Recessive dividing retroviral vector (variants), method for production thereof (variants), isolated and purified nucleic acid molecule

FIELD: biotechnology, medicine, in particular viral disease treatment.

SUBSTANCE: invention relates to recessive dividing retroviral vector useful in inhibition of wild-type retrovirus replication. Vector contains retroviral long terminal repeat sequences; retroviral packing signal; nucleotide sequence encoding (expressing) genetic antiviral agent; and optionally the second nucleotide sequence. Disclosed are method for production of said vector and reproduction thereof. Further isolated and purified nucleic acid (NA) molecule providing of selective advantage in regard to viral generation packing into virions is disclosed. Uses of retroviral vector in particular for specific antibody production are described.

EFFECT: new genetic antiviral agents generating prolonged and stable immunological responses in regard, for example, to AIDS and cancer viruses.

97 cl, 11 ex

 

This application claims priority in accordance with the application No08/563459, filed November 28, 1995, which is converted to a temporary patent in its entirety is incorporated into this description by reference.

The technical field to which the invention relates.

The present invention relates to conditional can replicate viral vector, methods of preparation, modification, reproduction and selective packaging of such a vector is allocated to a specific nucleic acid molecules and amino acid sequences relating to such vectors, pharmaceutical compositions and cell host containing the vector, and methods of application of the specified vector and the host cell.

The level of technology

The discovery of the fact that the human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS), contributed to the development of numerous studies of the mechanisms of infectious cycle of the virus and viral pathogenese. The study of these mechanisms is researchers increasing the number of targets for the development of antiviral agents, is effective not only for HIV, but also other viruses. These antiviral agents, particularly against HIV, can be divided into groups depending on their modus operandi. Such groups include the inhibitor of the reverse transcriptase, competitors penetration of the virus into cells, vaccines, and protease inhibitors, as well as the newly formed group, referred to here as "genetically anti-virus agents".

In General, each type of anti-virus agent has its own advantages and limitations and must be evaluated from the point of view of a particular therapeutic situation. Antiviral agents such as zidovudine (3'-azido-3'-deoxythymidine, also known as AZT, protease inhibitors, etc. can be relatively easily delivered into the cells of a patient and widely studied. Being aimed at one specific factor infectious viral cycle, such agents find the relative ineffectiveness against HIV. This is mainly due to the fact that the HIV strains quickly change and become resistant to the agents, acting on one locus (Richman, AIDS Res. and Hum. Retrovir., 8, 1065-1071 (1992)).

Accordingly, the problem of genetic variation and rapid mutations in the genomes of HIV creates the need for development of new antiviral strategies for the treatment of HIV infections. Among these areas of genetic antiviral agents are the most promising, since they work in cells at many levels.

Genetic antiviral agents differ from other therapeutic agents because they are the AK molecular elements in the target cell and protect against viral infection (Baltimore, Natura, 325, 395-396 (1988); Dropulic' et al., Hum. Gene Ther., 5, 927-939 (1994)). Genetic antiviral agents can be represented by any genetic sequence and include, but are not limited to antimyeloma molecules, "traps" RNA, transdominant mutants, interferons, toxins, immunogenum and ribozymes. In particular, the ribozymes are antiviral agents that break down RNA targets, including HIV RNA, a sequence-specific manner. Specificity due to ribozyme cleavage of RNA targets involves the use of ribozymes as therapeutic inhibitors of replication of viruses, including HIV. Different types of ribozymes, such as ribozymes in the form of a hammer and studs have been used in various approaches to fight HIV (see, for example, U.S. Patent No. 5144019, 5180818 and 5272262 and patent PCT application no WO 94/01549 and WO 93/23569). Both ribozyme - configuration of the hammer and studs - can be designed to break down any RNA target that contains the sequence GUC (Haseloff et al., Nature, 334, 585-591 (1988); Uhlenbeck, Nature, 334,585 (1987); Hampel et al., Nuc. Acids Res., 18, 299-304 (1990) and Symons, Ann Rev. Biochem., 61, 641-671 (1992)). In General, the ribozymes in the form of a hammer are two types of functional domains, conservative catalytic domain flanked by two hybridization domains. Hybridization domains bind the sequence is, the surrounding sequence GUC and the catalytic domain cleaves the RNA target with 3'-end of the sequence GUC (Uhlenbeck(1987), supra; Haseloff et al. (1988), supra and Symons (1992), supra).

Numerous studies have confirmed that ribozymes can be at least partially effective in the inhibition of the reproduction of HIV in tissue culture cells (see, for example, Sarver et al., Science, 247, 1222-1225 (1990); Sarver et al., NIH Res., 5, 63-67 (1993a); Dropulic' et al., J. Virol., 66, 1432-1441 (1992), Dropulic' et al., Methods: Comp. Meth. Enzymol., 5, 43-49 (1993); Ojwang et al., PNAS, 89, 10802-10806 (1992); Yu et al., PNAS, 90, 6340-6344 (1993) and Weerasinghe et al., J. Virol., 65, 5531-5534 (1991). In particular, Sarver et al. ((1990), supra) demonstrated that ribozymes in the form of a hammer, obtained with the aim of splitting transcribed plot the gag gene of HIV, i.e. anti-gag ribozymes, can specifically cleave RNA gag HIV in vitro. Moreover, when cell lines expressing anti-gag ribozymes were infected with HIV-1, was observed inhibition of HIV replication in 50 to 100 times. Similarly, Weerasinghe et al. ((1901), supra) showed that retroviral vectors encoding the ribozymes designed for splitting sequence U5 RNA HIV-1, determine the resistance to HIV transduced cells with subsequent HIV infection. Although the various clones of transduced cells showed different levels of resistance to infection, which was defined using promotora the system, used to direct the expression of the ribozyme, most of expressing the ribozyme cell lines "could not stand" the expression of HIV after a certain time of cultivation.

It is shown that transduction of tissue culture cells with provirus in the nef gene of which (not being a principal for virus replication in tissue culture) was introduced ribozyme with hybridization domains, specific to the site U5 HIV, inhibits viral replication in transduced cells in 100 effective compared to cells translotsirovannoi previously wild-type (see, for example, Dropulic' et al. (1992) and (1993), supra). Similarly it is shown that the ribozymes in the form of studs inhibit HIV replication in T-cells transduced with vectors containing ribozymes-stud U5, and infected with HIV (Ojwang et al. (1992), supra). Other studies have shown that vectors containing ribozymes expressed with the help of tRNA promoter, also inhibit some strains of HIV (Yu et al. (1993), supra).

Delivery of ribozymes or other genetic antiviral agents to the cellular targets of HIV (e.g., CD4+ T cells and monocytic macrophages) was the main obstacle to effective genetic therapy of AIDS. Existing approaches to providing "targeting" on cells of the haematopoietic system (i.e. primary target of infectious HIV) provides the with the introduction of therapeutically active genes in multipotential stem cell precursors, which differentiate and produce Mature T cells or, alternatively, Mature CD4+ T-lymphocytes. However, the provision of "targeting" on stem cells is problematic, as these cells are difficult to cultivate and transductional in vitro. Focus on circulating blood T-lymphocytes is also problematic, because they are so widely disseminirovanne in the body that all target cells is difficult to achieve when using existing vector delivery systems. Moreover, macrophages should be considered as a cellular target because they are the main reserve for the transmission of the virus to other organs. However, since macrophages are the terminal differentiated cells and therefore do not undergo cell division, they are difficult to transducible using commonly used vectors.

Accordingly, the dominant contemporary approach to HIV treatment involves the use of replication-defective viral vectors and packing (i.e. the "helper" (auxiliary)) cell lines (see, for example, Buchschacher, JAMA, 269 (22), 2880-2886 (1993); Anderson, Science, 256, 808-813 (1992); Miller, Nature, 357, 455-460 (1992); Mulligan, Science, 260, 926-931 (1993); Friedmann, Science, 244, 1275-1281 (1989) and Cournoyer et al., Ann Rev. Immunol., 11, 297-329 (1993)) for introduction into cells susceptible to viral infection (such as HIV infection) a foreign gene, which is elficiency interferes with viral replication or cause the death of infected cells (review Buchschacher (1993), supra). Such replication-defective viral vectors also contain a foreign gene of interest, CIS-acting sequences required for replication of the virus, but not the sequences that encode the major viral proteins. Therefore, this vector is not able to implement a full cycle of viral replication, and distribution uses line helper cells, which contain in their genome and constitutively expresses viral genes in its genome. After the introduction replication-defective viral vector in line helper cells, the vector gets trans-follows proteins needed for the formation of viral particles, and is formed vector viral particles capable of infecting target cells and Express them in a gene that interferes with viral replication or cause the death of virus-infected cells.

Such replication-defective retroviral vectors include adenoviruses and adeno-associated viruses, and the retroviral vectors used in clinical trials of gene therapy for HIV, in particular murine amphotropic retroviral vector, known as a virus murine leukemia mice, Malone (MuLV). These defective viral vectors were used for transduction of CD4+ cells genetic antiviral agents, is akimi as anti-HIV ribozymes, with varying degrees of success (Sarver et al. (1990), supra; Weerasinghe et al. (1991), supra; Dropulic' et al. (1993), supra; Ojwang et al. (1992), supra, and Yu et al. (1993), supra). However, these vectors by their nature are of limited use in gene therapy of HIV. For example, high frequency transduction is particularly important in the treatment of HIV, where the vector should transducible or rare hematopoietic CD34+stem cell precursors, or widespread in the body of CD4+ T-cell targets, most of which are in clinical "latent" stage of the disease are already infected with HIV. However, it is difficult to obtain MuLV vectors in high titers, which leads to inefficient transduction. Moreover, CD34+ stem cells-the precursors is not received long-term expression of transductional DNA, especially after differentiation into Mature T-lymphocytes. In addition, use of defective viral vectors requires strategies of gene transfer ex vivo (see, for example, U.S. Patent No. 5399346), which can be expensive and unaffordable for the majority of the population.

These drawbacks associated with the use of currently available vectors for genetic therapy of AIDS, has led to the development of new viral vectors. One of these vectors is HIV itself. HIV vectors were used to study the infectivity (Page et al., J. Virol., 64, 5270-526 (1990)) and for the introduction of genes (such as suicide genes in CD4+ cells, particularly in HIV-infected CD4+ cells (see, for example, Buchschacher et al., Hum. Gener. Ther., 3, 391-397 (1992); Richardson et al., J. Virol., 67, 3997-4005 (1993); Carroll et al., J. Virol, 68, 6047-6051 (1994) and Parolin et al., J. Virol., 68, 3888-3895 (1994)). The strategy of these studies is the use of HIV vectors for introduction of genes in CD4+ T-cells and monocytes.

Currently, however, these vectors are extremely complex. Moreover, the use of vectors is accompanied by a risk of generation of HIV wild type intracellular recombination. Cotransfected/confezione defective vector sequences and helper virus, as has been shown, leads to recombination between homologous sites of viral genomes (Inoue et al., PNAS, 88, 2278-282 (1991)). The observed in vitro complementation indicates that in such replication-defective HIV vector in vivo could occur recombination, thereby exacerbating already existing HIV infection. The fact that retroviruses package two RNA genome into a single virion, has led researchers to suggest that retroviruses contain two viral RNA in order to circumvent any genetic defects caused by complementation and/or recombination (Inoue et al. (1991), supra).

In addition to the risk of intracellular recombination, which is formed of HIV wild-type HIV-vectors find the associated figure is mutation in vivo, which increases the pathogenicity of the viral vector. This led Sarver et al. (AIDS Res. and Hum. Retrovir., 9, 483-487 (1993b)) by the assumption on the development of recombinant HIV-vectors of the second generation, which are replication-competent but non-pathogenic. Such vectors in comparison with widely used nerealizirane vectors (i.e. replication defective vectors) continue to replicate in the body of the patient, thus ensuring constant competition with wild-type HIV. However, the inventors do not have the specified vectors.

Ideally, the best opportunity to cure the infected individual exists at the time of inoculation, even before the virus infects the host. However, it is difficult to implement, since many individuals to clinical latent phase of the disease do not imply that they are infected with HIV. Thus, the stage at which antiviral treatment is most needed, is a clinical latent phase of the disease. Therapy at this stage requires you to attack a large number of already infected CD4+lymphocytes, which contain viral genomes, was recorded. It's not so simple, as evidenced by the fact that at the moment AIDS remains incurable and weakly influenced by modern methods of treatment. An effective vaccine procurement is not developed and although it has been shown that inhibitors of reverse transcriptase and protease inhibit HIV replication in tissue culture, the generation of viral resistance in vivo has not resulted in a successful therapeutic approaches. Thus, gene therapy for HIV may not be of great significance for the vast majority of HIV-infected individuals, the number of which is expected to exceed 40 million by the year 2000.

In light of the above, is becoming increasingly important in generating long-term and sustainable immunological response against certain pathogens, especially viruses, in particular, in the context of AIDS and cancer. Received live attenuated (LA) vaccines using replication-competent but non-pathogenic viruses (Daniel et al., Science, 258, 1938-1941 (1992) and Desrosiers, AIDS Res. & Human Retrovir., 10, 331-332 (1994)). However, such non-pathogenic viruses that are different from those of wild-type viruses with deletions in one or more genes, either (1) cannot induce a protective immune response, because there is no persistence of the antigen (as LA-virus is not efficiently can replicate), or (2) LA-virus is replicated, but has a different pathogenic potential, as evidenced by the ability of LA-virus to cause disease in young animal models (Baba et al., Science, 267, 1823-1825(1995)).

For the above reasons remains necessary is the cost of developing alternative prophylactic and therapeutic methods of treating a viral infection, especially AIDS and cancer. The present invention provides such alternative means by conforming vector can replicate. The invention also relates to additional methods that can be used this vector. These and other objects and advantages of the present invention, as well as additional features of the invention will be apparent from the following description of the invention.

The invention

The present invention relates to conditional can replicate viral vector, which is characterized by the ability to replicate only in cells-master of permissive for replication of the vector.

According to another variant of the invention, the conditional can replicate the viral vector contains at least one sequence of a nucleic acid, the presence, transcription or translation which provides vector in replication-permissive cell host selective advantage to the virus strain wild type virus from which the vector.

According to another variant of the invention, the conditional can replicate the viral vector, which preferably is a retrovirus that contains at least one nucleic acid sequence, n is the existence, transcription or translation which provides the cell host that is infected by the vector, a selective advantage to the cell that is infected with the virus strain wild type corresponding to the virus from which the vector.

In the present claimed invention is also a pharmaceutical composition comprising conditioned can replicate the viral vector and a pharmaceutically acceptable carrier. Declared and a host cell containing conditioned can replicate the viral vector. Another object of the invention is a vector, which in the case of a DNA vector contains the nucleotide sequence selected from the group comprising SEQ ID No 2, 3, 4, 5, 6, 14, in which at least one of the nucleotides (N) is mutated, 15 and 16, and in the case of RNA vector contains the nucleotide sequence encoded by a nucleotide sequence selected from the group comprising SEQ ID No 2, 3, 4, 5, 6, 14, in which at least one of the N is mutated, 15 and 16, as well as selected and indicated purified molecules of nucleic acid. Also stated method of constructing vector with the ribozyme methods of modification of the vector and the mode of reproduction and selective packaging conforming vector can replicate without the use of packing cell line.

Another object of the present invention is pic is b therapeutic and prophylactic treatment of the host cell during viral infection. Such methods can include the appropriate additional use helper expressing vector, cytotoxic drugs, proteins/factors or inhibitors protease/reverse transcriptase accordingly. The method can be used, for example, for inhibition of virus replication, cancer treatment, gene transfer in vivo or for expression of the gene of interest in a cell host.

Another object of the present invention is a method of using a host cell containing a conforming vector can replicate, for detection of interaction between drug substance/factor and protein. This method allows the characterization of the protein and screening activity of medicinal substances/factors in relation to this protein.

List of figures

In Figures 1A-1E presents a schematic picture of the structure of the viral genome that is present in wild-type HIV (Figa), cgwic-1.1 (Pigv), cgwic-1.11 (Figs), cgwic-1.12 (Fig.1D), cgwic-1.111 (Fige).

Designation: cr - conforming can replicate; U5 - U5-coding sequence; Rz - ribozyme; φ - packaging signal; gag, pol and env coding sequences of the proteins that form the viral core, reverse transcriptase and envelope of the virus, respectively; tat, rev, rre and nef - additional VI is asnie genes; unfilled rectangles - viral long terminal repeats. Crosses in the encoding section U5 wild-type and indicated the approximate loci, in which ribozymes in accordance with the claimed invention decompose RNA U5 wild type, but not modified PHK U5, cgwic (i.e. "mU5").

The Figure 2 shows the DNA sequence of U5 RNA HIV wild-type (SEQ ID No1) (a) and modified RNA U5, cgwic (SEQ ID No2) (In). Numbers denote the number of bases that are located below the area of the start of transcription.

The Figure 3 presents a plot of the activity of reverse transcriptase (cpm/μl) time (days after cotransfection) called for cgwic inhibition of HIV replication in wild-type Jurkat cells, cotransfection HIV wild-type and cgwic-1.1 (empty rectangles), HIV wild-type and cgwic-1.11 (unpainted crossed rectangles), HIV wild-type and cgwic-1.12 (non-shaded rectangles) and HIV wild-type and control plasmid pGEM-3Z (black rectangles).

The Figure 4 presents a plot of the activity of reverse transcriptase (cpm/μl) time (days after cotransfection) called for cgwic inhibition of HIV replication in wild-type Jurkat cells, cotransfection HIV wild-type and cgwic-1.1 (empty rectangles), HIV wild-type and cgwic-1.11 (unpainted negate the haunted rectangles) HIV wild-type and cgwic-1.12 (non-shaded rectangles) and HIV wild-type and control plasmid pGEM-3Z (black rectangles).

In Figures 5A-5C shows a schematic image of the primers and probes used for detection of RNA transcripts U5 HIV wild-type (Figa), cgwic-1.1 (Pigv), cgwic-1.111 (Figs). Legend: U5 - U5-coding sequence; φ - packaging signal; gag, pol and env coding sequences of proteins that form the core of the virus, reverse transcriptase and envelope of the virus, respectively; empty rectangles - viral long terminal repeats; black rectangles sequence encoding tat and rev, and D, V1, V2, V3, R1 and R2 primers used for viruses can replicate wild-type and/or conditioned viruses can replicate. The cross in the encoding section U5 wild-type and marked the approximate locus in which ribozymes in accordance with the claimed invention decompose RNA U5 wild type, but not modified RNA U5, cgwic (i.e. "mU5").

Information confirming the possibility of carrying out the invention

The present invention relates to a method of inhibiting replication of a virus strain wild type. The method involves providing contact the owner, which is able to be subjected to infection with this strain of wild-type virus, prepact the positive indeed with this strain of wild-type virus, with vector, breeding only in the host, which is permissive for replication of the vector (i.e. non-pathogenic conforming can replicate (cr) vector).

As hereafter described, the main purpose of this method is the generation of competitive infection in the host organism using a non-pathogenic conforming vector can replicate. In General, the conditional can replicate the vector according to the invention contains at least one sequence of nucleic acid, which leads to a selective advantage for replication and distribution conforming vector can replicate in comparison with wild-type virus, and/or at least one sequence of nucleic acid, which leads to a selective advantage for the propagation of viral particles in the cell host containing a conforming vector can replicate in comparison with the host-cell containing the wild-type virus.

According to a preferred variant of the invention, the vector contains the sequence of HIV and is used to treat HIV infection. Thus, a vector or a host cell carrying the vector contains at least one nucleic acid sequence which (1) provides genome of cgwic selective advantage over the genome of wild-type HIV from the point of view of the Oia packaging of progeny virions (i.e. in cells where both virion) and/or (2) provides the cell-master, producing conforming can replicate the vector (virus) selective advantage from the point of view of formation of virions, cgwic compared to the host-cell, producing the wild-type virus. One way (which the invention is not limited to) provide the genomes of cgwic selective advantage from the point of view of the packaging by putting them one or more ribozymes, is able to cleave the HIV genome of the wild type.

The Wild-Type virus

According to the invention the virus is an infectious agent composed of protein and nucleic acids and uses genetic mechanisms of host cell for the formation of viral products encoded by the viral nucleic acid. "Nucleic acid" means a polymer of DNA or RNA, which is one or donativum, linear or circular, and (optionally) contains a synthetic, non-natural or modified nucleotides that can be included in the polymers of DNA or RNA. Polynucleotide DNA preferably consists of a sequence of genomic or cDNA.

"The strain of wild-type virus is a strain that does not contain any generated human mutations, i.e., any virus that may be isolated from natural sources is of IKI. Alternatively, the wild-type strain is any virus that is cultivated in laboratory conditions but in the absence of any other virus capable of forming genomes or progeny virions, such a natural. For example, a molecular clone of HIV pNL 4-3, described in the following Examples, is a wild-type strain, which is obtained in accordance with the AIDS Reserch and Reference Reagent Program Catalog of the National Institute of health (see also Adachi et al., J. Virol., 59, 284-291 (1986)).

In General, the method described in this application, is preferably used for the treatment of viral diseases that develop as a result of viral infection. It is desirable that the virus (or vector, as discussed below) were RNA-virus, but it can be a DNA virus. RNA viruses are a diverse group of viruses that infect prokaryotes (e.g., bacteriophages), as well as many eukaryotes, including mammals, in particular humans. The genome of most RNA viruses presents single-stranded RNA, although at least one collection of genetic material presents double RNA. RNA viruses are divided into three main groups: viruses with a positive chain (i.e. portable virus genome is translated with the formation of protein, and deproteinizing nucleic acid of the virus is enough to start infecti is), viruses with a negative chain (i.e. portable virus genome is complementary sense and should be transcribed virion-associated enzymes that could be broadcast), as well as denitive RNA viruses. The method according to the present invention preferably use against viruses with a positive chain of viruses with a negative chain and double strand RNA viruses.

As indicated in the present description, an RNA virus belongs to Sindbis-like viruses (for example, Togaviridae, Bromovirus, Cucumovirus, Tobamovirus, Ilarvirus, Tobravirus and Potexvirus), a picornavirus-like viruses (for example, Picornaviridae, Caliciviridae, Comovirus, Nepovirus and Potyvirus), viruses with a negative circuit (e.g., Paramyxoviridae, Rhabdoviridae, Orthomyxoviridae, Bunyaviridae and Arenaviridae), donativum viruses (for example, Reoviridae and Birnaviridae), flavivirus-like viruses (for example, Flaviviridae and Pestivirus), retrovirus-like viruses (for example, Retroviridae), Coronaviridae and other groups of viruses, including but not limited to Nodaviridae.

Preferred RNA virus of the invention is a virus of the family Flaviviridae, preferably a virus of the genus Filovirus and especially virus Marburg or Ebola. Preferably, the virus family Flaviviridae was a virus of the genus Flavivirus, such as yellow fever virus, West Nile virus, the virus encephalitis San Louis, Japanese encephalitis virus, the virus encephalitis valley Muir is her the virus Rocio, tick-borne encephalitis virus, etc.

In addition, preferred is a virus of the family Picornaviridae, in particular the hepatitis a virus (HAV), hepatitis b virus (HBV) or hepatitis neither-A nor-Century

Other preferred RNA virus is a virus of the family Retroviridae (e.g. retrovirus, in particular a virus of the genus or subfamily Oncovirinae, Spumavirinae, Spumavirus, Lentivirinae, and a Lentivirus. Preferably, an RNA virus of the subfamily Oncovirinae was a T-lymphotropic (on T-cells) virus type 1 or 2 (i.e. HTLV-1 or HTLV-2) or a virus bovine leukosis (BLV), the virus leucosarcia birds (e.g. sarcoma virus rose (RSV), a virus myeloblastosis birds (AMV), the virus erythroblastosis birds (AEV) and rouse-associated virus (RAV; RAV-0 to RAV-50), the virus mammalian C-type (for example, leukosis virus of mice, Malone (MuLV), the virus Kaposi Harvey mice (HaMSV), the virus leukemia mice Abelson (A-MuLV), AKR-MuLV virus leukemia cats (FeLV), sarcoma virus monkeys, the virus reticuloendotheliosis (REV), virus, spleen necrosis (SNV), the virus-type (e.g., virus, tumors of the mammary gland of mice (MMTV)and virus D-type (e.g., simian virus Mason-Pfizer (MPMV) and viruses "SAIDS"). RNA viruses of the subfamily Lentivirus preferably are the human immunodeficiency viruses types 1 and 2 (i.e. HIV-1 or HIV-2 HIV-1 used to be called with lymphadenopathy virus 3 (HTLV-III) and the virus associated with syndrome the acquired immunodeficiency syndrome (AIDS) (ARV)), or other virus, relatives of HIV-1 or HIV-2, which was identified and associated with AIDS or AIDS-like disease. The acronym "HIV" or the terms "AIDS virus" or "human immunodeficiency virus" are used here in relation to HIV and HIV-like and HIV-associated viruses. Moreover, RNA virus of the subfamily Lentivirus preferably is a virus Visna/Maedi (for example, infecting sheep), human immunodeficiency virus cats (FIV), bovine lentivirus, human immunodeficiency virus monkeys (SIV), a virus infectious anemia of horses (EIAV) and the virus arthritis-encephalitis goats (CAEV).

The virus according to the invention preferably is a DNA virus. Preferably, the DNA virus is a virus Epstein-Barr, adenovirus, herpes simplex virus, human papilloma virus, the virus vaccine, etc.

Many of these viruses are classified as pathogens "Biosafety Level 4" (i.e., 4-Oh-risk" classification of the world health organization (who), which require certain equipment in all laboratory studies carried out with them. However, the usual qualified technician familiar with the safety precautions, providing the security necessary to work with these viruses, and able to meet them.

"A host cell" can be any cell, and presupposes the equipment is a eukaryotic cell. Preferably, a host cell was a lymphocyte (e.g., T-lymphocyte or macrophage (e.g., monocytic-macrophage) or a predecessor of any of these cells, such as hematopoietic stem cell. Preferably, the cells expressed on the cell surface of CD4+ glycoprotein, i.e. were CD4+cells. It is desirable, however, that CD4+ T-lymphocyte that has been infected with the AIDS virus, has not yet been activated (i.e. it is preferable that the expression of a gene net has not started yet, and even more preferably the lack of regulation according to the type of feedback gene expression of CD4, as will be discussed below). Moreover, preferably, a host cell was a cell that does not have a marker CD4, but which can still be infected with a virus, notified in accordance with the present invention. Such a cell may be (without limitation specified) astrocytomas, fibroblast skin cells of the intestinal epithelium, etc. Preferably a host cell is a eukaryotic cell of a multicellular organism (e.g., in contrast to the unicellular yeast) and more preferably a cell of a mammal, such as man. The cell can be represented by a separate cell or part of a larger cell population. This larger population of cells may be on the part, for example, the cell culture (mixed or pure), fabric (e.g., epithelial or other tissue), organ (e.g. heart, lung, liver, gall bladder, bladder, eyes and other organs), the system of bodies (e.g., circulatory system, urinary system, nervous system, of the outer integument or another system) or the body (for example, bird, mammal, and so on). Preferably the organs/tissues/cells-targets relate to the circulatory system (e.g., include, but are not limited to, heart, blood vessels and blood), respiratory system (e.g., nose, pharynx, larynx, trachea, bronchi, bronchioles, lungs and the like), gastrointestinal system (e.g., mouth, pharynx, esophagus, stomach, intestines, salivary glands, pancreas, liver, gall bladder etc), urinary system (e.g., kidneys, ureters, bladder, urethra, etc.), nervous system (for example, include, but are not limited to, brain, spinal cord and special senses such as the eye) and the system of the outer integument (e.g., the skin). More preferably, if the target cell is selected from the group consisting of the cells of the heart, blood vessels, lung, liver, gall bladder and eyes.

Vector

"Vector" is a nucleic acid molecule (in the normal case, the DNA or the NC), which serves to transfer the sequence of the nucleic acid-passenger" (i.e., DNA or RNA) into the cell owner. Three common types of vectors include plasmids, phages and viruses. The preferred vector is a virus.

It is desirable that the vector was not a strain of wild-type virus, because it contains generated by human mutations. Thus, the vector is usually obtained on the basis of the strain of the wild-type virus using genetic manipulation (i.e. through deletions), and it is a conditional can replicate the virus, as will be described further on. Optimally, the viral vector is a virus strain of the same type as that of the wild-type virus causing the infection to be treated, and is preferably one of the above-mentioned wild-type viruses. In accordance with the specified preferably receive vector-based RNA virus, it is preferable to obtain vector-based retrovirus and optimally receive vector based on human immunodeficiency virus. This vector, isolated from human immunodeficiency virus, here denoted by the General term "cgwic"-vector.

Preferably the vector is a "chimeric vector, for example a combination of a viral vector with other sequences, for example a combination of sequences with other HIV virus is m (which is preferably derived from a strain of wild-type virus and is a conforming vector can replicate). In particular, the sequence of HIV preferably may be associated with modified sequences (i.e. Medicago type) strain of adenovirus, adeno-associated virus vector-based virus Sindbis or amphotropic murine retroviral vector.

As indicated here, the vector may contain either DNA or RNA. For example, either DNA or RNA virus can be used to obtain a vector. Similarly, a cDNA copy can be obtained on the basis of the genomic RNA of the virus. Alternatively, the cDNA fragment (or viral genomic DNA can be transcribed in vitro with the formation of RNA. These techniques are well known in the art and described in the following Examples.

"Conforming can replicate the virus" is replication-defective virus that is defective only in certain conditions. In particular, the virus can complete its replication cycle in permissive cell the owner and may not complete replication cycle in a restrictive cage-owner. "Permissive cell-host" is the host-cell infected by a strain of wild-type virus. This infection can occur either before or after infection conforming virus can replicate, notified in accordance with the present invention. Alternatively, a "permissive a host cell" is CL is rigid, which encodes the gene products of the virus wild type, required for replication of the virus. Thus, the conditional vector can replicate declared in accordance with the present invention, a virus, preferably a virus of the same type as the virus that causes the infection to be treated)that can replicate only when complementaly with virus strain wild type or in the case where the wild-type virus infects cells containing the genome can replicate conforming vectors.

In a preferred embodiment of the invention, a vector is an RNA virus (e.g., conditional can replicate the HIV virus), which introducerea in the form of DNA. This preferred option characterizes the strategy using can replicate HIV-1 (cgwic)-vector, which provides reception of the genomes of non-pathogenic, cgwic-vector with a selective advantage compared to pathogenic genomes of wild-type HIV. In particular, in cells containing both HIV genome of wild-type and cgwic, RNA cgwic have a selective advantage from the point of view of packaging in virions, because they contain, for example, ribozymes, which decompose RNA wild type, but not break down RNA cgwic. Such non-pathogenic, cgwic able to spread to uninfected cells susceptible to HIV infection (n is an example, in CD4+ cells)in the presence of helper virus wild type. Thus, selective packaging and distribution of cgwic interferes with HIV replication of the wild type.

In particular, the genomes of cgwic being introduced in infected cells or uninfected cells. Infected cells provide genome of cgwic proteins required for encapsidation and the formation of progeny virions. The genome of cgwic being introduced in uninfected cells, preferably either by direct transduction (for example, this can be accomplished by transduction of DNA cgwic using liposomes or using chimeric viral vector)or infection of the particles cgwic in the transfection of cells infected with wild-type HIV. Uninfected cells themselves do not form particles of cgwic. However, they can become supersafetyanne the wild-type virus, which expresses the proteins necessary for further education particles of cgwic. In this sense, the conditional can replicate the virus, notified in accordance with the present invention operates and the type of "delivering viral vectors, providing the means by which may occur multiple cycles of infection cgwic (i.e. in the presence of competitive HIV wild type). This vector, which is the source of the virus for more than one cycle in d is likely virus very different from other currently used vectors, such as that used with packaging cell lines and which provide only a single cycle of replication.

If it is desirable (for example, to facilitate the use of the vector in vitro, the gene products of the wild-type virus can be introduced into a cell that is infected with conforming vector can replicate. The products of the genes of the wild-type virus can be introduced not only co-infection with a strain of wild-type virus (or cDNA or provirus RNA virus), but also in the form of" gene, subcloned in expressing vector, such as helper (auxiliary) expressing vector ("helper"), which is able to provide in the cell-master transcription or translation of sequences (regulatory or structural) or, alternatively, the gene products can be introduced exogenously, i.e. the addition of proteins to the cell. As for the "helper"that its expression may be cell-specific or necklace-specific, and it can be introduced into the cell-host together with the conditional can replicate viral vector, as described herein, and therefore provides continuous conditional replication can replicate viral vector.

As indicated in the present description, "complementation" on the mean non-genetic interactions in the cells of the gene products of the virus, received from various sources. In particular, a mixed infection, the complementation provides increase the yield of the virus with one or both parental genomes, while the genotypes of the parental genomes remain unchanged. The complementation can be nealley (i.e. intergenia mutants with defects of various functions help each other in virus replication, providing a function that is defective in another virus) or allelic (i.e. intravenous when two parents have defects in different domains multimeric protein).

Preferably, the cells that can be transliterowany (transpulmonary) DNA cgwic (using liposomes or using adenoviral vector or amphotropic retroviral vector), were either HIV-infected or uninfected cells. HIV-infected cells can be activated or inactivated. If activated, it will immediately transcribing RNA HIV wild-type or RNA cgwic that leads to the selective packaging of RNA cgwic in progeny virions. If HIV-infected cells active, DNA cgwic will remain in them until they are activated (e.g., via stimulation by mitogens, antigens, etc.), leading again to the selective packaging of RNA cgwic in progeny virions. As activated, that is, and don't uninfected cells, which transliterowany DNA cgwic, do not form the virion until then, until they become superintelligence HIV wild-type and activated stimulation, which also leads to the selective packaging of Rnxgiq in progeny virions.

Superinfection of cells containing the genomes of cgwic (for example, transfection or infection), occurs because the genomes of cgwic not encode viral proteins that block superinfection (such as env and nef). The resulting virions, cgwic can infect uninfected cells because the viral particles contain a molecule reverse transcriptase, which are all HIV particles, and capable of forming DNA provirus on the basis of the genomic RNA. This process is called reverse transcription. When virions, cgwic infect uninfected cells, they can perform reverse transcription to form the provirus on the basis of the genomic RNA. Thus, these cells are equivalent to those of uninfected cells, which directly transducer DNA cgwic. They are unable to form particles of cgwic up until the cells will not be superinfection HIV wild type and will not become activated, and then again it is possible for selective packaging of Rnxgiq in progeny virions. It is likely that the particles cgwic can infect some cells that are already infected with HIV (see e.g. the measures Yunoki et al., Arch. Viriol., 116, 143-158 (1991); Winslow et al., Virol., 196, 849-854 (1993); Chen et al., Nuc. Acids Res., 20, 4581-4589 (1992) and Kim et al., AIDS Res. & Hum. Retrovir., 9, 875-882 (1993)). However, for this to happen, these HIV-infected cells should not Express proteins that regulate the type of feedback the expression of CD4, as this will prevent the virions cgwic to infect these cells. Activated HIV-infected cells mainly regulate the expression of CD4 on the type of feedback. In accordance with the specified HIV-infected cells that are not activated, potentially susceptible to superinfection of cgwic and therefore could serve as another source of particle formation, cgwic.

The preferred vector cgwic declared in accordance with the present invention, contains sequences required for RNA transcription, binding of the tRNA primer, demersal and packaging and either does not contain sequences that encode proteins that block the HIV superinfection with wild-type or contains such sequences, but they are either not transcribed or not broadcast with the formation of active protein, so that their expression is considered to be "silent". Even more preferably, if the vector is no plot or sequence, coding region type gag coding sequence up to and on the tea nef gene of HIV wild. Optimally, however, when the vector contains rev-responsible element (RRE), which is cloned in the region deletions or other suitable site in the vector. This preferred HIV vector due to "lack of plot or sequence encoding the plot" is a vector that can be introduced in the form of RNA or, alternatively, in the form of DNA, as described previously.

Construction of vectors well known in the art. For example, as described in Example 1, an RNA virus, such as HIV, in the form of DNA digested with restricts to cut HIV coding sequences of the gag-encoding plot to plot U3, following the nef gene. Cloning cassette containing polylinker with numerous restriction sites, introducing plot deletions before legirovaniem provide convenient restriction sites for cloning into the vector. The DNA fragment containing the RRE, one of these sites. The resulting vector forms a truncated transcript gag and does not form a Gag protein of wild-type or any other HIV proteins of the wild type. Moreover, it is not necessary that the vector is expressed even truncated gag protein as a sequence of translation initiation gag can be mutated and prevent its translation.

Using the same approach, sequence cgwic may be associated with other sequence is elnashai, for example, virus, or other vector to obtain a recombinant vector. In particular, the sequence of cgwic can be legirovanyh with sequences of virus Sindbis, AAV, adenovirus or amphotropic retrovirus, but few of these viruses can be used to deliver sequences of cgwic. Such chimeric vector can be introduced into the cell or the binding of virus-cell membrane (e.g., receptor-mediated endocytosis for adenovirus) or other means, for example liposomes.

Preferred in accordance with the claimed invention is a vector (i.e. conforming can replicate the virus, which mainly represents cgwic-vector)containing at least one sequence of a nucleic acid, the presence, the transcription and translation of which provide a selective advantage. There are two types of such nucleic acid sequences, intended for inclusion in the vector: (1) the sequence of nucleic acid, the presence of which optimally provides a selective advantage for replication and dissemination of viral vectors containing this sequence, before the strain of wild-type virus (i.e. preferably before a strain of wild-type virus, on the basis of to the th received vector and which does not contain this sequence), and (2) the sequence of nucleic acid, the content of which optimally provides a selective advantage to cells infected with a vector containing this sequence, before the cells infected with virus strain wild type (i.e. preferably a wild-type strain from which the received vector, and also, for example, helper espressioni vector, which facilitates the replication of the vector and/or its activity in uninfected cell host), and which does not contain this sequence, for example, by promoting survival of cells, stimulation of the formation of virions vector cgwic in producing cgwic-vector cells, induction of apoptosis, facilitating the formation of the protein or enhancing immunological function, or "target", so it can be achieved the desired prophylactic, therapeutic or biological effect. Each of these sequences or many of these sequences, i.e. sequences that alone or in combination with another factor(s) promoting the multiplication of a vector and/or stimulates a specific function of the host cell, providing favorable prophylactic, therapeutic and/or biological effect, can be introduced into the vector either in the absence or in the presence of the other posledovatel the activity, i.e. the vector may contain at least one sequence of a nucleic acid and at least one additional nucleic acid sequence".

The term "nucleic acid" discussed earlier. "Nucleic acid sequence", in particular, contain any gene or coding sequence (i.e. DNA or RNA) potentially any size (subject to the limitation of the possibilities of packaging, due to the vector), which provides a selective advantage, as described here below. "Gene" is any sequence of nucleic acid encoding a protein or RNA molecule (regardless transcribed and/or translated sequence). Since the gene contains coding sequences and non-coding sequences (e.g., regulatory sequences), the "coding sequence" does not include any non-coding DNA.

1. The sequence of the nucleic acid, the presence of which provides in the cell-host selective advantage to the vector containing such a sequence, before the virus strain wild-type.

The sequence of the nucleic acid, which provides a selective advantage to the cell host vector containing such a sequence, before the strain Viru is as wild type, preferably is any sequence that enables the vector viral particles selectively produced or Packed in comparison with viral particles originating from wild-type virus. Such sequences include, but are not limited to the sequence, which leads to an increase in the number of generated intracellular vector genomes in comparison with genomes of wild-type and anti-virus nucleic acid sequence.

The first category of sequences of nucleic acids that provide a selective advantage to the cell host vector containing such a sequence, compared with the strain of wild-type virus, represented by such series as the promoter. "Promoter" is a sequence that directs the binding of RNA polymerase and thus provides RNA synthesis and may contain one or more enhancers. "Enhancers" is a CIS-activating elements, which stimulate or inhibit the transcription of nearby genes. Enhancer, which inhibits transcription, also known as "the silencer". The enhancers differ from the DNA-binding site sequence-specific DNA-binding proteins found only in the promoter (also referred to as "the promoter of the diversified elements"), that enhancers can operate in any orientation and at a distance of several kilobase (KBP), even being in a position below the transcribed segment.

Accordingly, preferably, when the promoter (for example, the long terminal repeat (LTR) of conditioned can replicate HIV vector is modified so that the vector becomes more sensitive to certain cytokines than the HIV strain. For example, the well-known modified HIV promoter, which has increased the transcriptional activity in the presence of interleukin-2. Embedding the specified promoter in the vector, and the introduction of the vector into the cells, HIV-infected wild-type, preferably enhances the formation and packaging of progeny virions derived from vector, compared with wild-type HIV. Other cytokines and/or chemokines (e.g., tumor necrosis factor α, RANTES, and so on) can be used in this way to stimulate the selective packaging of virions encoded by the vector.

The second category of sequences of nucleic acids that provide a selective advantage to the vector containing such a sequence, compared with a strain of wild-type virus, represented by such preferred nucleic acid sequences, as antivirus sequence is eljnosti. "Antiviral agents" are classified according to the way their actions and include, for example, reverse transcriptase inhibitors, competitors penetration of the virus into cells, vaccines, protease inhibitors and genetic antiviral agents. "Genetic antiviral agent" is a molecule of DNA or RNA that is transferred into cells and affect the appropriate intracellular target either directly (as introduced intracellular) or after conversion to RNA or protein (see review Dropulec' et al. (1994), supra). Genetic scan sequence is also the preferred sequence of nucleic acid. Genetic antiviral agents include, but are not limited specified) antisense molecules, traps, RNA, transdominant mutants, toxins, immunogen and ribozymes. It is desirable that the genetic antiviral agent represented an antisense molecule, an immunogen or a ribozyme. Accordingly, the preferred nucleic acid sequence that provides a selective advantage to the vector before the strain of wild-type virus, is a sequence of genetic antiviral agent selected from the group comprising antisense molecule, an immunogen and a ribozyme.

"Antisense molecule" is a molecule, Kotor, which is mirrored by a short fragment of the gene the expression which you want to block. Antisense molecule directed against HIV, hybridized with HIV RNA of wild-type, calling it the preferred degradation by cellular nucleases. Antisense molecules are preferably DNA oligonucleotides and it is desirable to have from about 20 to 200 base pairs in length, preferably from about 20 to 50 base pairs in length and optimally less than 25 base pairs in length. The antisense molecule can be expressed with RNA cgwic and preferably binds the genomic RNA of wild-type virus, thus providing a selective advantage to cgwic when packaging into progeny virions.

"Immunogen" is odnozadachnoy antibody (scAb), aimed at viral structural protein. The immunogen is transferred as nucleic acid and is expressed intracellularly. The immunogen may also be an antigen, surface protein (including class restrictively proteins) or an antibody that sposobstvuet selection vector and/or host cell. In the preferred vector, the nucleic acid sequence is a sequence scAb, which binds the Rev protein of HIV wild type. It mainly prevents the maturation of Rev protein and therefore it is retained in the endoplasmic reticulum. In particular, be the key Rev exported not subjected to the splicing of HIV RNA in the cytoplasm through binding to RRE and subsequent oligomerization around HIV RNA. HIV RNA, which form complexes with Rev, are transferred to the cytoplasm, bypassing mechanism of cellular splicing. Thus, if wild-type Rev does not bind wild-type RRE, HIV RNA wild type are not transferred to the cytoplasm and not encapsidated in progeny virions.

Optimally, to a vector containing a nucleic acid sequence scAb, also included a modified RRE sequence and encodes a mutant Rev protein, which recognizes the modified RRE, RRE, but not wild-type. Accordingly, in cells containing wild-type HIV and the vector comprising the nucleic acid sequence scAb, the vector preferably is packaged into virions. A similar strategy mainly used when matrix proteins or nucleocapsid of HIV wild-type (or any protein involved in the interaction of the protein/RNA that affect encapsidate viral RNA) are targets scAb.

"Ribozyme" is an antisense molecule with catalytic activity, i.e. instead of binding to the RNA and inhibition broadcast ribozymes bind RNA and induce site-specific cleavage of bound RNA molecules. Basically there are four groups of ribozymes: intropia sequence of the Tetrahymena group I, Mcasa R and ribozymes in the form of a hammer head and studs. However, additional catalytic p is ctory exist as part of other RNA molecules, for example, RNA Δ-hepatitis a virus and ribosomal RNA in fungal mitochondria.

The preferred ribozyme is a ribozyme, in which the catalytic domain cleaves the 3'nucleotide sequence NUH, where N can be any nucleotide (i.e. G, A, U or C), and N can be either a, C or U. However, since the sequence, the most effective split such ribozymes, is the site of the GUC, preferably, the sequence NUH contained the GUC website.

It is desirable that this ribozyme was split plot virus strain wild type or its transcripts, but did not split plot vector or its transcripts. The ribozyme cleaves the virus or its transcript in the sense that such virus or the vector may contain RNA or DNA, as described previously. The splitting of the "plot" refers to the cleavage site of the target, i.e. preferably part of the virus, which is required for reproduction of the virus. Preferably, if the vector is modified so that certain plot-target (if it is present in the vector) is not cleaved by the ribozyme. Optional ribozyme can cleave the vector, while the splitting does not affect the parcel, necessary for the reproduction of viral particles, for example particles of cgwic.

Optimally, if the ribozyme is encoded by a sequence selected from the group comprising SEQ ID No. 3 (the. CACACAACACTGATGAGGCCGAAAGGCCGAAACGGGCACA) and SEQ ID No. 4 (ATCTCTAGTCTGATGAGGCCGAAAGGCCGAAACCAGAGTC). While SEQ ID No. 3 is a ribozyme, which aims to website +115 (number of bases after the start of transcription) of section U5 HIV wild-type SEQ ID No. 4 is a ribozyme, which aims to website +133 section U5 HIV wild-type.

This ribozyme is able to cleave the HIV genome of wild-type (or transcripts), but not the genome of the vector (or transcripts), because the U5 sequence of the vector is modified in vitro site-directed mutagenesis, as is known in the art and described in Example 1. In particular, the sequence of the vector is preferably modified so that the vector contains a sequence selected from the group comprising SEQ ID No. 2 (GTGTGCCCACCTGTTGTGTGACTCTGGCAGCTAGAGAAC), SEQ ID No. 5 (GTGTGCCCGCCTGTTGTGTGACTCTGGTAACTAGAGATC), SEQ ID No. 6 (GTGTGCCCGTCTGTTGTGTGACTCTGGCAACTAGAGATC), SEQ ID No. 14, in which at least one N is mutated, SEQ ID No. 15 and SEQ ID No. 16. In the form of RNA, the vector preferably contains a sequence encoded by a sequence selected from the group comprising SEQ ID No. 2, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 14, in which at least one N is mutated, SEQ ID No. 15 and SEQ ID No. 16. In contrast, wild-type HIV contains the U5 sequence encoded by the sequence SEQ ID No. 1 (GTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATC). Modifications in toto and comparison with what sledovatelnot U5 wild-type (in the form of DNA) is shown in Figure 2.

Moreover, there may be used other ribozymes directed at other parts of the viral genome, in particular HIV, both separately and in combination with each other. For example, the ribozyme can cleave other RNA sequences necessary for replication of the virus, such as the sequence of the reverse transcriptase, protease or protein transactivator, Rev or other necessary sequence, as described earlier. Preferably, the vector contains numerous ribozymes, for example, aimed at different sites. In such cases, a similar sequence in the vector change site-directed mutagenesis or any other means known from the prior art to obtain the derived vector, which is resistant to such cleavage by the ribozyme.

When the vector is designed based on the human immunodeficiency virus, preferably so that the vector was absent tat gene and its 5'-splicing site and instead contained a cassette of three anti-Tat ribozyme, in which the catalytic domain of each of the ribozyme cleaves the different sites of the molecule nucleic acid of human immunodeficiency virus wild-type, particularly in tat-sites. Preferably, the catalytic domain of each ribozyme was digested nucleotide sequence plot of the mole is uly nucleic acid of human immunodeficiency virus wild-type, for which there is no ribozyme-sensitive similar plot in the vector.

2. The sequence of the nucleic acid, the presence of which provides a selective advantage to cells infected with a vector containing such a sequence, compared to cells infected with virus strain wild-type.

The sequence of the nucleic acid, which provides a selective advantage to the cell containing a vector comprising such a sequence, before the cell containing the virus strain wild-type (non-sequence), preferably is any sequence that promotes the survival of cells containing the vector, and multiplication of viral particles (i.e. viral particles, cgwic) compared to cells containing the wild-type virus. Such sequences include, but are not limited to the list) any sequences that do not allow the cell or vector contained in the cell, to avoid destruction sequence that promotes cell survival, sequences that induce apoptosis, sequences that facilitate the formation of a protein, or a sequence that stimulates the function of the immune system or the focus.

For example, preferably, such a sequence of nucleic acid, is contained in the vector encodes genes for multidrug resistance (see, for example, Ueda et al., Biochem. Biophys. Res. Coomun., 141, 956-962 (1986); Ueda et al., J. Biol. Chem., 262, 505-508 (1987) and Ueda et al., PNAS, 84, 3004-3008 (1987)). In the presence of added a cytotoxic drug (e.g., as is done when cancer chemotherapy) it ensures the survival of cells containing the vector, whereas the cell containing the wild-type virus, such as HIV doesn't survive. Such cytotoxic drugs include (but are not limited to these) actinomycin D, vinblastine sulfate, vincristine sulfate, daunomycin, adriamycin, VP-16 and AMSA.

Alternatively, such nucleic acid sequence preferably contains a sequence selected from the group comprising sequence (or coding sequence) mutant (mutant) protease and a sequence (or a sequence which encodes a) mutant (mutant) reverse transcriptase. Preferably the mutant reverse transcriptase obtained genetically engineered way so that it is resistant to nucleoside and non-nucleoside reverse transcriptase inhibitor and mutant protease obtained genetically engineered way so that it is resistant to commonly used protease inhibitors.

The introduction of these protease inhibitors and reverse transcriptase inhibitors households is inu in combination with the vector used for selection of cells, producing vector, in contrast to cells producing the wild-type virus. Similarly, this approach is modified for use with any medicinal substance that inhibits the replication of the virus, so the virus is able to mutate to avoid inhibition. Accordingly, for the treatment of HIV selective sequence of a nucleic acid incorporated into a vector, preferably contains a mutant sequence of HIV. Optimally, however, if these sequences do not prevent superinfection of HIV wild-type.

Preferably the vector is a one of the above and, in particular, the preferred cgwic-vectors shown in Figures 1B-1E, namely cgwic-1.1, cgwic-1.11, cgwic-1.12, cgwic-1.111 respectively (Dropulic' et al., PNAS, 93, 11103-11108 (1996)). In addition, preferably using a vector, described in Example 11, i.e sgic.

In the vector sgic preferably no tat gene and its splicing site in comparison with the genome of the human immunodeficiency virus wild type. Instead of the tat gene and its splicing site of the vector cr2 HIV contains a cassette of three anti-Tat ribozyme, and the catalytic domain of each ribozyme cassette splits the different sites of the molecule nucleic acid HIV wild type. Preferably the catalytic domain of each ribozyme cassette races is upset various sites in the tat gene of HIV wild type. More preferably, the catalytic domain of each of the ribozyme cleaves the nucleotide sequence of the portion of the molecule of nucleic acid HIV wild type, with similar ribozyme-sensitive site in the vector is missing.

Optimally, the vector is compatible with the cell into which it is introduced, for example, is capable of in the cell expression encoded by vector sequences of nucleic acids. Preferably, if the vector contains an origin of replication active in the cell. When the sequence of nucleic acid transferred in the form of DNA coding sequence (for example, in contrast to the full-size gene containing its own promoter), then it is optimal that the vector should contain a promoter that is capable of directing expression of the coding sequence operatively linked to the coding sequence. The coding sequence operatively linked to a promoter (for example, the coding sequence and the promoter together form a native or recombinant gene when the promoter is capable of directing the transcription of the coding sequence.

In the recombinant vector is declared in accordance with the present invention, it is preferable that all of the elements responsible for the proper transcription (for example, when gnali initiation and termination), the broadcast signal (for example, ribosomal entry or binding site etc) and signal processing (e.g. splicing sites of the donor and acceptor, and optionally, a polyadenylation signals) properly was part of the vector, so that any gene or the coding sequence is transcribed properly (and/or broadcast, if this is desirable) in cells in which the introduced vector. Manipulation of these signals to obtain the proper expression in the cells of the host are well-known and tested by professionals.

Preferably, the vector also contained some elements with which the vector or containing subcloned sequence identify or selectively selected. Identification and/or selection of the vector is performed using a number of approaches known in the art. For example, vectors containing certain genes or coding sequences, preferably identify the hybridization, the presence or absence of the functional activity of the so-called "marker genes", are part of a vector and/or expression of certain sequences. In the first case, the presence of a specific sequence in the vector is detected by hybridization (e.g., DNA-DNA hybridization using probes containing placentas the work, homologous to the corresponding sequence. In the second case, the system "recombinant vector/host identify and selectively selected based on the presence or absence of functional activity of specific marker genes such as antibiotic resistance, activity timedancing etc. due to responsible for these functions of the genes present in the vector. In the third case, the vectors identified by analyzing the product of a particular gene that is part of the vector. Such studies are based on physical, immunological and functional characteristics of the gene product.

Accordingly, the present invention also relates to a vector, which in the case of a DNA vector contains the nucleotide sequence selected from the group comprising SEQ ID№ 2, 3, 4, 5, 6, 14, in which at least one N is mutated, 15 and 16, and in the case of RNA vector contains the nucleotide sequence encoded by a nucleotide sequence selected from the group comprising SEQ ID№ 2, 3, 4, 5, 6, 14, in which at least one N is mutated, 15 and 16.

The present invention also relates to a method for obtaining a vector that is derived from human immunodeficiency virus wild type and that can only replicate in the cell host, which is permissive for replica the AI of the specified vector to the ribozyme. The ribozyme, which is included in the vector and encoded them, cleaves the nucleic acid of human immunodeficiency virus (but not the vector) and the corresponding transcripts when available. The method involves obtaining a vector based on human immunodeficiency virus wild type, which is able to replicate only in cells of the host, which is permissive for replication of the specified vector, and embedding in vector nucleic acid sequence that contains or encodes a ribozyme, a catalytic domain which cleaves the nucleic acid of human immunodeficiency virus wild-type (but not the vector) and the corresponding transcripts when available. In the process the nucleotide sequence containing or encoding the U5 sequence of human immunodeficiency virus wild type, can be removed from the vector and replaced with a nucleotide sequence selected from the group comprising SEQ ID No. 2, 5, 6, 14, in which at least one N is mutated, 15 and 16, if the vector is a DNA vector, and the nucleotide sequence encoded by a nucleotide sequence selected from the group comprising SEQ ID No. 2, 5, 6, 14, in which at least one of N is mutated, 15 and 16, if the vector is an RNA vector. Preferably, the vector d which was literals in the cell-master, permissive for replication of the specified vector more than once.

The present invention also relates to a method of modification of the vector. The method involves receiving vector and introduction to vector nucleotide sequence selected from the group comprising the DNA of SEQ ID№ 2, 3, 4, 5, 6, 14, in which at least one N is mutated, 15 and 16, if the vector is a DNA vector, and the nucleotide sequence encoded by a nucleotide sequence selected from the group comprising SEQ ID№2, 3, 4, 5, 6, 14, in which at least one N is mutated, 15 and 16 if the vector is an RNA vector.

Further, the present invention relates to a method for breeding and selective packaging conforming vector can replicate without the use of packaging cell lines. The method involves contacting the conditional replicating vector with the cell capable of being infected by another vector that is a vector of the same type as conditioned can replicate the vector, which is different from the conditional can replicate vector that is a vector, wild-type from the point of view of replication competence; further contacting the cell with another vector, and then culturing the cells under conditions that lead to the reproduction of conditioned replacerules the vector.

The invention also relates to isolated and purified nucleic acid molecule selected from the group comprising DNA molecules with nucleotide sequences selected from the group comprising SEQ ID No. 2, 5, 6, 14, in which at least one N is mutated, 15 and 16, and the RNA molecule with a nucleotide sequence encoded by a nucleotide sequence selected from the group comprising SEQ ID No. 2, 5, 6, 14, in which at least one N is mutated, 15 and 16.

Method of use

The above vectors preferably being introduced into the cell-host for prophylactic and therapeutic treatment of viral infections, to save the vector of the virus, as well as for other reasons. Accordingly, the present invention relates to the cell host containing the vector declared in accordance with the present invention. The selection of host cells and/or maintenance of such cells or cell lines in culture has become a routine way and can be done by the average person skilled in the field of research.

In particular, the vector, as described above, preferably used for prophylactic and therapeutic treatment of viral infections, preferably infections caused by wild-type virus, mainly RNA wild-type virus, more preferably pet what virusa wild-type and optimally HIV wild-type.

The method involves contacting the host cell capable of being infected by wild-type virus, with air-conditioned can replicate vector that can replicate only in cells-master of permissive for replication of the vector, the presence, transcription or translation which inhibit replication of the virus strain wild type in the cell host. Preferably, if the vector is replicated more than once, and contains at least one sequence of a nucleic acid, the presence, the transcription and translation of which cause a selective advantage in the cage-the owner of the specified vector with respect to the strain of wild-type virus, which in the optimal case is the strain from which it was received vector.

According to this method, the sequence of nucleic acids such preferred sequence, which contains or encodes genetic antiviral agent, adversely affecting replication and/or expression of the virus that is different from the vector. It is desirable that the genetic antiviral agent was selected from a group comprising antisense molecule, a ribozyme and an immunogen. Optimal genetic agent is a ribozyme, a catalytic domain which preferably cleaves the 3'nucleotide sequence of NUH (CCA the i.i.d. sequence GUC). It is not necessary that the ribozyme is encoded, at least partially, by a sequence selected from the group comprising SEQ ID No. 3 and SEQ ID No. 4. Preferably, the ribozyme was split plot virus strain wild type or its transcripts, but not the plot of the vector or its transcripts. Preferably this is because the virus strain wild type contains a sequence encoded by SEQ ID No. 1, while the vector in the case of a DNA vector contains the nucleotide sequence selected from the group comprising SEQ ID No. 2, 5, 6, 14, in which at least one N is mutated, 15 and 16, and in the case of RNA vector contains the nucleotide sequence encoded by a nucleotide sequence selected from the group comprising SEQ ID No. 2, 5, 6, 14, in which at least one N is mutated, 15 and 16.

It is also desirable that the implementation of the method, the vector contains at least one sequence of a nucleic acid, the presence, transcription or translation which provide a selective advantage to the cell host, infected by the vector, before cell infected by a strain of wild-type virus, which in the optimal case is a strain of the virus, on the basis of which was received vector. From this point of view, the vector may contain at least one sequence of nucleic key is lots which provides a selective advantage to the cell of a host infected with a virus, and at least one nucleic acid sequence that provides a selective advantage to the vector compared to the wild-type strain from which it was received vector.

Accordingly, it is preferred implementation of the method, when the nucleic acid sequence is a sequence that provides multi-drug resistance. Alternatively, the method implemented in the case where the nucleic acid sequence is a sequence encoding a mutant (mutant) protease, and the nucleotide sequence encoding a mutant (mutant) reverse transcriptase, and when a viral infection, which provides for preventive or therapeutic treatment, caused by a retrovirus.

In a preferred embodiment, the method comprises the additional introduction into the cell-the master agent selected from the group comprising a cytotoxic agent, a protease inhibitor and a nucleoside reverse transcriptase inhibitor.

Thus, the vector may be used in accordance with the above method not only for the treatment of viral infections, but also to protect potential host cell from viral infection, i.e. as the pic is b prophylaxis of viral infection or vaccination against a given virus, such as an RNA virus, in particular retrovirus, such as HIV. The method provides a significant inhibition of the replication of the virus strain wild type before a host cell will come into contact with a strain of wild-type virus. From this point of view, the vector may contain or encode proteins that block superinfection with wild-type virus. The method involves contacting the host cell with the conditional can replicate vector, as described above, and "helper expressing vector", i.e. viral genome. Conforming can replicate the vector has a selective advantage in terms of packaging and/or reproduction. Moreover, the vector, for example, may contain a sequence that increases the ability of cells to survive, stimulates the formation of virus, induces apoptosis, facilitates the formation of a protein and/or stimulates immune function and/or focus. Construction helper expressing vector expressing vector, which compensates for the inability of the vector to replicate. Such helper expressing vectors are normal, and average professionals can easily construct them. Helper expressing the vector can be packaged into virions, as the main vector, or to be expressed without the need for packaging. Because vector has elective advantage in packaging and/or reproduction, this system provides a reliable means for achieving a high level of replication of the virus without the possible pathogenic effects that potentially can cause a live attenuated virus. In addition, the vector may be mixed with non-specific adjuvants to enhance immunogenicity. Such adjuvants known in the art and include, but are not limited specified) full or partial beta-blockers, emulsions containing components of the cell wall of bacteria and mycobacteria, etc.

When using the vector according to the above-described method for preventing viral infection vector can encode antigenic protein that is encoded by the wild-type virus, such as mutant viral or non-viral protein. Accordingly, the antigen encoded by the vector, can be bacterial or, for example, be derived from a cancer cell. Moreover, the vector can encode and gene MHC (major histocompatibility complex) for proper antigen presentation to the immune system of the host. Thus, these vectors can be used to facilitate sustainable immunological response against a wide range of potential pathogens and/or endogenous proteins (e.g., tumor-specific antigens)that are selectively expressed in the abnormal cells.

the more, "helper virus" (also referred to here as the "helper") expressing the vector, which is expressed only in specific cell types (e.g., stem cells, a special antigen-presenting cells and tumor cells), can be obtained by genetic engineering methods through the introduction (or removal) of a specific genetic element/factor or vector (vector)or expressing helper virus (virus), which allows cell-specific vector to replicate and spread. Thus, the vector also applies if complementaly with helper virus, but this distribution is cell-specific and dependent on the addition or removal of a particular genetic element/factor to a vector (vector) or expressing helper virus (virus). This approach can be used separately or in combination with other aforementioned approaches.

For example, can be constructed conforming can replicate HIV-vector for a specific replication in macrophages but not in T-cells. A vector that can represent a Tat-defective HIV vector encodes other HIV proteins, but they are not expressed due to the lack of transactivator transcription Tat), can encode a ribozyme that cleaves HIV-dick is the second type, but not RNA can replicate conforming HIV. Helper expressing vector for a given vector can encode tat gene, expressed through specific promoter macrophages. Thus, cgwic could conforming to replicate only in cells of macrophages, while being incapable of replication in T-cells or cells of other types.

Alternatively, the tat gene can be operatively linked to a tumor-specific promoter; thus, cgwic in this case, can replicate only in tumor CD4 cells but not in normal cells. Genetic element/factor can be a modified promoter sequence in the vector that is expressed only in cells of a certain type, but not in cells of other types, in conjunction with expressing "helper virus".

In another embodiment of the invention proteins shell helper expressing constructs or vector designs (if such structures include them in coat proteins) can be modified so that the vector virion is specific to infect cells of certain types (e.g., tumor cells), being unable to infect cells of other types (e.g., normal cells). According to another variant implementation of the image is etenia adenovirus, who is missing one or more key factors necessary for replication, could be complementaly using helper structure, which provides the factors associated with tumor-specific promoter. Thus, the factors that will complementary replication of adenovirus, expressionlist only in tumor cells, thus ensuring the replication of the virus in the tumor cells (expression of proteins necessary for the destruction of cells), but not in normal cells.

Thus, the present invention also relates to a method of cancer treatment and, in particular, treatment of T-cell leukemia. "Cancer treatment" in accordance with the invention provides for the introduction of the master of the further modified vector (as disclosed in the present application) to generate a therapeutic response. This response can be estimated, for example, by monitoring the reduction of tumor growth and/or regression of the tumor. "Tumor growth" means an increase in tumor size and/or number of tumors. "Regression of the tumor" means the reduction of the tumor mass.

The term "Cancer" in accordance with the claimed invention means diseases that are characterized by abnormal cell proliferation and the absence of contact inhibition, as evidenced by the education of the tumor. This concept applies to the tumors, and also to such malignant cells that spread from the tumor locally by invasion or systemically by metastasis. Theoretically, any type of cancer can be treated with use of the method. Preferred, however, is a cancer of viral nature.

Finally, the above vectors can be used directly for gene therapy in vivo. Known strategies of gene therapy imperfect, because they cannot ensure the delivery of the gene into most cells; infected only a small percentage of cells. This is especially important in the case of anticancer strategies, when the decisive moment is the gene transduction of the entire tumor population. When using a "vector" in combination with "helper" directly transduced cells will form viral particles that can infect neighboring cells, and that leads to a high level and the most efficient transduction. In one embodiment of this invention retrovirus person (who may be HIV or retrotransposon element) can be delivered into the tissue or cells in vitro) together with the "helper" design. Cells receiving the vector and the helper will produce the virus and the certified packaging vector in virions. These virions are JV is able to induce highly efficient transduction of neighboring cells (as contact type "cells" is the most effective tool for their transduction). Immediately transduced cells may or may not die depending on whether the combination of the vector/helper to cytolytic infection. In the case of retrotransposon helper may optionally include structural proteins, as normal or tumor cells may contain protein/factor required for encapsidation in virions. In this case, the helper can only be (no limit specified) protein transactivator, which activates the transcription factors required for encapsidation retrotransposon. In the case of HIV, other factors can, but not necessarily, be required to encapsidation of the HIV genome into progeny virions to infection/transduction of cells.

The above vectors can be used against biological and chemical warfare. For example, the conditional can replicate the vector can be introduced individuals recently infected with the highly pathogenic virus or bacteria or chemical agent (e.g., a toxin). The vector will interfere with the replication of pathogenic virus, as described previously. However, the conditional can replicate the vector can also be used in combination with helper expressing vector ("helper") and in the implementation of antibacterial and anti-chemical strategies.

For example, the conforming rap is yzeroaxis vector can determine the secretion of antibodies against bacteria or toxins after as a "helper" will provide the expression and reproduction. "Helper" may (but not necessarily) controlled by the inducible promoter that directs the expression when activated by the bacterium, cytokine (in response to bacterial infection), antibiotics (as in the case of system tetracycline-inducible promoters (Paulus et al., J. Virol., 79, 62-67 (1996)) or a chemical agent (for example, by the toxin). Thus, the conditional vector can replicate not only could selectively breed using a "helper" in response to the introduced pathogen or toxin (as a result of the activation of the helper), but also to secrete antibodies against the pathogen or toxin to inhibit the pathological effects of tumor antigen of a pathogen or chemical agent (e.g., toxin). Thus, any protein factor or genetic element, which can be transcribed with the production of mRNA and/or protein, can be entered into a conditional can replicate a vector for inhibiting pathogenic reactions in complex with a "helper", which contributes to its selective breeding and expression (selective, because the products of helper expressed conforming, for example in the following cases, but are not limited to: (a) the inducible promoter is a factor in cancer cells activates the formation of the helper is about factor toxin-sensitive sequence that expresses helper factor or cytokine-responsive promoter, which induces the formation of a helper factor, (b) helper RNA/protein/factor selectively stabilized in certain cells, but not in other cells and (b) indirect induction of the third gene, which affects the formation of protein helper virus, determines the direction, structure and other biological functions). Such strategies can be used in transgenic plants and animals to protect them from pathogens. Similarly, such strategies can be used in transgenic systems to obtain valuable heterologous proteins/factors.

According to another variant implementation of the claimed method can be derived cell line with the purpose of screening medicinal substance/factor to determine, for example, what proportion of protein/factor is important for the implementation of this function. Can be constructed vector for expression mathenesserlaan protein of interest in a given cell line. RNA coding mutagenically protein, however, give resistance to the ribozyme with the insertion of silent point mutations, for example. Expression of wild-type protein, however, inhibited in cell lines. And can be the ü designed and vectors, expressing the ribozyme to a protein of interest, which Express a mutant test protein. When the transduction of a vector into cells of a large part of the native RNA that encodes a normal protein that is cleaved, whereas mutant test protein is expressed. This method can be carried out with the use of newly developed methods of delivery and selection as a quick and effective procedures for determining the action of this protein and how the system factor/drug interacts with protein.

Can be made and numerous other applications of the method and vectors, notified in accordance with the present invention, in vitro. For example, vectors can be used to ascertain certain details of viral replication and function of ribosomes. Similarly ribozyme-containing vectors can be used as diagnostic tools, for example, to assess mutations in diseased cells or to study the effects of genetic drift. The above is not exhaustive with regard to the use of the present invention.

Advantages of the invention

The advantages of using strategy cgwic for genetic therapy of AIDS and other viral diseases are significant. For example, the problem of delivery of the vector into the cells, deg. of infection is by HIV. After transfection in vivo, cgwic infected CD4+ cells, cgwic is packaged into progeny virions using endogenous membrane proteins of infectious HIV. Thus, RNA cgwic penetrates into progeny virions and infects the cell types in normal infinitudes the particular strain of HIV, non-pathogenic forms virions. It takes into account the difficulties of delivery of the vector to cells, such as microglia brain, which are a major reservoir of HIV infection of the Central nervous system. Probably, there is little toxicity associated with cgwic-vectors that infect uninfected CD4+ cells, as cgwic-vectors do not encode any viral proteins. Moreover, the competition cgwic-vector with wild-type HIV education is non-pathogenic particles that lead to reductions in viral load. Reducing the load of pathogenic HIV-1 can not only increase the life expectancy of infected individuals, but also to reduce the rate of transmission of the virus to uninfected individuals, as particles of cgwic also can spread systemically (i.e. as infectious HIV). Reduced load of pathogenic HIV-1 in the blood can be especially important for pregnant HIV-infected women, because the formation of cgwic can reduce the transmission of HIV-1 from inficirovannymi their fetus in utero.

The mixture of plasmid DNA/lipid, which can be used for the introduction of cgwic-vector in cells of the owners, is a stable and inexpensive compared to the more expensive ex vivo strategies. Of course, the method according to the invention is flexible in nature in the sense that it could be used for delivery of genes ex vivo, if specified was desirable. Regardless of this, the availability associated with liposomes approach opens the possibility of treating the main part of the patients, which is not feasible when using existing strategies of gene therapy. Can be constructed cgwic-vectors that contain multiple ribozymes directed to different targets in the HIV genome. This reduces the possibility of mutations infectious HIV and avoid them antovic-ribozymes. Moreover, the strategy based on conditional replication-competent virus can be used to treat other viral infections, especially with a high speed cycle.

A particularly useful property of cgwic-vectors is that they can be used for the expression of the genetic antiviral agents, such as ribozymes, post-transcriptional manner. Accordingly infecting uninfected cells cgwic-vectors leads to reduced toxicity, as promoter of the long terminal repeat is (LTR) of HIV in the absence of Tat protein causes little expression. High levels of expression of cgwic and its subsequent antiviral activity is detected only when the protein Tat complementarity HIV wild type. Thus, cgwic-vectors designed not to protect cells from HIV infection, but to reduce the overall viral load of HIV wild type by selective accumulation of non-pathogenic particles, cgwic.

Without being bound by any particular theory concerning the use of the invention, the authors believe that ribozymes can be used, as described in the following Examples, to obtain the genomes of cgwic with a selective advantage due to two useful features: (1) a high level of specificity and (2) the relative efficiency dependent on the ability of genomes to co localize with RNA targets (Cech, Science, 236, 1532-1539 (1987)). The specificity of ribozymes is due to specific hybridization with complementary sequences on target that contains the site XUY. Ribozymes are relatively efficient, because they break down RNA targets with high efficiency only when they are localized together with RNA targets. A mixed infection of HIV/cgwic should occur joint localization of the ribozyme-containing RNA cgwic with HIV RNA wild type, because the genomes of HIV RNA dimerizes before packing in virio the s offspring. Splitting phenomna types of HIV RNA wild type, necessary for the formation of viral proteins is probably less effective than the cleavage of genomic HIV RNA wild type, because negaranya HIV RNA not timeresults. In the here described experiments found that the selective advantage of RNA cgwic, caused by the selective packaging of cgwic in viral particles. These results suggest that the most effective splitting takes place intracellularly during dimerization, resulting in selective destruction of HIV RNA of wild-type nucleases owner. This provides a preferred packaging RNA cgwic in viral particles.

The use of cgwic-vectors for HIV therapy may include not only the selection of cgwic at the level of genomes, but also the selection of cells, forming particles of cgwic, at the level of cells. Otherwise, the cells that make up HIV wild-type, will produce HIV particles wild type with a selective advantage over cells that make up the particles of cgwic, and will soon dominate. Selective advantage can be achieved, cgwic-expressing cells via injection into the genomes of cgwic gene such as multidrug resistance), which provides cgwic-expressing cells (in the presence of drug is substances) advantages in survival before cells expressing wild-type HIV. Under these conditions, cells expressing wild-type HIV, progressive die, but still form some number of HIV wild type, whereas cgwic-expressing cells, which selectively form cgwic survive. Infection of cgwic-containing cells of the remaining wild-type HIV will lead to further education cgwic-containing viral particles. Thus, the shift of the viral genome may lead to cumulative infection of CD4+ cells genomes of cgwic, changing the balance of viruses in the host from pathogenic HIV wild-type to non-pathogenic genomes of cgwic. This strategy can lead to liberation from HIV wild-type, when the balance of the genomes of HIV selectively shifted from wild-type HIV to cgwic. Viral replication is really reduced, because cgwic can only replicate in the presence of helper genomes of HIV wild type. In this regard, taking into account such mutually restrictive conditions, it becomes possible to design cgwic-vectors, which not only reduce the burden of HIV wild-type, but released from HIV-infected host.

Means of introduction

According to the invention the vector is being introduced into the cell-the owner, in need of gene therapy viral infection, as described previously. Means of introduction include contacting Ho who Aina, able to infection by the virus, with the vector according to the invention. Such engagement preferably provides any means by which the vector is introduced into a cell of the host; the method does not depend on any specific means of injection and does not require discussion. Means of introduction of the vector are well known in the art, as well as here in the examples.

Accordingly, the introduction can be effected, for example, either in vitro (method of gene therapy of type ex vivo)or in vivo, including electroporation, transformation, transduction, conjugation or technogically crossing, transfection, infection, fusion of membranes with cationic lipids, high-speed bombing microparticles, incubation precipitate DNA with calcium phosphate, direct microinjection into single cells, etc. Other methods are also available and known to experts.

Preferred, however, the introduction of vectors and ribozymes using cationic lipids such as liposomes. Such liposomes are commercially available (e.g., Lipofectin®, Lipofectamine™ etc. offered by Life Technologies, Gibco BRL, Gaithersburg, MD). Moreover, liposomes with increased carrying capacity and/or reduced toxicity in vivo (e.g., as described in patent PCT application no WO 95/21259), can be used when implementing the present invention. D is I the introduction of liposomes you can follow the recommendations set forth in PCT application No. 93/23569. Generally, in such applications, the drug is absorbed by the majority of lymphocytes within 8 hours, at 37°With more than 50% of the administered dose is determined in the spleen one hour after intravenous injection. Other means of delivery of drugs include hydrogels and polymers with controlled release.

The form of the vector introduced into the cell-master, can vary, in particular, whether the vector in vitro or in vivo. For example, nucleic acid can be closed in a ring, to have single-strand breaks or to be linear depending on whether the vector is maintained extragenomic (i.e. as a stand-alone can replicate the vector), integrated whether it is as a provirus or proper, temporarily transfirieran, temporarily with as using replication-defective or conforming virus can replicate, or stably introduced into the host genome by recombination events using a single or double crossover.

Before the introduction of the master vector according to the invention can be introduced into various compositions for use in prophylactic and therapeutic methods. In particular, the vector can be introduced in a pharmaceutical composition together with a suitable pharmaceutically acceptable carriers or diluents, and may be obtained in the form of the Reparata, suitable for administration to a human or for veterinary use.

Thus, the composition used in the implementation of the method according to the present invention may contain one or more of the above-mentioned vectors, preferably in combination with a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers known in the art as suitable routes of administration. The choice of carrier will be partially determined by a certain vector, and a certain way of introduction of the composition. The expert is able to understand what is acceptable various methods of introduction of the composition, although more than one method can be used for administration, a particular method is able to provide faster and more effective reaction than another way. In accordance with a wide variety of suitable formulations based on the composition, as claimed in accordance with the present invention.

The composition comprising the claimed vector, either by itself or in combination with other antiviral compounds, can be prepared in the form of a composition suitable for parenteral administration, preferably intraperitoneal introduction. Such a drug can be an aqueous and non-aqueous isotonic sterile injection solutions which may contain antioxidants, buffers, bacteria is static and dissolved substances which provide isotonicity composition in relation to the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspendresume agents, solubilization, thickeners, stabilizers and preservatives. Drugs can be a single dose or multidose sealed containers, such as ampules and vials, and can be stored in a freeze dried (lyophilized) form requiring only the addition of sterile liquid carrier, for example water for injections, immediately prior to use. Injection solutions and suspensions changing composition can be prepared from sterile powders, granules and tablets, as described here.

The preparation is suitable for oral administration can be a liquid solution such as a solution of an effective amount of the compound in the diluents, for example water, saline solution or fruit juice; capsules, sachets or tablets, containing a certain amount of active ingredient in the form of solids or granules; solutions or suspensions in water; emulsions of the type oil-in-water or emulsion type water in oil". Tablet forms can include one or more of the following components: lactose, mannitol, corn starch, potato starch, mi is recrystallizes cellulose, gum Arabic, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, coloring agents, diluents, buffering agents, wetting agents, preservatives, giving a taste of the agents, and pharmacologically acceptable carriers.

Can be cooked and aerosol medication for inhalation. The aerosol product can be placed in a suitable propellant under pressure, such as DICHLORODIFLUOROMETHANE, propane, nitrogen, etc.

In this way the drug is suitable for oral administration can be a Lollipop, which may contain the active ingredient in the carrier giving the smell and flavor, usually sucrose and gum Arabic or tragakant; tablets containing the active ingredient in an inert basis such as gelatin and glycerol or sucrose and gum Arabic; rinse for the mouth, containing the active ingredient in a suitable liquid carrier, as well as creams, emulsions, gels, etc. containing in addition to the active ingredient carriers, known from the prior art.

Product suitable for outdoor use, can be a cream, ointment or lotion.

Preparation for rectal injection can be represented as a suppository with a suitable base, such as cocoa butter or a salicylate. Product suitable is for vaginal insertion, can be represented vaginal suppository, sponge, cream, gel, paste, foam or spray containing in addition to the active ingredient such carriers as are known in the prior art are suitable. Similarly, the active ingredient may be combined with a lubricating agent in the form of a coating for a condom.

Dose entered the animal, particularly a human, in accordance with the present invention, should be sufficient to generate a therapeutic response in an infected individual over a reasonable period of time. The dose will be determined by the capabilities of a particular vector used for treatment, severity of disease, as well as body weight and age of the infected individual. The magnitude of the dose will depend on the possible unwanted side effects that can accompany the use of a particular vector. As far as possible, it is necessary to minimize these unwanted side effects.

The drug may be in the form of a unit dose, such as a tablet or capsule. The term "unit dose"as used in the present description, refers to physically discrete units suitable for administration as a single dose human and animal, with each dose contains a given number of vectors as the CE is e, or in combination with other antiviral agents, calculated on the quantity sufficient to obtain the desired effect in combination with pharmaceutically acceptable diluent, carrier or the delivering agent. The form of a unit dose of the present invention will depend on the used compound or compounds and the effect you want to obtain, and pharmacodynamics of each compound in the host organism. Enter the dose should be "antiviral effective amount or amounts necessary to achieve the "effective level" of the individual patient.

Since the "effective level" is used as the preferred destination dosing, the actual dose and the drug can vary depending on differences between individuals, related pharmacokinetics, distribution, and metabolism of the drug. "Effective level" can be determined, for example, as is desirable for the patient level of the drug in blood or tissue, which corresponds to the concentration of one or more vector(s) according to the invention, inhibiting the virus, such as HIV, when performing analysis, prediction of clinical antiviral activity of chemical compounds. "Effective level" of the compounds of the present invention may vary, and that is the case, when the claimed composition is used in combination with zidovudine or other known antiviral compounds or their combinations.

The technician can easily install the appropriate dose, the circuit and method of administration of a particular composition used composition to achieve the desired "effective level" of the individual patient. In addition, a specialist can easily identify and use an appropriate indicator of the "effective level" of the compounds claimed according to the present invention direct (e.g., analytical chemical analysis) or indirect (for example, using surrogate indicators of viral infection, such as P24 or reverse transcriptase, for the treatment of AIDS and similar AIDS diseases) analysis of the respective samples obtained from the patient (for example, samples of blood and/or tissues).

Next, to determine the effective level of the drug in the patient in the treatment of AIDS or similar AIDS diseases, in particular, can be used to fit models on animals, which are widely used to assess in vivo efficacy against HIV different methods of gene therapy (Sarver et al. (1993b), supra). These models are developed in mice, monkeys and cats. Although these animals are not naturally susceptible to the disease caused by HIV chimeric model m is Shi (for example, SCID-bg/nu/xid, BALB/c with remote bone marrow)containing human mononuclear cells from peripheral blood (RVMS), lymph nodes or embryonic tissue liver/thymus can be infected with HIV and are used as models of HIV pathogenesis and gene therapy approaches. In a similar way can be used to model the apes (human immunodeficiency virus monkeys (SIV)and cats (human immunodeficiency virus cats (FIV)).

In General, the number of vector sufficient to achieve concentrations in the tissue of the entered ribozyme (or vector) from about 50 to 300 mg/kg of body weight per day is preferred, in particular from about 100 to 200 mg/kg of body weight per day. In some applications, for example the outer eye or vaginal, the preferred multiple daily doses. Moreover, the number of doses will vary depending on the means of delivery and features of a particular vector.

In the treatment of some virus infected individuals may be desirable to apply the scheme "megadoses", in which injected a large dose of vector, allow the connection some time to act, and then an individual enter a suitable reagent to inactivate the active connection(s). When implementing the method according to the present invention a therapeutic effect (i.e. replication of the vector p and the competition with the virus, which directed the impact is necessarily limited. In other words, at lower level, for example, HIV-level vector-dependent HIV from the point of view of formation of virions, will also decline.

Pharmaceutical composition for the treatment of AIDS may include other pharmaceutical agents in combination with a vector declared in accordance with the invention. Other pharmaceutical agents can be used in a traditional way (i.e. as agents for the treatment of HIV infection), or more specifically for the breeding of viruses, cgwic in vivo. Such selection, as described in this application will facilitate the distribution of conditioned HIV can replicate and provide conforming HIV can replicate more effective competition with wild-type HIV that will be necessary to limit the pathogenicity of wild-type HIV. In particular, refers to the use of antiretroviral agent, preferably zidovudine. The following are examples of additional pharmaceutical agents that may be used in addition to the previously described, including antiviral compounds, immunomodulators, Immunostimulants, antibiotics and other agents, and methods of treatment (including those who call alternative medicine that can be used to care what AIDS. Antiviral compounds include, but are not limited to ddI, ddC, ganciclovir, fluorinated dideoxynucleotide compounds nucleoside analogues, such as nevirapine (Shin et al., PNAS, 88, 9878-9882 (1991)), TIBO derivatives, such as R82913 (White et al., Antiviral Research, 16, 257-266 (1991)) and DI-RJ-70 (Shih et al., Am. J. Med., 90 (Suppl. 4A), 8S-17S (1991)). Immunomodulators and Immunostimulants include, but are not limited to, various interleukins, CD4, cytokines, antibody preparations, ransfusion blood and cells. Antibiotics include, but are not limited to antifungal agents, antibacterial agents, and agents against Pneumocystis carinii.

The use of virus-inhibitory connections with other antiretroviral agents, in particular with known inhibitors of RT (reverse transcriptase inhibitors), such as ddC, AZT, ddI, ddA, or other inhibitors that are active against other HIV proteins, such as anti-TAT agents will be mainly to inhibit most or all stages of the replication of the viral life cycle. Doses of ddC and zidovudine used for patients with AIDS or ARC published. Virusstatus range ddC average of 0.05 μm to 1.0 μm. The range of about 0.005 to 0.25 mg/kg of body weight is virusstatus for most patients. The range of doses for oral administration are somewhat wider and is for example, 0.001 to 0.25 mg/kg; dose take one or more times with intervals of 2, 4, 6, 8 and 12, etc. hour. Preferably, the dose ddC 0.01 mg/kg of body weight, take every 8 hours. When used in combination therapy other antiviral compound, for example, can be entered at the same time as the vector according to the invention, or if necessary, the dosage may be changed. The dose of each agent can be less when used in combination with other agents, than when applied individually.

EXAMPLES

Compounds and methods declared in accordance with the present invention, are further described in the following examples. These examples serve to further illustrate the present invention and are not intended to limit the scope of the invention.

Example 1

This example describes the construction of conforming replication-competent vectors. In particular, this example describes the construction of conforming vectors can replicate on the basis of HIV, i.e. cgwic-vectors. One of the most important aspects of the pathogenesis of HIV-1 is the formation of genetic variants of the virus. The rapid creation of variants of HIV in vivo indicates that the virus can be considered from the point of view of genetic modeling of Darwinian evolution (see, for example, Coffin, Curr. Top. Vicroboil. Immunol., 176, 143-164 (1992) and Coffin, Science, 267, 83-489 (1995)). Variants are formed due to the instability of the molecules of reverse transcriptase, which generates mutations in newly transcribed provirus with genomic RNA of the virus. Consequently, in vivo in the absence of important bottlenecks and multiple cycles of replication is a significant amount of genetic variation with the formation of numerous variants of the virus. However, HIV wild type is dominant and in such non-limiting conditions, it has the highest selective advantage. However, in the presence of an inhibitor such as zidovudine, selectively selected variant of the virus, which has a large selective advantage over the wild-type strain, and it subsequently becomes dominant (Coffin (1992) and (1995), supra). In accordance with the present invention provides conditioned can replicate the viral vector, which forms the genomes of non-pathogenic HIV-1 with selective advantage of pathogenic HIV-1 wild-type.

Non conforming HIV can replicate (cgwic)-vectors are defective HIV replication and packaging which occurs only in cells infected with wild-type HIV. The genomes of cgwic compete with pathogenic HIV wild-type and reduce viral load. The effect of reducing the viral load of HIV wild type in the infected host must when the contain to a greater probability of survival. It should also reduce the ability of infected hosts to transmit HIV wild-type uninfected individuals. For successful competition cgwic with HIV-1 wild-type are two important factors: (1) the selective advantage of the genomes of cgwic before HIV genomes of wild-type and (2) the selective advantage of cgwic-expressing cells before the cells expressing wild-type HIV.

Cgwic-vectors conditional replicated due to the fact that they contain sequences necessary for the expression of RNA dimerization and packaging, but does not Express active (i.e. wild-type) protein of HIV-1. The selective advantage of vectors of cgwic provide embedding them in cassettes ribozyme, which splits the plot U5 genome of HIV wild type, but not RNA U5, cgwic.

Ribozymes are included in the vectors do not break down the RNA cgwic, because the plot U5 RNA cgwic modify conservative base substitution (substitution of bases found in other strains of HIV) in order to hamper the efficient binding and cleavage of the corresponding sites of the ribozymes. Moreover, cgwic are non-pathogenic, because they do not encode proteins, which are believed to be responsible for the death of CD4+ cells. When HIV-infected cells (transfetsirovannyh cgwic vector)are activated, then stanova the camping capable of complementarity genomic defects cgwic, leading to the formation of progeny virions, cgwic.

Basically the genomes of cgwic design on the basis of an infectious full-length clone of HIV pNL4-3 (Adachi et al. (1986), supra). All reactions cloning and manipulation of DNA, RNA and proteins carried out using the methods described, for example, Maniatis et al., Molecular Cloning: A Laboratory Manual, 2nd ed. (Cjld Spring Harbir Laboratory, NY (1982)). Enzymes and reagents used in the respective reactions, obtained from commercial sources (e.g., New England Biolabs, Inc., Beverly, MA; Clontech, Palo Alto, CA and Boehringer Mannheim, Inc., Indianapolis, IN) and used in accordance with manufacturers ' recommendations. Moreover, the maintenance and multiplication of a vector is carried out using methods that are well known in the art and described previously (for example, Dropulic' et al. (1992), supra; and Dropulic' et al. (1993), supra).

pNL4-3 were cleaved by enzymes Pst I (which cleaves gag about position +1000 from start of transcription) and Xho I (which digests nef approximately in position +8400 from the start of transcription) and enter polylinker containing convenient restriction sites. Fragment BgI II, Bam HI length 0,86 TPN containing the corresponding element rev (RRE) clone site Bam HI, is present in polylinker. These manipulations lead to deletions in the genome of wild-type HIV from the coding section to gag coding section U3 (i.e., thus deletion of the gene nef). Although the vector is able to form at aceny transcript gag, he expresses not fully active protein Gag. However, since the function of wild-type Gag are not necessary in accordance with the invention, the gag sequence can be mutated to prevent broadcast protein Gag.

The cartridge ribozymes containing either one or multiple ribozymes as described in this application, enter in the website Sal I, localized in position downstreem" in relation to the site Bam HI. To perform this complementary deoxyoligonucleotide, coding sequences of the ribozymes, synthesized, annealed, and then clone the site Sal I. the Ribozymes used to construct cgwic-vectors represent the ribozymes in the form of a hammer head. These ribozymes contain the catalytic domain of the 22 base pairs and two hybridization domain of 9 base pairs each. Ribozymes "focused" on the website +115 +113 (number of base pairs after the start of transcription) RNA sequences U5. Hybridization domains and the catalytic domain (underlined) ribozymes directed to website +115 and website +113, have the following structure:

CACACAACACTGATGAGGCCGAAAGGCCGAAACGGGCACA (ribozyme +115) [SEQ ID No. 3]

ATCTCTAGTCTGATGAGGCCGAAAGGCCGAAACCAGAGTC ("ribozyme +133) [SEQ ID No. 4]

Cassette ribozymes contains one, two or three of the ribozyme arranged tandemly. The vectors containing either one (i.e. cgwic-1.1"-vector, Figure 1B)or three (i.e. sgui the-1.111-vector, Figure 1E) ribozyme, a ribozyme targeted to the same site RNA U5 HIV +115. The vectors containing two ribozyme, the ribozyme is targeted either at the same site at position +115 (i.e. cgwic-1.11-vector, Figure 1C)or at different sites in provisions +115 +133 PHK U5 HIV, cgwic-1.12 (i.e. cgwic-1.12-vector, Figure 1D). These vectors generally are considered here as "cgwic"-vectors.

At the completion of construction of cgwic-vectors give resistance to cleavage by ribozymes (using their RNA form) by generating mutations in the website, recognizable ribozymes in the form of a hammer head, which is in the U5 region of the genome of cgwic. To do this, denitely oligonucleotide

(i.e. AAGCTTGCCTTGAGTGCTCAAAGTAGTGTGTGCCCACCTGTTGTGTGACTCTG GCAGCTAGAGATCCCACAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGC GCC [SEQ ID No. 13])that contains a substitution of the bases shown in Figure 2 [SEQ ID No. 2] used for the introduction of modified sites in the vector. More precisely, the substitution of bases is introduced into the sites of hybridization and cleavage of the ribozyme in a pair of bases 115 and 133. In particular, as shown in Figure 2, the mutations generated in pairs of bases 113, 114, 132, 134 and 142. These sites can be modified so that they contain any mutation (i.e. GTGTGCCCNNCTGTTGTGTGACTCTGGNANCTAGAGANC, where N can be any nucleotide [SEQ ID No. 14]).

Preferably, however, when sequences mutate so the m way what they include, for example, replacing G And website +113 (i.e. so that the sequence contains GTGTGCCCATCTGTTGTGTGACTCTGGTAACTAGAGATC [SEQ ID no. 15]), replacing U (i.e. T in the case of DNA) on the website +114 [SEQ ID No. 5],

replacing U (i.e. T in the case of DNA) on the website+132 [SEQ ID No. 6] replacing And G in the website +134 (i.e. so that the sequence contains GTGTCGCCGTCTGTTTGTGTGACTCTGGTAGCTAGAGATC [SEQ ID No. 16] and replacing U (i.e. T values in the DNA sequence) And in the website +142, and these mutations can be generated either individually or in combination. In particular, in the absence of other mutations in the U5 replacement of U (i.e. T in the case of DNA) on the website +114 [SEQ ID No. 5] and/or in the website +132 [SEQ ID No. 6] RNA U5, cgwic prevents cutting her ribozymes (Uhlenbeck (1987), supra). Insertions, substitutions of bases found in various other strains of HIV (Myers et al., HIV Sequence Database, Los Alamos Nat. Lab. (1994)), it indicates that such replacement does not reduce the ability of the HIV genome replication.

Way, as evidenced by this description, can be used to construct other conforming vectors can replicate, for example, contains the genomes of different viruses (e.g., different RNA viruses) or containing different genetic antiviral agents. Next, the conditional can replicate the vector may be further modified so that it provides the cell-master, in which he is entered, the selective advantage is in front of the host-cell, containing the wild-type virus. For example, the vector can be modified so that defines multiple drug resistance or encodes a mutant protease or reverse transcriptase.

Example 2

This example shows the stability conforming vectors can replicate and, in particular, cgwic-vectors to the cleavage of the ribozyme.

To confirm the stability of cgwic-vectors to cleavage by ribozyme carry out transcription in vitro. To perform this sequence of ribozymes clone in the website Xho I pBluescript KSII (Stratagene, La Jolla, CA). Fragment BgI II length of 0.21 KB (KBP)containing the mutant plot U5, cgwic, similarly cut from cgwic-vector and injected into the site of Bam HI pBluescript KSII. These modified vectors pBluescript KSII linearizer using Dss HII before in vitro transcription. A similar plasmid expressing PHKU5 HIV wild-type (described by Myers et al. (1994), supra), used as a control. It linearizer Eco RI before in vitro transcription.

Labeled radioisotope label PHK U5 HIV RNA ribozyme get when transcription vectors in vitro, as described previously (Dropulic' et al. (1992), supra). Labeled with radioisotope-labeled transcripts incubated together (at a molar ratio of target - ribozyme 1:2) in 1X transcription buffer containing 40 mm Tris-HCl, pH 7.5, 6 mm MgCl2, 2 mm Spermidine and 10 mm NaCl. heated to 65° C, and then cooled to 37°With 5 minutes before adding the reducing buffer solution containing 95% formamide, 20 mm EDTA (ethylenediaminetetraacetic acid), of 0.05% bromophenol blue and 0.05% xylenecyanol FF. Products are then separated by polyacrylamide gel electrophoresis (PAGE) under denaturing conditions and determine autoradiographically.

When PHK U5 HIV wild-type incubated with samples containing a single ribozyme to the site+115, splitting it is easy to see. This splitting leads to the formation of products P1 and P2. Splitting can also be seen when HIV RNA wild type incubated with RNA, ribozymes containing a double or to the same site or different sites. When the ribozyme-containing transcript, aimed at two different customers, incubated with HIV RNA wild type, receive the products P1, P2 and P3. P3 is formed by the cleavage site +133.

For comparison, when a modified U5-containing RNA cgwic incubated either with one ribozyme directed to the website +115 or double ribozyme directed to the website +115 or on the website +133, the fission products are not detected. Thus, these results confirm that RNA U5, cgwic are resistant to cleavage by ribozymes, whereas RNA U5 HIV wild-type split by ribozymes targeted at U5. Moreover, given the results confirm, the approach used in the implementation of the present invention can be applied to obtain the conditional can replicate vectors (including vectors, other than cgwic-vectors) with a selective advantage in replication when introduced into a cell of the host compared to the strain, wild-type.

Example 3

This example shows the ability of the ribozyme-containing conditioned vectors can replicate intracellular cleave RNA of wild-type virus. In particular, this example confirms the ability of cgwic-vectors intracellular split HIV RNA wild type.

Efficacy mediated cgwic-vector of inhibition of wild-type HIV testing joint transfection of genomes in a Jurkat cell. For conducting transfection washed with approximately 106of Jurkat cells in the medium Opti-MEM (Life Technologies, Gibco BRL, Gaithersburg, MD) and then cotransfected cells approximately 0.6 μg DNA HIV wild-type (i.e. pNL4-3) and approximately 1.8 μg DNA cgwic. Use the molar ratio of wild-type HIV to the provirus cgwic 1:3 in order to ensure that all cells transfetsirovannyh HIV wild-type, also contain provirus cgwic. DNA is stirred solution lipofectin (Life Technologies) for 30 min, and then incubated with Jurkat cells for approximately 3-6 hours, then add complete medium RPMI 1640 containing an embryo is inuu bovine serum (FBS). The virus-containing supernatant collected every 2-4 days and analyze the levels of virus activity of reverse transcriptase in a cell supernatant, as described previously (Dropulic' et al. (1992), supra).

The impact of the genomes of cgwic on HIV replication in wild type are shown in Figure 3. When wild-type HIV cotransfected with cgwic-1.1, viral growth is delayed (Figure 3, unfilled rectangles) in the cells, cotransfection HIV wild-type and control virus (Figure 3, black squares), but not inhibited. Because anti-U5 ribozymes can inhibit HIV replication in vivo co-localization (see, for example, Dropulic' et al. (1992), supra) observed the growth of the virus may be the result of either: (a) preferred package HIV RNA of wild-type progeny virions, (b) education HIV RNA wild-type resistant to cleavage by ribozymes, (b) accumulation of inactive ribozymes in RNA cgwic.

The nature of "avoiding" the growth of the viruses tested by cotransfection HIV wild type with cgwic-vectors that contain double ribozymes. If your preferred package of HIV wild type is responsible for the growth of the virus, the culture containing cgwic double ribozyme, will have similar growth kinetics of the cultures containing cgwic with single ribozymes. If, however, the growth of the virus due to HIV RNA wild tee is a, which becomes resistant to the action of the ribozyme (i.e., from the instability of the reverse transcriptase of the virus), the growth kinetics of the virus finds a more significant delay in cultures containing cgwic-1.12 (i.e. directed against two sites of virus) compared with cultures containing cgwic-1.11 (i.e. directed against a single site of the virus). Alternatively, if you see a delay in the growth of the virus, which is comparable to that in cultures containing cgwic with various double ribozymes, it can be assumed that part of the single expressed by one of ribozymes is inactive in vivo.

As can be seen from Figure 3, the culture containing cgwic-1.11 (Figure 3, white crossed rectangles) or cgwic-1.12 (Figure 3, shaded rectangles)find a large delay in the growth of the virus than cgwic-1.1, which contains one transcribed ribozyme (Figure 3, open squares). However, the delay in the growth of the virus is similar to cgwic-1.11, cgwic-1.12, indicating a third possibility, namely, that a single transcribed ribozymes kinetically less efficient at splitting RNA targets than double ribozymes. This suggests that at a certain ratio of intracellular transcribers ribozymes can form inactive, possibly misfolded conformation, since experiments with cotransfection is carried out at a molecular excess of ribozyme-containing genomes of cgwic.

Use the ability multiple ribozymes to weaken this kinetic limitation by increasing the probability of the Association of active ribozymes with HIV RNA wild type. In these experiments, Jurkat cells cotransfected HIV wild-type and cgwic-1.111, which contains a triple ribozyme to the site +115. As can be seen from Figure 5 (shaded rectangles), there is no evidence of growth of the virus when using triple ribozyme, even after 22 days of cultivation. These results are especially important in light of the fact that the normal primary T cells often die quickly (e.g. within a week) after HIV infection.

Moreover, these results confirm that the ribozyme-containing conditioned vectors can replicate, such as cgwic-vectors, and particularly those that contain multiple ribozymes can be used to provide intracellular competition with the genome of wild-type virus, such as HIV.

Example 4

This example illustrates a study of the mechanism underlying the ability of the ribozyme-containing conditioned vectors can replicate, especially cgwic-vectors, intracellular cleave RNA of wild-type virus.

For these experiments, the cult of the market, cotransfection RNA from the cell supernatant of HIV wild-type and cgwic-1.111, examined using back-transcriptase polymerase chain reaction (RT-PCR), as described in the present description. RT-PCR performed using primers shown in Figures 5A-C. namely RNA ribozyme determined using primers R1 and R2, HIV RNA wild-type determine, using the primers V1 and V3, RNA cgwic determine, using the primers V2 and V3. Each of the primers R1 (TGTGACGTCGACCACACAACACTGATG [SEQ ID No7]) and R2 (TGTGACGTCGACTCTAGATGTGCCCGTTTCGGC [SEQ ID No8]) contains the restriction site Sal I and amplificare RNA anti U5-ribozyme binding hybridizers sequences of the ribozyme. In cells expressing cgwic-1.111, detect amplification products single, double and triple ribozyme. Each of the primers V1 (GGTTGGATCCGGGTGGCAAGTGGTCAAAAAG [SEQ ID No9]) and V1 (GGTTGGATCCGGGTGGCAAGTGGTCAAAAAG [SEQ ID No10]) contains the restriction sites Bam HI or Hind III and amplificare HIV RNA wild type. As the above-mentioned primer V1, primer V3 (CGGATCCACGCGTGTCGACGAGCTCCCATGGTGATCAG [SEQ ID No11]) contains a Bam HI and other sites of restriction. This set of primers amplificare RNA cgwic with cgwic-specific polylinker sequence.

For carrying out RT-PCR RNA virion and intracellular RNA allocate using Trizol™ (Life technologies). Intracellular viral RNA emit directly from the cellular precipitation obtained when the micro is zentrifugenbau. Requiring distinguish from supernatant cultures who first cleared of cells and debris by microcentrifuge at 12000×g for 5 min, Trizol™ add to the cell-free supernatants and incubated the mixture for 5 min before adding chloroform to separate the phases. The aqueous phase transferred to a clean tube and precipitate Uncesoredanal using glycogen. After recovery of the precipitate RNA carry out reverse transcription of viral RNA, and then amplified them by PCR using primers with radioisotope labels.

Reverse transcription was performed for 1 hour at 42°in the buffer for the first circuit containing 50 mm Tris-HCl, pH 8.3, 75 mm KCl, 3 mm MgCl2, 5 mm DTT (dithiothreitol), 1 mm dNTP (deoxynucleotide) and 20 units (U) of RNase inhibitor, to which is added 25 U reverse transcriptase. After reverse transcription reverse transcriptase inactivate by heating at 65°C for 10 minutes the mixture is Then entirely added directly to the buffer for PCR with obtaining a mixture containing a final concentration of 10 mm Tris-HCl, pH 8.3, 50 mm KCl, 1.5 mm MgCl2. Carry out 30 cycles of amplification mixture, using 2.5 Eg enzyme Taq. PCR products with a radioisotope label is shared by PAGE under denaturing conditions and detected by autoradiography.

RNA ribozymes, cgwic-1.111 found in super is tantah cells more than twenty days after cotransfection genomes of proviruses HIV-1 wild-type and cgwic-1.111. This is evidenced by the presence of PCR products of RNA single, double and triple ribozymes. Compared to this, these products are not detected in virions obtained in the control cultures transfected with wild-type HIV. During this period of time the cells look normal without obvious signs of cgwic-induced cytotoxicity. This confirms that cgwic packaged in viral particles even in the absence of the activity of reverse transcriptase. Moreover, it indicates the possibility of intracellular complementaly cgwic when the function of genes of HIV.

Thus, the results show that cgwic inhibits HIV replication in wild type by suppressing the spread of HIV wild type. The results also confirm that others can replicate conforming vectors, such as other viral vectors and/or vectors containing other genetic antiviral agents, may be similarly used to inhibit the replication and spread of the virus wild-type.

Example 5

This example illustrates further the use of the mechanism underlying the ability of the ribozyme-containing conditioned vectors can replicate, in particular cgwic-vectors, intracellular cleave RNA of wild-type virus.

One of the possible mechanisms is that is, that RNA both wild-type HIV, cgwic is packaged into progeny virions, and here there is an effective splitting due to the joint localization of the ribozyme and RNA targets. Alternatively, selective packaging RNA cgwic in progeny virions may occur because the cleavage of HIV RNA wild-type is mainly intracellular, but not in the HIV virion. The present invention uses these mechanisms.

The means by which cgwic-1.111 inhibits the spread of HIV wild type, are examined using RT-PCR virion - and cell-associated viral RNA in cell culture transfected with only HIV wild-type or co-transfected with wild-type HIV, cgwic-1.111. RNA cgwic-1.111 selectively detected in the progeny virions formed after cotransfection. Compared to this control transfetsirovannyh HIV wild-type culture form virions that contain only HIV RNA wild type. Intracellular RNA of both wild-type HIV, cgwic-1.111 found in cotransfection cultures. Therefore, although HIV RNA of wild-type and cgwic synthesized intracellular RNA cgwic selectively packaged into progeny virions. On this basis suggest that cgwic-1.111 inhibits the spread of HIV wild type by selective cleavage of the genomic RNA is ICH wild type before encapsidate, while some subgenomic RNA wild-type broadcast proteins for the formation of virions.

To test the selective cleavage of the genomic RNA of wild type RNA cgwic types of intracellular RNA detected in cultures of Jurkat cells after approximately 20 days after cotransfection, exploring the way Northern hybridization. The probe used for Northern blotting, as shown in Figure 5, separated from Bge-II-fragment length 0,21 KBP section U5 pNL4-3.

Culture, transfetsirovannyh HIV wild type, Express all kinds HIV RNA wild type, i.e. genomic and subhanahu RNA. Compared to this culture, cotransfection cgwic-1.111, does not Express significant amounts of genomic (9,7 KBP) HIV RNA wild type. Low molecular weight RNA (reflecting the presence subgenomic HIV RNA wild type) identified in cotransfection cultures. Detection of traces of HIV RNA in these samples suggests that some amount of degraded RNA HIV can be present in these low-molecular-weight RNA. Compared with the data traces of HIV RNA from wild-type control cells with wild-type HIV explain the degradation of RNA, which exists when a significant cytopathic effect (CPE)observed in the later stages of HIV infection.

Accordingly, the above result is you confirm, what genomic HIV RNA wild type selectively broken down and degraded in cells containing the genomes of wild-type HIV, cgwic-1.111, which allows RNA cgwic selectively packaged into virions. Moreover, these results show that the method can be similarly used for other viruses, especially RNA viruses.

Example 6

This example illustrates a study of the ability of the ribozyme-containing conditioned vectors can replicate, in particular cgwic viruses, to complete the replication cycle of the virus in the presence of helper virus wild-type.

To confirm that the genomes of cgwic undergo a complete cycle of virus replication in the presence of the helper genome of HIV wild type, study the formation of viral particles containing the genome of cgwic, in tough conditions. In particular, examine the first cycle of education of viral particles containing the genome of cgwic, in activated cells ASN (AIDS Reagent Refernce Program, Rockville, Maryland). These cells are latently infected HIV-1 cell liniju. Then examine the ability of any particles of cgwic isolated from these cultures, to infect infected Jurkat cells and to form DNA cgwic.

The implementation of these experiments approximately 106cells ASN transferout 2.5 µg DNA vector. Cells are stimulated with 50 nm 12-O-tetradecanoylphorbol 13-acetate (TPA) is IMEMO after 24 hours after transfection. RNA isolated from the cell supernatant approximately 72 hours after transfection. RT-PCR performed using primers R1 and R2, as described in Example 4. RNA ribozymes, cgwic determine the virions are formed by activated cells ASN after transfection, cgwic-1.11, but not after transfection with a control plasmid hGEM 3Z (Promega, Madison, WI). Thus, the transfection of cgwic-vectors infected CD4+ cells leads to the formation of viral particles that contain RNA cgwic.

Then examine the ability of virions, cgwic isolated from these cultures, to infect uninfected Jurkat cells and to form provirus cgwic. Such provirus find secreting cell DNA using Trizol™, splitting the DNA Eco RI and amplificatio ribosomnuyu DNA by PCR, using primers R1 and R2, as described in Example 4. DNA cgwic formed in Jurkat cells after infection cell supernatants from the transfected cgwic cells ASN. Namely, in this case showing specific amplification of ribosomal DNA cgwic-1.11. Compared with that in cells infected with only supernatants stimulated cells ASN (i.e. in the absence of any infection of cells ASN cgwic-1.111)find products ribozyme DNA.

Since cgwic-vectors are distributed only in the presence of helper genomes of HIV wild type,investigate the ability of uninfected cells, containing the genomes of cgwic, to avoid infection of HIV wild type. These experiments are conducted, through the first transfection cells cgwic-1.11 (vector cgwic) and then supertransport HIV wild-type (i.e. pNL4-3). Accordingly, approximately 106cells Jurkat transferout about 2.5 μg DNA cgwic. Cells pokasivaut about 72 hours before infection with HIV strain. Cells Jurkat, transfetsirovannyh cgwic-1.11, incubated with strain pNL4-3 (2×105units TCID50106cells) for about 2 hours at 37°C, washed three times in medium with reduced serum Opti-MEMSMand then resuspended in complete medium (RPMI 1640 with 10% FBS). RNA isolated from the cell supernatant as described in Example 4, about 5 days after infection.

For analysis TCID50(dose of virus, infectious for 50% of the cells) supernatant containing HIV, placed in 96-well tablets with a 5-fold limiting dilution. Approximately 104of MT4 cells (AIDS Reference Reagent Program, Pockville, Maryland and Harada et al., Science, 229, 563-566 (1985)) are added to the diluted virus suspension and incubated the resulting suspension within 7 days to obtain the full growth of viruses. The MT4 cells are modified T-cells that contain the gene of Tax HTLV-1, which is transactivator genome, similar to Tat of HIV-1. Then supernatant analyze the and reverse transcriptase activity and take into account, as described previously (Dropulic' et al. (1992), supra). The infectious dose for tissue culture is determined by the method described by Reed and Muench (In: Tech. in HIV Res., Johnson et al., eds., Stockon Press, 71-76 (1990)).

Superinfection of cgwic-infected cells Jurkat HIV wild type leads to the inclusion of the genomes of cgwic in viral particles. The genomes of cgwic packaged in viral particles after superinfection of HIV wild type. During this period the cells look normal without significant manifestations of cytotoxic effect.

These results suggest that the genomes of cgwic able to complete a replication cycle after complementaly helper virus HIV wild type. In addition, the results confirm that other viral genomes is likely to be able to complete a replication cycle after complementaly the corresponding wild-type virus.

Example 7

This example reveals the nature of "avoiding" the growth of the virus, as described in the previous examples.

For exploring the nature of "avoiding" the growth of the virus in cultures transfected with wild-type HIV or cotransfection HIV wild type ispwich-1.11, analyze RNA virions using RT-PCR, as previously described. Viruses produced in the cultures at the early growth stages of the virus (i.e. culture, transfusiona on day +11 wild-type HIV, culture, cotranslationally cr the ICH-1.11 on day +19), contain mostly RNA cgwic. Compared to this culture at late growth stages of the virus (i.e. culture, transfusiona on day +17 HIV wild type, culture, cotranslationally cgwic-1.11 on day +23) contain mostly HIV RNA wild type. As a consequence, the growth of viruses in cells, cotransfection previously HIV wild-type and cgwic-1.11, obviously, are the result of the growth of HIV wild type, which avoids intracellular restriction by the ribozyme. It is important that the genomes of cgwic still contain substantial proportions of the total genomes of HIV even in cultures at late growth stages of the virus. This suggests that, although the genomes of wild-type HIV prevail, the genomes of cgwic nevertheless propagated in culture, although with less efficiency than the genomes of HIV wild-type.

Specified confirms that cgwic-vectors, as well as other conforming vectors can replicate, can effectively compete with the genomes of wild-type viruses during viral replication.

Example 8

This example also reveals the nature of "avoiding" the growth of the viruses described in the previous examples.

The effect of packing Rnxgiq in virions by "avoiding" the growth of the viruses studied, determining the titers of infectious HIV wild type. Research TCID50by limiting dilution as described in Example 6) is carried out with Viru is tion supernatant cultures in the exponential growth stage of the virus (i.e. cultures of HIV wild type on day +14, cultures, cgwic-1.1 on day +16, cultures, cgwic-1.11 or cgwic-1.12 on day +20). These samples normalize before analysis using reverse transcriptase activity. Supernatant cultures of wild-type HIV, cgwic-1.1, cgwic-1.11, cgwic-1.12 have infectious dose of 1.3×104TCID50/ml, 5,4×103TCID50/ml, 3,8×103TCID50/ml and 3.8×103TCID50/ml, respectively. Thus, the packaging RNA cgwic in virions during the "avoidant" growth of viruses leads to a decrease in the number of produced infectious particles of HIV wild-type.

Next examine whether the reduction of the titer of infectious HIV wild type by the cleavage of HIV RNA wild type in "escaped" the virions. The cleavage products of RNA from virions found in supernatant cotransfection cells, evaluated by the method of elongation of the primer. Use primer D

(GGTTAAGCTTGTCGCCGCCCCTCGCCTCTTG [SEQ ID No12], shown in Figure 6 and containing a restriction site Hind III. The elongation of the primer for cleavage site carried out for 2 h at 42°in the buffer for the first circuit containing 50 mm Tris-HCl, pH 8.3, 75 mm KCl, 3 mm MgCl2, 5 mm DTT, 1 mm dNTP and 20 Eg RNase inhibitor, to which is added 25 Eg MuLV reverse transcriptase. Viral RNA extracted from concentrated virus preparations obtained from concentrated cult is cgwic. Cells and debris are removed by centrifugation at 2000×g for 15 min at 4°C. the virus Then concentrate ultracentrifugation at 30,000×g for 4 h at 4°C. Viral RNA was then isolated from the sediment of viruses using Trizol™as described previously.

RNA viruses are separated from supernatant cultures transfected with wild-type HIV and cotransfection cgwic-1.11 in the later stages of growth of viruses (i.e. cultures, transfected with wild-type HIV on day +17, cultures, cotransfection cgwic-1.11 on day +23). Virions in these cultures contain genomic RNA of both wild-type HIV, cgwic. Elongated primer cDNA full length detected in both cultures - transtitional HIV wild-type and cotranslational cgwic-1.11. Do not detect smaller cDNA, which would be the result of splitting PHK U5, despite effective analysis method for elongation of the primer. Thus, lower titers of infectious wild-type HIV is not the result vnutribruchnogo cleavage of HIV RNA wild type, but is a consequence of the quantitative substitution of Rnxgiq in progeny virions.

The results thus show that the described method can be used to replace the genomes of wild-type, for example, genomes of HIV and other genomes in progeny virions using to dicianno can replicate vectors according to the invention.

Example 9

This example demonstrates that cgwic-vectors can inhibit HIV replication in wild type after controlling infection by plasmid or recombinant virus cgwic-1.111.

The Jurkat cells to infect a strain of HIV (clone pNL 4-3) and infect either (1) a plasmid DNA containing the design cgwic-1.111, or (2) recombinant virus cgwic-1.111 packaged in 293 cells, i.e. mutant shwick (Nadlini et al., Science, 272, 263-267 (1996)). Cells transferout using DLS-lipids (Thierry et al., PNAS, 92, 9742-9746 (1995)) or cgwic-mediated delivery. Viral replication is determined by the activity of reverse transcriptase 12 days after initial HIV infection. Culture wild-type, serving as a positive control, detect normal levels of growth of wild-type HIV. When cells infected with wild-type HIV, infect the mutant cgwic-M by DLS due to transfection, the growth of wild-type HIV not broken. In contrast, when cells infected with wild-type HIV, infect cgwic-1.111, which encodes an anti-HIV ribozyme, DLS-based transfection, growth (i.e. replication) HIV wild type significantly inhibited. Moreover, when co-infection with the mutant cgwic-M and wild-type HIV replication HIV wild type is not disturbed. In contrast, when carrying out a joint INF is their HIV wild-type and cgwic-1.111, replication of HIV wild type significantly inhibited. The data show that cgwic-vectors can be used to significant intracellular inhibition of HIV replication in wild type.

Example 10

This example discloses the use of conditional can replicate vectors for cancer therapy.

Can be constructed conforming can replicate the viral vector to treat cancer, which is defective for replication in normal cells, since it has no viral protein necessary for replication. However, when this vector infects a cancer cell, the unique properties of cancer cells provide a factor (for example, preferably the same mutant cell protein, which contributes to the aberrant growth of cancer cells), which facilitates the replication defective vector is designed for treatment of cancer. Accordingly, this method differs from the method used to treat a viral infection that is not selective packaging of the viral vector, but instead is the preferred lysis of cancer cells, due to the packaging of progeny virions derived from the vector in the cell. However, this method is similar to the method used for the treatment of viral infections in that and in this case you can use expressing, etc) is R helper virus for selective breeding conforming vector can replicate in cancer cells. Can be constructed in the vector and/or expressing the vector and helper virus-sensitive tumor-specific factors that facilitates the selective propagation of the vector in tumor cells.

Tumor-specific factors that can be used in this method of treatment include (without limitation specified) factors that operate at the level of: (1) penetration of the virus into the cell (for example, the presence of tumor-specific receptor, which provides selective penetration of viral vectors in cancer cells but not in normal cell); (2) transcription of the virus (for example, a mutant protein of a cancer cell, providing preferential transcription of RNA vector designed for treatment of cancer in cancer cells as opposed to normal cells), and (3) maturation and release of the virus (e.g., mutant proteins cancer cells can provide selective maturation conforming vector can replicate intended for the treatment of cancer, for example, the Association of mutant cellular proteins with a protein or viral genome, leading to the stimulation of the maturation and release of the virus). Accordingly mutant proteins that exist in cancer cells, can interact with viral proteins (or genomic RNA or DNA) at various stages of the replication cycle of the virus. These EOI is Imedashvili can be manipulated to create conforming vectors can replicate, intended for the treatment of cancer, which are defective in normal cells and can replicate in cancer cells.

In particular, the described method can be used to treat T-cell leukemia. T-cell leukemias represent a severe form of cancer with a poor prognosis. Many of leukemic T-cells are CD4+cells. Thus, the conditional vector can replicate intended for treatment of T-cell leukemia, can be constructed using wild-type HIV as a backbone vector. Because HIV is obviously enters the cell via glycoprotein CD4, the corresponding vector acting on the penetration of the virus into cells.

Vector for cancer treatment can be obtained, for example, with the introduction of deletion(s) in wild-type HIV. In the HIV genome can be introduced by mutation when it is in the form of DNA, and can be made site-specific mutagenesis, as described previously. In this way the method can be implemented through complementaly defects of the virus to other tumor suppressor mutations or negative oncogenes or other tumor-specific factors that interact with viral proteins. For example, there may be generated a deletion of the tat gene, which encodes a protein important for rap the paths HIV. In the absence of HIV Tat can no longer be adjusted according to the feedback type of its expression, which is absolutely necessary for the reproduction of HIV. Protein Tat acts by binding to the structure of the stem-loop RNA TAR, which is associated with the HIV promoter, and is able to increase the type of feedback the expression of HIV more than 100 times. Thus, without Tat vector-based HIV does not expresses proteins of HIV, does not propagate and does not cause the death of normal (i.e. non-cancerous) T cells.

However, leukemic T-cells usually contain functionally modified molecule, which is either a mutant, overexpression or silent. This change in the function of the molecule is not associated with normal cells. In neotantra condition (no mutant) this molecule is involved in the regulation of cell proliferation and/or apoptosis (programmed cell death). Changes associated with the mutant condition, can be used for specific stimulation of reproduction conforming can replicate the viral vector in the presence and in the absence expressing vector helper virus (vector). For example, a defect in the Tat can be complementarian helper expressing vector that is directed tumor-specific promoter, and the promoter is going on is it from sverkhekspressiya gene leukemia cells. Such a vector can replicate only in leukemic T-cells and not in normal cells. Expression and replication of the virus in leukemic T-cells should lead to lysis and cell death during the formation of the virus. The vector may contain additional elements to stimulate cell death (for example, a sequence encoding a toxin, a cytokine or antigen stimulating the immunologic targeting).

Other methods and strategies can be similarly used in the design the following conditional can replicate vectors for the treatment of cancer.

Example 11

This example illustrates the construction of cgwic second generation (sgic), which are better able to reproduce than cgwic-1.111-vectors.

The vectors of the second generation provide an increased level of education of particles of cgwic in cgwic-producing cells. Education increased the number of particles of cgwic facilitates their distribution and prevents efficient growth of HIV wild-type cultures. Not having sequences that encode proteins that block the HIV superinfection with wild-type vectors contain all sequences of native wild-type HIV, but do not contain the Tat gene. Instead of the Tat gene is integrated cartridge triple anti-Tat ribozyme ([SEQ ID No18])addressed to three different sites Tat gene. Implemented the Jena also the deletion of the splicing site of the Tat gene, so Tat-ribozymes selectively cleaved genomic HIV RNA wild type and were not subjected to RNA splicing HIV wild type, which will complementary defect in Tat and facilitate the replication of cgwic. In contrast to the known vectors that do not encode proteins other than, perhaps, from protein genetic antiviral agent, such as an immunogen, the vectors of the second generation code, but Express these proteins only in the presence of Tat. In the cell, which contains both genome - HIV wild-type and cgwic, the genomes of cgwic not only selectively packaged, but a much more virions than in cells with cgwic-1.111, as structural proteins are formed not only from the genomes of HIV wild-type, but with the genomes of cgwic. Accordingly, the vector has a selective advantage in reproduction, since it not only forms the viral matrix HIV wild-type, but also on matrices cgwic.

The vectors of the second generation are also characterized by the fact that they contain silt and encode ribozymes, catalytic domain plots of targets which are different from those of the vectors. In contrast, cgwic-1.111, which contains or encodes a ribozyme directed to the site U5 leader sequence of HIV, contributing to the need for incorporating modified sequences U5 leader in the sequence cgwic-vector, rib the winter plots of target vectors of the second generation are not in the vector, thus eliminating the need to modify the sequence of the vector. This reduces the probability of formation of resistant HIV recombination of HIV wild type with modified sequences U5, cgwic. Thus, recombination of HIV wild-type sequences of cgwic would not provide the advantage of HIV wild type; incorporation sequences of the ribozyme in HIV wild type was only undesirable for HIV wild-type.

The vectors of the second generation is further characterized by the introduction into the composition of various ribozymes, each focused on different sites, to reduce the likelihood of the formation of the ribozyme-resistant mutants of HIV wild-type.

When further improving vector system for security purposes conforming can replicate vaccine design "helper-vector" can be even more improved by adding genetic elements/factors that specifically facilitate the replication and spread of cgwic in a safe manner. One possible implementation is the embedding of the ribozymes in the helper vector to prevent genetic recombination with the vector with the formation of wild-type virus. Therefore, the above sgic-vector can be complementarian Tat-helper expresser the criterion vector to facilitate its dissemination. When the insertion of anti-HIV ribozymes in helper expressing vector, the probability of recombination minimize, since the meeting of the vector RNA helper vector would lead to their mutual splitting and destruction. Consequently, expressing helper vector can be modified in various ways for the development of specific preventive or therapeutic strategies. Accordingly, the vectors sgic find use as vaccines against HIV, because they (1) are replicated and thus continuously stimulate the immune response of the host and (2) allow the host to recognize different epitopes, because they are isolated from HIV and antigenic change.

All information provided in this description, references, including patents, patent applications and publications, are included in their entirety, solely to reflect the known prior art.

As in the description of the invention set out the preferred options for its implementation, for professionals it is obvious that can be implemented and used various modifications of the preferred variants of the invention, and it can be implemented in other ways than described here. The present invention involves these modifications and alternative approaches. In accordance with this invention covers all modifications included in the volume is, and its essence is expressed below by the claims.

1. Conventionally can replicate the retroviral vector for inhibiting replication of a retrovirus wild-type helper virus, helper vector or genetic element wild-type, able to replicate in permissive cell host by complementaly with retrovirus wild-type helper virus, helper vector or genetic element containing the sequences of the long terminal repeats (LTR) of retroviruses, retroviral packaging signal, at least one first nucleotide sequence containing or encoding, and in this case expressing the genetic antiviral agent that adversely affects the replication of the retrovirus wild-type helper virus, helper vector or genetic element wild type, and, optionally, at least one second nucleotide sequence, while the presence of the above-mentioned first and second nucleotide sequences separately or in combination provides a cage-hoteispelicano advantage over other cell, infected by a strain of wild-type retrovirus, or helper virus or helper vector, when mentioned in another cell without the specified conditionally can replicate the retroviral vector and the specified conditionally can replicate the retroviral vector is resistant to the presence of the indicated genetic antiviral agent and has a selective advantage for replication before the specified retrovirus wild-type helper virus, helper vector or genetic element of the wild-type.

2. The vector according to claim 1, characterized in that it is a chimeric vector.

3. The vector according to claim 1 or 2, characterized in that it is derived from human immunodeficiency virus (HIV) wild-type and contains the sequence of the HIV LTR.

4. The vector according to claim 1 or 2, characterized in that it is derived from a virus belonging to the genus or subfamily selected from the group consisting of Spumavirinae, Spumavirus, Lentivirinae and Lentivirus, and the specified vector contains at least one CIS-acting genetic element, colocalize genetic antiviral agent with its target.

5. The vector according to claim 4, characterized in that the specified target is a retrovirus wild-type helper virus, helper vector or genetic element of the wild-type.

6. The vector according to claim 4, characterized in that the CIS-acting geneticallybased is an export signal or the dimerization and/or the specified vector is resistant to genetic antiviral agent.

7. The vector according to claim 1 or 2, characterized in that the specified genetic antiviral agent selected from the group consisting of an antisense molecule, a ribozyme, an external helper RNA sequence R, traps, nucleic acids, transdominant mutant protein, antibodies of the same chain, cytokine, cellular antigen, or receptor, or immunogen.

8. The vector according to claim 7, characterized in that the specified genetic antiviral agent is represented by a ribozyme or ribozyme cassette, containing one, two or multiple ribozymes.

9. The vector of claim 8, wherein each ribozyme from the specified cassette capable of splitting different sites and/or when the specified cartridge contains at least three of the ribozyme.

10. The vector according to claim 7, characterized in that the specified genetic antiviral agent encodes the antibody of the same chain against the protein of the retrovirus wild-type helper virus or helper vector or encodes antisense molecule.

11. The vector according to any one of claims 1 to 10, characterized in that the presence of the second nucleotide sequence provides the specified cell host selective advantage over other cell infected by a strain of wild-type retrovirus, or helper virus or helper vector, when specified in another cell without the specified conditionally the bulk packing : spindle is ruusila retroviral vector, or provides a selective advantage to the specified conditionally can replicate retroviral vector before the specified retrovirus wild-type helper virus or helper vector.

12. The vector according to claim 11, characterized in that the second nucleotide sequence is a sequence that gives multidrug resistance, encodes a mutant protease that encodes a mutant reverse transcriptase, or it contains a promoter, optionally comprising enhancer, mainly activated in this cell the owner compared to the promoters present in the specified strain of retrovirus wild-type helper virus or helper vector.

13. The vector according to item 12, characterized in that the second nucleotide sequence gives multidrug resistance, and the specified conditionally can replicate the vector is used with the drug, or the specified second nucleotide sequence contains a promoter, optionally comprising enhancer, mainly activated in this cell the owner and the specified conditionally can replicate the vector is used with the cytokine.

14. The vector according to any one of claims 1 to 12, characterized in that it is a chimeric vector comprising sequences derived from HIV.

15. The vector according to 14, characterized in that it is a chimeric vector comprising sequences derived from HIV-1 and BEACH 2.

16. The vector according to item 15, wherein the specified a host cell selected from the group consisting of hematopoietic stem cells, fibroblasts, epithelial cells, blood cells or blood vessels, cells of the respiratory system, cells of the gastrointestinal tract, cells of the urinary system, cells of the nervous system, epithelial cells and antigen-presenting cells.

17. The vector according to item 16, characterized in that specified a host cell selected from the group consisting of lymphocytes, macrophages and astrocytes.

18. The vector of claim 8, characterized in that the catalytic domain of the specified ribozyme cleaves the nucleotide sequence of NUH and/or is encoded by a sequence selected from the group comprising the sequences SEQ ID No 3 and SEQ ID No 4.

19. The vector according to any one of claims 1 to 17, characterized in that the specified retrovirus wild-type contains the nucleotide sequence encoded by SEQ ID No 1, and the specified vector in the case of a DNA vector contains the nucleotide sequence selected from the group comprising the sequences SEQ ID No 2, SEQ ID NoNo 3, 4, 5, 6, and 14, in which at least one N is mutated, SEQ ID NoNo 15 and 16, and the specified vector in the case of RNA vector contains nucleate the percent sequence, encoded by a nucleotide sequence selected from the group comprising the sequences SEQ ID NoNo 2, 3, 4, 5, 6, 14, in which at least one N is mutated, SEQ ID NoNo 15 and 16.

20. The vector according to claim 19, characterized in that the specified vector in the case of a DNA vector containing SEQ ID No 3 or a nucleotide sequence selected from the group comprising the sequences SEQ ID NoNo 2, 5 and 15, and the specified vector in the case of RNA vector contains the nucleotide sequence encoded by SEQ ID No 3, and the nucleotide sequence encoded by a nucleotide sequence selected from the group comprising the sequences SEQ ID NoNo 2, 5 and 15, or the specified vector in the case of a DNA vector containing SEQ ID No 4, and the nucleotide sequence selected from the group comprising the sequence of SEQ ID NoNo 2, 6 and 16, and the specified vector in the case of RNA vector contains the nucleotide sequence encoded by SEQ ID No 4 and a nucleotide sequence encoded by a nucleotide sequence selected from the group comprising the sequences SEQ ID NoNo 2, 6 and 16.

21. The vector according to claim 3, characterized in that the specified vector is missing tat gene and its splicing site of the genome of a strain of human immunodeficiency virus wild-type.

22. The vector according to item 21, characterized in that it does not encode proteins env and/or proteins nef-.

23. The vector according to item 21 Il is 22, characterized in that it contains a gag gene and a gene RA.

24. The vector according to any one of p-23, characterized in that instead of the specified tat gene and splicing-site specified vector contains a cassette of three anti-tat ribozyme, and the catalytic domain of each ribozyme cassettes of the three ribozyme cleaves various sites in the molecule nucleic acid of human immunodeficiency virus wild-type.

25. The vector according to paragraph 24, wherein the specified molecule nucleic acid of human immunodeficiency virus wild-type tat, and contains the catalytic domain of each ribozyme cassettes of the three ribozyme cleaves various sites in tat or catalytic domain of each of the ribozyme cleaves the nucleotide sequence of the portion of the molecule of nucleic acid of human immunodeficiency virus wild-type, for which there is no ribozyme-sensitive equivalent in the vector.

26. The vector of claim 8, wherein the specified vector is conditionally can replicate vector based on human immunodeficiency virus, which contains a ribozyme cassette, comprising one, two or three of the ribozyme, each of which is independently directed to the site+115 or website + 133 RNA U5 HIV.

27. The vector according to any one of claims 1 to 26, characterized in that it is designed for the manufacture of drugs, inhibition of bulk packing : spindle is the situation of wild-type retrovirus in a cell.

28. The vector according to any one of claims 1 to 27, characterized in that it is intended for transformation of a host cell.

29. The vector according to any one of claims 1 to 27, characterized in that it is in combination with an acceptable carrier.

30. A method of obtaining a conditional can replicate the retroviral vector according to any one of claims 1 to 27, characterized in that you are getting the original retroviral vector containing retroviral sequences of the long terminal repeats (LTR) and the retroviral packaging signal, incorporate in the original vector, at least one first nucleotide sequence containing or encoding, and in this case expressing the genetic antiviral agent that adversely affects the replication of the retrovirus wild-type helper virus, helper vector or genetic element of the wild type, and, if necessary, incorporate at least one second nucleotide sequence, the presence of the mentioned first and second nucleotide sequences separately or in combination provides the cell-host selective advantage over other cell infected by a strain of retrovirus wild-type or helper virus or helper vector, when mentioned in another cell without the specified conditionally can replicate the retroviral vector, get that about the time the specified vector having a selective advantage for replication before the specified retrovirus wild-type helper virus, helper vector or genetic element of wild-type and replicate the specified vector in the cell host by complementaly with retrovirus wild-type helper virus, helper vector or genetic element.

31. The method according to item 30, wherein in the original retroviral vector incorporate in the case of a DNA vector, the nucleotide sequence selected from the group comprising the sequences SEQ ID No 3 and SEQ ID No 4, or in the case of RNA vector nucleotide sequence encoded by a nucleotide sequence selected from the group comprising the sequences SEQ ID No 3 and SEQ ID No 4, and modify the original retroviral vector so that in the case of DNA-vector it contains the nucleotide sequence of SEQ ID No 14, in which at least one N is mutant, or in the case of RNA vector contains the nucleotide sequence encoded by nucleotide sequence SEQ ID No14, in which at least one N is mutated.

32. The method according to p, characterized in that in the original retroviral vector incorporate in the case of DNA-vector nucleotide sequence of SEQ ID No 3, or in the case of RNA vector nucleotide sequence, codere the Oy SEQ ID No 3, and modify the original retroviral vector so that it is in the case of a DNA vector contains the nucleotide sequence selected from the group comprising the sequences SEQ ID NoNo 2, 5 and 15, or in the case of RNA vector contains the nucleotide sequence encoded by a nucleotide sequence selected from the group comprising the sequences SEQ ID NoNo 2, 5 and 15.

33. The method according to p, characterized in that in the original retroviral vector incorporate in the case of DNA-vector SEQ ID No 4, or in the case of RNA vector nucleotide sequence encoded by SEQ ID No 4, and modify the original retroviral vector so that it is in the case of a DNA vector contains the nucleotide sequence selected from the group comprising the sequences SEQ ID NoNo 2, 6 and 16, or in the case of RNA vector contains the nucleotide sequence encoded by a nucleotide sequence selected from the group comprising the sequences SEQ ID NoNo 2, 6 and 16.

34. The method according to item 30, wherein using the specified nucleotide sequence corresponding to SEQ ID No 14, which is selected from the group comprising the sequences SEQ ID NoNo 2, 5, 6, 15 and 16, if the original retroviral vector is a DNA vector, and the nucleotide sequence encoded by a nucleotide sequence selected from the group including placentas the activity SEQ ID NoNo 2, 5, 6, 15 and 16, if the vector is an RNA vector.

35. Method of reproduction can replicate conditionally vector according to any one of claims 1 to 27 without the use of packaging cell lines, characterized in that the conditional vector can replicate in contact with the cell, is able to become infected with a helper virus or helper vector, which is able to complementarity replication of the specified vector, then contacting the cell with the specified helper virus or helper vector and cultivate the specified cell in conditions which ensure the reproduction of the specified conditionally can replicate in the vector.

36. An isolated and purified nucleic acid molecule, providing a vector according to claim 1 selective advantages in terms of packaging in progeny virions selected from the group consisting of DNA molecules having the nucleotide sequence selected from the group comprising the sequences SEQ ID NoNo 2, 5, 6, 15 and 16, and RNA molecules having the nucleotide sequence encoded by a nucleotide sequence selected from the group comprising the sequences SEQ ID NoNo2, 5, 6, 15 and 16.

37. Method of inhibiting replication of infectious replicated wild-type retrovirus in a cell, characterized in that carry out the contacting of the specified cells that are already infected or at risk of infection pet what virusa wild-type, with conventionally can replicate the vector according to any one of claims 1 to 27.

38. The method according to clause 37, characterized in that by means of the first nucleotide sequence or its expression inhibit replication of the specified infectious replicating retrovirus wild type in the specified cell.

39. The method according to clause 37, wherein said wild-type retrovirus causes cancer or is HIV-positive.

40. The method according to § 39, characterized in that the specified HIV is an HIV-1 or HIV-2.

41. The method according to clause 37, characterized in that use is specified conditionally can replicate a vector that comprises a sequence derived from HIV-1 and HIV-2, and/or the specified vector packaged into infectious viral particle, or include in the composition of the liposomes, or use with adjuvant.

42. The method according to clause 37, wherein the specified communication carried out ex vivo or in vitro.

43. The method according to § 42, characterized in that the communication carried out ex vivo.

44. The way gene expression in the cell, wherein the first carry out the contacting of the specified cells with conditionally can replicate the vector according to any one of claims 1 to 27, while complying with the condition that the vector also contains at least one gene and is able to Express the gene, and then Express in a specified cell MC is related gene with a product, encode the specified genome.

45. The method according to item 44, wherein the conducting contacts of the specified cells with retrovirus wild-type helper virus or helper vector and then not necessarily spend the expression of a specified gene in a cell infected by the vector, which is replicated from the specified conditional vector can replicate in this cell, and/or expression of a specified gene in a given cell inhibit replication of the specified strain of retrovirus wild type in this cell the owner.

46. The method according to item 45, wherein the lower genetic recombination between conventionally can replicate the vector and helper virus or helper vector by using the first nucleotide sequence.

47. The method according to any of paragraphs 44 to 46, characterized in that use cell selected from the group consisting of hematopoietic stem cells, fibroblasts, epithelial cells, blood cells or blood vessels, cells of the respiratory system, cells of the gastrointestinal tract, cells of the urinary system, cells of the nervous system, epithelial cells and antigen-presenting cells.

48. The method according to p, characterized in that use cell selected from the group consisting of lymphocytes, macrophages and astrocytes.

49. The method according to item 44, characterized in that h is on then hold the contacts of the specified cells with the drug/factor and reveal the interaction between the drug substance/factor and the product of the specified gene.

50. Method of detecting interaction between drug substance/factor and the protein expressed by the cell that contains the conditionally can replicate the vector according to any one of claims 1 to 27, which carry out the contacting of medicinal substance/factor with the cell and produce detection through screening methods, at least one interaction, resulting from the binding of the drug substance/factor and the specified protein.

51. Conventionally can replicate the retroviral vector for inhibiting replication of a retrovirus wild-type helper virus, helper vector or genetic element wild-type, containing

5'- and 3'-long terminal repeats (LTR), isolated from lentivirus, and 5'-long terminal repeat modified by inclusion of sequences that are not allocated from the specified lentivirus, with control of the expression of the specified modified 5'-long terminal repeat differs from the control of the expression of the unmodified long terminal repeat;

the heterologous nucleic acid sequence, the 3'end of which is operatively linked to the 5'-long terminal repeat, providing the control of its expression 5'-long terminal repeat,

and specified the 3'long terminal repeat is located further downstream transcription than GE is anologichnaya sequence.

52. The vector according to § 51, characterized in that lentivirus represented by the human immunodeficiency virus type 1 (HIV-1) or human immunodeficiency virus type 2 (HIV-2).

53. The vector according to § 51, wherein the vector is conditionally can replicate.

54. The vector according to item 53, wherein the vector is conditionally can replicate vector based on human immunodeficiency virus (crHIV).

55. The vector according to § 51, characterized in that the region of the 5'-long terminal repeat contains the promoter and/or enhancer that is not allocated from the specified lentivirus.

56. The vector according to § 55, wherein the enhancer is a silencer.

57. The vector according to § 55, characterized in that the promoter and/or enhancer are sensitive to the cytokine.

58. The vector according to § 57, characterized in that the sensitivity to cytokine envisages an increase in transcription from the promoter.

59. The vector according to § 57, characterized in that the sensitivity to cytokine provides for reduction of transcription from the promoter.

60. The vector according to § 57, wherein the cytokine is selected from the group including interleukins, lymphokines, Monokini, interferons, colony stimulating factors and chemokines.

61. Vector on p, wherein the cytokine is selected from the group consisting of IL-2, tumor necrosis factor a (TNFα) and RANTES.

62. The vector according to § 55, characterized t is m, the promoter and/or enhancer are specific for macrophages.

63. The vector according to § 55, characterized in that the promoter and/or enhancer are specific to the tumor.

64. The vector according to § 55, characterized in that the promoter is sensitive to DNA-binding protein.

65. The vector according to § 51, wherein the heterologous nucleic acid sequence is a sequence that is transcribed with the formation of RNA selected from the group comprising antisense molecule, a trap RNA and ribozyme, or a heterologous nucleic acid sequence encodes a protein selected from the group consisting of transdominant mutant toxin and single-chain antibodies (scAb), aimed at viral structural protein.

66. Vector on p, characterized in that the transcribed RNA or encoded by heterologous nucleic acid protein (i) inhibits the replication of lentivirus wild-type or (ii) gives a selective advantage for replication of the retroviral vector before replication of the genome of lentivirus wild type in the cell, where the optional lentivirus is HIV type 1 and HIV type 2.

67. The vector according to § 51, characterized in that it lacks a nucleotide sequence encoding a Tat.

68. Vector on p, characterized in that it is conditionally replicating the I.

69. Vector on p, characterized in that it is conditionally can replicate vector based on human immunodeficiency virus.

70. Vector on p, characterized in that the promoter and/or enhancer are specific for macrophages.

71. Vector on p, characterized in that the promoter and/or enhancer are specific to the tumor.

72. The retroviral vector described in any of PP-71 used to transform a host cell.

73. The retroviral vector, as described in § 57, used to transform host cells containing the native for cell cytokine.

74. The retroviral vector, as described in § 57, used to transform a host cell, optionally containing typed it cytokine.

75. Vector on p, wherein the cytokine is administered in a cage with another vector.

76. Method cell-specific replication and/or propagation of the retroviral vector, as described according to any one of p-71, characterized in that conduct in the cultivation of a host cell transformed by the vector according to item 72.

77. The way of expression of a heterologous nucleic acid sequence according to § 51 in the specific cell, wherein spend the cultivation of the host cell, the modified vector according to any one of p-75.

78. JV the property on p, characterized in that the heterologous nucleic acid sequence is a sequence that is transcribed with the formation of RNA selected from the group comprising antisense molecule, a trap RNA and ribozyme, or a heterologous nucleic acid sequence encodes a protein selected from the group consisting of transdominant mutant toxin and single-chain antibodies (scAb), aimed at viral structural protein.

79. The method according to p, characterized in that the transcribed RNA or encoded by heterologous nucleic acid protein (i) inhibits the replication of lentivirus wild-type or (ii) gives a selective advantage for replication of the retroviral vector before replication of the genome of lentivirus wild type in the cell, where the optional lentivirus is HIV type 1 and HIV type 2.

80. Recombinant vector characterized by p used to obtain a recombinant host cell.

81. The way of expression of a heterologous nucleic acid sequence in a specific cell, characterized in that the conducting contacting a recombinant host cell, characterized in item 80, containing the vector according to § 51, which contains a nucleotide sequence that does not encode Tat, with a helper vector containing a nucleotide follow etelnost, encoding Tat, while Tat-encoding sequence and the heterologous nucleotide sequence operatively linked to a promoter for expression in the cell.

82. The method according to p, wherein the vector contains (LTR) nucleotide sequence selected from lentivirus, which is represented by the human immunodeficiency virus type 1 (HIV-1) or human immunodeficiency virus type 2 (HIV-2).

83. Method of producing antibodies in a cell, characterized in that exercise contacting cells with a helper vector containing the promoter and/or enhancer, which is able to activate cell factor present in the cell, and carry out the contacting of the cell with the vector according to § 51, containing 5'-and 3'-long terminal repeats (LTR), isolated from lentivirus, and the heterologous nucleic acid sequence, the 3'end of which is operatively linked to the 5'-long terminal repeat, which ensures its expression, with the specified heterologous sequence encodes an antibody that is secreted and acts on cell factor and 3'-long terminal repeat is located further downstream transcription than heterologous sequence.

84. The method according to p, characterized in that lentivirus represented by the human immunodeficiency virus type 1 (HIV-1) or human immunodeficiency virus che is oweka type 2 (HIV-2).

85. The method according to p, characterized in that the vector is conditionally can replicate.

86. The method according to p, characterized in that conventionally can replicate the vector is a vector-based human immunodeficiency virus.

87. The method according to p, characterized in that the cellular factor selected from the group comprising bacteria, cytokines, antibiotics and toxins.

88. The method according to p, wherein the heterologous sequence encodes an antibody selected from the group comprising anti-bacterial, anti-toxic and antipathogen antibodies.

89. Conventionally can replicate the retroviral vector for inhibiting replication of a retrovirus wild-type helper virus, helper vector or genetic element wild-type, containing

5'- and 3'-long terminal repeats (LTR), isolated from lentivirus, while 5'-long terminal repeat contains the promoter and/or enhancer-sensitive cell factor, and

the heterologous nucleic acid sequence, the 3'end of which is operatively linked to the 5'-long terminal repeat, providing the expression of the 5'-long terminal repeat, with the specified heterologous sequence encodes an antibody that influences cell factor and 3'-long terminal repeat is located further downstream transcription than heterologous on sledovatelnot.

90. Vector on p, characterized in that lentivirus represented by the human immunodeficiency virus type 1 (HIV-1) or human immunodeficiency virus type 2 (HIV-2).

91. Vector on p, characterized in that the vector is conditionally can replicate.

92. Vector on p, characterized in that conventionally can replicate the vector is a vector-based human immunodeficiency virus.

93. Vector on p, characterized in that the cellular factor selected from the group comprising bacteria, cytokines, antibiotics and toxins.

94. Vector on p, wherein the heterologous sequence encodes an antibody selected from the group comprising anti-bacterial, anti-toxic and antipathogen antibodies.

95. Vector on p, wherein the promoter is a tet promoter, the toxin-sensitive promoter and cytokine-sensitive promoter.

96. Conventionally can replicate the retroviral vector for inhibiting replication of a retrovirus wild-type helper virus, helper vector or genetic element wild-type, containing

5'- and 3'-long terminal repeats (LTR), isolated from retrovirus, while 5'-long terminal repeat contains sequences that are not allocated from the specified retrovirus, and

the heterologous nucleic acid sequence, the 3'end of which is perative linked to the 5'-long terminal repeat, providing its expression, with the specified heterologous sequence of nucleic acid is a genetic antiviral agent siPHK, a 3'-long terminal repeat is located further downstream transcription than heterologous sequence.

97. The way of expression of a heterologous nucleic acid sequence in a specific cell, characterized in that

carry out the contacting of the specified cells with a retroviral vector according p containing 5'- and 3'-long terminal repeats (LTR), isolated from retrovirus, and the heterologous nucleic acid sequence, the 3'end of which is operatively linked to the 5'-long terminal repeat, which ensures its expression, specified the heterologous nucleic acid sequence is a genetic antiviral agent siPHK, and the 3'long terminal repeat is located further downstream transcription than heterologous sequence, and lacks a nucleotide sequence encoding a Tat, and

carry out the contacting of the specified cells with helper vector containing a nucleotide sequence encoding a Tat, and a cell-specific promoter and/or enhancer, capable of driving the expression of the Tat gene.



 

Same patents:

FIELD: genetic engineering, molecular biology.

SUBSTANCE: invention provides construction of linking map for segregated progeny of crossed organisms and identification of one or more loci of quantitative features. Invention is designated for identification of one or more regions on the organism genome.

EFFECT: improved developing method.

10 cl, 33 dwg, 2 tbl, 2 ex

FIELD: molecular biology, biochemistry, microbiology, medicine.

SUBSTANCE: method involves the simultaneous amplification of DNA and RNA targets and E. coli plasmid fragment or E. coli 16S-RNA as universal standard. For amplification two pairs of primers with the identical annealing temperature are used being primers of the first pair are specific to the target nucleotide sequence and primers of the second pairs of primers - to nucleotide sequence of the internal standard. A number of target copies are determined by data of electrophoretic separation of target amplicons and the universal internal standard. Using the invention allows carrying out the determination of amount of copies of DNA and RNA targets.

EFFECT: improved assay method.

4 dwg, 1 tbl

FIELD: gene engineering, in particular plant selection.

SUBSTANCE: chimera gene encoding protoporphyrinogen oxydase is introduced into plant.

EFFECT: plants transformed by chimera gene and generation thereof with herbicide resistance.

16 cl, 2 tbl, 27 ex

FIELD: biotechnology, in particular gene engineering, pharmaceutical and food processing industry.

SUBSTANCE: DNA sequence (1341 n.p.) encoding fatty acid -desaturase (447 amino acid residue, 57 kD) of nematode Caenorhabditis elegants is isolated and characterized. Obtained DNA-sequence is expressed in bacterium and yeast cells to produce Biologically active enzyme recombinant form. Said recombinant form is capable to catalyze conversion of dihomo-γ-linolenic acid to arachidonic acid and eicosatetraenoate to eicosapentaenoate.

EFFECT: method for large-scale production of polyunsaturated fatty acid.

15 cl, 4 dwg, 1 ex

FIELD: biotechnology, genetic engineering.

SUBSTANCE: inventions represent sets of primers, pairs of primers and individual primers used in detection and/or identification of transgene DNA sequences in vegetable material and products comprising thereof, methods for detection and/or identification with their using and a device for realization of one of methods. Primers are complementary to 5 typical marker genes and regulatory DNA sequences - gus gene from microorganism E. coli, nptII gene from transposon Tn5, 35S-promoter site in cauliflower mosaic virus, terminator sites in nos gene and ocs gene from A. tumefaciens that comprises most often in genetic constructions of the most abundant in the world market of transgene plant strains and have nucleotide sequences given in SEQ ID Nos. 1-10. Methods involve DNA extraction from vegetable material and products comprising thereof, carrying out asymmetric or symmetric polymerase chain reaction (PCR), among them the multiplex reaction, with taking part of extracted DNA and set of primers, separation of amplified reaction products and their following detection and/or identification by their hybridization with oligonucleotides immobilized on biological microchip or by gel-electrophoresis method, or by using amplifying agent in real time regimen. Original selection of primers and addition of correcting nucleotide exchanges in their sequences provide similarity in their thermodynamic parameters and complete compatibility in sets that provides their effective working in the similar reaction conditions and enhance specificity, sensitivity and reliability of methods for detection and/or identification of transgene DNA sequences with their sharing significantly. Using in method in hybridization analysis of PCR results with specially developed biological microchips BM "Tressigen"-aminated glasses with oligonucleotides immobilized directly on their surface with nucleotide sequences given in SEQ ID Nos. 11-15, and apparatus-program complex "Degmigen" enhances specificity, economy and technological effectiveness of the process significantly. Inventions can be used in monitoring biological safety of nutrient, fodder foodstuffs and other goods of mass consumption.

EFFECT: improved method for analysis, valuable properties of primers.

54 cl, 5 dwg, 1 tbl, 5 ex

FIELD: biotechnology, genetic engineering, virology.

SUBSTANCE: invention proposes a method for isolating virus IRT KRS in polymerase chain reaction. Method involves carrying out polymerase chain reaction with primers B1 and B2 followed by differentiation of detected DNA in case of positive result in PCR reaction. Result is considered to be positive if PCR product corresponds to size of fragment consisting of 464 pair bases. For differentiation PCR product is treated with (restriction) endonuclease Sac II. As result, the presence of one fragment with length 464 pair bases corresponds to the vaccine strain TK-A and two fragments of size 343 and 121 pair bases correspond to epizootic strains and isolates.

EFFECT: improved detecting method and analysis.

1 dwg, 3 tbl, 6 ex

FIELD: genetic engineering, medicinal genetics.

SUBSTANCE: invention relates to the constructed plasmid DNA alpha-R-12 based on vector pBR325 and fragment of alphoidal DNA of human lymphocytes prepared from Eco RI restricts of the total fraction of human alphoidal DNA in hybridization on chromosomes in situ under special conditions of enhanced rigidity. Using the invention allows carrying out the reliable identification of human 6-th chromosome in norm and in pathology.

EFFECT: improved method for chromosome analysis.

4 ex

FIELD: veterinary science, virology.

SUBSTANCE: method for evaluation of semen from bull-sires for contamination with cattle infectious rhinotracheitis virus involves taking semen samples, combining semen samples obtained from bull-sire for one month and their analysis as a single sample. The analysis is carried out by method of molecular hybridization. For evaluation of semen from rejected bull-sires the semen samples are taken obtained for all period of their exploitation. Method provides reducing labor intensity and time for analysis and enhanced sensitivity of analysis in assay of semen contamination with indicated virus.

EFFECT: improved method for evaluation of semen.

2 cl, 1 tbl, 4 ex

FIELD: biochemistry, molecular biology.

SUBSTANCE: invention proposes variants of a method for detecting the sequence in DNA- or RNA-"target" that is based on carrying out the primer splicing reaction under conditions providing the definite limit of the product size (isometric primer splicing). Indicated conditions involve using at stage for primer splicing hybridized preliminary with the corresponding sequence site - a "target", the reaction mixture, wherein at least one of types of dNTP (deoxynucleoside triphosphate) is absent or replaced with the corresponding terminating substrate. The usage of proposed method provides significant enhancing sensitivity of analysis and to reducing time for its carrying out. Invention can be used in diagnostic tests and analytical systems for any designations suggesting detection of specific nucleic acid sequence in the sample.

EFFECT: improved detecting method.

44 cl, 2 dwg, 2 tbl, 1 ex

FIELD: molecular biology, medicine.

SUBSTANCE: invention relates to methods (variants) for identification of P[8] genotype rotavirus subtypes. Claimed method includes rotavirus RNA isolation followed by reverse transcription thereof. Further single-round polymerase chain reaction is carried out followed by analysis of obtained fragments in agarose gel. For identification of P[8]-1 subtype 5'-cca ttt att tga atc gtt a-3' primer is used, and for identification of P[8]-1 subtype 5'-cca ttt atc tga atc att a-3' primer is used. Presence of desired subtype is detected on the base of specific fragment with size of 410 n.p. Method of present invention is useful in detection of P[8] genotype rotavirus of various subtypes for monitoring of rotavirus strain circulation and investigation of their variability, abundance, etc.

EFFECT: simplified and accelerated method for strain differentiation.

2 cl, 2 ex

FIELD: biotechnology, virology.

SUBSTANCE: invention relates to preparing a new strain of hybrid cells of Mus musculus L., NIIMB-280 (9E2), as a producer of monoclonal antibodies to the West Nile virus (WNV) protein E. West Nile virus (strain WNV/LEIV-VIg99-27889) is isolated in Volgograd district in 1999 year from a patient. Producing monoclonal antibodies can be used effectively for detection of the strain WNV/LEIV-VIg99-27880 of WNV that causes human diseases in Russia territory. New hybrid strain of cells is obtained by fusion of murine myeloma cells p3-X63/Ag8.653 (NS0/1) with murine splenocytes BALB/c immunized with the purified and inactivated preparation WNV (strain WNV/LEIV-VIg99-27889). The strain of hybrid cells Mus musculus L., NIIMB-280 (9E2), is deposited in Collection of cellular cultures of NII cellular cultures GNTS VB "VEKTOR" at number № NIIMB-280. Author's name of hybridoma cellular strain is 9E2. Using hybridoma allows preparing specific monoclonal antibodies raised to the West Nile virus protein E that, in turn, gives a possibility for identification of WNV and to standardize the content of protein E in immunodiagnostics.

EFFECT: valuable properties of strain.

1 dwg, 3 ex

FIELD: biotechnology, hybridoma technology.

SUBSTANCE: hybridoma strain is prepared by fusion of murine plasmocytoma Sp2/0-Ag.8 and B-lymphocytes of murine spleen of the inbred strain BALB/c immunized with protein-polysaccharide complex from Y. enterocolitica. Hybridoma produces monoclonal antibodies of isotype IgG to Y. enterocolitica O3 and O9 serovars used as components of IFA-test-system for identification of indicated serovars that are isolated most often in European areas from sick humans, agricultural animals and from objects of environment. The usage of monoclonal antibodies producing by hybridoma allows carrying out the identification of Y. enterocolitica strains of indicated serovars representing the most epidemic danger among other intestine-persistent microorganisms. Invention can be used in the development of diagnostic test-systems for identification of Y. enterocolitica strains O3 and O9 serovars for aims laboratory diagnosis in the public health, veterinary science and in carrying out scientific investigations.

EFFECT: valuable properties of strain.

1 tbl, 2 ex

FIELD: immunology; treatment of mediated diseases IL-1 and failures.

SUBSTANCE: bonding molecule IL-1β which is antibody to human IL-1β and especially human antibody to human IL-1β where hypervariable sections CDRs of heavy and light chains have definite amino acid sequences. Antibody may be used for treatment of mediated disease IL-1, for example osteoarthritis, osteoporosis and other inflammatory processes of bones of rheumatism or podagra nature. Constructions of deoxyribonucleic acid are described which code heavy and light chains or their fragments and expressive vectors which may be replicated in cells including deoxyribonucleic acid constructions. Method of obtaining bonding molecule IL-1β by means of cell transformed by vector is described. Proposed antibody may be used both in prophylactic and treatment of diseases.

EFFECT: enhanced efficiency.

15 cl, 3 dwg, 5 ex

FIELD: medicine, immunobiology, pharmacy.

SUBSTANCE: humanized monoclonal antibody (monAb) or its fragments comprises heavy and/or light chain with the binding rate constant with AILIM 1.0 x 103 (1/M x s) and above, and the dissociation rate constant between monAb and AILIM 1.0 x 10-3 (1/s) or less. MonAb shows also a nucleotide sequence encoding variable region of light and/or heavy chain and corresponding amino acid sequences. Invention relates to DNA and it part encoding monAb or its fragments, and vectors comprising nucleotide sequences encoding antibody or its fragments. The humanized monAb can be prepared by using a genetically recombinant host. MonAb is comprised as a component of pharmaceutical compositions used for inhibition or induction of AILIM-mediated transfer of signal into cell for induction of antibody-dependent cytotoxicity against AILIM-expressing cell and others. Invention can be effective in treatment of different autoimmune diseases associated with AILIM-mediated transfer of co-stimulating signal. Invention can be used in medicine for treatment of diseases associated with AILIM-mediated transfer of co-stimulating signal.

EFFECT: valuable medicinal properties of antibody.

75 cl, 78 dwg, 14 ex

FIELD: biology, hybridoma technology.

SUBSTANCE: invention represents a new strain of mammalian hybrid cells C3/S-3E5 of Mus musculus L. producing monoclonal antibodies (MCAb) to Bernet's coxiellas (strain "Grita") in cell cultures and abdominal cavity of syngenic animals. Hybridoma C3/S-3E5 producing MCAb to this pathogen is obtained by fusion of murine myeloma of strain Sp-2/0 and murine splenocytes of strain BALB/c immunized with the concentrated and purified Bernet's coxiella preparation (strain "Grita) inactivated with formalin using polyethylene glycol of molecular mass 1000 Da as a fusing agent and the following cloning by method of maximal dilutions. Specificity of prepared MCAb: absence of cross-reactions in IFA with Provacheck's rickettsia antigen and with the non-infected accumulation substrate. Using prepared MCAb it is possible to carry out specific detection of Bernet's coxiellas by method IFA (direct and indirect variants). IFA sensitivity based on these MCAb is 2.0 x 103 ID50 x cm-3 for white rats. Applying the present invention allows detecting and identifying pathogens of rickettsial etiology.

EFFECT: improved method preparing, valuable properties of strain.

3 tbl, 1 dwg, 1 ex

FIELD: biology, biotechnology, medicine.

SUBSTANCE: strain of murine hybridoma cells is prepared by fusion of murine splenocytes immunized with cell lysates of lymphoblastoid line RAMOS with cells of murine myeloma. Hybridoma secrets monoclonal antibodies directed to antigen of molecular mass 110 kDa located on microtubules in cell cytoplasm and detected in nuclear cells of different species. Using the invention allows studying pathogenesis of cell dividing and state of mitotic activity of health and malignant cells, and evaluation of anti-mitotic (anti-tumor) effect of different chemopreparations and substances. Invention can be used for identifying phase of mitotic activity of cells.

EFFECT: valuable properties of strain.

2 dwg

Thrombopoietin // 2245365

FIELD: medicine, molecular biology, polypeptides.

SUBSTANCE: invention describes homogenous polypeptide ligand mpI representing polypeptide fragment of the formula: X-hTPO-Y wherein hTPO has amino acid sequence of human fragments TPO (hML); X means a amino-terminal amino-group or amino acid(s) residue(s); Y means carboxy-terminal carboxy-group or amino acid(s) residue(s), or chimeric polypeptide, or polypeptide fragment comprising N-terminal residues of amino acid sequence hML. Also, invention relates to nucleic acid encoding polypeptide and expressing vector comprising nucleic acid. Invention describes methods for preparing the polypeptide using cell-host transformed with vector, and antibodies raised against to polypeptide. Invention describes methods and agents using active agents of this invention. The polypeptide ligand mpI effects on replication, differentiation or maturation of blood cells being especially on megacaryocytes and progenitor megacaryocyte cells that allows using polypeptides for treatment of thrombocytopenia.

EFFECT: valuable medicinal properties of polypeptide.

21 cl, 92 dwg, 14 tbl, 24 ex

The invention relates to the field of biotechnology and medicine, namely, to new sequences of DNA nucleotides and amino acids sequences of monoclonal antibodies (MABS) generated against lymphoblastoid cells, and peptides that bind MAT

FIELD: gene engineering, in particular apoptosis inducing gene delivery vectors useful for cancer, hyperplasia, metaplasia and displasia diagnosis and treatment.

SUBSTANCE: recombinant adenovirus apoptin-containing vectors are obtained by cotransfection into 911 helper cell line of p.Amb-VP3 adaptor plasmids (in case of VP3 protein expression) or pMAb-VP2 plasmids (in case of VP2 protein expression) and JM17 DNA. p.Amb-VP3 plasmids carry apoptin gene in 5'-3'-orientation, expressing under control of adenoviral main late promoter. Plasmid JM17 DNA contains complete adenoviral DNA excepted E1 and E2 regions. pMAb-°VP2 plasmids carry apoptin gene with two point mutation in limits of coding region. Cotransfections are carried out by calcium phosphate method. Recombinant adenoviral DNA is formed by homologous recombination between homologous viral sequences representing in p.Amb-VP3 (or pMAb-VP2) plasmid and in adenoviral DNA from plasmid JM17 DNA. Cell infection of various human tumors with gene delivery vectors causes to tumor cell apoptosis induction and sufficiently reduced normal, diploid, non-transformed or non-pernicious cell apoptosis.

EFFECT: new gene delivery vector capable to induce cell apoptosis.

8cl, 7 dwg

Up!