Recombinant plasmid dna pfgm17 encoding polypeptide of human granulocytic-macrophagal colony-stimulating factor and strain of bacterium escherichia coli bl21(de3)/pfgm17 as producer of polypeptide of human granulocytic-macrophagal colony-stimulating factor

FIELD: biotechnology, microbiology, genetic engineering.

SUBSTANCE: invention describes construction of recombinant plasmid DNA pFGM17 encoding constitutive synthesis of polypeptide of human granulocytic-macrophagal colony-stimulating factor (GM-CSF) and consisting of Kpn I/Eco RI-fragment of plasmid pSPF1 DNA and artificial DNA sequence encoding signal peptide of the protein Caf1 from Yersinia pestis, and also Kpn I/Eco RI-fragment of intermediate plasmid pSK-GM comprising the synthetic human gene GM-CSF. Escherichia coli cells are transformed with plasmid DNA pFGM17 and strain E. coli BL21(DE3)/pFGM17 is prepared that is a producer of human polypeptide GM-CSF. Invention provides enhancing technological effectiveness and economy of process for preparing recombinant FM-CSF due to excluding the induction stage in biosynthesis process and in simultaneous increasing the yield of the end product by 2 times. Invention can be used for preparing human granulocytic-macrophagal colony-stimulating factor.

EFFECT: valuable properties of plasmid DNA and microorganism strain.

2 cl, 4 dwg, 4 ex

 

The invention relates to biotechnology, particularly genetic engineering. Can be used to produce granulocyte-macrophage colony-stimulating factor (GM-CSF) human.

Granulocyte-macrophage colony-stimulating factor man (GM-CSF) can be used in the treatment of various pathological conditions of the immune and hematopoietic systems (anemia and myelodysplastic syndrome, neutropenia, AIDS and others), effects of radiation and chemotherapy of neoplastic diseases [C.M. Sakamoto, Golde D.W., Gasson J.C. The biology and clinical applications of granulocyte-macrophage colony-stimulating factor. J. of Pediatrics, 1991, v.118, no. 3, p.s17-s20], and also in immunotherapy for cancer in vitro activation of dendritic cells and stimulation of the immune response to cancer antigens [Nestle F.., Alijagic s, Gilliet m, Sun y, Grabbe s, Dummer R, Burg g, Schadendorf D. Vaccination ofmelanoma patients with peptide - or tumor lysine - pulsed dendritic cells. Nature Med., 1998, v.4, p.328-332].

Known methods for producing GM-CSF person, based on expression in transformed mammalian cells [Wong G.G., Witek J.S., Temple, P.A., Wilkens C.M., Leary C, Luxenberg D.P., Jones, S.S., Brown, E.L., Kay R., Orr E.G., Shoemaker C., Golde D.W., R.J. Kaufman, Hewick R., Wang, E.A., Clark, S.C. Human GM-CSF: Molecular cloning of the complementary DNA and purification of the natural and recombinant proteins. Science, 1985, v.228, No. 4701, p.810-815] and in yeast [Miyajima A., Otsu K., Schreurs J., M.W. Bond, J.S. Abrams, K. Arai Expression ofmurine and human GM-CSF in S. cerevisiae: mutagenesis of the potential glycosvlation sites. EMBO J., 1986, v.5., No. 6, p.1193-1197. The disadvantage of the first method is the extremely low yield of the target product (50 µg of protein from 1 l of medium). Yeast cells provide a higher level of synthesis (0.5 mg from 1 l of medium), but in this case, an obstacle to the use of the drug is species-specific post-translational glycosylation.

Microbiological synthesis is a promising method for receiving GM-CSF person. Closest to the claimed method is described in [R.T. Libby, G. Braedt, Kronheim S.R., C.J. March, L. Urdal, Chiaverotti S.R., Tushinski RJ Mochizuki D.Y., Hopp T.P., Cosman D. Expression and purification of native human granulocyte-macrophage colony-stimulating factor from an e. coli secretion vector. DNA, 1987, v.6, №3, p.221-229]. Recombinant plasmid DNA contains a gene artificial predecessor GM-CSF person, which consists of a sequence that encodes a signal peptide OmpA of E. coli and cDNA of the Mature GM-CSF person under the control of the hybrid promoter Ipp-lac.

Protein synthesis is carried out with the addition of the inducer, isopropyl-β-D-thiogalactopyranoside (IPTG), to a final concentration of 2 mm. The synthesized target protein after cleavage of the signal sequence is in the insoluble state. The obtained protein is purified using ion exchange and hydrophobic chromatography under denaturing conditions, followed by renaturation. The result is a Mature GM-CSF person the century with a total yield of 2.5 mg/l of culture fluid.

The disadvantage of this method is the relatively low level of synthesis of GM-CSF and the use of large quantities of IPTG for induction.

The invention solves the problem of obtaining a polypeptide with properties of GM-CSF person by constitutive synthesis, and increase the level of its biosynthesis in bacterial cells.

The problem is solved by constructing recombinant plasmid DNA pFGM17 that encodes a constitutive synthesis of the polypeptide with properties of GM-CSF human and Escherichia coli strain BL21(DE3)/pEGM17 for synthesis of this polypeptide with the level of expression of at least 15% of the total cellular protein. High constitutive level of synthesis of the target polypeptide is provided that plasmid pFGM17 has a high copiesto and contains the lac promoter of E. coli, in which the strains are not superproducers lac-repressor, acts as constitutive.

Recombinant plasmid DNA pFGM17 encoding a polypeptide with the structure of the GM-CSF is characterized by the following features:

has a molecular mass of 2,04 Md (3,133 KBP);

encodes the amino acid sequence synthetic precursor of GM-CSF person;

consists of Cloned/EcoRI - fragment DNA plasmids pSPFl [Peter LE, Kryukov E.A., Yakimov S.A., Wolfson A.N., Alibaeva R.A., Gusev A.A. Abramov, V.M., Korobko V.G. Influence of topog is the her site signal peptidases on the efficiency of secretion in periplasm Escherichia coli recombinant granulocyte-macrophage colonystimulating factor of the person. Bioorgan. chemistry, 1995, CH, No. 12, s-919] length 2,686 KBP containing the lac promoter of E. coli, the gene bla β-lactamase fragment of the lacZ gene of E. coli, plot ori of replication initiation and artificial sequence DNA encoding the signal peptide of the protein Cafl Yersinia pestis; and kpni restriction sites/EcoRI fragment of the intermediate plasmid pSK-GM length 447 BP, including synthetic gene GM-CSF person;

contains: lac promoter of E. coli, a synthetic gene artificial predecessor GM-CSF human gene bla β-lactamase, which determines the stability of the transformed plasmid pFGM17 cells to ampicillin, plot ori of replication initiation; the unique recognition sites of restriction endonucleases, with the following coordinates: Cloned - 280, PST - 293, BglII - 309, NcoI - 333, Xhol - 474, BamHI - 688, SalGI - 700, ClaI - 710, EcoRI - 727.

A distinctive feature of the proposed plasmid constructions is that the nucleotide sequence of the Mature GM-CSF together with a sequence that encodes a signal peptide protein Cafl Yersinia pestis, is part of the artificial gene predecessor, which is under the control of the lac promoter of E. coli. When using strains of E. coli, which is the superproducers lac-penpeccopa (laclq-strains, e.g., JM101), for induction of promoter and synthesis of the target protein requires the addition of IPTG at low concentrations (0.1 mm). In strains, which SuperPro what acetami lac-penpeccopa (for example, BL21(DE3)), expression of this gene is not dependent on the presence of inducer, which provides highly effective constitutive protein synthesis, precursor, which is cleaved by a signal peptidase cells of bacteria with the formation of the Mature GM-CSF (target product).

The use of the secretory apparatus of bacterial cells for heterologous expression has several advantages, in particular, allows to obtain the target protein, devoid of N-terminal methionine, in a soluble state from periplasm, bypassing the stage of destruction of the cell wall. In addition, the presence of a sequence that encodes a signal peptide at the 5'end of the gene artificial predecessor is able to overcome the difficulties often associated with the expression of GC-rich sequences. The use of the signal sequence Cafl Yersinia pestis is due to the fact that this protein, which is a component of bacterial capsules, is synthesized and secreted with high efficiency.

N-terminal sequence of the Mature GM-CSF contains an arginine residue and, therefore, carries a positive charge, a negative effect on the efficiency of cleavage of the signal sequence [Yamane K., Mizushima S. Introduction of basic amino acid residues after the signal peptide inhibits protein translation across the cytoplasmic membrane of E. coli. J. Biol. Chem., 1988, v.263, No. 36, p.19690-19696]. To eliminate this effect the Oia residue asparagine at position (-2) relative to the site of cleavage was replaced by an aspartic acid residue, that led to the charge neutralization of the site and to improve the efficiency of cleavage of the signal sequence. Primary structure of the Mature GM-CSF was not changed. This change was made by cloning the oligonucleotide duplex appropriate structure (see example 1) between the sites of cleavage of restricted Kpnl (3'-end portion sequence that encodes a signal peptide) and BglII (5'end of the gene gmcsf).

Expression of the hybrid precursor in cells of E. coli is accompanied by a partial translocation of the Mature GM-CSF in periplasmatic space, where the target protein can be isolated in soluble form, however, a large part of the protein after cleavage of the signal sequence remains in the insoluble state. For his selection, the use of denaturing agents.

To obtain strain-producer of the polypeptide with the structure of GM-CSF person transform competent cells of Escherichia coli BL21(DE3) recombinant plasmid pFGM17.

The resulting strain Escherichia coli BL21(DE3)/pFGM17 characterized by the following features.

Morphological features. Cells are small rod-shaped, gram-negative, risperadone, 1×3-5 µm, motile.

Cultural characteristics. During growth on solid medium LA colonies are round, smooth, translucent, nl is Stewie, gray, smooth edge, the diameter of the colonies 1-3 mm; the pasty consistency. Growth in LB liquid medium is characterized by a smooth blurred with the formation of light draught.

Physical and biochemical characteristics. Cells grow at temperatures 4-42°s at the optimum pH of 6.8 to 7.2. As the source of nitrogen used as a mineral salt in ammonium form, and organic compounds in the form of peptone, tryptone, yeast extract, amino acids. As the carbon source used amino acids, glycerol, carbohydrates.

Resistance to antibiotics. Cells are resistant to ampicillin (200 μg/ml), due to the presence of plasmid gene betalactamase.

The strain E. coli BL21(DE3)/pFGM17 provides constitutive synthesis of the polypeptide with properties of GM-CSF of human rights in the amount of not less than 15% of the total cellular protein, which is 2 times higher than in the prototype, in contrast to prototype the operation of induction during in vitro cultivation of strain is required. The combination of the above-mentioned properties of the strain E. coli BL21(DE3)/pFGM17 leads to increased manufacturability of the process of obtaining recombinant polypeptide.

Figure 1 shows the physical map of recombinant plasmid pFGM17; figure 2 is the nucleotide sequence of the synthetic gene artificial predecessor GM-CSF person with the adjacent regulatory what ways: lac - the promoter (1-84 BP), DNA sequence encoding a signal peptide protein Cafl (123-206 BP), gmcsf gene (207-590 BP); initiation and termination codons are shown in bold, underlined sites restricts: kpni restriction sites, Pstl, BgIII and BamHI; figure 3 - amino acid sequence of the polypeptide GM-CSF encoded by the recombinant plasmid pFGM17; figure 4 - electrophoregram lysates of cells of strain-recipient E. coli BL21(DE3) (lane 1), producer strain E. coli BL21(DE3)/pFGM17 (track 2) 13%-Mr. polyacrylamide gel (M - protein molecular weight markers; the arrow indicates the polypeptide GM-CSF).

The invention is illustrated by the following examples.

Example 1. Construction of intermediate recombinant plasmid DNA pSK-GM.

5 μg of plasmid DNA pBluescript (SK)+(Stratagene, USA) is treated sequentially with restrictase Kpnl and SalGI (Fermentas, Lithuania) in a proprietary buffer solutions and from the resulting hydrolysate allocate 0.8%gel low-melting agarose linearized vector plasmid DNA.

5 μg of plasmid DNA pGMS231 [Peter LE, A. Ruzin, Shingareva L.N., Korobko VG "Construction of recombinant strains of Escherichia coli, determining the secretory expression of artificial genes granulocyte-macrophage colony-stimulating factor." Bioorgan. chemistry, 1995, CH, No. 12, s-854] processed jointly by restrictase BglII and SalGI and extracting the aqueous hydrolysate allocate 1%gel low-melting agarose fragment length 0,391 KBP, containing gmcsf gene.

0.5 μg of the obtained fragment length 0,391 KBP and 0.1 μg of the vector portion of the plasmid pBluescript (SK)+ sew using 3 units of T4 DNA ligase (Fermentas, Lithuania) in 20 μl of buffer for ligation (Fermentas) with 50-fold molar excess of oligonucleotide duplex:

CATTGCAACTGCAGATGCGGCACCTGCTA

CATGGTAACGTTGACGTCTACGCCGTGGACGATCTAG

10 μl of the reaction mixture used to transform 100 μl of competent cells of Escherichia coli XL-1 Blue (Stratagene, USA). 1/10 of the total number of cells used for transformation, plated on LB-agar containing 75 μg/ml ampicillin. In the process of sieving cells on the surface of agar add 100 ál of 0.1 M solution of IPTG and 20 ml of 4%solution of 5-bromo-4-chloro-3-indoxyl-β-D-galactoside.

Construction of intermediate recombinant plasmid DNA pSK-GM allows you to use the principles of colour selection to search for clones containing embedded fragment. From growing up white clones secrete plasmid DNA and analyze DNA restriction analysis. Selected plasmid DNA containing the desired set of restriction fragments. Determine the nucleotide sequence selected DNA and finally selected plasmid DNA in which the nucleotide sequence of the gene gmcsf fully compliant with the data shown in figure 2.

Example 2. Construction of recombinant plasmid DNA pFGM17.

5 m the g plasmid DNA pSK-GM processed sequentially by restrictase Kpnl and EcoRI (Fermentas, Lithuania) and from the resulting hydrolysate is isolated in a 1%gel low-melting agarose fragment length 0,447 KBP containing gmcsf gene.

5 μg of plasmid DNA pSPFl treated sequentially with restrictase Kpnl and EcoRI, and the obtained hydrolysate allocate 1%gel low-melting agarose vector DNA length 2,686 KBP

The obtained fragment and vector DNA are combined using a ligase reaction in 20 μl of buffer for ligation (Fermentas)containing 2 units of T4 DNA ligase. 10 μl of the reaction mixture used to transform 100 μl of competent cells XL-1 Blue. 1/10 cells used for transformation, plated on LB-agar containing 75 μg/ml ampicillin. From grown clones secrete the target plasmid DNA pFGM17 and analyze it by processing a set of restriction endonucleases HaeIII, HinDIII, EcoRV, Kpnl and EcoRI, followed by electrophoretic analysis of the lengths of the restriction fragments in 5% polyacrylamide gel.

Finally the structure of the recombinant DNA pFGM17 confirmed by determining the nucleotide sequence in the region of the embedded fragment containing the synthetic gene GM-CSF person.

Example 3. Obtaining and determining the productivity of the producer strain polypeptide with properties of GM-CSF person.

Recombinant plasmid DNA pFGM17 transform competent cells of Escherichia coli BL21(DE3) (Novagen) and get the strain about want polypeptide with properties of GM-CSF person. Cells of E. coli BL21(DE3)/pFGM17 grown at 37°With 20 ml of liquid LB medium containing 75 μg/ml ampicillin, for 16 h on a shaker at 175 rpm Select a sample of 1 ml and centrifuged 5 min at a speed of 6000 rpm, after which the cells are suspended in 100 μl of buffer containing 125 mm Tris-HCl, pH 6.8, 20% glycerol, 3% sodium dodecyl sulphate, 3% mercaptoethanol, of 0.005% bromophenol blue, incubated for 10 min in a boiling water bath, samples of 5 µl analyzed by electrophoresis in a 13% polyacrylamide gel with sodium dodecyl sulfate. Gel paint Kumasi R-250 (figure 4), scan and calculate the percentage of recombinant protein in the lysates using the program Scion Image (Scion Corp., USA). According to the scanning polypeptide GM-CSF is 15% of the total cellular protein.

Example 4. Isolation and characterization of the recombinant polypeptide with properties of GM-CSF person.

Cells of E. coli BL21(DE3)/pFGM17 grown at 37°With 200 ml of liquid LB medium containing 100 μg/ml ampicillin, for 16 h on a shaker at 175 rpm Cells are centrifuged, after which 1 g of wet biomass suspended in 10 ml buffer A (20 mm Tris, pH 8, 300 mm NaCl, 0.1% Triton X-100, 10% sucrose, 1 mm phenylmethylsulfonyl, 5 mm EDTA) and subjected to sonication (6-10 pulses for 10 seconds each) in an ice bath. The precipitate after centrifugation washed 2 times with buffer B (50 The M Tris, pH 8, 20 mm EDTA, 0,5% Triton X-100), dissolved in 2 ml of buffer (10 mm Tris, pH 8, 6 M urea, 10 mm beta-mercaptoethanol, 20 mm NaCl) and applied to a column of Sephadex G-100 (Pharmacia) with a volume of 70 ml, pre-equilibrated with buffer C. the Gel filtration is carried out in the same buffer for 20 h at a speed of elution 2 ml/h Containing purified protein fractions determined by the results of electrophoresis in SDS-page according to laemmli's method.

Renaturation carried out by slowly adding the protein solution to an equal volume of buffer D (10 mm Tris, pH 8.5, 500 mm NaCl, 1 mm EDTA) followed by dialysis in 50-fold volume of buffer E (10 mm Tris, pH 8, 100 mm NaCI, 1 mm EDTA) overnight. The resulting solution is sterilized by filtration through 0.22 μm filter (Millipore).

The described allocation method allows to obtain 1.5 mg of GM-CSF from 1 g of wet biomass, which corresponds to 1.5 mg of protein from 100 mg of freeze-dried biomass.

N-terminal amino acid sequence determined by sequencing machine A and FGF analyzer 120A company "Applied Biosystems", USA. Recombinant GM-CSF person has the following structure N-Terminus of the molecule: Ala Pro Ala Arg Ser Pro Ser...i.e. fully corresponds to the structure of the N-end natural GM-CSF person.

Thus, the claimed technical solution allows to obtain a polypeptide with the structure and properties identical to the structure and properties of natural GM-CSF brow of the ESA; biosynthesis polypeptide constitutive, and the level of its synthesis is not less than 15% of the total cellular protein due to the fact that the gene GM-CSF is under control of the lac promoter of E. coli in the composition vysokonapornoj plasmids. All this greatly increases the adaptability and efficiency of the process of production of recombinant GM-CSF by eliminating the induction stage of the process of biosynthesis while increasing the yield of the target product 2 times.

1. Recombinant plasmid DNA pFGM 17 encoding a polypeptide granulocyte-macrophage colony-stimulating factor, human (GM-CSF), having a molecular weight of 2,04 Md (3,133 KBP) and consisting of Cloned/EcoRI - fragment DNA plasmids pSPFl length 2,686 KBP containing the lac promoter of E. coli, the gene bla β-lactamase fragment of the lacZ gene of E. coli, plot ori of replication initiation and artificial sequence DNA encoding the signal peptide of the protein Cafl Yersinia pestis, and kpni restriction sites/EcoRI fragment of the intermediate plasmid pSK-GM length 0,447 KBP, including synthetic gene GM-CSF man, the sequence of which is shown in figure 2, and containing a unique recognition sites of restriction endonucleases, with the following coordinates: Cloned - 280, PST - 293, BglII - 309, NcoI - 333, Xhol - 474, BamHI - 688, SalGI - 700, ClaI - 710, EcoRI - 727.

2. The bacterial strain Escherichia coli BL21(DE3)/pFGM17 producing polypeptide is granulocyte-macrophage colony-stimulating factor human .



 

Same patents:

FIELD: genetic engineering, in particular production of human granulocyte colony-stimulating factor.

SUBSTANCE: Recombinant plasmid DNA pES3-7 with molecular weight of 3.63 MDa (5907 b.p.) is constructed. Said DNA consists DNA Ndel/Notl-fragment containing sequence of recombinant G-CSF artificial gene, β-lactamase gene; and plasmid pET22b(+) DNA Ndel/Notl-fragment containing promoter and terminator of T-RNA-polymerase transcription, amplifier of 17 phage 10 gene translation. Plasmid pES3-7 contains as genetic marker β-lactamase gene which determines resistance of E.coli cells transformed with plasmid pES3-7 to ampicillin, and unique restriction endonuclease recognition sites existing on the next distance to the right from Ndel-site: Xbal - 38 b.p.; Hpal - 1332 b.p.; Pstl - 4065 b.p.; Pvul - 4190 b.p.; Xhol - 5363 b.p. Obtained plasmid is used in transformation of Escherichia coli cells to produce strain E.coli BL21(DE3)/pES3-7 as subproducer of recombinant G-CSF. Method of present invention makes in possible to produce recombinant G-CSF with high yield (20-30 % based on total cell protein content).

EFFECT: simplified method for production of recombinant G-CSF with high yield.

2 cl, 2 dwg, 2 ex

The invention relates to biotechnology, in particular genetic engineering, and can be used to produce secreted modified colony-stimulating factor granulocyte person (hG-CSF)

The invention relates to biochemistry and biotechnology and can be used for isolation and purification of physiologically active recombinant granulocyte colony-stimulating factor human (RCG-CSF)

The invention relates to biotechnology and Microbiology and is a method of obtaining biomass of recombinant strains of E. coli containing plasmid DNA encoding the biosynthesis of cytokines with the properties of factors, tumor necrosisand(TNF-alpha and TNF-beta), granulocyte colony-stimulating factor (G-CSF) and granulocyte-macrophage colony-stimulating factor (GM-CSF) human and bearing as a selective marker gene bla (resistance to ampicillin)

The invention relates to biotechnology and can be used in the production of recombinant granulocyte-macrophage colony-stimulating factor (GM-CSF) in industrial scale

The invention relates to genetic engineering

The invention relates to biotechnology, and in particular to methods specific cleavage obtained by biotechnology proteins using IgA-protease and especially the methods of production in prokaryotes recombinant proteins or polypeptides with the potential for subsequent removal of the N-terminal sequence

FIELD: biotechnology, microbiology.

SUBSTANCE: inosine and 5'-inosinic acid are prepared by using microorganism of genus Escherichia wherein production of inosine by indicated microorganisms is enhanced by elevating activity of protein encoding by gene yicM. Proposed invention provides elevating yield of inosine and 5'-inosinic acid.

EFFECT: improved preparing method.

8 cl, 3 dwg, 3 tbl, 4 ex

FIELD: biotechnology, molecular biology, microbiology, genetic engineering.

SUBSTANCE: invention relates to a method for preparing an immunogenic polypeptide inducing immune response that represents the protective response against infection with Bacillus anthracis. Proposed immunogenic polypeptide comprises from one to three domains of the full-scale Protective Antigen (PA) from B. anthracis or their variants and at least one of indicated domains represents domain 1 or domain 4 from PA or its variant. These variants of immunogenic polypeptide and full-scale PA are produced as result of expression in E. coli. Also, invention proposes a vector for expression in bacterial cells that comprises nucleic acid encoding abovementioned immunogenic polypeptide. Also, invention the developed method for prophylaxis of infection caused by B. anthracis based on administration of sufficient amount of immunogenic polypeptide. Also, invention proposes a vaccine for prophylaxis of infection caused by B. anthracis that comprises the effective amount of immunogenic polypeptide and a suitable carrier. Invention provides preparing the effective agent used for prophylaxis of infection caused by B. anthracis.

EFFECT: improved preparing method and valuable properties of polypeptide and vaccine.

22 cl, 5 dwg, 3 tbl, 6 ex

FIELD: biotechnology, biochemistry, enzymology, genetic engineering.

SUBSTANCE: invention relates to preparing new strain used for isolation of the new restriction endonuclease Bis I that can be used in detection of the modified DNA. The strain Bacillus subtilis 230 isolated from soil as result of search of producers of restriction endonucleases provides preparing the restriction endonuclease Bis I recognizing and cleaving both chain of DNA nucleotide sequence comprising at least one C5-methylcytosine base in the recognition site 5'-GCNGC-3'.

EFFECT: valuable properties of strain, new enzyme.

1 tbl, 3 dwg, 2 ex

FIELD: biotechnology, gene engineering, microbiology.

SUBSTANCE: invention relates to TUL4spCBD recombinant protein comprising TUL4 Francisella tulergenis protein, Gly-Ser spacer and cellulose-binding domain of CelD endoglucanase gen from Anaerocellum thermophilus. Said protein has TUL protein antigen properties and is capable of spontaneous binding to cellulose-containing sorbents. Described is recombinant plasmid pTUL4spCBD DNA of 4388 n.p. length, encoding TUL4spCBD recombinant protein. Abovementioned plasmid contains: artificial bacterial operon of TUL4spCBD recombinant protein, including promoter region of N5 bacteriophage earlier promoter (7-87 n.p.); TUL4spCBD recombinant protein gene (115-1113 n.p.); transcription terminator (1134-1230 n.p.); beta-lactamase bacterial operon (4183-3323 n.p. of complementary chain)), providing ampicillin resistance; ColE1-type bacterial site of replication initiation, providing plasmid replication in E.coli strain (4388 n.p.). Also discoised is M15[pREP4, pTUL4spCBD] Escherichia coli strain as producer of TUL4spCBD recombinant protein and method for production of purified, concentrated and immobilized TUL4spCBD recombinant protein from said strain by treatment of cell hydrolyzate supernatant from M15[pREP4, pTUL4spCBD] Escherichia coli with cellulose-containing sorbent. Method for production of specific antibodies against TUL4spCBD protein also is described. Said method includes animal immunization with TUL4spCBD recombinant protein immobilized onto cellulose.

EFFECT: method for high yield production of TUL4spCBD recombinant protein; simplified method for purification, concentration and immobilization of said protein.

5 cl, 1 dwg, 4 ex

FIELD: biotechnology, biochemistry, amino acids.

SUBSTANCE: invention relates to a method for producing L-amino acids, for example, L-isoleucine and L-leucine prepared by culturing a microorganisms in medium and able to produce L-amino acid. This microorganism carries the avtA gene encoding enzyme alanine-valine transaminase (transaminase C) and possesses the enhanced activity of this enzyme as compared with it's the parent strain. Accumulated L-isoleucine and L-leucine are isolated from the cultural fluid. Invention provides preparing L-isoleucine and L-leucine with high effectiveness degree by diminishing the amount of amino acid as a by-side product that results to complications in the process of purification of indicated L-amino acids.

EFFECT: improved producing method of amino acids.

8 cl, 1 dwg, 2 tbl, 3 ex

FIELD: biotechnology, microbiology, biochemistry, molecular biology.

SUBSTANCE: for preparing l-lysine method involves carrying out fermentation with using corynebacterium strain producing L-lysine wherein polynucleotide comprising the polynucleotide sequence encoding the component H of phosphotransferase system is enhanced. Prepared L-lysine is isolated. The claimed invention provides enhancing the effectiveness of synthesis of L-lysine by corynebacteria.

EFFECT: valuable properties of strain, enhanced effectiveness of amino acid synthesis.

16 cl, 3 dwg, 1 tbl, 5 ex

FIELD: biotechnology, biochemistry, genetic engineering.

SUBSTANCE: invention proposes a method for construction of genetically modified strains of microorganisms able to destroy steroids. These strains comprise multiple inactivated genes, for example, genes encoding enzymes steroid dehydrogenases implicated in destroying the steroid ring. The gene kstD1 is an example of such genes. Strains comprising the multiple amount of inactivated genes encoding enzymes destroying steroids provides the enhanced effectiveness with respect to accumulation of intermediate steroid compounds. The preferable product of steroid accumulation if 9α-hydroxy-4-androstene-3,17-dione.

EFFECT: improved method for construction of strain.

8 cl, 5 dwg, 7 ex

FIELD: biotechnology, microbiology, genetic engineering, amino acids.

SUBSTANCE: invention describes a microorganism belonging to genus Escherichia used as a producer of L-amino acids with optimized level of expression of gene that effects in disposition of carbon flow, in particular, gene sucAB. Method involves stages for insertion of DNA fragments set into microorganism chromosome synthesized in vitro and comprising regulatory elements of gene expression instead the natural element of regulatory gene region to obtain population of microorganisms and selection of microorganisms showing the enhanced production of L-amino acids. Also, invention describes a method for preparing such L-amino acids as L-glutamic acid, L-proline, L-arginine, L-glutamine, L-leucine by using microorganisms with optimized level of expression of gene sucAB. Invention provides preparing L-amino acids with the high effectiveness degree.

EFFECT: improved preparing method.

15 cl, 1 dwg, 2 tbl, 5 ex

FIELD: biotechnology, microbiology, amino acids.

SUBSTANCE: aromatic L-amino acid is prepared by culturing microorganism belonging to genus Escherichia. This microorganism is modified and shows increased activity of PEP-carboxykinase. Then the accumulated amino acid is isolated from cultural fluid. The claimed invention provides preparing aromatic L-amino acids with the high effectiveness degree.

EFFECT: improved preparing method.

12 cl, 1 dwg, 2 tbl, 4 ex

FIELD: genetic engineering, biotechnology, medicine.

SUBSTANCE: invention relates to the prepared strain of Vibrio cholerae con comprising gene thyA in chromosome a resulting to loss of gene thyA functionality. By transformation of indicated strain with expressing vector comprising the functional gene thyA and gene encoding a homologous or heterologous protein the expression system for preparing indicated homologous or heterologous protein is created. Applying the invention provides enhancing stability of system used in expression of homologous or heterologous protein.

EFFECT: valuable properties of expression system.

8 cl, 17 dwg

FIELD: biotechnology, microbiology.

SUBSTANCE: invention relates to a method for preparing inosine and 5'-inosinic acid that are prepared by using microorganism Escherichia coli. Production of inosine by indicated microorganisms is elevated due to the enhanced activity of protein encoded by gene yijE. Invention provides increasing yield of inosine and 5'-inosinic acid.

EFFECT: improved preparing method, valuable properties of strain.

8 cl, 3 dwg, 2 tbl, 3 ex

Up!