5' GC AGC ATC AGC CCGTT TTA TTT CA GCT TGG TCC (PEFC. ID No. 10);

(sense) 5' TTA AGC GAG ATC GTG CTG ACC CAG (PEFC. ID No. 11) and

(antisense) 5' CTC GAG HUNDRED ACA CTC ATT CCT GTT GAA GC (th. ID No. 12).

Oligonucleotides were designed for hybridization to the connection VLhuKS and the constant region of a murine cDNA κ (italics). In the first round PCR was conducted two separate reactions. In one reaction VLDNA huKS was used as template with oligonucleotides, which are fourth in the sequence ID No. 10 and No. 11, which was introduced restriction site AfIII (CTTAAG) in the beginning of the sequence encoding the Mature amino-all VLhuKS (in the blood). In another reaction murine cDNA κ used as a template with oligonucleotides, which are fourth in sequence ID No. 9 and 12, which introduced the restriction site XhoI after the termination of the codon (antisense in the blood).

The PCR products of these two reactions were mixed and subjected to the second cycle of PCR using oligonucleotide primers that are fourth in the sequence ID No. 11 and 12. The resulting PCR product was cloned and, if the verification sequence, the fragment AfIII-XhoI encoding VLhuKS and the constant region of the mouse κ, stitched with DNA that encodes a signal peptide AfIII site.

Both sequences of mouse high and low molecular weight chains were used in owani to replace human sequences in pdHL7. The resulting expression vector, the antibody-containing marker gene, featured dhfr, was electroporative (6,25 V, 500 μf) in cells of the mouse myeloma NS/0 clones selected by kulturarbeit in medium containing 0.1 μm methotrexate. Then, by standard ELISA techniques, tested transfection clones resistant to methotrexate, on the secretion determinants of antibodies. Fused proteins were purified by chromatography on protein A Sepharose according to the manufacturer's instructions.

huKS-muγ2a-muIL12

The gene encoding fused protein huKS-muγ2a-muIL12, constructed and expressed, adhering to, mainly, the techniques described in the application U.S.S.N. 08/986997 registered 8 December 1997, and the work of Gillies et al. (1998) J. Immunol. 160: 6195-6203. With this in mind, we merged subunit R35 IL-12 murine cDNA with a pre-prepared region that encodes a high molecular chain huKS-muγ2a. Then the resulting vector was transfectional the cell line myeloma NS/0, pre-transfectional subunit R40 IL-12 and are able to Express. In other words, the cell line was transfectional one R40 and selected stable cells with a high expression level, which are then used as recipients for transfection fused protein containing the R35 (i.e. sequential transfection).

Mouse the subunit R35 and R40 IL-12 was isolated using PCR from tRNA, prepared from spleen cells, activated with Concanavalin A (5 μg/ml in the medium culture for 3 days). The PCR primers used for isolation of nucleic acid sequences that encodes the R35, which, in addition, adapted to cDNA R35 as restriction fragment XmaI-XhoI included

5' CCCCGGGTAGGGTCATTCCAGTCTCTGG (PEFC. ID No. 13) and

5' CTCGAGTCAGGCGGAGCTCAGATAGC (PEFC. ID No. 14).

The PCR primer used for isolation of nucleic acid sequences, the coding R40 included

5' TCTAGACCATGTGTCCTCAGAAGCTAAC (PEFC. ID No. 15) and

5' CTCGAGCTAGGATCGGACCCTGCAG (PEFC. ID No. 16).

By well-known methods (Gillies et al. J. Immunol. Methods 125: 191) constructed a vector plasmid (pdHL7-huKS-muγ2a-p35), which contained a recognizable dhfr marker gene, a transcription unit encoding a low molecular weight chain gumanitarnogo antibodies KS, and a transcription unit encoding a high molecular chain of the mouse, merged with the subunit R35 murine IL-12. The merger was carried out with the help of knitting with XmaI-XhoI fragment cDNA adapted to the subunit of the R35; single saiga Xmal at the end of the CH3 exon prepared in advance of the mouse gene γ2A. Both transcription units of the chains H and L included the promoter of cytomegalovirus (CMV) (instead of the promoter metallothionein in original reference) at the 5' end and polyadenylation site at the end of 3'.

Similar vector (pNC-p40) was construire the n for the expression of free subunits R40, it included a recognizable marker gene (a gene that is resistant to neomycin), but still used the CMV promoter for transcription. In this case, the coding region consisted of a sequence of natural leader subunit R40 for correct transport to the endoplasmic reticulum and installation with the merged protein. Plasmid pNC-p40 was electroporative in cells, the cells were placed on the plate and made a selection in medium containing G418. In this case, the supernatant of the culture of drug-resistant clones were subjected to ELISA testing to obtain subunits R40.

According to the method described in Gillies et al. (1998) J. Immunol. 160: 6195-6203, the expression vector pdHL7-huKS-muγ2a-p35 was electroporative in line cells, NS/0, which already expresses murine R40. Transfection clones resistant to the method of trexate, tested on the secretion determinants of antibodies and mouse IL-12 standard ELISA technique. The resulting protein was purified by binding to protein A Sepharose and elution in the column in accordance with the manufacturer's instructions.

Example 3. Cytotoxic activity of the combination therapy in vitro.

Testing of cell lines, designed for use in animal models (example 1), their sensitivity caused by taxonom cytotoxicity in cultured cells was carried out in the presence of p and the absence of immunocytokine, based on L-2, consisting of a humanized form of the antibody KS 1/4, fused at the carboxyl end of the chain H with human IL-2 (huKS-huγ1-huIL2, below abbreviated as KS-IL2). Cells are evenly distributed at 1000 cells/well on plates with 96 flat-bottomed wells and incubated for 24 hours at 37°C, 7% CO2. Paclitaxel at 2-multiple dilutions from 200 ng/ml to of 3.125 ng/ml, KS-IL2 at 200 ng/ml and IL-2 at a 33.3 ng/ml (equivalent amount of IL-2 in KS-IL2) was added in duplicate to the cell culture plates and incubated for 6 days at 37°C, 7% CO2. Colorimetric analysis of MTS (Promega), allowing to determine cell viability, based on the cellular conversion of salts of tetrazole produced directly on 96-well plates. After reading and registration plates viable adhesive cells were stained using Crystal violet (Sigma, St. Louis, MO). Colored Crystal violet plates were used for verification of the results of the analysis of MTS. The results are presented in tabular form. IC50denotes the concentration of the drug, which leads to a decrease of cytotoxicity up to 50% level of the control samples.

Analysis of cytotoxicity produced in a separate application of paclitaxel (from 3 to 200 ng/ml)and the combined Prim is in with KS-IL2 (200 ng/ml) or IL-2 (33,3 ng/ml, equivalent amounts of IL-2 in KS-IL2) against cells CT26/KSA, LLC/KSA and 4T1/KSA. There were low up to the absence of cytotoxicity used individually KS-IL2 or IL-2 to the three used in testing the cell lines (from 81 to 101% of control samples, see table). Add as KS-IL2 and IL-2 did not affect the cytotoxicity of paclitaxel. Thus, since neither the KS-IL2 or IL-2 does not affect the cytotoxicity of paclitaxel, any increase in antitumor activity in mice in the combined treatment must be associated with other mechanisms that operate only in animals-carriers of the tumor.

The cytotoxicity of paclitaxel in combination with IL-2 or KS-IL2
IC50paclitaxel (ng/ml)
ST/KSAaLLC/KSAbT/KSAb
Taxol27616
Taxol + IL-2 (33 ng/ml)30820
Taxol + KS-IL2 (200 ng/ml)26519
% of control samples is Sza
ST/KSAaLLC/KSAbT/KSAb
IL-2 (33 ng/ml)9710095
KS-IL2 (200 ng/ml)9010181
A. Average of three experiments.

b. Average of two experiments.

Example 4. Combination therapy of KS-IL2 and taxonom skin tumors, LLC.

Regression analysis of tumor growth produced with the use of fast growing tumors LLC/KSA. One week after administration of a single dose of paclitaxel (80 mg/kg) was administered for 5 days intravenous injection of KS-IL2 (20 µg) into the tail vein (figure 2). No effect when self-appointment as paclitaxel and KS-IL2 (Days 0-4) was not observed. However, when KS-IL2 was administered a week after paclitaxel, there was a significant decrease in the average volume of tumors (41% of the volume in the control experiments) and the suspension of tumor growth (TGD) for about 8 days, which is very different from the version independent paclitaxel alone (p=0,023).

No related medication overt toxicity was not observed, except for weight loss <5% in the group treated with paclitaxel.

Next, the effect of the application of multiple doses of paclitaxel is, what is generally regarded as more effective chemotherapy, compared with the effect obtained with the introduction of a single dose of paclitaxel in combination with KS-IL2, to determine how the treatment affects the improvement. It was found that self-application of KS-IL2 (20 mg, Days 0-4) again has no effect on tumor growth LLC/KSA, but independent application of paclitaxel, when assigning multiple doses (50 mg/kg, every other day), reduces the average tumor volume to 63% observed in the control experiments and leads to a 4-day suspension of tumor growth (TGD) (figure 3). When immunocytokine KS-IL2 was administered one week after treatment with paclitaxel, a decrease in the tumor volume to 27% observed in the control group, and TGD was 10 days, which is significantly different from results obtained in a separate application of paclitaxel (p=0,016). No related medication overt toxicity was not observed, except for weight loss <5% in the group treated with paclitaxel. In the group that used combination therapy, weight loss was even smaller. These positive results combination therapy all the more surprising that between chemotherapy (and potentially dangerous to the immune system) treatment and early treatment, based on what moznosti to stimulate the proliferation and cytotoxicity of lymphocytes, passed a relatively short time.

The only explanation of the effect of combined action is that caused by taxonom apoptosis of the growing tumor mass decreases interstitial pressure, which, in turn, increases the effective absorption of KS-IL2 in the tumor. Recent studies (Griffon-Etienne et al. 1999, CANCER RES. 59: 3776-3782) show that the effect of a single dose of paclitaxel is effective in reducing pressure of interstitial fluid, and the maximum effect was observed from 24 to 48 hours (Griffon-Etienne et al. 1999, CANCER RES. 59: 3776-3782). Although this effect can lead to the creation of better conditions for absorption immunocytokine in the tumor, it is too short time interval after chemotherapy. Nevertheless, we were treated KS-IL2 mice-media tumors LLC/KSA next five days, starting after exactly 24 hours after introduction of a single dose of paclitaxel. The results show that there is an even better combination reaction, if the treatment immunocytokines to start earlier than one week after administration of a single dose of paclitaxel with this line tumor, and in the case of the colony carcinoma ST (see below).

Example 5. Combination therapy of KS-IL2 and taxonom metastases T.

Because we found that treatment intervals between appointments taxane and immunocyto the ina can be shorter than expected, we tested the combined modes, in which Texan and immunocytokine was introduced in the same day, it was compared the effect of the introduction of a single dose (75 mg/kg) paclitaxel with the effect of fractionated doses (25 mg/kg × 3 days), which was administered simultaneously with the treatment of KS-IL2 (15 μg/dose × 3 days, was administered 4 hours after paclitaxel). In these experiments we used an experimental model of lung metastasis induced by cells of breast carcinoma 4T1/KSA. Doses of drugs were chosen so that they were almost optimal by themselves, so that it was possible to observe any potential improvement or synergistic activity.

Each agent entered independently, significantly (p<0.02) were reduced average weight of the lungs in about equal measure: reduction of 43% was observed with the introduction of a single dose of paclitaxel and a decrease of 49% in the case of multiple doses of paclitaxel, which was introduced independently, and a decrease of 39% was observed during the self-introduction of KS-IL2 (figure 4). The combination of paclitaxel and KS-IL2 resulted in even a small decrease in lung metastases, but the effect was less than additive: reduction of 58% was observed in the case of a single dose of paclitaxel in combination with KS-IL2 and a decrease of 68% and the eating place with multiple introduction of paclitaxel in combination with KS-IL2. Although synergy was not observed, a single dose of paclitaxel in combination with KS-IL2 resulted in significant contrast to self-assign option of paclitaxel (p=0,047).

In all groups was observed weight loss of less than 10%, however, the greatest weight loss occurred when 25 mg/kg paclitaxel was administered 3 times a day. Based on these data we can conclude that the best program in this analysis of pulmonary metastases T in terms of the greatest effect of combination therapy was the opportunity of introducing a single dose of paclitaxel followed by the appointment of KS-IL2, as in the case of regression models of tumor growth LLC/KSA. Because the dosing interval in this case was only 4 hours, the results might not be optimal for effective uptake by the tumor.

Example 6. Combination therapy of KS-IL2 and taxonom skin tumors ST.

The results described in example 5, lead to the assumption that the time interval of 4 hours between doses of the two agents may be too short. It is possible that the levels of paclitaxel, still remaining in the animal at the time of introduction of KS-IL2, could be a direct obstacle lymphocyte activation, thus reducing their potential antitumor activity when combined administration of drugs. Chrome is also at the time of 4 hours after the administration of paclitaxel its maximum effect in the aspect of interstitial pressure could not be achieved. So we have planned another experiment, this time with the use of established skin tumors colony carcinoma CT26/KSA, in which we combined a single dose of paclitaxel (75 mg/kg) with 5-day course of KS-IL2, which began 24 hours after the appointment taxane. With self-administration of paclitaxel had no effect on tumor growth (figure 5). Treatment with suboptimal doses of KS-IL2 (10 μg, Days 1-5) resulted in tumor volumes, which accounted for 71% of the volume of tumors in the control group. Sharp and synergistic reduction in tumor volume by up to 8% of the control samples was observed with the combination of paclitaxel and KS-IL2; this result differs from the variant independent paclitaxel (p<0,001). Minimum weight loss ˜5% were observed in both treated with paclitaxel groups.

The second experiment was conducted using the model CT26/KSA, this time tested steps combination therapy of established metastases in the liver and again used a break of 24 hours between the introduction of paclitaxel and appointment of KS-IL2. We also made a comparison of the effects depending on the dose of paclitaxel in combination those who FIPA. Mice were injected with 25, 50 or 75 mg/kg of paclitaxel on Day 5 after the introduction of metastases, independently or with the appointed day later treatment of KS-IL2 (7 mg) for 5 days. The response to the dose of paclitaxel was tested first his own use, in this experiment the administration to mice of 25, 50, 75 mg/kg of the drug resulted in weight reduction of the tumor, respectively, to 49%, 23%, 10% of the weight of the tumor samples (Fig.6). The combination of paclitaxel with KS-IL2 provided further decrease in lung metastases up to 12%, 9% and 6% of the weight of the tumor control samples, respectively, at the same doses of paclitaxel. The lowest dose of paclitaxel (25 mg/kg) in combination with KS-IL2 resulted in the largest and most significant (p<0.001) and the reduction of weight of the tumor compared with higher doses of paclitaxel in combination with KS-IL2. Thus, the combination of KS-IL2 with the previous introduction of paclitaxel will lead to greater antitumor effect than the self-application of any of these agents. Further, the lowest dose of paclitaxel in combination with KS-IL2 gave the same antitumor effect, and that the highest dose of paclitaxel his own introduction. Therefore, the use of lower doses of paclitaxel in combination with KS-IL2 should reduce toxicity while maintaining good efficiency

Example 7. The measurement of absorption KS-IL2 in tumors.

The effect of processing a single dose of cytotoxic drug, entered before therapy immunocytokine is to decrease interstitial pressure in tumors and increased permeability of the tumor, which should yield measurements using the labeled radioactive isotope immunocytokine, i.e. KS-IL2. Labeling of purified KS-IL2 isotope produced by a standard method (reference) by contact with a commercially available125I (New England Nuclear, Billerica, MA). Skin tumor CT26/KSA implanted subcutaneously according to the method described in example 1 and gave them to grow to a volume of the order of 100-200 mm3. Two groups of 4 mice each were injected with either paclitaxel (50 mg/kg) in the media, or one medium, then after 1 hour (experiment 1) or after 24 hours (experiment 2) was injected 10 mg125I-KS-IL2 (95 MX). Six hours after injection of the labeled radioactive isotope immunocytokine mice killed and tumors removed surgically. As a control liver of animals also collected and all tissues were weighed, then were measured using a gamma counter particles. The results were expressed as the number of pulses per minute (CPM) per gram of tissue by dividing the total CPM in the tissue at its weight.

When marked the th KS-IL2 was administered within 1 hour after treatment with paclitaxel (figa), in tumors, cut out those who got the drug in animals, was observed only a small increase in radioactivity. Conversely, when a bulleted KS-IL2 was administered 24 hours after treatment with paclitaxel, there was a sharp increase in absorption (>200%) compared with the control group received the vehicle (figb). This large difference between the absorption of the tumor at time points 1 hour and 24 hours is in accordance with the data determined by taxonom changes in interstitial pressure (Griffon-Etienne et al. 1999, CANCER RES. 59: 3776-3782) and is consistent with the data obtained in our models of the tumor, which suggests that starting treatment within 24 hours after paclitaxel is more effective than if you start early (4 hours).

We have also tested other classes of drugs, with the aim to find out whether they can increase the absorption of the labeled immunocytokine solid tumor. In this case, the mice did injection of a single dose of cyclophosphamide (40 mg/kg) or 24 hours, or 3 days before the start of the experiment. Injection KS-IL2, bulleted125I did all mice, including the control group, pre-PBS, and after 16 hours was measured radioactivity carved tumors. The results (Fig) show that pre-treatment with cyclophosphamide increased the absorption KS-IL 48% in mice pre-processing was made 24 hours before the start of the experiment, and 70% in mice pre-processing was performed for 3 days.

Example 8. Combination therapy huKS-huγ4-IL2 and taxonom

Have been recently described new forms of immunocytokines, which are characterized by increased elimination half-life and high efficiency, which is associated with a reduced affinity for Fc receptors (see Gillies et al. 1999, CANCER RES. 59: 2159-2166). Testing was conducted with one representative from this group improved immunocytokines IL-2, huKS-huγ4-IL2 in combination therapy with a single dose of paclitaxel. In this case, too, there was an increase of efficiency when the two medicinal product was sequentially injected into mice native skin tumor CT26/KSA.

Example 9. Combination therapy huKS-muγ2a-muIL12 and taxonom.

To check whether to restrict a synergistic therapeutic effect only immunocytokine based on IL-2, we first process the large established tumors CT26/KSA-paclitaxel (single dose of 75 mg/kg), and 24 hours after the injection conducted a 5-day course of drug treatment huKS-muγ2a-muIL12 (5 µg per day). This immunocytokine is a product of the merger of murine forms of antibodies HuKS (i.e. mouse With Kappa and gamma 2A were returned constant region) and is isinai IL-12. It was necessary to use the mouse sequence IL-12, because, unlike IL-2, the cytokine to a high degree specific to biological species, and the human form shows weak activity in the mouse. The results show that the treatment of one paclitaxel has a very small effect on tumor growth. Treatment with suboptimal doses of huKS-muγ2a-muIL12 gave antitumor effect and it was increased in mice that were previously treated with a single dose of paclitaxel.

Example 10. Combination therapy huKS-IL2 and alkylating agent.

i. Was also demonstrated an increased therapeutic effect of combination of huKS-IL2 with cyclophosphamide, a chemotherapeutic drug from the group of alkylating agents. 3 days before the start of treatment immunodulatory mice were injected cells, breast carcinoma T to cause pulmonary metastases. Mice were injected a single dose of cyclophosphamide (15, 40 or 80 mg/kg), and three days after it conducted a 5-day course of treatment huKS-IL2 (15 µg/day). Despite the fact that the two smallest dose of cyclophosphamide when used alone, resulted in only modest weight reduction of lung tumor metastases, in combination with huKS-IL2 provided a significantly greater reduction of tumor weight compared with separate application of the cyclophosphamide (p< of 0.05, figure 9). However, at the highest dose (80 mg/kg) synergy was not observed.

ii. Increased therapeutic effect of combination of huKS-IL2 with cyclophosphamide was also confirmed by analysis of tumor growth in immunodulatory mice-carriers of established subcutaneous tumors of breast carcinoma. Mice were treated with a single dose of 80 mg/kg of cyclophosphamide alone or in combination with 5 devname doses of huKS-IL2 (30 μg), which was introduced in 3 days after injection of cyclophosphamide. The average volume of tumors in cases of separate treatment of huKS-IL2 and a single dose of 80 mg/kg of cyclophosphamide was reduced by 31% and 69%, respectively (figb). Combined treatment was provided by the reduction in the average tumor size at 100% on Day 25, which differed significantly from the results of independent use as huKS-IL2, and cyclophosphamide (p<0,05), and has completely eliminated tumors in six mice from eight through twelve weeks after the start of treatment. The animals tolerated this treatment well, in all groups was observed weight loss of less than 10%.

iii. Increased therapeutic effect of combination of huKS-IL2 with cyclophosphamide was also confirmed by analysis of tumor growth, held at immunodulatory mice-carriers of established subcutaneous tumors carcinoma of the lung. Mice were treated with a single dose of 80 mg/kg, C is clophosphamide either alone or in combination with 5 daily doses of huKS-IL2 (20 μg), which was introduced in 3 days after treatment with cyclophosphamide. When used alone, huKS-IL2 and 80 mg/kg of cyclophosphamide average tumor volumes decreased by 2% and 27%, respectively (pigv). Combined treatment reduces the average size of tumors 48% on Day 20, which differs significantly from the results of independent use as huKS-IL2, and cyclophosphamide (p<0,05). The animals tolerated this treatment well, in all groups was observed weight loss of less than 10%.

Example 11. Combination therapy huKS-IL2 and alkylating agent.

Demonstrated an increased therapeutic effect of combination of huKS-IL2 with carboplatinum, another chemotherapeutic drug from the group of alkylating agents. Mice are carriers of established subcutaneous tumors carcinoma of the lung with large cells (LLC/KSA) was treated with carboplatin (75 mg/kg) on Day 0 and three days after it conducted a 5-day course of treatment KS-IL2 (20 µg per day). Separate treatment carboplatinum and KS-IL2 resulted in moderate inhibition of tumor growth, however, only the combined treatment resulted in a significant reduction in the average volume of tumors at Day 20 (p<0,05, figure 10). In addition, tumor growth, in which mice were treated by a combination of these drugs differed greatly from case is yourself at any time use carboplatin (p< 0,05).

The invention may be embodied in other specific forms without deviating from its essence or essential nature. The above embodiments should therefore be considered in all respects rather as illustrative rather than as limiting the described invention. The breadth of this invention is more defined in the following claims than the above description, and all changes of meaning and range of equivalence in the formula are designed to reach this goal.

Each of the patent documents and scientific publications entered in the text description of the invention by reference.

1. The way of initiation in mammals, the immune response leading to the destruction of tumor cells, comprising the steps of destination mammals

at least one immunocytokine, including the site, linking the antibody; and at least one agent that increases the absorption immunocytokine, which strengthens the immune reaction caused by immunocytokines.

2. The method according to claim 1, in which the site linking the antibody forms a relationship with a cancer cell.

3. The method according to claim 1, in which the site linking the antibody forms a link with specific to a tumor antigen.

4. The method according to claim 1, in which the agent that increases the absorption immunocytokine, nominated jointly what immunocytokines.

5. The method according to claim 1, in which the agent that increases the absorption immunocytokine, appointed to the destination immunocytokine.

6. The method according to claim 1, in which the site linking the antibody includes the amino-end in the direction of the carboxy-end of the variable region of the immunoglobulin domain CN and CH2 domain.

7. The method according to claim 6, in which the website linking antibody, in addition, includes a CH3 domain, attached to the end of the carboxy-end of the CH2 domain.

8. The method according to claim 1, in which immunocytokine is a fused protein comprising, from the amino end to the carboxy-end, (i) the website linking antibody comprising the variable region of an immunoglobulin that is capable of forming a bond with the antigen to the cell surface in cells pre-selected type, domain, immunoglobulin SN, the domain of an immunoglobulin CH2, and (ii) a cytokine.

9. The method according to claim 6, in which the website linking antibody, in addition, includes a CH3 domain, inserted between the CH2 domain and a cytokine.

10. The method according to claim 1, in which the cytokine immunocytokine selected from the group consisting of tumor necrosis factor, interleukin, colony stimulating factor and lymphokine.

11. The method according to claim 1, in which the said agent that increases the absorption immunocytokine is Texan.

12. The method according to claim 11, in which the mentioned taxon selected from the group consisting of Taxol, docetaxel, 10-deazetil Baccatin III and their derivatives.

13. The method according to claim 1, in which the said agent that increases the absorption immunocytokine, is an alkylating chemotherapeutically agent.

14. The method according to item 13, which mentioned alkylating chemotherapeutically agent selected from the group consisting of cyclophosphamide, carboplatin and their derivatives.

15. The method according to claim 1, in which the aforementioned mammals appoint two or more agents that increase the absorption immunocytokine.

16. The method according to claim 1, in which the aforementioned mammals appoint two or more different immunocytokines.

17. The method according to claim 1, in which the said agent that increases the absorption immunocytokine designate approximately 24 hours prior to the appointment mentioned immunocytokine.

18. Composition for initiation in mammalian immune response against cancer, including immunocytokine, including the website, linking antibody and a cytokine; and an agent that increases the absorption immunocytokine.

19. The composition according to p, in which the site linking the antibody includes, in the direction from amino end to the carboxy-end, the variable region of the immunoglobulin domain CN and CH2 domain.

20. The composition according to claim 19, in which the site linking the antibody includes, in addition, the CH3 domain, attached to the end-the end of the CH2 domain.

21. The song is about p, in which immunocytokine is a fused protein comprising, from the amino end to the carboxy-end, (i) the website linking antibody comprising the variable region of an immunoglobulin that is capable of forming a bond with the antigen to the cell surface in cells pre-selected type, domain, immunoglobulin SN, the domain of an immunoglobulin CH2, and (ii) a cytokine.

22. The composition according to claim 19, in which the site linking the antibody includes, in addition, the CH3 domain, inserted between the CH2 domain and a cytokine.

23. The composition according to p, in which the cytokine immunocytokine selected from the group consisting of tumor necrosis factor, interleukin, colony stimulating factor and lymphokine.

24. The composition according to p, in which the said agent that increases the absorption mentioned immunocytokine is Texan.

25. The composition according to paragraph 24, in which the mentioned taxon selected from the group consisting of Taxol, docetaxel, 10-deazetil Baccatin III and their derivatives.

26. The composition according to p, in which the said agent that increases the absorption mentioned immunocytokine, is an alkylating chemotherapeutic agent.

27. The composition according to p, in which the aforementioned alkylating chemotherapeutic agent is selected from the group consisting of cyclophosphamide, carboplatin and their derivatives.



 

Same patents:

FIELD: medicine, oncology, dermatology.

SUBSTANCE: the present innovation deals with treating mammalians due to introducing nonpsychotropic compounds - tetrahydrocannabinol derivatives, adjulemic acid derivative, in particular. The innovation suggested enables to either decrease or prevent cell proliferation at the following diseases: psoriasis, tumors along with low toxicity level of therapy conducted.

EFFECT: higher efficiency.

11 cl, 4 dwg, 1 ex, 2 tbl

FIELD: organic chemistry, chemical technology, medicine, pharmacy.

SUBSTANCE: invention relates to crystalline polymorphic modifications of strong acting epotilone analog of forma A and forma B represented by the formula (I): Invention proposes a crystalline substance representing a mixture of form A and form B of epotilone analogs. Invention proposes two variants of a method for preparing crystalline polymorphic modification representing form A. Also, invention proposes a pharmaceutical composition inhibiting angiogenesis and comprising an active component that represents crystalline polymorphic modification of epotilone analog of form A, form B or a crystalline polymorphic modification of epotilone analog of the formula (I) wherein this modification has no amorphous component, and a pharmaceutically acceptable carrier. Also, invention proposes a method for treatment of cancer comprising administration in mammal the effective dose of crystalline polymorphic modification of epotilone analog. Invention provides preparing crystalline polymorphic modifications of strong acting epotilone analog of the formula (I) characterizing by improved properties for using in therapy of cancer species.

EFFECT: improved preparing methods, valuable medicinal properties of compounds and composition.

16 cl, 9 dwg, 7 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: method involves incubating antibiotics and/or chemopreparations in therapeutic doses with autoplasma 30 min at 37°C and introducing the preparations into paravaginal cellular tissue to patients suffering from genitalia diseases and into paravesical cellular tissue to patients suffering from urinary bladder diseases and into pararectal cellular tissue to patients suffering from rectum diseases. Tumor proliferation into neighboring small pelvis organs (into paravaginal and/or pararectal and/or paravesical cellular tissue) taking place, the treatment is applied twice a week.

EFFECT: increased pathological focus regression percent; reduced manifestations of drug therapy complications.

FIELD: medicine, in particular treatment of malignant neoplasm.

SUBSTANCE: claimed method includes administration of vaccine representing complex of heat shock protein and tumor peptide, isolated from subject tumor tissue, and radioactive preparation Oncofer. Oncofer is administered both during vaccination course and after vaccination.

EFFECT: stable antitumor immunity, enhanced tumor cell apoptosis and blocked blood supply due to alteration of erythrocyte properties in tumor caused by radioactive preparation and activation of clot formation in said vessels.

2 cl, 4 ex, 2 dwg

FIELD: medicine, oncology.

SUBSTANCE: invention relates to a method for treatment of malignant tumors. Method involves administration in a patient the chemotherapeutically active dose of antitumor platinum compound, foe example, cisplatin or carboplatin and erythropoietin or erythropoietin-like substance wherein the latter is administrated before administration of platinum compound or simultaneously with its. This method provides attaining the synergistic antitumor effect.

EFFECT: improved and valuable medicinal effect.

8 cl, 2 tbl, 2 dwg, 2 ex

FIELD: medicine, oncology, pharmacy.

SUBSTANCE: after proving the pleural fluid sterility method involves its exfusion from pleural cavity and administration of antitumor chemopreparations. Firstly, 20 mg of bleomycetin is incubated with 20 ml of autopleural fluid, pleural fluid remained after exfusion is placed into packages "Gemakon" and centrifuged at 2000 rev/min for 60 min and liquid part is frozen. Pleural fluid is removed again as its accumulation and administration of incubated mixture of pleural fluid with bleomycetin is repeated also wherein the bleomycetin dose is increased up to 25 mg. In 2-3 days after removal of pleural liquid chemopreparations incubated with preliminary defrosted liquid part of pleural fluid are administrated each 5-7 days in the following sequence and doses: the first administration - 100 mg of cisplatin; the second administration - 100 mg of cisplatin; third, fourth and fifth administrations - 30 mg of doxorubicin and 1000 mg of cyclophosphan up to the total amount - cisplatin, 200 mg; doxorubicin, 90 mg, and cyclophosphan, 3000 mg. Method provides elimination of pleural fluid in full volume, to compensate loss of liquid, protein and trace elements, to reduce tumor size and to avoid toxic symptoms of chemotherapy. Invention can be used in the presence of exudative pleuritis in patients with lung cancer who can't to be subjected for operative and radiation treatment.

EFFECT: improved treatment method.

2 ex

FIELD: medicine, oncology.

SUBSTANCE: invention proposes using a medicine valsartan as an antagonist of AT-1 receptors and a modulator of AT-2 receptors in treatment of lung or mammary glands invasive cancer. All carcinomas comprise AT-2 receptors while in hyperplasia of normal epithelial cells AT-2 receptors are localized only. This allows carrying out both diagnosis of malignant tumor development and treatment indicated diseases with valsartan owing to modulation of AT-2 receptors, i. e. based on change of the host biological response for tumor cells.

EFFECT: improved and valuable medicinal properties of medicine agent.

13 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: method involves taking blood from pulmonary artery in the amount of 400-600 ml into reservoir containing Glucigir as anticoagulant during operation after having ligated lung root blood vessels. Cysplatin in the amount of 50 mg/m2 and Doxorubicin in the amount of 50 mg/m2 are added and the mixture is hold for 30 min at 37°C and introduced to a patient in drip feed during continued surgical intervention.

EFFECT: combined specific antitumor treatment and nonspecific immune system stimulation; improved patient life quality.

FIELD: medicine.

SUBSTANCE: method involves taking marrow suspension into two flasks with Glucigir in the amount of 100,0 ml in each of them before operation at the first treatment day. Cysplatin is added into one of the flasks on the basis of 100 mg/m2, and 1000 mg of 5-fluorouracyl is added to the second flask. The mixture is incubated and intravenously drop-by-drop introduced. Exfusion of 100 ml of marrow suspension into flask containing Glucigir is repeated at the eighth treatment day. It is combined with 1000 mg of 5-fluorouracyl, incubated and intravenously drop-by-drop introduced.

EFFECT: improved patient health condition; increased organism resistance level; prolonged period of no relapse.

1 tbl

FIELD: medicine.

SUBSTANCE: method involves administering fixed 3% Prospidine ointment applications applied to the uterine cervix on the immune correction treatment background at the second menstrual cycle half. The uterine cervix is treated with Myramistin solution.

EFFECT: reduced risk of complications.

FIELD: medicine.

SUBSTANCE: one should carry out antibacterial and infusion therapy. Moreover, additionally, after compensating the volume of circulating blood during infusion therapy one should intravenously inject 30 thousand IU antigangrenous polyvalent equine serum by drops per 200 ml isotonic NaCl solution: the first 1 ml solution should be injected for 5 min, the rest volume - for 1-1.5 h. The innovation suggested enables to optimize immunocorrecting therapy without sensitizing patient's body.

EFFECT: higher efficiency of therapy.

3 ex, 1 tbl

FIELD: immunology.

SUBSTANCE: invention relates to immunoenzyme analysis and can be used for assay of von Willebrand factor. Method involves immunoenzyme analysis wherein monoclonal antibody 5C3 is used as an immobilizing antibody, and a mixture of biotin-labeled monoclonal antibodies 2H2 and 7D12 is used as a detecting antibody. Also, invention relates to monoclonal antibodies produced by the strain of hybridoma cultured cells Mus musculus L. and directed against von Willebrand factor, and to strains of hybrid cultured cells Mus musculus L. producing indicated monoclonal antibodies. Invention provides the development of highly sensitive method for assay of von Willebrand factor.

EFFECT: improved method for analysis.

9 cl, 1 tbl, 2 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: obtained human antibody or its antigen-binding fragment specifically binds tumor necrosis factor hTNFα. The like antibodies show high affinity relative to hTNFα in vitro and in vivo. Antibodies according to the invention are taken as a full-length antibody or its antigen-binding fragment. The antibodies or their fragments are usable for detecting hTNFα and for inhibiting hTNFα activity in human beings suffering from a disorder in the case of which hTNFα activity is harmful.

EFFECT: wide range of applications of high affinity recombinant antibodies to hTNFα or their fragments of low dissociation kinetics.

15 cl, 11 dwg, 17 tbl

FIELD: medicine, oncology, immunology.

SUBSTANCE: invention relates to humanized antibodies with ErbB2. Invention involves the development of new humanized antibodies raised to tyrosinase receptors of family ErbB2, and to a composition comprising these antibodies. The advantage of invention involves expanding region in using indicated antibodies in cancer treatment wherein receptor of epidermal growth factor, EGFR, is a target of these antibodies.

EFFECT: valuable properties of antibody.

14 cl, 3 tbl, 13 dwg

FIELD: medicine.

SUBSTANCE: the present innovation deals with increasing life duration period due to deteriorating the onset of aging-associated sick states. For this purpose, it is necessary to introduce an agent that inactivates extra-cellular blood DNA into blood circulation. AS such an agent one should apply DNAse, antibody anti-DNA, enzymes that alter chemical structure of extra-cellular blood DNA, and, also, agents that stimulate synthesis or activity of endogenous DNAse or that of antibodies that bind extra-cellular blood DNA. The method provides high therapeutic effect in case of no direct impact upon genetic apparatus of aging cells.

EFFECT: higher efficiency.

6 cl, 8 ex, 4 tbl

FIELD: biotechnology, immunology, molecular biology, medicine, pharmacy.

SUBSTANCE: invention describes the isolated human antibody or its antigen-binding fragment able to bind the human tumor necrosis factor (TNF-α). Amino acid sequence is given in the description. Invention discloses nucleic acid encoding heavy and light chain of isolated human antibody. Nucleotide sequences are given in the description. Invention describes recombinant vector expressing variable region of heavy and light chains of isolated human antibody, Chinese hamster ovary cells CHO dhfr- carrying vector. Invention discloses a method for synthesis of isolated human antibody. The isolated human antibody or its antigen-binding fragment can be used as an active component of pharmaceutical composition used in treatment of disturbances when activity of TNF-α is harmful. Using the invention allows neutralization of effect of TNF-α in case when its activity is harmful. Invention can be used in medicine.

EFFECT: valuable medicinal properties of antibody, improved method for synthesis.

17 cl, 11 dwg, 17 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: binding structure is to be bound in tumor cells and/or to tumor cell surface. Target structure available and/or expressing in the tumor cells and/or on tumor cell surface. The binding structure recognizes and blocks the target structure. Substance binding to the target structure or blocks the target structure expression is described. Pharmaceutical compositions comprise the binding structure, target structure or the substance as active principle. Methods for making phage selection, and methods for making in-vitro and in vivo diagnosis and prognosis and methods for treating malignant human diseases provide for the materials usage.

EFFECT: enhanced effectiveness in treating tumor diseases.

42 cl, 14 dwg, 4 tbl

FIELD: medicine, veterinary science.

SUBSTANCE: the present innovation deals with treating malignant tumors, or infections, caused by bacteria, fungi and protozoa, or atherosclerosis, or diabetes mellitus, or diseases associated with delayed-type reaction of hypersensitivity, or diseases developed due to mutations of somatic cells' genes. For this purpose, one should introduce an agent that binds blood extra-cellular DNA, or an enzyme to alter chemical structure of blood extra-cellular DNA, or blood should be supplemented with an agent that stimulates either the synthesis or activity of endogenous desoxyribonuclease or an agent that stimulates the synthesis of antibodies that bind blood extra-cellular DNA. The innovation suggested enables to obtain high efficiency of low-toxic etiological treatment of the diseases mentioned above.

EFFECT: higher efficiency of therapy.

3 cl, 3 dwg, 14 ex, 10 tbl

FIELD: medicine, oncology, gastroenterology, immunobiotechnology.

SUBSTANCE: invention describes an antibody or its derivative, or its fragment showing the structure able to bind the target structure. Antibody is located inside and on surface of human gastroenteric tract epithelial tumor cells and in subpopulation of normal gastroenteric tract epithelial cells. Indicated binding structures comprise sequences determining the complementarity of the region (CDR) in light chain comprising in main amino acids at number 23-33 (CDR 1), 49-55 (CDR 2), 88-98 (CDR 3) of amino acid sequence represented in SEQ ID NO:2, and CDR sequence in heavy chains comprising in main amino acids at number 158-162 (CDR 1), 177-193 (CDR 2), 226-238 (CDR 3) of amino acid sequence represented in SEQ ID NO:2, or other binding structures with similar unique binding properties. Also, invention describes the target-structure located inside or on surface of tumor cells: vaccine composition designated for treatment of malignant disease in human and comprising abovementioned antibody. Also, invention describes methods for treatment and diagnosis of malignant disease. Using this invention provides preparing antibodies that relieve identification of new phenotype-specific tumor-associated antigens, to predict and treat metastatic human diseases. Invention can be used in medicinal practice.

EFFECT: valuable medicinal properties of antibodies.

37 cl, 21 dwg, 4 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: the present innovation deals with immunobiological medicinal preparations applied for intravenous injection at correcting immunodeficient states of different genesis. One should immunize animals with human thymus gland's cells, isolation of immune plasma, its depletion with plasmatic proteins AB (IV) human blood group followed by plasmatic fractioning with PEG 6000 and 20000, depleting semi-product with cellular components of the mixture of all four human blood groups and purification of the target product with PEG 6000. As a stabilizing agent on should apply glycine.

EFFECT: more simplified method.

4 cl, 3 ex

FIELD: medicine, oncology, biochemistry.

SUBSTANCE: invention relates to fused proteins, namely to the multifunctional fused protein cytokine-antibody. This fused protein involves immunoglobulin region and cytokine fused protein of the formula IL-12-X or X-IL-12 wherein interleukin-12 (IL-12) represents the first cytokine and X represents the second cytokine taken among the group comprising IL-2, IL-4 and GM-CSF bound covalently either by amino-end or carboxyl-end to subunit p35 or p40 of interleukin-12 (IL-12) in its heterodimeric or a single-chain form. Indicated fused cytokine protein is fused by either its amino-end or carboxyl-end with indicated region of immunoglobulin. Multifunctional fused protein cytokine-antibody shows an anticancer activity.

EFFECT: valuable medicinal properties of protein complexes.

13 cl, 40 dwg, 18 ex

Up!