Method for construction of genetically modified microorganism strain

FIELD: biotechnology, biochemistry, genetic engineering.

SUBSTANCE: invention proposes a method for construction of genetically modified strains of microorganisms able to destroy steroids. These strains comprise multiple inactivated genes, for example, genes encoding enzymes steroid dehydrogenases implicated in destroying the steroid ring. The gene kstD1 is an example of such genes. Strains comprising the multiple amount of inactivated genes encoding enzymes destroying steroids provides the enhanced effectiveness with respect to accumulation of intermediate steroid compounds. The preferable product of steroid accumulation if 9α-hydroxy-4-androstene-3,17-dione.

EFFECT: improved method for construction of strain.

8 cl, 5 dwg, 7 ex

 

The present invention relates to a method for genetically modified microorganisms having the ability to inhibit nuclear disintegration of steroids, the use of such organisms for the accumulation of steroids, as well as to the accumulation of such modified microorganisms.

The ability to destroy the phytosterols are widely distributed among nocardioform actinomycetes and requires a set of enzymes that Deplete the side chain and the structure of the steroid nucleus.

The enzyme 3-ketosteroid Δ1dehydrogenase (KSTD) [4-EN-3-oxosteroid: (acceptor)-1-ene-oxidoreductase, EC 1.3.99.4] participates in the gap of the ring In the steroid nucleus resulting from the introduction of a double bond in position S1-S2. More precisely, this enzyme is involved in the conversion of 4-androsten-3,17-dione 1,4-androstadien-3,17-dione and 9α-hydroxy-4-androsten-3,17-dione 9α-hydroxy-1,4-androstadien-3,17-dione (see Figure 1). This enzyme was identified in several bacteria: Arthrobacter simplex (Penasse and Peyre, 1968 Rhodococcus. Crit. Rev. Biotech. 14:29-73), Pseudomonas (Levy and Talalay, 1959 J.Biol. Chem. 234:2009-20013; 1959 J. Biol. Chem. 234:2014-2021), Nocardia restrictus (Sih and Bennet, 1962 Biochem. Biophys. Acta 56:587-592), Nocardia corallina (Itagaki et al., 1990 Biochim. Biophys. Acta 1038:60-67), Nocardia opaca (Drobnič et al., 1993 Biochim, Biophys. Res. Comm. 190:509-515), Mycobacterium fortuitum (Wovcha et al., 1979 Biochim. Biophys. Acta 574:471-479) and Rhodococcus erythropolis IMET7030 (Kaufmann et al., 1992 J.Steroid. Biochem. Molec. Biol. 43:297-301). KSTD N. opaca Oh racterizado as flavoprotein (Lestrovaja et al., 1978 Z.Allg. Environ. 18:189-196). Fully characterized only genes encoding KSTD at A.simplex, Comamonas testosteroni, and Rhodococcus rhodochrous (Plesiat et al., 1991 J.Bacteriol. 173:7219-7227; Molnár, et al., 1995 Mol. Environ. 15:895-905; Morii et al., 1998 J.Biochem. 124:1026-1032).

Exclusive inhibition of steroid 1,2-dehydrogenase causes the accumulation 9α-hydroxy-4-androsten-3,17-dione, the best source material for corticoides synthesis (Kieslich, K., 1985 J.Basic Environ. 25: 461-474). 9α-Hydroxyandrost are commercially important as an antiandrogen, an antiestrogen and contraceptives. 9α-hydroxy-group easily dehydratases to 9(11)-dihydrocodei and is the base structure for the formation of 9α-halogencontaining.

The species Rhodococcus widely known for its large catabolic potential (Warhurst and Fewson, 1994 Rhodococcus. Crit. Rev. Biotech. 14:29-73; Bell et al., 1998 J.Appl. Environ. 85:195-210). Some species of Rhodococcus able to degrade natural phytosterols, which are cost-effective raw material for the production of bioactive steroids (Kieslich, K., 1986 Drug Res. 36:888-892). Strains of Rhodococcus and Mycobacterium treated with mutagens and/or grown together with enzyme inhibitors, turn sterols in 4-androsten-3,17-dione and 1,4-androstadien-3,17-dione (Martin, 1977 Adv. Appl. Environ. 22:29-58).

Although cloning kstQ and expression of an inactive protein KSTD R. erythropolis IMET7030 in Escherichia coli has already been described (Wagner et al., 199 J.Basic Environ. 32:65-71, 1992 J.Basic Environ. 32:269-277), and the nucleotide sequence N. (et al., 1993 Biochem. Biophys. Res. Comm. 190:509-515) (synonym R.erythropolis IMET7030) known (DDBJ/EMBL/GenBank U59422), on the molecular characterization of this gene was not reported. Activity KSTD essential for nuclear decay steroids, and inactivation of kstD gene required for accumulation of intermediate steroid compounds. In accordance with one aspect of the present invention created the nucleotide sequence of the gene kstD R.erythropolis. Protein KSTD1 is encoded by nucleotides 820-2329 of SEQ ID NO:1.

Inactivation of genes is a powerful tool for analyzing gene function and for the introduction of blocks of metabolism. The destruction of the gene using rereplicating vector carrying the selective marker is the most commonly used method for gene inactivation. Construction of strains with desired properties is achieved through the creation of metabolic pathways, however, may be necessary in the gradual inactivation or replacement of several genes. This is possible only in the presence of a suitable method for the introduction of unmarked gene deletions or gene replacement that allows you to create technologically endless options metabolism without the participation of many markers. In accordance with the second aspect of the present invention developed the sequential scheme is aktivacii genes preferably dehydrogenase genes involved in the destruction of steroids. In particular, the present invention is applicable to inactivation of genes involved in the accumulation of 9α-hydroxy-4-androsten-3,17-dione, as a result of microbial growth on 4-androsten-3,17-dione. Preferably inactivated, at least, gene kstD1.

It has been unexpectedly discovered that the destruction of the gene kstD1 encoding the R.erythropolis SQ1 3-ketosteroid Δ1-dehydrogenase, leading to inactivation of nuclear disintegration steroids. Residual activity is due to the presence of the second enzyme. It is now established that to obtain a strain with a completely blocked by the nuclear decay of steroids necessary to inactivate more than one gene. Preferably the second enzyme is a dehydrogenase, more preferably the enzyme KSTD. Order to obtain the possibility of destruction or deletion of several genes, preferably can be used a method of site-directed mutagenesis. Method for the introduction of unmarked gene deletions preferable to sequential inactivation of genes KSTD. Received genetically modified strains should not contain heterologous DNA.

In accordance with a second preferred embodiment of the present invention is inactivated, at least, gene kst2. More preferably, were inactivated both genes kstD1 and kstD2. Another aspect of the present invention is the nucleotide sequence of the gene kstD2 of R.erythropolis. Protein KSTD2 is encoded by nucleotides 1-1678 of SEQ ID NO:5.

Methods for the introduction of unmarked gene deletions in cells of the genus Rhodococcus are not reported. However, methods of gene dellarovere or gene replacement described in relation to some other representatives of actinomycetes, namely Streptomyces (Hillemann et al., 1991 Nucleic Acid Res. 19:727-731; Hosted and Baltz, 1997 J.Bacteriol. 179:180-186), Corynebacterium (Schäfer et al., 1994 Gene 145:69-73) and Mycobacterium (Marklund et al., 1995 J.Bacteriol. 177:6100-6105; Norman et al., 1995 Mol. Environ. 16:755-760; Sander et al., 1995 Mol. Microbioi. 16:991-1000; Pelicic et al., 1996 Mol. Environ. 20:919-125; Knipfer et al., 1997 Plasmid 37:129-140). Contractive markers can be used for the second screening of rare recombination events leading to gene deletions or gene replacement. In this respect, and sacB and rpsL was useful reporter genes (Hosted and Baltz, 1997 J.Bacteriol. 179: 180-186; Schäfer et al., 1994 J.Bacteriol. 172: 1663-1666; Sander et al., 1995 Mol. Environ. 16: 991-1000; Pelicic et al., 1996 Mol. Environ. 20: 919-125; Jäger et al., 1992 J. Bacteriol. 174: 5462-5465), but can also be used and other suitable markers. About the use rspL from Rhodococcus not reported, but sacB (encoding Levantehaus Bacillus subtilis) is for this biological kind of strong POS is positive selective marker (Jä ger et al., 1995 FEMS Environ. Lett. 126:1-6; Denise-Larose et al., 1998 Appl. Environ. Environ. 64:4363-4367).

Lavansaari .subtilis encoded sacB gene, catalyzes the hydrolysis of sugars and synthesis Levanov (high-molecular fructose polymers). The expression of sacB in the presence of sucrose is lethal for Rhodococcus. Biochemical basis of toxicity lianshang action on sucrose are still unknown. Mortality (i.e. the presence or absence of sucrose), is caused by a gene sacB, can therefore be used as Contracting marker. Centrelake in this context means that the expression of this marker is lethal, increasing resistance, as, for example, in the case of selective markers (e.g., resistant markers).

Centrelake need for selection of such mutants, which are the second recombination event, losing the marker sacB and introducing the desired mutation. The advantage of this system is that during selection will survive only the most suitable mutants. Compared with a system in which there is only one selective marker, centrelake avoids the time-consuming process of screening as lost token resistance, which is required for a system with one selective marker.

The advantage of unmarked mutations is clochette is that it allows the re-introduction of mutations in the same strain. Alien DNA (vector DNA) is removed in the process of introducing this mutation. The newly introduced vector DNA, intended for the introduction of a second mutation, cannot for this reason be integrated into the site of a previous mutation by homologous recombination between the vector DNA). Integration will happen if the vector DNA is still present in this chromosome and will give rise to a large number of false-positive products integration. This system allows the use of a separate gene antibiotic for the introduction of an infinite number of mutations. Unmarked mutation makes it possible to easily use it in industry, since in the absence of heterologous DNA allows for easy removal of fermentation broth.

Inactivation of the gene in the deletion of the gene allows to create a sustainable, preventoria mutants. Mostly small genes (<500 BP) easier inactivated by gene deletions in comparison with the destruction of the gene in the result of a single recombination integration. Mutagenesis performed using gene deletions can also be used for inactivation of the cluster in several genes of the genome. Method of mutagenesis by gene dellarovere can also be used to replace the gene (for example, replacement of the Jena wild-type to mutant gene).

The preferred strain for mutagenesis catabolic genes of steroid dehydrogenases is Rhodococcus erythropolis. However, other species may occur unmarked deletion of the gene kstD1 and/or kstD2 carried out using genetic conjugation, if the molecular organization have the same (or similar)that R.erythropolis SQ1. These types preferably belong to the genus Rhodococcus, but can also be used and such closely related species as Nocardia, Mycobacterium, and Arthrobacter.

Gene inactivation in Rhodococcus difficult when there are illogical recombination events leading to random genomic integration of this mutagenic vector (Desomer et al., 1991 Mol. Environ. 5:2115-2124; Barnes et al., 1997 J.Bacteriol. 179:6145-6153), a phenomenon which the authors of the invention have faced when attempting to destroy a gene kstD1 at R.erythropolis SQ1. Illogical recombination is a well-known phenomenon in some slow-growing Mycobacterium species (McFadden, 1996 Mol. Environ. 121:205-211). It is shown that conjugational transfer of plasmids from E. coli S17-1 in Rhodococcus minimizes random integration (Powell and Archer, 1998 Antinie van Leeuwenhoek 74:175-188). Proven ability conjugative mobilization of plasmids from strain S17-1 E. coli in many different strains coryneform bacteria and Rhodococcus fascians DSM20131 (Schäfer et al., 1990 J.Bacteriol. 172:1663-1666; Jäger et al., 1995 FEMS Environ. Lett. 126:1-6). In accordance the present invention conjugatively transfer mutagenic vector, carrying the sacB gene as Contracting token, therefore, was used for the introduction of unmarked gene deletions in steroid catabolism in R.erythropolis SQ1.

As an additional variant of implementation of the present invention the introduction of a second gene inactivation event is carried out using the same methods described in the Examples for gene kstD2. For further gene inactivation can again be used the same methods or UV irradiation or chemical means, as, for example, nitroguanidine or diepoxide. Methods of introducing genetic mutations performed so well known in this field.

Well-known methods for creating media used in the mutagenesis Protocol (Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, latest edition). In addition, methods for site-directed mutagenesis, legirovanie incremental sequences, PCR, DNA sequencing and the creation of suitable expression systems are now also well known in the art. Part or all of the DNA encoding the desired protein can be created in the result of the synthesis using standard solid-phase methods, mainly to include restriction sites facilitating ligation.

Modifications and variations of this SPO is both destroyed by the introduction of gene mutations or unmarked gene deletions, as well as the transformation and conjugation will be clear to experts in this field from the previous detailed description of the present invention. Understood that such modifications and variations are within the scope of this application.

In accordance with another aspect of the present invention, the microorganisms having lots of inactivated genes, can be used for accumulation of steroid intermediates. The accumulated product is primarily 9α-hydroxy-4-androsten-3,17-dione. This starting material may depend on the availability of enzyme genes that are inactivated. Suitable source substances are, for example, phytosterols or 4-androsten-3,17-dione. Preferred the original substance is 4-androsten-3,17-dione.

The advantage of the presented method is that it is possible to provide a highly efficient transformation of the original steroid accumulated in the desired product. Its output can exceed 80%, preferably more than 90% and often reaches values of almost 100%.

Another aspect of the present invention relates to genetically modified microorganisms with lots of inactivated genes involved in steroid degradation. In particular, these genes are dehydrogenase. Preferably inactive who are, at least gene kstD1 or kstD2. More preferable is the inactivation of both genes kstD1 and kstD2. Preferred are microorganisms belonging to the genus Rhodococcus. Most preferred is a strain of Rhodococcus erythropolis RG1-UV29.

Strains of microorganisms Rhodococcus erythropolis RG1-UV29 and Rhodococcus erythropolis RG1 have been deposited in the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Mascheroder Weg 1b, D-38124 Braunschweig, Germany under the catalog numbers respectively DSM 13157 and DSM 13156. This deposition was carried out in accordance with the Budapest Treaty.

Professionals should be clear how to use the methods and substances to create microorganisms that loses the ability to the destruction of the steroid nucleus described in this document and on which link. Similarly, you can inactivate many genes encoding several other enzymes that destroy the steroid nucleus.

The following examples are illustrative for the present invention and in no way should be interpreted as limiting the scope of the present invention.

Description of the drawings

Figure 1

Schematic representation of the nuclear decay of steroids in R.erythropolis SQ1. Specify the location of the isoenzymes KSTD1 and KSTD2 enzyme 3-ketosteroid Δ1-dehydrogenase (KSTD).

Figure 2

Schematic representation of Muta is i.i.d. vector pSDH422 together with contractional marker sacB, used to create a strain of Rhodococcus erythropolis RG1, 1062 BP unmarked deletion of the gene kstD1. ORF2 and ORF3 are flanking genes gene kstD1 R.erythropolis SQ1.

Figure 3

A schematic of the molecular organization of the gene kstD1 in strain wild-type R.erythropolis SQ1 and after switching pSDH422 using a single crossover respectively on the right (strain SDH422-3) and the left locus-target (strain SDH422-4) kstD1. Window-insert: southern analysis using as a probe kstD1, where chromosomal DNA R.erythropolis wild-type (lane 1) raceplane BamHI, strain SDH422-3 (lane 2), SDH422-4 (lane 3) and two deletion mutants kstD1 (lanes 4 and 5).

Figure 4

Bioconversion of 4-androsten-3,17-dione 9α-hydroxy-4-androsten-3,17-dione in 6-liter culture of Rhodococcus erythropolis SQ1 UV29. 10 g/l AD (-O-) and 20 g/l AD (-Δ-,, -X-).

Figure 5

Bioconversion of 4-androsten-3,17-dione 9α-hydroxy-4-androsten-3,17-dione in 6-liter culture of Rhodococcus erythropolis RG8. 10 g/l AD(-Δ-, -X-).

Examples

Example 1

Description kstD1

A degenerate oligonucleotide probe kstD [5' ttcgg (c/g)gg (c/g)ac(c/g)tc(c/g)gc(c/g)tactc(c/g)gg(c/g)gc(c/g)tc(c/g) atctgg] (SEQ ID NO: 2) was created from the aligned N-terminal parts of known protein sequences KSTD A.simplex, C. testosteroni and N.. After splitting the total DNA R.erythropolis SQ1 by the restriction enzyme BglII was determined size fragment is using centrifugation in sucrose gradient. Southern analysis at 68° (washed in stringent conditions with (2×SSC for 2×15 min and 0.1×SSC for 2×10 min) obtained fractions gives 6 TPN DNA fragment, hybridize with labeled digoxigenin oligonucleotide probe kstD. This fragment are ligated into the BglII site of Rhodococcus-E. coli Shuttle vector pDA71 (Dabs et al., 1995 Development of improved Rhodococcus plasmid vectors and their use in cloning genes of potential commercial and medical importance, p.129-135. In: Proceedings of the Ninth Symposium on the Actinomycetes, Moscow, Russia) and subcloning in cleaved with BamHI plasmid pBluescript II KS (Stratagene) (pSDH200).

The results of the analysis, restriction mapping, the inventors concluded that only a single EcoRV site is present in the specified 6 TPN fragment, which divides it into equal pieces, approximately 3 TPN southern analysis indicates that the EcoRV fragment pSDH200 size of about 2.9 TPN contains sequences homologous kstD-olignucleotides. Nucleotide sequencing reveals an open reading frame in 1,533 N. (kstD1, see SEQ ID NO:1)encoding KSTD1 that demonstrates using heterologous expression in Escherichia. Further nucleotide sequencing can detect two ORF - 1,533 N. (ORF1) and 627 N. (ORF2), encoding putative proteins, respectively, of 510 amino acids and 208 amino acids.

Example 2

Strain with a deletion of the kstD1.

Was designed mutage the tion vector, which contains a fragment of chromosomal DNA R.erythropolis SQ1 with a deletion of the kstD1. 1062 BP BsmI fragment pSDH200 encoding most inner part KSTD1, deleteroute to create pSDH200)BsmI. In order to create a mutagenic vector 2724 BP SmaI/EcoRI fragment from pSDH200)BsmI, zakariayi 468 BP residue kstD1 and its flanking region, clone into SmaI/EcoRI site pK18mobsacB (pSDH422, see Figure 2). Vector pSDH422 encoding resistance to kanamycin to select for integration of this mutagenic vector in the chromosome, and zakariayi sacB gene from .subtills designed to contrelle, introduced into E. coli S17-1 and mobilize in R.erythropolis SQ1 through conjugation as follows. Cells of the recipient strain R.erythropolis SQ1 distribute LBP-agar with the addition of 30 μg·m-1nalidixic acid and raise them within 5 days. Mutagenic vector pSDH422 initially introduced into E. coli S17-1 by transformation.

Transformants (approximately 1000 per Cup), grown overnight in selective medium (25 mg·ml-1kanamycin), incubated at room temperature for further 24 h Colonies of both strains, Rhodococcus and E. coli resuspended in a final volume of 1.5 ml LBP (1% bactopeptone (Difco), 0.5% of yeast extract (BBL), and 1% NaCl). Mixed aliquot of sample 750 ál from each strain and gently precipitated by centrifugation. The precipitate cells resuspended in 1 ml of LBP, and the cells in RA is predelay on non-selective LBP-agar in 250 µl-a new aliquot. After growing overnight at 30°obtained together With grown material resuspended in 2 ml of LBP-medium and 100 ál of marketing aliquots distribute LBP-agar with the addition of kanamycin (200 μg·ml-1) and nalidixic acid (30 mcg·ml-1). After 3 days appear transconjugate R.erythropolis SQ1. All received transconjugate Rhodococcus, resistant to kanamycin (kanr), were sensitive to sucrose (sucs); growth after obtaining replica on LBPS-agar (1% bactopeptone, 0,5% yeast extract, 1% NaCl, 10% sucrose) supplemented with 200 mcg·ml-1kanamycin occurred.

Southern analysis (Figure 3) microorganisms wild-type (lane 1: single band of approximately 4500 BP) and two transconjugation, SDH422-3 (lane 2: two bands of approximately 2900 and 10100 P.K.) and SDH422-4 (lane 3: two bands of approximately 4000 and 9000 BP) finds that both strains have a single copy of pSDH422 included in the locus of a target through a single recombination event. Gene deletion kstD1 obtained in strain SDH422-3 R.erythropolis after an overnight growth in non-selective conditions, becomes visible after passage of cell culture on selective medium, i.e. on the LBSP-agar.

DeleteMovie gene kstD1 is achieved after an overnight growth in non-selective conditions and the subsequent passage of cell culture on selective medium, i.e. on LBPS-AG is re. PCR colonies using kstD1-primers (forward primer [5' gcgcatatgcaggactggaccagcgagtgc] (SEQ ID NO:3); reverse primer [5' gcgggatccgcgttacttcgccatgtcctg] (SEQ ID NO:4)) 9 sucr/kans-the colonies gives 6 PCR products with a size of fragments 468 P.N., including deleteriously gene kstD1. The deletion of the gene was confirmed by southern analysis at 60° (washed in stringent conditions with (2×SSC for 2×5 min and 0.1 SSC for 2×5 min) using as a probe a gene kstD1, randomly labeled digoxigenin. 4,5 TPN kstD1-DNA fragment of the wild type, obtained after cleavage of chromosomal DNA BamHI, decreased to 3.4 TPN mutants with gene deletion, indicating the intended deletion of the fragment kstD1-DNA size 1062 BP That the resulting strain was named R.erythropolis RG1.

Example 3

Inactivation of steroid Δ1-dehydrogenase in UV mutagenesis.

Cells (2·108SOME·ml-1) R.erythropolis RG1 late exponential phase, grown in 10 mm glucosaminyl environment (K2NRA44,65 g·l-1, NaH2PO4·H2O 1.5 g·l-1, NH4Cl 3 g·l-1, MgSO4·7H2O g·l-1, Vishniac-trace elements, pH 7,2), subjected to ultrasonic treatment in a short period of time to obtain single cells. Diluted (104) samples distribute gluco is mineralno agar medium and irradiated for 15 to 20 seconds using a UV lamp (Philips TAW 15W) at a distance of 27 cm, on average, leads to 95% cell death. After 4 days of incubation colonies placed on mineral agar medium containing 4-androsten-3,17-dione (0.5 g·l-1dissolved in DMSO (50 mg·ml-1)). After 3-4 days taken defective in growth on the steroid mutants for further characterization. For selection of strains blocked in Δ1-dehydrogenating obtained mutant population sceneroot for the presence of mutants with defective growth on 4-androsten-3,17-dione, able to grow on mineral agar medium containing 1,4-androstadien-3,17-dione (0.25 g·l-1). On this basis it is concluded that the corresponding gene is inactivated. This gene is called kstD3 (see Figure 1).

Example 4

Microbiological 9α-hydroxylation 4-androsten-3,17-dione with a UV mutant of Rhodococcus erythropolis UV-29.

Rhodococcus erythropolis SQ1 UV-29 is a UV-mutant, which is able to convert 4-androsten-3,17-dione (AD) 9α-hydroxy-4-androsten-3,17-dione (9αOH-AD) with a concentration of from 10 to 20 g/L.

This conversion is carried out using the following method.

In a 250 ml-OIC Erlenmeyer flask containing 75 ml of sterile medium (1.5% of yeast extract, 1.5% glucose; pH 7.0)on a rotary shaker (180 rpm./min) in 24 hours is grown at 28°Rhodococcus erythropolis SQ1 UV-29 (preculture). A 10-liter fermenter, with 6 what frame it sterile culture fluid (1.5% of yeast extract, 1.5% glucose, 0.01% of defoaming agent propylene glycol; pH 7.5) inoculant preculture (1%) and incubated at 28°C for 16 hours while bubbling sterile air, while the culture is stirred for stimulation of deep growth. Then enter suspension of 60 grams of 4-androsten-3,17-dione in 300 ml of Polysorbate (0,1%). Then continue aerobic incubation with stirring at 28°C for 24 hours. The obtained culture samples extracted with methanol (70%) and before the definition steroid composition using Ehud filtered through 0.45 µm-tion deaf filter. The same operation carried out in triplo (three times) with twice the concentration of AD in the amount of 20 g/l by adding 120 g AD instead of 60 g

As shown in figure 4, for 24 hours, 10-20 g/l 4-androsten-3,17-dione is almost completely transformed into a 9α-hydroxy-4-androsten-3,17-dione (approximately 93% of the total number of 4-androsten-3,17-dione).

Example 5

Description kstD2.

Gene library R.erythropolis RG1 injected through electrotransformation competent strain R.erythropolis RG1-UV29. Colonies are replica on mineral agar medium containing 4-androsten-3,17-dione (0.5 g/l) as sole source of carbon and energy. The complementation phenotype of strain RG1-UV29 evaluate after three days incubation at 30°C. Colonies growing on mineral agar medium with 4-EN the speed-3,17-dione, cultivated in LBP environment for selection of plasmid DNA, which is subsequently re-introduced into the strain RG1-UV29 to control the true complementaly. Plasmid pKSD101 allocated from transformant that demonstrates the restoration of growth on mineral medium with 4-androsten-3,17-dione, is introduced into E. coli DH5α for subsequent analysis. In pKSD101 identify box, approximately 6.5 TPN DNA phototrophic bacteria, and subjected to analytical restriction mapping, subclavian and subsequent experiments complementaly. 3,6 TPN DNA fragment EcoRI still retains the ability to recover the phenotype of strain RG1-UV29 and therefore subcloning in pBluescript(II)KS (pKSD105) for nucleotide sequencing. Analysis of a nucleotide sequence detects the presence of a large open reading frame (ORF) size 1,698 N., proposed coding protein of 565 amino acids with a calculated molecular weight of 60.2 kDa. This ORF was designated kstD2 (SEQ ID NO:5) (which is identical to the previously described kstD3 - see Example 3). Deduced amino acid sequence kstD2 shows high similarity with known 3-ketosteroid Δ1-dehydrogenase (KSTD), indicating that kstD2 encodes the second enzyme KSTD at R.erythropolis RG1.

Example 6

Strains with a deletion of the kstD2.

Strain RG7 R.erythropolis is a mutant strain derived from a wild-type strain Q1 R.erythropolis, containing a single gene deletion kstD2. Strain RG8 R.erythropolis created as a result of consistent deletion in the wild-type strain SQ1 R.erythropolis two genes encoding the activity of 3-ketosteroid Δ1-dehydrogenase, i.e. kstD1 and kstD2. Strain RG8 receive as a result of deletion of the gene kstD2 of the genome which have deletions kstD1 strain RG1 R.erythropolis. The method used for deletion of the gene kstD2, similar to the method described for dellarovere gene kstD1 in example 2, except that used different mutagenic vectors (pKSD201 instead pSDH422).

Mutagenic vector pKSD201 create the following way. DeleteMovie internal 1,093 BP DNA fragment of the gene kstD2 splitting MluI and subsequent ligation pKSD105 allows you to create pKSD200. 2,4 TPN EcoRI fragment from pKSD200 containing the mutated gene kstD2, are ligated in EcoRI-treated pK18mobsacB, thereby creating pKSD201. Plasmid pKSD201 introduced into E. coli S17-1 and mobilized by conjugation in strain SQ1 R.erythropolis (to create a strain RG7), or - in strain RG1 (to create a strain RG8). Transconjugate (sucskanr), the resulting target enable pKSD201 in this gene appear after 3 days of growth at 30°C. a Deletion kstD2 exercise during the night the growth of one selected transconjugate (sucskanrin non-selective conditions (i.e. LBP-environment) and the subsequent premises on selective agar with the food LBPS. PCR colonies carried out on 15 colonies sucr/kansusing kstD2-primers (forward primer [5' gcgcatatggctaagaatcaggcaccc] (SEQ ID NO:6); reverse primer [5' gcgggatccctacttctctgctgcgtgatg] (SEQ ID NO:7)), getting 4 PCR product with a fragment size of 0.6 TPN, including the remaining part of the gene kstD2. Southern analysis using as a probe dig-labeled gene kstD2, chromosomal DNA of the wild type treated with Asp718, and these 4 are obtained mutant confirm the deletion kstD2: 2,4 TPN Asp718 fragment of wild type DNA is reduced to 1.3 TPN in the mutant strains.

Example 7

Microbiological 9α-hydroxylation 4-androsten-3,17-dione using strain RG8 R.erythropolis.

Rhodococcus erythropolis RG8 is a double mutant deletions kstD1 and kstD2, which is able to convert 4-androsten-3,17-dione (AD) 9α-hydroxy-4-androsten-3,17-dione (9αOH-AD) with a concentration of 10 g/L.

This transformation is done by using the following method:

In a 250 ml-OIC Erlenmeyer flask containing 75 ml of sterile medium (1.5% of yeast extract, 1.5% glucose; pH 7.0), grown for 24 hours on a rotary shaker at 28°Rhodococcus erythropolis RG8 (preculture). A 10-liter fermenter, with 6 liters in it sterile culture fluid (1.5% of yeast extract, 1.5% glucose, 0.01% of defoaming agent propylene glycol; pH 7.5), inoculant preculture (1%) and incubated at 28&x000B0; C for 16 hours while bubbling sterile air, while the culture is stirred for stimulation of deep growth. Then enter suspension of 60 grams of 4-androsten-3,17-dione in 300 ml of Polysorbate (0,1%). Then continue aerobic incubation with stirring at 28°C for 24 hours. Samples taken during this process. These samples are extracted with methanol (70%) and before the definition steroid composition using Ehud filtered through 0.45 µm-tion deaf filter. This process is carried out twice.

As shown in figure 5, for 15 hours and 10 g/l 4-androsten-3,17-dione is almost completely transformed into a 9α-hydroxy-4-androsten-3,17-dione (approximately 92-96% of the total number of 4-androsten-3,17-dione).

1. Method of constructing a genetically modified strain of a microorganism that destroys steroids, lost the ability to destroy the steroid nucleus, providing inaktivirovanie of many genes associated with the destruction of the steroid nucleus, in particular the deletion of many genes steroidogenesis, and the first gene deleterows through unmarked gene deletions and, in particular, the first deleteriously gene is a kstD1.

2. The method according to claim 1, characterized in that any subsequent gene is inactivated by UV-irradiation.

3. The method according to claim 1 or 2, characterized in that Liu is th subsequent gene deleterule through unmarked gene deletions.

4. The method according to claim 1, characterized in that the second gene deleterows through unmarked gene deletions.

5. The method according to any one of claims 1 to 4, characterized in that at least and kstD1, and kstD2 inactivated.

6. The method according to any one of claims 1 to 5, characterized in that the microorganism is a Rhodococcus, preferably R.erythropolis.

7. The method according to any one of claims 1 to 6, characterized in that the receive genetically modified strain of Rhodococcus erythropolis RG1-UV29(DSM13157).

8. The method according to any one of claims 1 to 7, characterized in that the microorganism used to produce 9α-hydroxy-4-androsten-3,17-dione specified by growing the microorganism in a culture medium containing 4-androsten-3,17-dione.



 

Same patents:

FIELD: biotechnology, immunology, molecular biology, medicine, pharmacy.

SUBSTANCE: invention describes the isolated human antibody or its antigen-binding fragment able to bind the human tumor necrosis factor (TNF-α). Amino acid sequence is given in the description. Invention discloses nucleic acid encoding heavy and light chain of isolated human antibody. Nucleotide sequences are given in the description. Invention describes recombinant vector expressing variable region of heavy and light chains of isolated human antibody, Chinese hamster ovary cells CHO dhfr- carrying vector. Invention discloses a method for synthesis of isolated human antibody. The isolated human antibody or its antigen-binding fragment can be used as an active component of pharmaceutical composition used in treatment of disturbances when activity of TNF-α is harmful. Using the invention allows neutralization of effect of TNF-α in case when its activity is harmful. Invention can be used in medicine.

EFFECT: valuable medicinal properties of antibody, improved method for synthesis.

17 cl, 11 dwg, 17 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: method involves increasing receptor activity, that is activated with proliferating agent of peroxis, by introducing NADP+-dependent isocitrate dehydrogenase (IDPc), IDPc gene or NADPH, selecting antisense molecule inhibiting fat deposit or nitroglycerides and cholesterol production using IDPc gene, and treating metabolism disorder diseases like adiposity, hyperlipiemia or hepatic fat infiltration by introducing antisense molecule of IDPc gene or IDPc gene inhibitor like oxalomalic acid or methyl isocitric acid.

EFFECT: enhanced effectiveness of treatment; reduced NADP level in cells.

5 cl, 10 dwg

FIELD: gene engineering.

SUBSTANCE: the present innovation deals with transferring a mutant gene due to homologous recombination into animal embryo. The animal obtained is characterized by the capacity to express mutant protein of presenylin-1 and induction of beta-myeloid protein production that leads to the development of progressing nervous disease in hippocampus or peripheral department of cerebral cortex, It is, also, suggested to apply several plasmids carrying a mutated gene. It is, also, described the way to obtain primary cell culture or subcultivated cell out of obtained mutated animals. Moreover, several methods are, also, suggested for testing the substances for usefulness in therapeutic and/or prophylactic procedures at treating Alzheimer's disease. They deal with introducing a tested substance for mutated animal to evaluate the data obtained. The obtained mutated animals could be applied as model animals while studying Alzheimer's disease nature.

EFFECT: higher efficiency.

25 cl, 8 dwg, 10 ex

FIELD: immunology; treatment of mediated diseases IL-1 and failures.

SUBSTANCE: bonding molecule IL-1β which is antibody to human IL-1β and especially human antibody to human IL-1β where hypervariable sections CDRs of heavy and light chains have definite amino acid sequences. Antibody may be used for treatment of mediated disease IL-1, for example osteoarthritis, osteoporosis and other inflammatory processes of bones of rheumatism or podagra nature. Constructions of deoxyribonucleic acid are described which code heavy and light chains or their fragments and expressive vectors which may be replicated in cells including deoxyribonucleic acid constructions. Method of obtaining bonding molecule IL-1β by means of cell transformed by vector is described. Proposed antibody may be used both in prophylactic and treatment of diseases.

EFFECT: enhanced efficiency.

15 cl, 3 dwg, 5 ex

FIELD: biotechnology, genetic engineering, immunology.

SUBSTANCE: invention proposes: isolated nucleic acid encoding feline ligand CD86; diagnostic oligonucleotide; cloning vector; vaccine for modulation of the immune response in cat; method for induction, enhancement and suppression of immune response in cats. Proposed group of inventions allows designing effective vaccines used in prophylaxis of immunodeficiency in felines and infectious peritonitis in domestic cats. Invention can be used in veterinary science.

EFFECT: valuable properties of nucleic acid.

27 cl, 13 dwg, 5 tbl, 8 ex

FIELD: medicine, immunobiology, pharmacy.

SUBSTANCE: humanized monoclonal antibody (monAb) or its fragments comprises heavy and/or light chain with the binding rate constant with AILIM 1.0 x 103 (1/M x s) and above, and the dissociation rate constant between monAb and AILIM 1.0 x 10-3 (1/s) or less. MonAb shows also a nucleotide sequence encoding variable region of light and/or heavy chain and corresponding amino acid sequences. Invention relates to DNA and it part encoding monAb or its fragments, and vectors comprising nucleotide sequences encoding antibody or its fragments. The humanized monAb can be prepared by using a genetically recombinant host. MonAb is comprised as a component of pharmaceutical compositions used for inhibition or induction of AILIM-mediated transfer of signal into cell for induction of antibody-dependent cytotoxicity against AILIM-expressing cell and others. Invention can be effective in treatment of different autoimmune diseases associated with AILIM-mediated transfer of co-stimulating signal. Invention can be used in medicine for treatment of diseases associated with AILIM-mediated transfer of co-stimulating signal.

EFFECT: valuable medicinal properties of antibody.

75 cl, 78 dwg, 14 ex

FIELD: genetic engineering, proteins, medicine, pharmacy.

SUBSTANCE: invention relates to a method for preparing a fused protein representing immunoglobulin Fc-fragment and interferon-alpha and can be used in treatment of hepatitis. Method involves construction of a fused protein comprising immunoglobulin Fc-fragment prepared from Ig G1 or Ig G3 in direction from N-end to C-end and the end protein comprising at least one interferon-alpha. Fc-fragment and the end protein are joined directly or by a polypeptide bridge. The fused protein is used for preparing a pharmaceutical composition used in treatment of liver diseases and in a method for targeting interferon-alpha into liver tissues. Invention provides preparing the fused protein eliciting with biological activity of interferon-alpha providing its concentrating in liver and showing enhanced solubility, prolonged half-time life in serum blood and enhanced binding with specific receptors.

EFFECT: improved targeting method, valuable biological properties of fused protein.

10 cl, 5 dwg, 9 ex

FIELD: medicine, immunology, phthisiology.

SUBSTANCE: invention proposes a vaccine composition used in prophylaxis and treatment of tuberculosis infection. The composition comprises a mixture of fused recombinant protein ESAT-HSP70 from Mycobacterium tuberculosis, protein HSP65 from M. tuberculosis and an inert vehicle. Also, the proposed composition can comprise timogen additionally. Also, invention proposes recombinant plasmid DNA pE HSP70 and pQE HSP65 encoding corresponding proteins. The proposed vaccine composition enhances effectiveness in treatment and prophylaxis of tuberculosis infection. Genetic constructions provide carrying out the stable expression of indicated proteins and to enhance purity the end preparing proteins. Invention can be used in treatment and prophylaxis of tuberculosis.

EFFECT: valuable medicinal properties of composition.

5 cl, 6 dwg, 6 ex

FIELD: biotechnology, in particular method for construction and production of mutant transglutaminases (MTG).

SUBSTANCE: invention relates to method for construction and production of mutant transglutaminases based on space structure of transglutaminase obtained from Streptoverticillium mobaraense, as well as to mutant MTG obtained by said method. Also disclosed are method for MTG modification based on space structure and modified transglutaminase with enhanced reactivity relative to substrate. Method of present invention makes it possible to predict MTG binding site to substrate on the base of space structure that is determined by MNG crystal X-ray analysis, and to design mutant transglutaminases by replacement, insertion or deletion of amino acid residues disposed on transglutaminase substrate-binding site.

EFFECT: new method for production and modification of mutant transglutaminases.

6 cl, 60 dwg, 5 ex

FIELD: genetic engineering, in particular genes for cell cycle controlling point.

SUBSTANCE: polynucleotide encoding rad3 polypeptide ATR homologue is cloned into expression vector, having functionality in eucariotic cells. Polypeptide of rad3 polypeptide ATR homologue is obtained by cultivation of eucariotic cell culture, transformed by vector. Monoclonal antibody to rad3 polypeptide ATR homologue is obtained by hybridoma technologies. Polyclonal antibodies are obtained by inoculation of rad3 polypeptide ATR homologue in host animal. Polynucleotide presence in animal tissue sample is detected by contacting of this sample containing DNA or RNA with polynucleotide encoding rad3 polypeptide ATR homologue under hybridization conditions. Polypeptide in biological sample is detected by sample contact with monoclonal or polyclonal antibodies. Substances having anticancer activity are screened on the base of reduced activity of ATR polypeptide on substrate or reduced chelating of ATR homologue in presence of candidate substance. Present invention makes it possible to produce human or S.pombe rad3 polypeptide ATR homologue and is useful in investigation ATR role as gene for cell cycle controlling point in cell culture in vivo or in vitro.

EFFECT: new anticancer substances.

24 cl, 1 dwg

FIELD: molecular biology, criminology, genetic medicinal trials.

SUBSTANCE: the present innovation deals with new markers , the method for their obtaining and applying to identify one's sex in DNA-containing human biological samples. The innovation suggested enables to detect chromosomal abnormalities by sex more accurately and at high sensitivity.

EFFECT: higher accuracy and efficiency of identification.

4 cl, 3 dwg, 3 ex, 2 tbl

FIELD: biotechnology, biochemistry, amino acids.

SUBSTANCE: invention describes a polynucleotide showing activity of glucose-6-phosphate isomerase and comprising polynucleotide sequence taken among the group including: a) polynucleotide encoding polypeptide that comprises amino acid sequence identical at least by 90% with amino acid sequence represented in SEQ ID NO:2; b) polynucleotide that is complementary with polynucleotides given in sub-paragraph a). Also, invention describes a method for enhancing the metabolism intensity in pentose phosphate cycle by attenuation of pgi gene and a method for preparing L-amino acids. Invention provides preparing L-amino acids with the high effectiveness degree.

EFFECT: improved preparing method, valuable properties of polynucleotide.

16 cl, 7 dwg, 3 tbl, 6 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to polynucleotide encoding zwal gene product containing polynucleotide sequence selected from group including a) polynucleotide encoding polupeptide with amino acid sequence with at least 90 % identity to amino acid sequence represented in SEQ ID NO:2; b) polynucleotide which is complementary to polynucleotides from a), as well as primer representing polynucleotide containing at least 15 sequential base pairs of abovementioned polynucleotide.

EFFECT: new zwal gene encoding ionic zwal product.

6 cl, 1 dwg, 1 tbl, 5 ex

FIELD: gene engineering, in particular purification and isolation of polynucleotides.

SUBSTANCE: invention relates to purification and isolation of polynucleotides regulating mammalian gene transcription and is useful in regulation of heterologous polynucleotide expression, obtaining transgene animals, and identification of affined regulatory DNA sequences. DNA containing transcriptional regulatory DNA of hamster gene EF-1α was isolated by screening of genome library to Chinese hamster ovary (CHO-K1). Chimeric polynucleotide including isolated regulatory DNA of hamster gene EF-1α operably bonded to gene sequence encoding target protein product other than protein encoded by hamster gene EF-1α was constructed. Obtained chimeric polynucleotide is used as component of expression plasmid for transformation or transfection of host cell. To increase target gene transcription in host cell DNA containing regulatory DNA of hamster gene EF-1α was integrated into host cell genome DNA in site operably bonded to target gene. Method of present invention make it possible to increase mRNA expression level for operably bonded heterologous polynucleotides by 3-11 times.

EFFECT: increased mRNA expression of operably bonded heterologous polynucleotides.

31 cl, 3 tbl, 7 ex

FIELD: biochemistry.

SUBSTANCE: the present innovation deals with an anti-sense oligonucleotide or one of its derivatives which can inhibit expression of human eg5 protein being relative to kinesin of motor proteins. The oligonucleotide has got a sequence being correspondent to that of nucleic acid coding certain part of human eg5. This innovation deals with the way to obtain the above-mentioned oligonucleotides, pharmaceutical composition for inhibiting human eg5 and its application. Advantage of the innovation deals with developing e new preparation to be applied for inhibiting cell proliferation.

EFFECT: higher efficiency of inhibition.

11 cl, 1 dwg, 2 ex, 3 tbl

FIELD: biotechnology, molecular biology, biochemistry.

SUBSTANCE: invention relates to regulatory sequences. Method involves isolation of DNA molecule with nucleotide sequence SEQIDNO:2 or SEQIDNO:3 that is necessary for expression of the required encoding sequence. Then vector comprising any of indicated sequences and the required sequence is constructed followed by transformation a plant with the prepared vector. Invention provides preparing transgenic plants with regulating expression of the required gene.

EFFECT: improved preparing method.

19 cl, 1 tbl, 6 ex

The invention relates to molecular biology and genetic engineering, specifically to the creation of synthetic polyepitope vaccines against HIV-1

The invention relates to biotechnology and can be used for separation of proteins with desired properties from large pools and nucleic acids (NC)
The invention relates to medicine, epidemiology, Microbiology and molecular biology

FIELD: biotechnology, microbiology, genetic engineering, amino acids.

SUBSTANCE: invention describes a microorganism belonging to genus Escherichia used as a producer of L-amino acids with optimized level of expression of gene that effects in disposition of carbon flow, in particular, gene sucAB. Method involves stages for insertion of DNA fragments set into microorganism chromosome synthesized in vitro and comprising regulatory elements of gene expression instead the natural element of regulatory gene region to obtain population of microorganisms and selection of microorganisms showing the enhanced production of L-amino acids. Also, invention describes a method for preparing such L-amino acids as L-glutamic acid, L-proline, L-arginine, L-glutamine, L-leucine by using microorganisms with optimized level of expression of gene sucAB. Invention provides preparing L-amino acids with the high effectiveness degree.

EFFECT: improved preparing method.

15 cl, 1 dwg, 2 tbl, 5 ex

Up!