Barley of reduced starch ii synthase (ssii) activity

FIELD: biotechnology, food processing industry.

SUBSTANCE: barley plants are mutated in SSII gene to reduce SSII activity. Such barley corn has starch structure with. Moreover said corn optionally has relatively high β-glucan content. Starch is characterized with decreased gelatinization viscosity, low crystallinity, and high levels of lipid-bonded starch of V-form crystallinity.

EFFECT: barley plants having reduced amylopectin content and relatively high amylose content.

33 cl, 39 dwg, 10 tbl, 2 ex

 

This invention relates to plant barley with reduced activity of the enzyme starch synthase II (SSII), leading to starch having a low content of amylopectin. In addition, this invention relates to starch and grains, and foods derived from them.

PRIOR art

One of the discoveries in the science of nutrition is the fact that resistant starch is important for gut health, in particular, for the health of the large intestine. The beneficial effects of resistant starch are the result of supply of the large intestine, where the intestinal microflora receives the energy source that undergoes fermentation with the formation of, among other things, short-chain fatty acids. These short-chain fatty acids provide nutrients for colonocytes, enhance the capture of some nutrients through the colon and contribute to the physiological activity of the colon. As a rule, if you don't provide a stable starches or other dietary fiber, the colon is relatively inactive in metabolism.

In recent years there is the search direction of the development of resistant starches from different sources, aimed at gut health. Accordingly, vysokomolochnye starch is found in some cereals, such as corn for use in food products as a means of contributing to the health of the intestine.

The physical structure of starch can have an important impact on the nutritional and technological properties of starch for food. Some characteristics can be considered as an indicator of the structure of starch, including the distribution of lengths of chains of amylopectin, the degree of crystallinity and the presence of forms of crystallinity, such as the V-complex form of the crystallinity of the starch. Forms with such characteristics can also be viewed as an indicator of nutritional and technological properties of food products containing these starches. Thus, small chain length of amylopectin can be an indicator of low crystallinity and low gelatinization, and also believe that it correlates with reduced retrogradely of amylopectin. Also, consider that the distribution of the lengths of the shorter chains of amylopectin reflects the organoleptic properties of food products, in which the starch is included in significant amounts. The reduced crystallinity of the starch may also be an indicator of low temperature gelatinization of starch, and, in addition, believe that it is associated with improved organoleptic properties. The presence of a V-complex cristallin the STI or otherwise associated with starch lipid will increase the level of resistant starch and consequently, dietary fiber.

Lines of barley with starches with high amylose content were previously identified. The result of this was only a relatively small increase in the content of amylose to a maximum of about 45% of the total starch, such as barley, known as High Amylose Glacier (AC38). Although starches with high amylose content of this type is useful, nevertheless the preferred starches with higher amylose content, and grow some other types of cereals to obtain starches with higher amylose content at levels of 90-percentile range. They are very resistant to enzymatic hydrolysis, and bring great health benefits.

When developing vysokomolochnyh starches there is a problem, because the known vysokomolochnye starches also have high temperature gelatinization. The gelatinization temperature reflects the pulverization energy required for the processing of such food products. Therefore, for the processing of grain or flour for food production of these grains or starches usually need a higher temperature. Therefore, as a rule, products that have vysokomolochnye starches, are more expensive. Similarly, from the point of view of the consumer, for the cooking is these produced food or for cooking of flour, having vysokomolochnye starches, may require longer periods of time and higher temperature. Therefore, in ensuring vysokomolochnyh starches in food there is a significant inconvenience.

Another nutritional component of cereals, particularly barley are β-glucan. β-Glucans consist of glucose units connected β(1-4) and/or β(1-3) glycosidic bonds, and also not destroyed by human digestive enzymes, which makes them suitable as a source of dietary fiber. β-Glucan may be partially subjected to enzymatic hydrolysis by endogenous bacteria of the colon, in the fermentation process which the formation of short-chain fatty acids (mainly acetate, propionate and butyrate), which are useful for mucosal cells lining the intestine and the colon (Sakata and Engelhard Comp. Biochem. Physiol. 74a: 459-462 (1983)).

In addition, absorption β-glucan has the effect of increasing the excretion of bile acids, resulting in lower total serum cholesterol and low-density lipoprotein (LDL) with reduced risk of coronary heart disease. Similarly, β-glucans act by weakening shifts in the concentration of blood glucose that occurs after eating. Consider, Thu is both of these effects based on the increase of viscosity of the contents of the stomach and intestines.

The composition of food products containing starch, and close interaction of these starches with other nutrients or other components can have a significant impact on the nutritional value of these foods or functional characteristics of these components in the preparation or the structure of these food products.

Although modified starches or β-glucan, for example, can be used in food products that provide functionality, normally do not provide non-modified sources, such processing tends either to modify other important components, or is undesirable because of the processes involved in the modification. Therefore, it is preferable to provide the sources of components that can be used in unmodified form in food products.

Barley MC available from Barley Germplasma Collection (USDA-ARS National Small Grain Germplasma Research Facility, Aberdeen, Idaho 831290 USA). Grain MK is shrunken and is highly colored husks and elongated shape, and in the hands of the authors of the invention this grain is very difficult to machine, including the fact that it is very resistant to crushing. Properties of grain MC have not been previously characterized, the nature of the mutation is not installed, and it is not considered suitable for food production.

CU IS RIGID SUMMARY of the INVENTION

This invention is a result of the selection and characteristics of SSII mutant of barley, the grain of which, as discovered, contains starch, which has a low content of amylopectin and, consequently, relatively high levels of amylose, and therefore has elevated levels of dietary fiber.

The grain of this mutant and grain from crosses in some genetic backgrounds, in addition, has a higher level β-glucan. The combination of high level β-glucan and resistant starch, contributing to the high level of dietary fiber, the inventors believe is unique to the present invention.

In addition, at least in some genetic backgrounds found that the grain from such mutants contains starch, which has a high relative levels of amylose, and has a low temperature of gelatinization. Low swelling properties of such starch during and after gelatinization also have advantages in some applications, a technology diet and food.

In addition, we discovered that the grain from such mutants contains starch, which has a high relative levels of amylose, and detected levels of amylose above 50% of the starch content, which is a level that has never been found in namadi itirapina starch, derived from barley.

Starch mutants and lines back-crossing with the origin of these mutants (to the extent to which these lines back-crossing tested), behaves as resistant starch with an altered structure, which indicate specific physical characteristics, including one or more than one group, which includes the presence of a high relative amylose content, physical inaccessibility due to the presence of high content of β-glucans, modified the morphology of the granules and the presence associated with starch, lipid, and this modified structure also specifies the characteristics selected from one or more than one of the group, which includes low crystallinity, reduced the distribution of lengths of chains of amylopectin and the presence of significant associated with starch lipid.

In addition, the grain obtained from these mutant plants of barley, can easily be used in procedures, technology, food.

The present invention in one aspect relates to a starch obtained from corn barley plants with lower level of activity SSII, and these starch granules have a high content of amylose due to the low content of amylopectin.

The present invention in another broad aspect the grain, useful for the production of food products derived from barley plants with lower level of activity SSII, and starch specified grain has a high content of amylose due to the low content of amylopectin.

The present invention in one broad aspect relates to plant barley with reduced level of activity SSII, and this plant barley able to produce grain and starch specified grain has a high content of amylose due to the low content of amylopectin, with specified grain is suitable for food production.

Alternatively, the present invention relates to the selected nucleic acid molecule that encodes a protein of barley SSII, and the specified nucleic acid capable of hybridizing in stringent conditions with SEQ ID NO 1, or a cell bearing a replicable recombinant vector carrying the specified nucleic acid molecule. In another embodiment, this invention relates to the selected nucleic acid molecule capable of specific hybridization with SEQ ID NO 1.

A BRIEF DESCRIPTION of GRAPHIC MATERIALS

For a better understanding of the invention will be described hereinafter with reference to some examples.

Figure 1. Analysis of the distribution of the molecular size of the starch, as determined by the PU is eat HPLC-separation of starch in 90% DMSO. (a) Himalaya, (b) AS, (C) 342, (g) 292.

Figure 2. Pictures showing the morphology of the grain mutant and parental lines (a) Himalaya, (b) AS, (C) 292, (g) Waxiro, (d) 342 (e) Tantangara, (W) MK, (C) Sloop. The grain size in length (L), width (W) and thickness (T) is illustrated in panel (a).

Figure 3. Analysis of the distribution of lengths of chains of various starches mutant and wild-type using the FACE. (a) Normalized distribution of the lengths of the chains, (b) comparison of the distributions of the lengths of the chains with the chart of differences. Samples were 342, 292, Tantangara (s), AC38, MKand Himalaya (+).

Figure 4. RVA analysis of samples of barley starch. Samples were Himalaya, Namoi (Δ), AC38 (O), 342 (▿), 292and MK. The temperature profile used for the profile is indicated by a continuous line.

Figure 5. Data of x-ray diffraction for the mutant and the wild-type.

6. Micrograph of scanning electron microscopy of selected starches, barley, (a) Himalaya, (b) Waxiro, (C) AC38, (d) 292 (d) 342 (e) MK.

7. The loci on chromosome 7H barley, showing the proximity of the loci nud1 and sex6. Chart according to GrainGenes (http://wheat.pw.usda.gov/) Barley morphological genes, 7H map, author; Franckowiak JD).

Fig. Hung is on between seed sizes and distribution of the lengths of chains of starch for double haploid lines 292× Tantangara. Lines marked (+), gave a picture of PCR Himalaya, and the lines marked (a), given the results of PCR 292. Panel (A), the ratio of seed length to thickness plotted on a graph against the percentage of starch chains with a DP of 6 to 11; panel (B), seed mass, plotted on a graph against the percentage of starch chains with a DP of 6 to 11.

Fig.9. The SSII cDNA sequence of barley (SEQ ID NO 1) from the cultivar Himalaya.

Figure 10. Structure SSII genes from (1) .tauschii (diploid wheat), (2) varieties of barley Morex. Lines in bold font presented exons and thin lines introns. A straight line under each example indicates an area of gene sequences. The dashed line shows the plot SSII gene of barley, from intron 7, which was not sequenced, but was determined PCR analysis of approximately 3 KBP in length.

11. Comparison of predicted SSII cDNA from MK (SEQ ID NO 2), Morex (SEQ ID NO 3) and 292 (SEQ ID NO 4) and the cDNA sequence Himalaya (SEQ ID NO 1). The predicted sequence obtained by identifying areas of genomic sequences present in the cDNA SSII Himalaya. The start codon ATG and stop codon wild-type is specified as an additional stop codons present in MK (#) and 292 (&), respectively.

Fig. Comparison of amino acid sequences, originating from genes encoding SSII, lines of barley 292 (SEQ ID NO 7), Morex (SEQ ID NO 5), MK6827 (SEQ ID NO 8), Himalaya (SEQ ID NO 6). To anitelea stop codons in 292 and MK6827 indicated by the symbols (& and (#), respectively.

Fig. The position of the mutations in MK6827 (SEQ ID NO 2) and 292 (SEQ ID NO 4) in SSII gene of barley.

Fig. The development and use of PCR analysis for mutations 292. (a) Schematic plot SSII from Himalaya, amplified using primers ZLSS2P4 and ZLBSSIIP5, (b) image of a part, amplified from SSII gene from 292 using ZLSS2P4 and ZLBSSIIP5, showing the absence of one site NIaIV, (b) agarose gel electrophoresis of the products of enzymatic hydrolysis NIaIV from barley; Lane M; ladder DNA markers, lane 1: MK, track 2: Himalaya, lane 3: Tantangara, lane 4: 292, track 5: 342.

Fig. LTO-PAG electrophoresis (polyacrylamide gel electrophoresis with sodium dodecyl sulfate) protein starch granules. Panel (a) 8% acrylamide (37,5:1 acryl/bis) LTO-SDS page gel, subjected to electroblotting and probing with antibody SSII raised against purified associated with protein granules from wheat SSII. (B) 12.5% acrylamide (30:is 0.135 acryl/bis), painted silver. Migration of molecular mass standards of a certain mass (units are KD) are indicated on each side of the shape.

Fig. Schematic illustration of the structures of the DNA intended for negative regulation of the expression of SSII after stable transformation of barley. (1) SSII Gene from nucleotide 1 to 2972 (see sequence figure 9) inserted between the promoter and the terminator is m in the sense orientation. (2) SSII Gene inserted between the promoter and terminator in the antisense orientation from nucleotide 2972 to 1 (see sequence figure 9). (3) Double structure, in which the intron 3 of the gene SSII barley (between nucleotides 1559 and 2851) genomic sequence SSII Morex built between exons 2 and 3 of the SSII cDNA barley from Himalaya (nucleotides 363-1157 figure 9).

DETAILED description of the INVENTION

Definition

The Glycemic Index. This comparison of the effects of the tested foods such as white bread or glucose, changes in the concentration of glucose in the blood. The glycemic Index is a measure of the likely effect of food associated with the glucose concentration in the serum after eating and the need for insulin for glucose homeostasis in the blood.

Resistant starch. The sum of starch and products of enzymatic hydrolysis of starch is not absorbed in the small intestine of healthy people, but coming into the large intestine. Thus, resistant starch excludes products are digested and absorbed in the small intestine.

Resistant starches can be classified into four groups.

RS1 physically inaccessible starch. Examples of this form of starch are formed where the starch is enclosed within a protein or of a similar matrix or within the plant cell wall, or it can be formed because of the partial grinding of grain or legumes after cooling.

RS2 resistant granules. It is, as a rule, raw starches, such as those which are formed from a raw potato or green bananas, some legumes and vysokomolochnyh starches.

RS3 retrogration starches. These starches are formed by thermal/wet processing of starch or starch foods, such as are found in cooked and cooled potatoes, bread and Breakfast cereals.

RS4 chemically modified. These starches are formed due to chemical modifications, such as substitution or cross-stitching. This form of starch is often used in processed foods.

Dietary fiber. This description is the amount of carbohydrates or products of enzymatic hydrolysis of carbohydrates that are not absorbed in the small intestine of healthy people, but is produced in the large intestine. These include resistant starch, β-glucans and other soluble and insoluble carbohydrate polymers. You should include the part of carbohydrates, which is at least partially oxidised resident microflora in the large intestine.

The gelatinization is a fracture (break) of molecular order within the starch granules with concomitant and irreversible changes in properties such as granular swelling, crystallite melting,loss of double refraction the development of viscosity and solubilization of starch.

This invention arose as a result of the selection and characteristics of SSII mutant plants of barley grain which, as discovered, contains starch, which has a low content of amylopectin and, consequently, relatively high levels of amylose, and therefore has elevated levels of dietary fiber.

Found that these mutants have a number of highly desirable characteristics, and it is shown that mating in different genetic backgrounds retain at least some of these characteristics.

Grain mutant and grain from crosses in some genetic backgrounds, in addition, have an increased level β-glucan. The combination of high level β-glucan and high levels of dietary fiber, the inventors believe is unique to the present invention.

In addition, we discovered that at least in some genetic backgrounds grain from such mutants contains starch, which has a high relative levels of amylose, and has a low temperature of gelatinization. The gelatinization characteristics related to swelling, this starch also have the advantage of representing a weak swelling, which is useful for some applications in technology, diet and food.

In addition, we discovered that the grain from such mutants contains starch, which has a high relative levels of amylose, and detected levels of amylose above 50% of the starch content, which represents a level that had never before found in an unmodified starch from barley.

Starch mutants and lines of back-crossing to the extent to which they tested behaves as resistant starch with an altered structure, which indicate specific physical characteristics, including one or more than one group, which includes the presence of a high relative amylose content, physical inaccessibility due to the presence of high content of β-glucans, modified the morphology of the granules and the presence associated with starch, lipid, and this modified structure also specifies the characteristics selected from one or more than one of the group comprising a low crystallinity, low distribution of lengths chains of amylopectin and the presence of significant associated with starch lipid.

In addition, for this reason, the grain obtained from these mutant plants of barley, can easily be used in procedures, technology, food.

Grain from these mutants in one form preferably contains starch, which has high the relative levels of dietary fiber, more specifically, amylose, as well as an increased level β-glucan. The combination of high level β-glucan and high amylose the inventors believe is unique to the present invention, and it provides a unique source of combinations β-glucan and resistant starch, which does not require, at least in the broader aspects of the invention, mixing β-glucan and soluble dietary fiber together or modification of these components.

To the authors ' knowledge of the invention the plant barley according to the present invention is the first open-grain barley with improved relative levels of dietary fiber in the form of resistant starch having a high amylose, which also has elevated levels β-glucans, which are at a higher point typical levels β-glucan or which exceed this level. Grains, which have a higher content of β-glucans represent the waxy phenotype and, consequently, have low levels of amylose.

It is known that there is a wide variety of levels β-glucan in barley in the range from about 4% to about 18% mass/mass of barley, but more typically from 4% to about 8% (Izydorcyk et at. (2000) Journal of Agricultural and Food Chemistry 48, 982-989; Zheng et al. (2000) Cereal Chemistry 77, 140-144 Elfverson et al. (1999) Cereal Chemistry 76, 434-438; Andersson et al. (1999) Journal of the Science of Foods and Agriculture 79, 979-986; Oscarsson et al. (1996) J. Cereal Science 24, 161-170; Fastnaught et al. (1996) Crop Science 36, 941-946). Developed improved lines of barley, for example Prowashonupana, which have from about 15% to about 18% mass/mass β-glucan, but has a waxy phenotype. It is commercially available under the name Sustagrain™ (ConAgra™ Specially Grain Products Company, Omaha, Neb. USA.

Levels β-glucan addressed by the present invention can depend on the genetic background in which the enzymatic activity of the synthesis of amylopectin reduced. Suppose however, that a reduction of activity of the synthesis of amylopectin will have the effect of increasing the relative level of dietary fiber, which partially takes the form of amylose and at the same time, improve β-glucan. One explanation for the concomitant increase β-glucan at higher relative levels of amylose is that this increase may be the result of the concentration effect of reduced endosperm and may further be increased by switching the carbon in the synthesis of starch synthesis β-glucan.

Thus, a grain of barley plants preferably has a content of β-glucan, which is higher than 6% of the total mass of nesluchaino grain, or more preferably above 7%, and most preferably above 8%, but is, levels β-glucan mutants waxy measured up to levels from 15 to 18%, and in the present invention can be considered as high or higher levels than these.

In the second preferred form of the grain of barley plants has decreased gelatinization temperature (as measured by differential scanning calorimetry) in addition to the relatively high content of amylose. According to the data submitted for barley, which serves as an example, this lowered temperature of gelatinization is not only reduced in comparison with starch produced by barley with several high content of amylose, but also in comparison with starch produced by barley with starch, in which normal levels of amylose. Thus, although the present invention consider lower gelatinization temperature relative to the corresponding vysokoimpulsnogo starch, you can also consider the gelatinization temperature, low relative to that of the starch with normal levels of amylose.

In addition, in the genetic backgrounds tested thus, starch is also characterized by swelling in excess heated water, which is weaker than the swelling other tested starches.

In a third preferred form of the starch has levels of amylose above 50% of the content of the project starch, that is a level that has never been found in an unmodified starch from barley.

The starch of the present barley plants has a high relative amylose content, higher than can be expected for a mutation in the SSII gene or another gene starch synthase. So, in wheat mutants by SSII result in relative levels of amylose approximately 35% of the starch. The content of amylose in starch can be considered high when this content is significantly higher than 25%, or which is present in the normal grain of barley, and, therefore, may be higher than about 30% mass/mass of total starch. Known plants of barley, which is considered vysokomolochnye have the content of 35-45%. However, in the present invention is proposed with barley content of amylose, which is higher than 50%, a level that has never been found in an unmodified starch from barley.

The relative content of amylose can be higher than 60% and, more preferably, even above 70%. It may be desirable to have even higher levels and, therefore, it was possible to achieve even higher levels of other plants by hybridization with single mutations, and these levels reach 90%. Therefore, this invention can reach levels of amylose, which is above 80% or above 90%.

In the fourth preferred form of the starch also has a modified structure, which leads to resistant starch. This may be a result of the high content of amylose. Resistant starch may also be formed as β-glucan is present in high levels and is likely to have protective effects due to binding β-glucan with starch granules, and the strength of the contact potentially provides a protective effect for starch, in order thereby to ensure sustainability, which can be described as RS1 form, which to some extent inaccessible to enzymatic hydrolysis. Similarly, the availability of communications starch-lipid, as measured on the basis of the V-complex crystallinity, also likely contributes to the level of resistant starch. In this case, sustainability, apparently, is the result of the physical unavailability of starch due to the presence of lipid, and, accordingly, it can be seen as RS1 starch. It is known that retrograding starch, which adopt the V-complex configuration, is highly resistant to enzymatic hydrolysis, and consequently expect that the amylopectin, which forms part of the V-complex crystal structure, will also be resistant to enzymatic hydrolysis. Starch plant cell is Ana, employee example, may be resistant to enzymatic hydrolysis due to the structure of starch granules and, accordingly, may have a RS2 starch. Each of these characteristics may be present separately or in the form of two or more than two of these characteristics in combination.

Elevated levels of dietary fiber can, at least partially, to take the form of resistant starch, which can be characterized by a high content of amylose starch granules, as explained above.

The relative content of amylose can be higher than 60% and more preferably above 70%. It may be desirable to have even higher levels, and therefore it was possible to achieve even higher levels in other plants by hybridization with single mutations, and these levels reach 90%. Thus, the invention may include levels of amylose above 80% or above 90%.

It may be desirable to plant barley additionally expressed the altered level of activity of one or more than one enzyme in the synthesis of amylose or other enzymes to further increase the relative level of amylose. Thus, this plant barley can carry a different mutation, which additionally reduces or modifies the biosynthesis of amylopectin, either mutation or genetic background that p is fishaut the biosynthesis of amylose. For example, this plant barley may be genotype amylose extender, such as plant barley carrying the mutation amo 1. An example of such a plant is a variety, known as AS (also known as High Amylose Glacier).

It should be understood that the relative level of amylose, which is discussed is the level relative to the total content of starch, and therefore the remainder of the starch can be a predominantly intermediate type of starch, or it can represent mainly amylopectin, or a mixture of both types. In the analysed barley increased amylose is the result of low levels of amylopectin, and, accordingly, the relative level of amylose is not the result of increased synthesis of amylose.

It is known that β-glucan has the effect of slowing down enzymatic hydrolysis in the small intestine just as a result of his presence, along with other food component. Similarly, it is known that stable molecules that have a nearest neighbor position with starch granules help to mask the starch and contribute to its stability, making it physically inaccessible. Elevated levels of amylose and other forms of starch, which may be formed in the connection with the lipid will, therefore, additional increases which were the result of the presence and physical neighbouring position with starch granules. Therefore, provided a significant increase effects of resistant starch, as well as providing other useful effects resulting from high levels of β-glucan.

In addition, it is known that there is a response to the dose in relation to the beneficial effects of resistant starch and β-glucan. Therefore, suggest that the increased level β-glucan together with elevated levels of resistant starch will provide increased health benefits.

The combination of levels β-glucan and resistant starch content of at least preferred variants of the present invention has not been previously detected and, no doubt, from either source without some degree of modification or treatment, and therefore the form of the present invention provide the only practical source of this benefit.

Another preferred aspect of the starch is that, despite a high relative amylose content, it also has a low gelatinization temperature, as measured using differential scanning calorimetry. This is in contradiction with the generally accepted information concerning the fact that vysokomolochnye starches tend to have higher gelatinization temperature, which imposes restrictions on the way in which you can use vysokomolochnye Brahma the s. On the basis of the data submitted for barley, which serves as an example, this lowered temperature of gelatinization is not only reduced in comparison with starch produced lines with several high content of amylose, but also in comparison with starch produced by barley with starch, in which normal levels of amylose. Thus, although in a preferred aspect of the present invention consider lower gelatinization temperature relative to the corresponding vysokoimpulsnogo starch, you can also consider the gelatinization temperature, low relative to that of the starch with normal levels of amylose. For vysokomolochnyh starches aspects of processing that requires high temperatures, therefore, inevitably require high energy consumption, which is costly and can destroy the functionality of other food components. Similarly, from the point of view of a direct consumer, food vysokoimpulsnogo starch may be less convenient due to high temperature or longer time required for cooking. So, for example, in this preferred aspect of the invention it is now possible to offer a product such as the product in the form of noodles, requiring the addition of boiling or hot water in the vessel, this is AK Cup, and does not require heating for a long period of time, and at the same time delivering sustainable starches and other components that have nutritional value, in the large intestine.

The main effect of low temperatures of gelatinization of these starches are lower temperature requirements and, therefore, the pulverization energy of this food. The consequence is that if, as typically can occur when certain food processing, mixing occurs at room temperature, and then this mixture is heated, the lower the gelatinization temperature also reduces the time required to achieve gelatinization. In addition, at temperatures below the temperature of complete normal gelatinization of starch, will be more complete gelatinization of the starch of the present invention than normal starch.

One of the measures of the ability of gelatinization is reflected in thermal properties based on measurements using DSC (differential scanning calorimetry). The beginning of the first peak (peak gelatinization) DSK may be at a temperature less than 53°S, more preferably at a temperature of less than 50°and most preferably at a temperature of less than about 47°C. the Beginning of the first peak can be considered as the beginning of gelatinization. Rahman, obtained from the barley grains may have a first peak at a temperature of less than about 60°S, more preferably at a temperature of less than 55°S, and most preferably at a temperature of less than 52°C. ΔH (Enthalpy) of the first peak may be less than about 3.5, more preferably less than about 1.0, and most preferably less than about 0.5.

Another opening in relation to gelatinization types of flour containing starch according to this invention is that they exhibit low swelling. The amount of swelling is typically measured by mixing the starch or flour with excess water and heating to elevated temperatures, typically above 90°C. the sample was Then collected by centrifugation, and the amount of swelling is expressed as the mass of deposited material divided by the dry mass of the sample. Found that the volume swelling flour from waxy starches and normal barley is higher than about 5.5. The volume swelling of the flour produced from corn, which is vysokololtnoe grain (AS), approximately 3,75. While grain investigated mutants and hybrids they make up less than 3.2, preferably less than a 3.0, but as a rule, higher than about 2.

This characteristic of gelatinization related to low swelling, especially useful if it is desirable to increase with what the actual content of the starch food preparation, in particular, the hydrated food of the drug. In this case, it may be desirable to increase the dietary fiber Zola or other liquid preparation, where otherwise there would be a restriction on the delivery of food preparation.

This characteristic in combination with low gelatinization temperature, shown in the present starch, provides the prospect of a significant improvement of nutritional value of food, where there is a need for quick cooking, such as instant soups and instant noodles.

Postulated that the effects of gelatinization temperature are the result of the modified structure of amylopectin in the endosperm of the grain, and one of the dimensions of this structure is the distribution of lengths of chains (degree of polymerization) of the starch molecules after removal of the branching circuit isoamylase. Analysis of the lengths of the chains amylopectinosis content of starch mutants SSII, employees example, showed that removing the branching chain they have a distribution of lengths of chains in the range from 5 to 60, which is shorter than the distribution of starch, which give natantia line after removal of the branching circuit. Starch with smaller lengths of chains will also be a commensurate increase in the frequency of branching. Thus, the starch may also be allocated to the e shorter lengths of chains of amylopectin. The proportion of starch chains that have a degree of polymerisation that falls in the range of from 6 to 11 residues, can be more than 25%, more preferably more than 30%, and most preferably more than 35%. The proportion of starch chains that have a degree of polymerisation that falls in the range of 12-30 residues may be less than 65%, more preferably less than 60%, and most preferably less than about 55%. The proportion of starch chains that have a degree of polymerisation that falls in the range of 31-60 residues may be less than 10%, more preferably less than 8%, but preferably more than about 5%, and most preferably more than about 6%. Rather than taken individually, the combination of the shares of the three ranges of the lengths of the chains can be considered as indication that the starch is the starch of the type which corresponds to the present invention.

The decrease in the distribution of the lengths of the chains, probably contributes to the low temperatures of gelatinization. Also consider that the reduced chain length improves the organoleptic properties of starch, in particular, taste, thus possibly contributing to the homogeneity of the product. In addition, postulated that the reduced chain length of amylopectin can reduce the degree of destruction of amylopectin, which has an impact on the quality of the food n the example, it is considered important when karstenii bread.

In addition, it is shown that the structure of starch in the starch serves as a sample, characterized in that the degree of crystallinity is reduced compared to normal starch isolated from barley. When combined with a reduced distribution of the lengths of chains of amylopectin reduced granular crystallinity may indicate that the gelatinization temperature will be lower. Consider also that the reduced crystallinity of the starch is associated with improved organoleptic properties and, as a smaller chain length of amylopectin contributes to a more uniform taste sensation. Thus, the starch may optionally be reduced crystallinity due to the reduced levels of activity of one or more than one enzyme in the synthesis of amylopectin. The proportion of starch exhibiting crystallinity, can be less than about 20%, and preferably less than about 15%.

An additional measure properties of this starch is the measurement of viscosity. When using the Rapid Visco Analyser (rapid viscosity analyzer) found that the peak viscosity of the starch present invention differs significantly from that of normal and waxy starches and vysokomolochnyh starches derived from barley. These measurements were performed on the whole-wheat flour, however, the properties of cu is chmela in these measurements will prevail. Normal and waxy starches have a peak viscosity from about 900 to about 500 units RVA known vysokopilsky starch has a peak viscosity of more than 200, whereas the starch of the barley plants of the present invention has a peak viscosity of less than 100, with the majority less than about 50, in some plants as low as about 10 units RVA. Specialist in the art should understand that the above parameters are empirical units, and these results are intended to indicate the relative characteristics of these starches in the RVA devices or similar devices, such as amylograph.

In addition to reduced crystallinity, explained above, this starch can be characterized by the presence of a V-complex form of starch. The inventors believe that for the first time this form of starch demonstrated in appreciable quantities in starch granules cereal. This form of starch is usually associated with retrograding starch, in particular, if there is contact with the lipids, In the case of the present invention postulated that the structure of the starch gives the possibility of formation of a close relationship between plant lipids and starch, which results in V-complex structure. Believe that this form of starch may have uses the th health because it has low digestibility and, therefore, may contribute to the resistant starch.

Other forms of structure can also be the result of the interaction of lipid-starch and include non-crystalline complexes of lipid-starch. Thus, it is possible to say that the present invention relates to plant barley, showing appreciable quantities of complexes of starch-lipid in starch content of the seed endosperm, which is the result of low activity levels of one or more than one enzyme in the synthesis of amylopectin. Starches, which contain complexes of starch-lipid, including those which exhibit V-complex structure, also usually resistant to enzymatic hydrolysis and, therefore, contribute to the levels of dietary fiber. Preferably the proportion of the crystalline starch, showing the shape of crystallinity characteristic of complex starch-lipid, higher than about 50%, and more preferably higher than about 80%.

Starch, in addition to the availability of the V-complex form of starch, may also not show appreciable quantities And complex forms of starch. The absence of A-complex can be considered as an indicator of the presence of starch in this invention.

It was also discovered that the temperature of pastravanu starch and the product obtained and the grain according to this invention, significantly increased. Temperature pastravanu known starches are less than 70°With, both for normal and for vysokoimpulsnogo starches. The starches of the present invention, however, preferably are temperature pastravanu higher than about 75°or more preferably higher than about 80°C. it Should be noted that these characteristics are empirical and can be considered as belonging to that dimension other starches.

Found that the starch of the barley plants, the employee example, has significant amounts of dietary fiber and resistant starch, preferably this increase is, at least partially, a result of the high relative level of amylose, however, the contribution of dietary fiber may also be the result of complexes of starch/lipid, including a V-complex, or close relations of the amylose or amylopectin with β-glucan. In this way, only high level β-glucans can also make a significant contribution to improving the level of dietary fiber.

Higher relative levels of amylose in the endosperm of barley plants, which exemplifies the most likely are the result of altered production of amylopectin by reducing the level of enzyme activity SSII.

Mo is but to expect that mutations in the gene encoding this enzyme, manifested in a higher content of amylose and/or to reduce the level of amylopectin. In those cases, when the reduced synthesis of amylopectin, starch shows an increased relative level of amylose.

Reduced activity of the enzyme for the synthesis of amylopectin can be achieved in the appropriate mutations within the gene or regulatory sequences of the gene. The extent to which this gene Engibarov, will to some extent determine the characteristics of the resulting starch. Mutations, serving as an example, in the present invention, representing mutations SSII barley, are truncation mutants, and it is known that they have a significant impact on the nature of the starch, however, the modified structure of amylopectin also be the result of a mutant with leaking the original phenotype, which reduces the activity of the enzyme for the synthesis of amylopectin to provide interesting characteristic of starch or grain of barley. Other chromosomal rearrangements can also be effective, and they can include deletions, inversions, duplications or point mutations.

Such mutations can be introduced in the desired genetic backgrounds or by mutagenesis of interesting varieties, but, more reliably, by crossing Mutan is and with the plant of the desired genetic background and conduct the appropriate number of back crosses to displace the source of unwanted parental genetic background. Selection of mutations can be achieved by using a selection of plants subjected to mutagenesis.

As an alternative to conventional ways you can take molecular biological approach. The sequence SSII presented in this description. Vectors carrying the desired mutation and breeding marker can be inserted in the tissue culture plants or suitable plant systems, such as protoplasts. Plants, where the mutation is integrated into the chromosome, replacing the existing wild-type allele, can be subjected to selection using, for example, using an appropriate probe representing a nucleic acid specific for this mutation, and observation of the phenotype. Methods of transformation of monocotyledonous plants, such as barley, and regeneration of plants from protoplasts or immature plant embryos are well known in the art, see, for example, Canadian patent application 2092588 Nehra, Australian patent application No. 61781/94 National Research Council of Canada, Australian patent No. 667939 Japan Tobacco Inc., International patent application PCT/US97/10621 Monsanto Company, US patent 5589617, and other methods described in WO99/14314.

You can also take other known approaches to changes in the activity of the enzyme for the synthesis of amylopectin, other than the use of mutations. For example, this can be done by the expression, where is the yaschih antisense molecules, which prevent transcription or processing of the gene or genes encoding the enzyme for the synthesis of amylopectin. They can be based on the DNA sequence described here for SSII gene of barley. This can be an antisense sequence for the structural genes or sequences that control gene expression or splicing event. In these sequences the links above. How to develop antimicrobic sequences are well known in the art, and examples can be found, for example, in U.S. patent 5190131, EP 0467349 A1, EP 0223399 A1 and in EP 0240208, which is incorporated herein by reference, in the sense that these are the ways of implementation of antisense techniques. Methods of administration and preservation of such sequences in plants also published and known.

Option antisense methodology is the use of ribozymes. Ribozymes are RNA molecules with enzymatic function, which can cleave other RNA molecules at specific sites, specific antisense sequence. The cleavage of RNA blocks expression of the target genes. The link given by EP 0321201 and WO 97/45545.

Other molecular-biological approach can also be used, is compresse. The mechanism of compressie not fully understand the Yong, but it involves introducing into the plant an extra copy of the gene in normal orientation. In some cases, this additional copy of the gene inhibits expression of the target genes of plants. On ways to implement technology compressie reference is made to WO 97/20936 and EP 0465572.

The next method that can be applied using the DNA sequence is a gene suppression mediated duplex or double-RNA. With this method uses DNA that directs the synthesis donateware product RNA. The presence of this double-molecule triggers the response of the defence system of plants, which destroys and Dunaeva RNA, and RNA derived from the gene-target plants, effectively reducing or eliminating the activity of this gene target. On ways to apply this technique, reference is made to Australian patent 99/292514 and WO 99/53050.

It should be understood that the invention is likely the result of lower activity levels of two or more than two of the above genes using molecular biological approach.

One of the important products that can be considered, in particular, as a result of the high content of amylose and high content of β-glucan is a low-calorie product with a low glycemic index. Low-calorie product can betonowe on the inclusion of flour, obtained from the crushed grain. However, it may be desirable to first process the grain into pearl barley, removing, perhaps 10% or 20% mass/mass of the grain, thereby removing the aleurone layer, and at a higher grinding removing the embryo. The effect of the stage of processing of barley into pearl barley consists in the reduction of lipid content and, consequently, in reducing the calorie content of the food product. Such foods will have the effect of saturation, improve the health of the large intestine, reducing serum concentrations of glucose and lipid after a meal, as well as providing low-calorie food product. The use of the product in the form of barley will result in reducing the nutritional value provided by the aleurone layer and the germ. The flour obtained from the product in the form of barley, probably has an improved appearance, since the product obtained in this way has a tendency to white color.

Aspects of this invention also result from a combination of the aleurone layer and germ in combination with high levels of dietary fiber. Specifically, this is the result of a slightly higher relative levels of aleurone or germ present in the grain that serves as an example. First, the barley has a significantly higher aleurone layer than the other commercially available cereals, due to Treklyano the aleurone layer. Secondly, barley grain, which serves as the example, is also unpleasant, which means that the endosperm is present in reduced quantities, the result is that the aleurone layer and the germ are present in higher relative amounts. Thus, the barley has a relatively high level of some useful elements or vitamins in conjunction with the delivery system of resistant starch, and such elements include divalent cations such as bioavailable CA++and vitamins, such as folate, or antioxidants, such as Tocopherols and tocotrienols. Thus, it was found that calcium provides the material for the growth and formation of bones and other soda tissue and reduces the risk of osteoporosis later in life. Found that folic acid has a protective effect against neural tube defects with reasonable use and reduces the risk of cardiovascular disease, thereby exacerbating the effects of a combination of resistant starch and β-glucan. Also consider that folic acid has the effect of reducing the risk of certain cancers. Tocopherol and tocotrienols benefit as antioxidants, and believe that they reduce the risk of cancer and heart disease, and he shall have the effect of reducing the undesirable effects of oxidation of food components, such as fatty acids, which can lead to rancidity. While these components of this preferred form of barley grain or products derived from them, is conveniently placed in one grain. One of the specific forms of the crushed product can be set in such a form, where the aleurone layer is included in this crushed product. Concrete grinding process can be performed so as to increase the number of the aleurone layer in the powdered product. In this way made reference to Fenech et al. ((1999), J. Nutr, 129: 1114-1119). Thus, any product derived from corn, crushed or otherwise processed for inclusion of the aleurone layer and the embryo will have additional nutritional benefits without requiring the addition of these elements from separate sources.

It should be understood that the plant barley according to the present invention preferably is a plant having grain, which is useful for obtaining food and, in particular, for the industrial preparation of food. Such obtaining may include obtaining flour or other product, which can be an ingredient in industrial production of food. A lower level of fitness may be the starch content is higher than about 12%, or possibly higher than about 15%. Or, under the service way it may include the ability to grinding grain; thus, although the barley in barley can be produced from most forms of grain, some configurations of grain particularly resistant to crushing. Another characteristic that may influence the diversity of products industrially applicable grain, is the discoloration produced product. Thus, if the husks, or another part of the grains show significant staining, such as purple, it will be manifest through the entire product and limit its industrial application only to such applications, as a component of bread containing colored solid or crushed grain. Usually it is more convenient to barley plants were non-coated, because the presence of the husk on the grains of barley introduces significant difficulties in the processing of grain. Another aspect that can give the plant barley higher the value, aspect is based on the extraction of starch from the grain, and a higher degree of extraction is more useful. The grain shape is also another characteristic that can affect the industrial suitability of the plant, thus, the grain shape can affect the ease or anything else, through which the grain can be crushed, for example, a grain of barley plants MK is unusual about the Yan elongated morphology of the grains, which makes it difficult grinding and processing. A convenient feature of this oblong form and applicability is the ratio of two morphological characteristics - length of the grain to the thickness (L/T). This attitude is often due to the nature of the starch. The inventors discovered that MK has a ratio L/T is greater than 6. Barley plants subjected to this selection, bearing the mutant gene SSII, have a ratio L/T in the range from about 4 to about 5, although expect that it can be extended even to a larger range, so they were still useful, may be less than about 5.8 or at least a 5.5.

The desired genetic background will include considerations of industrial output and other characteristics. Such characteristics may include whether it would be desirable to have a winter or spring type barley, agronomic characteristics, resistance to diseases and tolerance to abiotic stress. In Australia, it may be desirable to cross with varieties of barley, such as Sloop, Schooner, Chebec, Franklin, Arapiles, Tantangara, Galleon, Gairdner or Picolla. The examples are specific to the Australian industrial district, and for other growing areas may be suitable for other sorts of.

More filled grains may be desirable in achieving higher outputs is some advantages, which can be achieved by this invention, such as the production of starch with high amylose or variant of starch with altered distributions of the lengths of the chains. Other aspects of this invention may, however, be better achieved with the help of grain, which is less than full. Thus, the share of the aleurone layer or embryo in relation to the starch may be higher in less filled with grain, thereby providing barley flour or other product which is more useful parts of the aleurone layer. A product with high aleurone layer may, therefore, have a higher content of some vitamins, such as folate, or higher levels of some minerals such as calcium, and this combined with higher levels of resistant starch and/or higher levels β-glucan can provide synergistic effects, such as providing enhanced absorption of minerals in the colon.

To maximize the amount of amylose, for barley plants may also be desirable to have other phenotypic characteristics in addition to reduced activity of one or more than one enzyme in the synthesis of amylopectin. Genetic background may therefore include additional vysokopilsky phenotype, for example, mutation of amo in AS (the causative gene is unknown) and the waxy mutation (found, for example, in sort Waxiro). Additionally, it may be desirable to obtain double mutations at other available mutants of barley with the wrinkled endospermum, where the causative gene is unknown.

The following aspect of this invention relates to seed obtained from a plant of barley, referring to this description.

It should also be understood that the scope of the present invention is processed grains, including crushed, crushed, crushed, in the form of barley or cereal, or a product obtained from a processed or whole grain barley plants, referenced above, including flour. These products can then be used in various food products, such as bakery products such as bread, cakes, biscuits and the like, or food additives, such as thickeners, or for producing malt barley or other drinks, noodles and instant soups.

Alternatively, the scope of the present invention is a starch selected from corn barley plants, referenced above. Starch can be distinguished using known methods.

It should be understood that one advantage of the present invention is that it offered one or more than one product that has special nutritional value, and, moreover, this is done without the need mo is to officeroute starch or other parts of the grain of barley.

However, it may be desirable to create modified starch, β-glucan or other parts of the grain, and the scope of the invention includes a modified part.

Methods of modification of the well-known and include the extraction of starch or β-glucan, or other component parts of the conventional methods and modified starches to obtain the desired stable form.

Thus, starch or β-glucan can be modified, either once or repeatedly through the use of processing selected from the group including, but not limited to, heating and/or hydration, physical treatment (e.g., crushing, ball mill), enzymatic (using, for example, αor β-amylase, pullulanase or the like), chemical hydrolysis (wet or dry when using liquid or gaseous reagents), oxidation, cross-linking bifunctionality reagents (for example, trimetaphosphate sodium, phosphorus oxychloride) or karboksimetilirovaniya.

Dietary fiber grain barley, employee example, is not solely the result of increased relative content of amylose in the endosperm. One of the main reasons is that β-glucan is present in high levels and makes means the local contribution to the level of dietary fiber. Probably also has protective effects due to binding β-glucan with starch granules, and the strength of this relationship potentially provides a protective effect for starch, in order thereby to ensure sustainability, which can be described as RS1 form, which to some extent inaccessible to enzymatic hydrolysis. In this way the connection starch-lipid, as measured on the basis of the V-complex crystallinity, also likely contributes to the sustainable level of carbohydrate. In this case, the resistance probably occurs due to physical inaccessibility due to the presence of lipid and, accordingly, it can be seen as RS1 starch. Thus, it is known that retrograding starch, which adopt the V-complex configuration, highly resistant to enzymatic hydrolysis, and, accordingly, expect the amylopectin, which forms part of the starch granules having a V-complex crystal structure, will have a high resistance to enzymatic hydrolysis. Thirdly, the starch of the barley plants, the employee example, may be resistant to enzymatic hydrolysis due to the structure of starch granules and, accordingly, may have a RS2 starch.

It should be understood that, although various indications are given as to the aspects of altoadige of the invention, the invention can include combinations of two or more than two aspects of the present invention.

EXAMPLE 1

Prerequisites

The synthesis of starch in the endosperm of higher plants is carried out by a number of enzymes that catalyze the four key stages. First, ADP-glucocerebrosidase activates the Monomeric precursor of starch through the synthesis of ADP-glucose from G-1-P and ATP. Secondly, the activated donor glycosyl, ADP-glucose, is transferred to the end of the non previously existed α-1-4 due to starch synthase. Thirdly, the branching enzymes of starch introduce branching points by splitting section α-1,4-linked glucan with subsequent transfer of the split chain acceptor chain with the formation of a new α-1,6 linkages. Finally, genetic studies show that enzymes removal of branching chains of starch is essential for the synthesis of normal quantities of starch in higher plants, however, the mechanism by which enzymes remove branching circuit, not solved (Myers et at., 2000).

Although it is clear that at least these four activity is required for normal synthesis of starch granules in higher plants, the endosperm of higher plants has multiple isoforms of each of these four activities, and for the individual who's isoforms suggested specific roles on the basis of mutational analysis (Wang et al., 1998, Buleon et al., 1998) or by modifying the levels of gene expression using transgenic approaches (Abel et al., 1996, Jobling et al., 1999, Scwall et al., 2000). However, the precise contributions of each of the isoforms of each activity in the biosynthesis of starch is still unknown, and unknown, are there much these contributions between species. In the endosperm of cereals there are two isoforms of ADP-glucocerebrosidase, one form inside amyloplast and one form in the cytoplasm (Denyer et al., 1996, Thorbjornsen et al., 1996). Each form consists of two types of subunits. Mutant shrunken (sh2) and brittle (bt2) corn mean damage in the large and small subunits, respectively (Girouz and Hannah, 1994). In the endosperm of cereals found four classes of starch synthase, isoform exclusively localized within starch granules, granulomatosa starch synthase (GBSS, granule-bounded starch synthase), two forms, which are distributed between the pellet and the soluble fraction (SSI, Li et al., 1999a, SSII, Li et al., 1999b) and the fourth form, which is completely localized in the soluble fraction, SSIII (Cao et al., 2000, Li et al., 1999b; Li et al., 2000). It is shown that GBSS essential for the synthesis of amylose (Shure et al., 1983), and it was shown that mutations in SSII and SSIII change the structure of amylopectin (Gao et al., 1998, Craig et al., 1998). Mutations that define the role of activity SSI, are not described.

In the endosperm of cereals expressed three forms of razorblades enzyme, Razorblade enzyme I (BEI, branching enzyme I), Razorblade enzyme IIa (BEIIa) and Razorblade enzyme IIb (BEIIb) (Hedman and Boyer, 1982, Boyer and Preiss, 1978, Mizuno et al., 1992, Sun et al., 1997). It is shown that in maize and rice vysokomolochnye phenotypes are the result of damage in BEIIb gene (Boyer and Preiss, 1981, Mizuno et al., 1993). In these mutants, the amylose content was significantly increased, and the frequency of branching residual reduced amylopectin. In addition, there is a significant pool of a substance is defined as "intermediate" between aminosol and amylopectin (Boyer et al., 1980, Takeda et al., 1993). Mutations that define the role of BEIIa and BEI, still need to describe, despite the fact that the potato negative regulation of one BEI has minimal impact on the structure of starch (Filpse et al., 1996). However, the potato combination of negative regulation BEII and BEI gives a much higher content of amylose than negative regulation of one BEII (Schwall et al., 2000). Two types of enzymes that removes the branching of the chain, are present in higher plants and is defined on the basis of their substrate specificity, the enzyme that removes the branching circuit of the type isoamylase and enzymes that removes the branching circuit of the type pullulanase (Myers et al., 2000). Mutations Sugary-1 in maize and rice are associated with failure of both enzymes, removes the branching circuit (James et al., 1995, Kubo et al., 1999), however, the causal mutation mapped to the W the localization as the gene of the enzyme that removes the branching circuit of the type isoamylase. The mutant Chlamydomonas sta-7 (Mouille et al., 1996), similar mutations sugary-1 corn, has negative regulation of one isoamylase activity.

Known variations of the structure of the starch of the barley is limited compared to the variation available in maize. The most highly characterized mutations are waxy and vysokozaraznoy mutation, identified as AS. Double mutants constructed and analyzed (Schondelmaier et al., 1992, Fujita et al., 1999). Report on a wide range of variation in structure and properties of starch (Czuchajowska et al., 1992; Schondelmaier et al., 1992; Vasanthan and Bhatty, 1995; Morrison et al., 1984; Gerring and DeHaas, 1974; Bankes et al., 1971; Persson and Christerson, 1997; Vasanthan and Bhatty, 1998; Czuchajowska et al., 1998; Song and Jane, 2000; Andreev et al., 1999; Yoshimoto et al., 2000), as well as the properties of the grain (Swantson, 1992, Ahokas, 1979; Oscarsson et al., 1997; Oscarsson et al., 1998; Andersson et al., 1999; Elfverson et al., 1999; Bhatty, 1999; Zheng et al., 2000; Izydorczyk et al., 2000; Andersson et al., 2000), and investigated the usefulness of these mutants in experiments in animal feeding (Xue et al., 1996; Newman et al., 1978; Calvert et al., 1976; Wilson et al., 1975; Sundberg et al., 1998; Bergh et al., 1999), food of man (Swantson et al., 1995; Fastnaught et al., 1996; Persson et al., 1996; Pomeranz et al., 1972) and human nutrition (Pomeranz 1992; Granfeldt et al., 1994; Oscarsson et al., 1996; Akerberg et al., 1998).

In the present example, the inventors have identified a new class vysokoimpulsnogo mutant of barley. These meters is tantie line have the amylose content (65-70%), higher than known from well-characterized mutant High Amylose Glacier (AC38) (45-48%) (Walker et al., 1968), and have a starch with the structure of amylopectin, in which there is an increase in the frequency of branching of the starch, which is opposite to the reduced frequency of the ramifications associated with mutant amylose extender in maize (Takeda et al., 1993).

Characteristics of grain and starch of the present mutant explored and mapped the causative mutation. Selected mutations alleline previously known mutations shrunken in barley sex6, and it is shown that the causal mutation is localized within a gene starch synthase II. The effects of this mutation shed new light on the biosynthesis of starch and illustrate how mutations in specific genes can have different effects on the structure of starch from species to species.

Materials and methods

Mutagenesis and selection

Grade non-coated barley "Himalaya" was subjected to mutagenesis using sodium azide, according Zwar and Chandler (1995). Selection of variants with altered morphology of grain were conducted according to Green et al. (1997). Identified and supported a total of 75 lines with phenotypes wrinkled endosperm according to Green et al. (1997).

Selection of starch

Starch was isolated from barley grain, using the method Schulman et al. (1991).

Methods for the determination of amylose

Defining relationships amylose/amylopectin by the method of HPLC for the separation of starch is unbranched chains and the method of binding of iodine carried out, as described Batey and Curtin (1996). Analysis of the relationship amylose/amylopectin by analysis of starches branched chain were conducted according to Case et al. (1998).

Measurement of starch content

Starch was determined using a test kit total starch supplied by Megazyme (Bray, Co Wicklow, Republic of Ireland).

The protein content

Nitrogen was determined by the method of Kjeldal, and the protein content was calculated using a factor of 5.7.

Levels β-glucan

β-Glucan was determined using a kit supplied by Megazyme (Bray, Co Wicklow, Republic of Ireland).

The distribution of lengths of chains of starch

Starches were subjected to removal of branching chains, and distribution of the lengths of the chains were analyzed using electrophoresis of carbohydrates using fluorophore (FACE, fluorophore assisted carbohydrate electrophoresis)using capillary electrophoresis according to Morell et al. (1998).

DSC

The gelatinization was measured in a differential scanning calorimeter Pyris 1 (Perkin Elmer, Norwalk CT, USA). Starch was mixed with water at a ratio of 2 parts water: 1 part of starch, and the mixture (40-50 mg, accurately weighed) were placed in a stainless steel bowl and tightly closed. The sample was scanned at 10°within minutes from 20°to 140°With an empty bowl stainless steel as a comparison. The gelatinization temperature and enthalpy were determined using the software Pyris.

RVA analysis

In scost measured on Rapid-Visco-Analyser (RVA, Newport Scientific Pty Ltd, Warriewood, Sydney), using conditions as described by Batey et al., 1997, for wholemeal flour. To inhibit α-amylase, in all analyses included the silver nitrate at a concentration of 12 mm. The measured parameters were peak viscosity (highest viscosity, hot paste), strength retention, the final viscosity and temperature pastravanu. In addition, the calculated decomposition (peak viscosity minus strength retention) and delay (final viscosity minus strength retention).

Swelling of the flour

The amount of swelling of the flour was determined according to the method Konik-Rose et al. (2001).

X-ray data analysis

Data of x-ray diffraction were collected using standard methods (Buleon et al., 1998).

Scanning electron microscopy

Scanning electron microscopy was carried out on the equipment Joel JSM 35C. Refined starches were covered with a spray of gold and scanned at 15 kV at room temperature.

Obtaining a doubled haploid

Double haploids were obtained from F1 plants originating from crosses between 292 and Hordeum vulgare cv Tantangara and between 342 and .vulgare cv Tantangara Dr. P.Davies, Waite Institute, Adelaide, Australia.

Analysis of clutch

Data genetic clutch was calculated using MapManager.

Construction of cDNA library barley

Five mg of poly a+mRNA from the tissue of the endosperm of barley on 10, 12 and 15 days after the poll is tion was used for cDNA synthesis according to the protocols (Life Technology). For the synthesis of the first cDNA strands used primer Notl-(dT) 18 (Pharmacia Biotech). Denitive cDNA ligated with adapter Sa/I-XhoI (Stratagene) and cloned to the shoulders Sa/I-NotI ZipLox (Life Technology) after enzymatic hydrolysis cDNA using NotI, followed by fractionation by size (column SizeStep 400 spun from Pharmacia Biotech). Legirovannye cDNA was packaged with the packaging extract (Gigapack III Gold (Stratagene). The titer of the library, tested strain of E. coli Y1090(ZL), was 2×106boe (plaque-forming units).

Cloning specific areas cDNA starch synthase II barley using PCR

The cDNA clone wSSIIp1 used for screening the cDNA library of barley. This cDNA clone wSSIIp1 received by PCR using primers ssIIa (TGTTGAGGTTCCATGGCACGTTC SEQ ID NO 9) and ssIIb (AGTCGTTCTGCCGTATGATGTCG SEQ ID NO 10), amplificare the area between the provisions of nucleotides 1435 1835 and wSSIIA (GenBank catalog number AF 155217).

Amplification was performed using thermosequenase FTS-1 (Corbett, Australia) for 1 cycle at 95°With 2 minutes; 35 cycles at 95°for 30 seconds, at 60°With 1 minute at 72°With 2 minutes, and 1 cycle at 25°C for 1 minute. Fragment wSSIIp1 cloned in the vector pGEM-T (Promega).

Screening of the cDNA library barley

Screening of a cDNA library constructed from RNA from endosperm of barley cv Himalaya, conducted by the cDNA fragment 347 P.N., wSSIIp1, under such conditions of hybridiza the AI, described previously (Rahman et al., 1998). Hybridization was performed in 50% formamide, 6x SSPE, 0.5% of LTOs, 5x denhardt's solution and 1.7 μg/ml DNA salmon sperm at 42°C for 16 h, then washed 3x 2x SSC containing 0.1% LTOs, at 65°C for 1 hour for washing.

Screening of the genomic library barley

Genomic library barley (barley cv Morex) was designed and subjected to screening essentially as described in after Gubler et al (2000), using SSII cDNA barley as a probe.

Sequencing of genomic clones

SSII gene Morex was subcloned into the plasmid vector and sequenced. Genes 292 and MC sequenced using PCR amplification of overlapping sites of this gene, using primers designed based on sequence Morex. The PCR fragments either sequenced directly or subclinically and sequenced from plasmid.

Identification of expressed plots

Regions of genomic sequences 292 and MC, presumably present in the cDNA, determined in comparison with the cDNA sequence of Himalaya and genomic sequence Morex.

PCR analysis of the mutation G to a in the gene SSII

Designed PCR primers that amplified the area containing the transition G to A, identified in 292. Sequences of the primers are: ZLSS2P4 (CCTGGAACACTTCAGACTGTACG SEQ ID NO 11) and ZLBSSII5 (CTTCAGGGAGAAGTTGGTGTAGC SEQ ID O 12). Amplification was performed using thermosequenase FTS-1 (Corbett, Australia) for 1 cycle at 95°C for 2 minutes; 35 cycles at 95°for 30 seconds, at 60°With 1 minute at 72°With 2 minutes, and 1 cycle at 25°C for 1 minute.

Analysis of the proteins of the endosperm of barley in LTO-PAG electrophoresis

The starch obtained from the developing and Mature endosperm of barley and wheat, and surface proteins were removed with proteinase K as described (Rahman et al., 1995). Proteins starch granules were extracted from 20 mg of starch (dry weight), using 0.5 ml of extracting buffer containing 50 mm Tris pH 6.8, 10% LTOs and 10% 2-mercaptoethanol. After gelatinization by boiling for 10 min and collect the starch by centrifugation 15 microliters supernatant was applied on each track.

Obtaining a doubled haploid

Double haploids were obtained from F1 plants originating from crosses between 292 and Hordeum vulgare cv Tantangara and between 342 and .vulgare cv Tantangara Dr. P.Davies, Waite Institute, Adelaide, Australia.

The reverse strategy of crosses

Conducted a cross between 292 and Hordeum vutgare cv Sloop for obtaining seed F1. Plants grown from seed F1 were subjected to self-pollination with obtaining populations of seed F2. Plants grown from this seed F2 were tested using PCR analysis, and plants homozygous p is the mutation 292, was subjected to reverse the crossing with Sloop (BC1). The F1 plants resulting from BC1, again tested by PCR, and plants heterozygous for the mutation 292, were selected and subjected to reverse the crossing with Sloop (BC2). The F1 plants resulting from BC2 again analyzed by PCR and selected plants, heterozygous for the mutation 292. These plants were either subjected to self-pollination with getting the BC2F2 population, or again crossed with Sloop (BC3). The F1 plants resulting from BC3, again analyzed by PCR and selected plants, heterozygous for the mutation 292. These plants were pollinated with getting the BC3F2 population. Plants grown from this seed, were tested using PCR, and plants homozygous for the mutation 292, was selected to receive one seed generation and seed multiplication.

Results

Selection of mutants

About the identification of several mutants in barley varieties "Himalaya" without husk or non-coated seeds induced by treatment with sodium azide, previously reported Zwar and Chandler (1995). A group of 75 mutants with shrunken grain identified by the inventors, and amylose the starch content of this wrinkled seed was determined using HPLC (Figure 1). It was found that two lines 292 and 342, had a content of amylose 71 and 62.5%, respectively (Table. 1). The content of amylose 292 and 342 which was significantly higher than line AS previously well characterized (47% amylose, see Table. 1). This study has identified the genetic basis of the new vysokoimpulsnogo phenotype, manifested 292 and 342, and described the causal impact of mutations on the structure and functionality of grain and starch.

Characteristics of grain

The size and morphology of grains

The marked influence of mutations on the mass and morphology of the grains (PL. 2). Grain weight was reduced from 51 mg for parent lines Himalaya up to 32 mg for 292 and 35 mg for 342. These mutants survived length and width as in wild type, but in comparison grains are flattened (2,82 mm average thickness of the Himalaya 1.58 and 1.75 mm at 292 and 342, respectively) and are essentially blank Central area. Figure 2 shows pictures of the grain of the mutant and wild type. The grain size was measured in a traditional way, the length of the grain (L), the width of the grain at the widest point (W) and thickness (T), as shown in figure 2. The ratio of the length (L) to thickness (T) is a useful diagnostic sign for this mutation, when values of >3,5, typically detected for seed bearing mutations 292 or 342, and the values of <a 3.5 for namutoni barley plants.

Composition of grain:

The starch content of mutant lines is reduced from 49,0% for Himalaya to 17.7 and 21.9% for the 292 and 342, respectively (see Tab. 1). Subtract the weight of the starch from the total mass of grain to obtain summary the th non-starch content of the grain showed the loss of starch content is due to the loss of weight of grain at masses of non-starch content 26,0, and 26,3 27,3 mg Himalaya, 292 and 342, respectively.

Protein 292 and 342 is raised relative to the parental line Himalaya (Table. 1), however, this effect takes place due to the loss of starch from grain and is not associated with any increase in protein synthesis in the caryopsis.

Levels β-glucan mutants 292 and 342 also increased and are higher than would be expected as a result of reduction of starch content (Table. 1). In both cases, the content β-glucan increased by approximately 20% on the weevil, which probably represents the switching of a small part of the incoming carbon from the synthesis of starch synthesis β-glucan.

The composition and functionality of starch

The content of amylose and amylopectin

The amylose content was determined using two methods, first, the pressure on the size of HPLC in 90% (V/V) DMSO and, secondly, metric blue color with iodine. The amylose content determined by each method were similar, and HPLC data are presented in Table. 1.

On the basis of data on grain mass and the content of amylose for mutant lines wild-type, you can calculate the number of reserved amylose grain. This analysis shows that there is a reduction in the number of amyl is PS for grain from 6.2 mg/weevil from Himalaya to 4.0 mg/weevil at 292 and 4.8 mg/weevil at 342. On the contrary, there is a sharp decrease in the synthesis of amylopectin on the weevil from 18.7 mg from Himalaya to 1.6 mg at 292 and 2.9 mg at 342.

The distribution of chain lengths

The distribution of the lengths of chains of starch after removal of the branching circuit isoamylase was performed using electrophoresis of carbohydrates using fluorophore (FACE). The distribution of lengths of chain mutants 292 and 342 and Himalaya shown in Figa. On Figb shows a graph of the difference, which is the normalized distribution of the lengths of chains for mutants 292 and 342 is subtracted from the normalized distribution of the Himalaya. The percent of the lengths of chains of DP 6-11, DP 12-30 and DP 31-65 calculated and presented in Table. 3. There was a noticeable shift in the distribution of the lengths of chains of mutant 292 and 342, such that the plot of DP 6-11 percentage circuits higher in comparison with DP 12-30.

Differential scanning calorimetry

The gelatinization temperature of the specimens was investigated using differential scanning calorimetry, and the data are presented in Table. 4. As 292 and 342 provide starches, which have significantly lower gelatinization temperature than starches Himalaya, in relation to the initial, peak and end temperatures for peak gelatinization. Enthalpy peak gelatinization for mutants 292 and 342 also dramatically reduced compared to wild type. The initial temperature peak amylose/lipid was also reduced for the mutant 292 and 342, however, the enthalpy increases is on, which corresponds to a higher content of amylose mutants.

The viscosity of the starch RVA

RVA-analysis of samples of wholemeal barley flour conducted to explore their viscosity pastravanu. Previous studies have shown that the analysis of samples of wholemeal flour has a strong correlation with the analysis of isolated starches (Batey et al., 1997). This analysis showed that there are large differences between the investigated genotypes of barley (see table. 5 and figure 4). Two varieties of barley starch-containing wild-type, Himalaya and Namoi, showed a typical RVA profiles that were observed protruding peak viscosity with decreasing viscosity to the power of retention, with the consequent increase in viscosity with decreasing temperature to a final viscosity. As usually observed for starch barley, final viscosity for starch wild type were equivalent peak viscosities or below them (PL. 5). HAS received an outstanding peak viscosity, however, due to the high content of amylose in this line the final viscosity was higher than the maximum viscosity. However, at 292, 342 and MK got a very different profile. Other barley starches were received significant initial increase in viscosity, the corresponding peak viscosity, and therefore, it was impossible to calculate any metric destruction. Values for the peak is the viscosity, the data in the Table. 5 for 292, 342 and MC, represented viscosity registered at the time of peak viscosity for Himalaya. At 292, 342 and MC viscosity increased throughout the analysis with the final viscosity comparable to other samples of wholemeal flour. When normalization based on the content of starch starches 292 and 342 had a very high final viscosity (see Table. 5).

The amount of swelling is a method of measuring properties of flour and starch, which examine the behavior of this material under the influence of heat and excess water. The increased absorption of water is measured by weighing the sample before mixing and after mixing of the sample with water at certain temperatures and subsequent collection gelatinizing material. This analysis showed that the control samples, Himalaya and Tantangara, swell 6-8 times their dry weight, on the contrary, 292 and 342 swell only to 2-3 times their dry weight (Table. 9).

The crystallinity

The structure of the starches further investigated using x-ray crystallography (see Table. 6 and Figure 5). Himalaya showed the expected pattern for starch grains having predominantly the crystallinity "And" type, and as AS and Waxiro showed a very similar pattern of x-ray diffraction, although the levels of crystallinity were lower for AS and enter the for Waxiro. For mutants 292 and 342 picture of the x-ray diffraction was shifted to a mixture of V and paintings. In addition to the shift pattern of diffraction, the amount of crystallinity was sharply reduced in mutants 292 and 342 to 9 and 12%, respectively. This result corresponds to the low content of amylopectin starches 292 and 342.

The morphology of the granules

The morphology of starch granules was investigated using scanning electron microscopy (6). The size and shape of the granules of the Himalaya (6, panel a), waxy barley (Waxiro, 6, panel b) and AS (6, panel C) was consistent with previously published observations of starch granules from normal lines of barley. The morphology of starch granules "And" type in the mutant lines 292 (6, panel d), 342 (6, panel d) and MC (6, panel e) clearly changed, as granules have a curved surface compared to the smooth lenticular shape of the pellets normal barley.

Dietary fiber

The analysis of dietary fiber was carried out according to the method of AOAC and showed that increasing dietary fiber was observed in the 292 and 342, and that this increase dietary fiber was likely due to the increase in insoluble dietary fiber than soluble dietary fiber (Table. 1), in accordance with the components of dietary fiber, which are resistant starch and β-Lucan. It should be noted that this measure of dietary fiber is chemically-defined measure, which is completely different from the physiological measures that are relevant from the point of view of power.

Genetic basis of mutations

Segregation ratio

Crossing mutation varieties of barley, not exhibiting the phenotype wrinkled endosperm 292 or 342, showed that this mutation is a recessive mutation straight direction, showing the ratio of 3 normal: 1 wrinkled seed F2 populations of outcrossing and 1 normal: 1 wrinkled seed double haploid populations that developed after one of outcrossing (see Tab. 6). Normal seed is defined as a seed with the ratio L/T<3,5, wrinkled seed is defined as a seed with the ratio L/T>3,5.

Allelic nature mutants

Through an analysis of progeny from crosses 292 and 342 have shown that mutations 292 and 342 are allelic. The whole seed F1, originating from reciprocal crosses showed phenotypes grain weight and grain morphology within the range of sizes and shapes observed for the parental lines 292 and 342 and outside the range of the size and shape of the seed, found for the parental line Himalaya. In addition, all seed F2, originating from F1 plants h, showed the typical phenotype wrinkled seed mutants 292 is 342.

Analysis of the morphology of the grain and starch characteristics of a series of mutants with shrunken grain, available from Barley Germplasm Collection (USDA-ARS, National Small Grains Germplasm Research Facility, Aberdeen, Idaho 83210, USA), allowed to assume that the line MC (BGS31, also called GSHO 2476)carrying the mutation sex6, showed many of the characteristics of grain and starch, highly similar mutations 292 and 342. Spent a cross between 292 and MC, and all the grain F1 showed the typical phenotype 292 in relation to the phenotype of the weight of grain and wrinkled seed. The whole seed F2, originating from F1 plants 292×MC, showed the wrinkled phenotype of the endosperm with the ratio L/T>4. In contrast, the seeds of F2 from a cross between 292 and a commercially available barley Sloop gave a bimodal distribution, indicating the ratio of the segregation of 3:1 between shrunken and filled with seed (PL. 6). The whole seed F1, originating from crosses 292 and 5 other lines with phenotypes wrinkled endosperm (BGS 380, shrunken endosperm 4, 7HL (Jarvi et al., 1975); BGS 381, shrunken endosperm 5, 7HS (Jarvi et al, 1975); BGS 382, sex 1, 6HL (Eslick and Ries, 1976); BGS 396, shrunken endosperm 6, 3HL (Ramage and Eslick, 1975); BGS 397, shrunken endosperm 7, not mapped (Ramage and Eslick, 1975), gave the grain morphology is filled with seed. On this basis mutations 292, 342 and MK believe allelic, and on the basis of earlier published locations on the map for lo the USA sex6 mutations 292 and 342 likely predicted on the map to the short arm of chromosome 7H barley approximately 4 cm from centromere (Netsvetaev, 1990, Netsvetaev and Krestinkov, 1993, Biyashev et al., 1986, Netsvetaev, 1992).

Analysis of clutch

From a cross between 292 and a commercially available varieties of malting barley, Tantangara, got a double haploid population, which contained 90 lines of descendants (PL. 8).

These lines were evaluated for morphology seed (filled against the wrinkled seed), the distribution of the lengths of the chains by FACE (the percentage of chains with DP 6-11), the seed's shell (non-coated or covered with husk) and PCR marker (see below). These data are presented in Table. 8. In this population characteristic wrinkled seed and FACE-distribution 292 accurately cosegregates, as you might expect, if you changed the size and shape of the grains was due to altered deposition of starch. Cosegregated signs illustrated in Fig. Panel a shows the relationship between the length of the chain of starch (illustrated on the basis of the percentage of circuits between DP 6-11) and the ratio of length to thickness. Empty circles show the lines that have a PCR marker for mutation 292, shown by crosses lines that are PCR-marker of the wild type. There is a clear definition between the two groups of lines. Panel B Fig shows the relationship between the length of the chain of starch and seed mass, and it is shown that seed mass is less diagnostic for this mutation than the ratio of length to thickness.

In barley, the presence of the s or the lack of husk controls the nud locus, localized on chromosome 7H, and because Tantangara is a barley covered by the husk, and 292 is a non-coated type, this characteristic can be assessed in a double-haploid progeny. Analysis of the coupling between the sign of the non-coated/covered with husk and FACE data showed that this mutation breeding 292 mapped within 16,3 cm from the nud locus. This localization coincides with previous data mapping for allelic mutations sex6 (Netsvetaev, 1990, Netsvetaev and Krestinkov, 1993, Biyashev et al., 1986, Netsvetaev, 1992).

Identification of the causal gene

Demonstrated that the nud gene localized on barley chromosome 7H (Fig, Fedak et al., 1972). The three wheat starch synthase (GBSS, SSI and SSII) and the enzyme type isoamylase that removes the branching circuit (S.Rahman, personal communication), localized on the short arm of chromosome 7, homologous chromosomes (Yamamori and Endo, 1996, Li et al., 1999a, Li et al., 1999b; Li et al., 2000). Close grip with the nud locus suggests that the most likely gene is a candidate gene is SSII. SSII gene of wheat cloned the cDNA level (Li et al., 1999b; Genbank catalog number AF155217) and on genomic level (Li et al., personal communication), and barley cDNA was isolated and cloned (Fig.9). Sequencing of the genomic sequences SSII barley and wheat showed that these genes have very similar exon/intron structures, however, the length of the intron Uch the rates vary between sequences (Figure 10). Comparison of the genomic sequence of Morex and cDNA sequence of the Himalaya (Figure 9) leads to the identification of derived cDNA sequences from Morex, 292 and MC.

Mutant of transitions G And detected in the gene SSII from 292 in the position that corresponds 1829 alignment shown figure 11. This mutation introduces a stop codon in the open reading frame SSII 292 (Fig). The analysis of sequences of Tantangara and Himalaya showed that both wild-type gene is identical in this area, and as the 292 and 342 contain the same mutation transition G on A. Put a stop codon should shorten the product of this gene so that the full-size C-terminal catalytic domain of the gene starch synthase II will not be broadcast, and therefore, there is a high probability that the SSII activity completely stopped this mutation.

The transition G And was also present in MK in position 242 of the alignment shown in 11, and sequence cDNA Himalaya figure 9. This mutation introduces a stop codon in the open reading frame SSII 292 (Fig) and is intended to prevent the broadcast of more than 90% of the SSII gene, stopping the SSII activity encoded by homeobox gene.

Mutation of transitions G And 292 interrupted restriction site (NIaIV) in SSII gene of barley. The localization of this diagnostic site NIalV shown in Fig, panels (a) and (b). On FIGU shown electr which the gel agarose gel of the products of enzymatic hydrolysis NIalV from barley, showing that the diagnostic pattern for the 292 mutation is located in the 292 and 342, but not in MK, Himalaya or Tantangara.

PCR marker for the transitions G And was evaluated in 90 lines of double haploid populations 292×Tantangara and found that it accurately cosegregated with phenotypes wrinkled seed and distribution of the lengths of the chains on the FACE, indicating that the mutation 292 fully linked with the phenotype of starch, and that there is a high probability that this mutation is causal mutation underlying the phenotype 292. On Figg shows the analysis of lines from a double haploid population of 292×Tantangara.

Biochemical evidence of loss of activity SSII

The composition of the enzymes of starch biosynthesis in the mutant and normal lines of barley were investigated using a number of techniques gel electrophoresis. Analysis of the soluble fraction of the developing endosperm showed that all lines contained BEI, BEIIa, BEIIb, SSI and SSIII, and that the contents of these isoforms BE and SS, respectively, were essentially not changed. However, analysis of starch granules showed that several bands were absent. First, the analysis by electrophoresis in LTO-page (Fig, panel B) showed that the band 90 KD, which was present in the Himalaya, Tantangara and AS was absent at 292, 342 or MC. Using Western blot turns, it was shown that this strip contains SSII (Fig, panel B, and BEIa and BEIIb. The discovery of the fact that BEIIa and BEIIb present in the soluble fraction, but not in starch granule, indicates that mutants 292, 342 and MC likely there is a change in the distribution of these enzymes than mutation, which terminates the expression. On the contrary, did not reveal any evidence of SSII expression either in soluble or granular fraction (Fig, panels a and B), which coincides with the genetic evidence of the direct clutch mutations SSII with the observed phenotypes in 292, 342 and MC.

Breeding lines carrying the mutation 292

To transfer the 292 mutation in alternative genotypes of barley used two strategies.

In the first example got a double haploid lines from a cross between 292 and Tantangara. Data for seed coating, seed mass, the relationship L:T, the distribution of the lengths of the chains and the status of DNA-marker SSII are presented in Table. 8. A more complete analysis of the composition of these lines are presented in Table. 9, including the RVA analysis, content β-glucan and the amount of swelling of the flour. These data show that the lines carrying the mutation 292, have significantly different RVA parameters (an example of which is the ratio of the peak/final viscosity), a higher content β-glucan and changed the volume swelling flour.

In the second example, the mutation carried by the two return crossings from 292 grade, have the normal properties of starch (cv Sloop). For the analysis of collected seed material F2 from three F1 plants back-crossing 2. This seed F2 divided into categories of seeds with respect to LT>3.5, and with respect to LT<a 3.5. Seed distribution between these classes corresponded to expectations for a single recessive gene. Data on the volume of swelling flour for these categories of seeds obtained from each plant, presented in Figure 10 and show that the sign of swelling of the starch is clearly tolerated by the process of crossing in line with the average content of the genetic background of the Sloop 75%.

Discussion

The inventors describe the allocation of new mutants, 292 and 342, in barley, which have a phenotype wrinkled endosperm. Analysis of the composition of the grain shows that wrinkled phenotype is a consequence of the significant reduction in starch content and composition analysis of starch shows that this decline is manifested in the form vysokoimpulsnogo phenotype, which is the result of a decrease in the synthesis of amylopectin.

Mutants 292 and 342 have a unique combination of properties of grain and starch content as elevated levels β-glucan and resistant starch. Levels β-glucan these lines increased by approximately 15% above the level expected due to the effect of low starch content, suggesting that coal is the genus, unable to turn into starch, switches on the synthesis of β-glucan. Definitions of levels of dietary fiber show that the grain from the mutant has elevated levels of dietary fiber, and that this increase is a consequence of the increase of insoluble dietary fiber.

This combination of properties indicates that these mutants may have very interesting potential as components of the diet of the person. First, elevated levels β-glucan assume that these lines can be useful in reducing cholesterol through a well-established action β-glucan in reducing cholesterol levels. Secondly, the presence of resistant starch indicates that these lines can be useful due to the prospects of intestinal health due to its well established ability of resistant starches can promote fermentation in the colon (Topping et al., 1997, Topping, 1999). Thirdly, the composition of the grains indicates that these lines will have low energy density and that they can slowly be subjected to enzymatic hydrolysis, indicating that they may contribute to the production of foods with a low glycemic index.

Properties of starch lines that serve as the example, are unique in that they combine vysokopilsky starch, which also has a low temperature of gelatinization. This contradicts vysokoodarennym mutations resulting from mutations in ResetSystem chain of the enzyme IIb in which the gelatinization temperature typically increases, as for example by mutation amylose extender in maize (Ng et at., 1997, Katz et al., 1993, Krueger et al., 1987, Fuwa et al., 1999). Although the content of amylose 292 comparable with lines amylose extender, structure amylopectin component of starch differs sharply (Wang et al., 1993). The 292 and 342 of the distribution of lengths of chains of amylopectin is shifted towards a lower degree of polymerization, whereas the amylose extender distribution of the lengths of the chains is shifted in the direction of high degree of polymerization. This suggests that the amylopectin, and not the content of amylose, is a primary determinant of the temperature of gelatinization, and that this effect is mediated by force of interaction between the outer chains of amylopectin molecules. Similar effects were noted for a number of starches Jane et al., 1999.

Data on viscosity based on the RVA analysis indicate that starch mutant in SSII lines is markedly different from normal barley and AS. Mutants of barley for SSII essentially have no peak viscosity, typically observed with a sharp rise in temperature to 95°at the beginning of the RVA-temperature profile. Instead, these mutants viscosity on asaeda monotonically to the final viscosity, if it is available. These data are in accordance with the low content of amylopectin granules, low amylopectinosis crystallinity in grains and low temperature and enthalpy of gelatinization observed in the differential scanning calorimeter. High final viscosity is reached as soon as amylase released from the granules by heating in excess water and mixing. These RVA features are unique to the starch of cereals and provide a new source of starch for food and industrial applications where low viscosity pastravanu and still high final viscosity.

Observations on the temperature of gelatinization in DSK, reflected in the results of studies of x-ray diffraction. Granules 292 and 342 have lower levels of crystallinity and shifts crystalline form type And typical starches cereals, to a mixture of types V and C. Type V typical amylose and reflects amelody component of starch that forms a complex with fatty acids, whereas the form is the origin of amylopectin and mainly reflects the content of residual amylopectin starch (Buleon et al., 1998).

Analysis of the genetic basis of mutations 292 and 342 demonstrates that these mutations represent a simple recessive Mut is tion, which give typical Mendelian ratio in experiments on outcrossing. Research crosses showed that the 292 and 342 are allelic. Further analysis of the interaction between 292 and other mutations wrinkled endosperm in experiments on crossing demonstrated that mutations 292/342 are allelic with mutations Sex6 in line MK. This mutation mapped previously, and shown that it is localized within 3 cm from centromere short arm of chromosome 7H (Netsvetaev, 1990, Netsvetaev and Krestinkov, 1993, Biyashev et al., 1986, Netsvetaev, 1992).

Was created with a double haploid population of between-covered husk barley Tantangara and non-coated mutant 292, and mutation wrinkled endosperm mapped on the short arm of chromosome 7HS within 16 cm from the nud gene localization coincides with the localization on the map mutations Sex6.

Localization of the gene in the site, adjacent to centromere, on the short arm of chromosome 7HS shows that the causal mutation (sex6) is a gene that is different from the mutation that causes vysokopilsky phenotype in AS (amo 1), which is mapped on chromosome 1H (Schondelmeier et al., 1992). This localization on the map suggest that one of the candidates for the gene interrupted by mutation sex6/292, is a starch synthase II, about which it is known that wheat is localized in the same segment of a chromosome (Yamamori and Endo, 1996, Li et a., 1999b). Sequence analysis of the mutants 292 and 342 showed that this gene was the mutation transition G to a, which could cause the shortening of this gene, so that the C-terminal section containing the active site of the enzyme should not be broadcast, which mainly leads to the synthesis of a completely inactive protein. In addition, sequencing of the gene SSII from MC showed the mutation transition G to a at position 242, which also was expected to cause shortening of the gene. This result confirms the allelic nature of mutations 292 and MC.

Identification of mutations in the gene SSII has led to the development of PCR-marker diagnostic for mutations in 292. This PCR marker was evaluated through 91 descendant populations 292×Tantangara, and it is shown that it is 100% cosegregated with wrinkled phenotype endosperm phenotype of reduced length distribution of starch chains. Detection of allelic mutations in the genes SSII from styes different genetic backgrounds (292 and MC)that cause similar phenotypes, and exact coupling of this mutation with the phenotype wrinkled grain gives high confidence that these mutations are present in SSII genes 292, 342 and MK are causal mutations, leading to the characteristic wrinkled endosperm.

The phenotype observed here for mutations SSII in barley, in some respects similar to the phenotypes of mutations SSII among others the other plants, however, mutations SSII not cause such a high content of amylose, as the mutations found in 292/342. Mutations SSII known in pea (rug5, Craig et al., 1998) and Chlamydomonas (Fontaine et al., 1993) and lead to amylopectin with reduced distributions of the lengths of the chains, as observed here. There is also evidence to suggest that the mutation Shrunken-2 in maize is the result of a mutation of the gene SSII, although this has yet to be definitively demonstrated (Harn et al., 1998, Knight et al., 1998). In maize mutation Shrunken-2 leads to the formation of starches with low gelatinization temperature (Campbell et al., 1994). Wheat Yamamori has developed a line of triple nullisomic that lacks protein, Sgp-1 (Yamamori, 1998), which, as shown in Li et al (Li et al., 1999b), is the product of the gene SSII. In wheat amylose content increased by approximately 35%, and observed anomalous starch granules, modified crystallinity and changed the temperature of gelatinization (Yamamori, 1998). Differences in properties between mutants SSII barley and mutants SSII from other species are completely unexpected.

It is shown that the mutation SSII capable of transfer by crossing from one genetic background to another, and gives diagnostic morphology and composition of the grains, typical of the original 292, 342 and MC. In table (9) the parameter data from a double haploid lines 292 x Tantangara against L/T, is argenio β -glucan, the distribution of the lengths of the chains, RVA and volume swelling flour demonstrate that the lines carrying the mutation 292 exhibit phenotypes typical parent 292. The following confirmation segregation of seed from the progeny from self-pollination of the second back-crossing 292 on the Sloop showed against segregation, coinciding with the segregation of 3:1 for normal (74 seed with respect to L/T<3.5), and smooth phenotypes (21 seed with respect to L/T>3,5).

The availability of gene sequence SSII and systems transformation of barley provides the tools necessary to turn off the SSII gene using methods of gene suppression, with the purpose of obtaining a phenotype comparable with detected mutations SSII. Recently developed a highly effective strategy is to obtain stem design, intended to receive double-RNA, which is expected to suppress endogenous activity SSII. Although the mutation is complete shutdown, similar to the mutations described here will be of interest, the use of DNA structures with different promoters and selection of transgenes with different levels of expression of hairpin constructs, should provide the opportunity to evaluate the effects of titration of expression of the gene from normal levels to a fully-off levels.

It has been shown that these mutations are able to parenesis 292 in alternative genetic backgrounds barley, at the same time preserving the essential features of the original mutation 292. In Tables 9 and 10 presents the phenotypic data for double haploid progeny 292×Tantangara and inoculum from the second back-crossing with the Sloop, and they suggest that these phenotypes are transferred through a process of crossing.

Table 1
The composition of barley grain
The starch content (%)andThe amylose content by HPLC (%)bThe content of amylose binding of iodine (%)The protein content (%)andβ-glucan (%)andTotal dietary fiberand(%)Insoluble dietary fiberand(%)Soluble dietary fibreand(%)
Glacierthe concentration is31,0the concentration is11,54,321,616,65
AS4747,460,610,45,824,928,861
Himalaya492525,410,04,827,118,19
29217,77168,915,09,530,321,48,9
342of 21.962,571,715,78,328,319,48,9
MC10,2the concentration is44,421,3the concentration isthe concentration isthe concentration isthe concentration is
Waxiro42,8the concentration is5,014,6the concentration is19,8a 12.77,1
Tantangara51,6the concentration is29,514,6the concentration is17,2a 12.74,5
a% weight of grain, 14% moisture

b%of the total starch content

the concentration is not defined, elali
Table 2
The grain sizes
Grain weight (mg)Length of grain (mm)The width of the grain (mm)The thickness (mm)The ratio L/T
Himalaya51,01±6,63and7,01±0,51to 3.58±0,342,82±0,362,48
Tantangara50,40±6,51and7,22±0,983,60±0,252,73±0,212,64
Waxiro45,71±to 5.217,54±0,473,40±0,202,67±0,192,82
AC3850,79±by 8.22the 7.62±0,653,35±0,272,64±0,252,89
29232,13±4,67and7,05±0,493,63±0,55 1,58±0,204,46
34235,45±6,017,28±0,553,76±0,381,75±0,184,16
MK682744,89±3,7811,20±0,583,63±0,271,77±0,336,33
N=50, except as specified asandwhere n=200

Table 3
The distribution of lengths of chains of starches in which the fork is removed by isoamylase
DpandHimalaya %bTantangara %bAS %b342 %b292 %bMC %b
DP 6-1124,1522,4026,3338,1838,9637,98
DP 12-30 69,1267,5967,6254,1453,4255,60
DP 31-60of 6.7310,016,057,68a 7.626.42 per
andthe degree of polymerization

b% distribution of oligosaccharides expressed on a molar basis
Table 4
Thermal parameters of barley starch, as measured by DSC
Peak 1Peak 2
StartPeakEndΔNStartPeakEndΔN
Glacier55,459,365,34,2 93,9101,4to 107.70,87
AS55,062,268,2a 3.989,3100,1106,91,195
Himalaya56,860,968,04,5br93.1101,8108,30,78
29246,051,2to 58.10,2988,797,7104,9of 1.34
34245,250,456,80,4786,597,0105,01,59
Table 5
The RVA parameters for starch barley
Peak viscosityR is zrusenie Strength retentionDelayThe final viscosityNormalized final viscosity*Temperature pastravanu (°)
Himalaya871,5653,1218,4235,8454,292664,9
Namoi621,7367,5254,2375,3629,5128465,9
AC38of 226.7of 87.3139,4EUR 188.4327,869768,9
292to 92.1*****133,9230363,92055to 89.5
342110,9**** 144,9264,5409,4186987,9
MC18,2*****25,743,369676the concentration is
* Final viscosity divided by the starch content of the flour from whole grains

** The value registered at the time of peak viscosity for Himalaya

*** The value was below 0

the concentration is not defined
Table 6
Data crystallinity of starch
Sample%H2O (W..)The crystallinity %*And %*In %*V %*
29229,69-1387
34235,812- 1881
AS26,119937(traces of)
Himalaya27,727937(traces of)
Waxiro29,741946-
*(±5%)
Table 7
Analysis of the progeny
CrossingWrinkledFilledCalculated χ2the value ofin
292×Sloopand45155χ2(3:1)=1,0
292×Tantangarab4546χ2(1:1)=0,01
andpotest what about the standard crossing

bdouble haploid offspring

inin each case, χ2(0,05), df=1=3,84, therefore, the population of 292×Sloop corresponds to a segregation of 3:1, and double haploid population of 292×Tantangara corresponds to a segregation of 1:1

/table>

Table 8
Evaluation of double haploid lines 292xTantangara
Line numberandHuskbThe seed mass (mg)The ratio L/TinDP 6-11 (%)gThe content of amylosedPCRe
1N26the 3.835,8750,2292
2N244,2136,8756,2292
3N433,3225,4518,3Wt
5N404,5839,4755,5292
7N344,28quintiles these figures were 19.6343,0292
8N483,0221,6467 Wt
9N31was 2.7622,8925,9Wt
10N263,0227,5621,1Wt
11N343,5537,9044,7292
12N502,9426,3732,8Wt
13N274,2938,6848,4292
14N56of 3.0722.98mm20,8Wt
15N462,74are 24.8822,9Wt
16N432,7825,4018,3Wt
17N31the 3.837,3754,2292
18N314,5137,46of 57.5292
19N263,129,5722,7Wt
20N533.04 from25,4223,8Wt
21N314,538,5159,1292
22N274,6337,2527,2292
23N472,7324,11of 21.2Wt
24N274,5836,8942,0292
26N353,5719,5015,1Wt
27N224,336,8148,6292
28N314,3438,8837,0292
30N304,0438,0548,4292
31N234,2537,0751,7292
32N482,6220,6713,0Wt
33N 254,9235,6833,3292
34N314,0138,3446,1292
35N433,1620,0723,6Wt
36N264,3336,9329,7292
38N383,0121,119,1Wt
39N332,9220,4923,5Wt
40N362,9919,572,2Wt
41N304,0537,82of 40.9292
42N472,9520,8011,9Wt
43N403,2421,9718,1Wt
45N522,7819,9714,5Wt
46N29of 4.44 35,8732,1292
47N353,6936,3492,9292
48N312,5420,27the 13.4Wt
49N542,9422,2919,3Wt
50N502,9421,9220,6Wt
51N43to 3.7320,5918,1Wt
53N314,1236,5255,3292
54N34as 4.0235,1757,1292
55N324,1941,3560,4292
56N293,1721,4818,1Wt
57N304,8536,6646,3292
58N322,9723,8313,8 Wt
59N462,9124,159,2Wt
60N442,7422,3913,5Wt
61N314,4735,6761,3292
63N324,336,9439,4292
64N392,9321,9520,5Wt
65N26a 3.8737,5120,7292
66N304,0336,8948,7292
67N363,1720,2414.4VWt
68N432,6522,538,4Wt
69N323,9336,3454,7292
70N432,7722,2817,6Wt
71 N29to 3.7338,7331,5292
72N472,6522,0020,8Wt
73N364.09 to39,5849,0292
74N244,1836,1547,8292
75N342,9924,4214,2Wt
76N314,3535,95to 49.9292
77N493,1921,22of 17.0Wt
78N332,7821,27the 15.6Wt
79N312,8523,04of 21.2Wt
80N383,18fall of 19.8818,9Wt
81N372,8424.22 to16,2Wt
82N33 with 4.6439,9945,3292
84N283,6236,9828,9292
85N266,4444,4341,3292
86N322,8730,7316,1Wt
88N26to 4.6246,1239,3292
89N382,8831,2516,3Wt
90N323,1931,1113,8Wt
91N314,1742,8637,3292
92N273,9945,3044,6292
93N372,9930,7712,5Wt
94N43to 3.6729,46of 21.9Wt
96N335,6947,34 52,2292
97N233,4131,3617,1Wt
98N325,9545,2752,4292
99N193,6838,361,7292
100N363,131,9215,4Wt
101N583,2924,712,9Wt
anddouble haploid line 292×Tantangara

bphenotype husk: N - non-coated; N - shuck

inthe ratio L/T: the ratio of length to thickness
gthe percentage of chains in the starch with a remote branch circuit range DP6-DP11, calculated on a molar basis as the percentage of circuits, eluruumid between DP6 and DP65

dthe amylose content is determined by the value of the blue color of the iodine

eevaluation of PCR: 292 - PCR reaction network bandwidth, which gives the band 169 BP plus 103 BP after enzymatic hydrolysis NIaIV; Wt - PCR reaction network bandwidth, which gives the strip 111 BP and 103 BP and 57 BP after enzymatic hydrolysis NlaIV.
Table 9
A detailed analysis of double haploid lines
LineThe ratio L/TFACERVA peak viscosity (RVA units)the final viscosity RVA (RVA units)the ratio of the peak/final viscositycontent β-glucan (%)the amount of swelling of the flour
Control
Sloop2,7823,5535,8483,51,112,37,54
Tantangara2,6422,4507395,11,285,165,97
Himalaya2,4824,2873,9449,31,948,538,18
AS2,8926,33of 226.7327,80,695,83,75
2924,4638,9to 92.1363,90,25to 13.092,00
MC6,3337,9818,2690,26the concentration is2,11
Double haploid line
Wild type
83,0221,6RUR 527.9that amount to 431,31,228,96,47
433,2425,4566,6527,41,07to 7.776,04
563,1724,9703,1523,5of 1.347,816,95
582,9727,9726,8588,81,239,656,23
592,9127,0655435,81,507,167,21
682,6522,5876,3465,51,888,878,63
1013,29 34,71471,3410,31,156,546,26
Mutant SSII
54,5839,568,7316,60,2179,872,55
113,5548,251,5240,80,21at 8.362,58
134,2938,743,7265,50,1611,132,92
274,3036,820,396,60,2113,112,71
304,0438,0557,3251,10,2310,562,27
314,2537,117,6124,50,1411,352,48
334,9235,711,7to 83.50,147,222,13
364,3336,914,593,60,15 7,202,20
46of 4.4435,931,3175,80,1810,022,32
914,1742,935,8189,50,1911,32,43
the concentration is not defined

Table 10
Data on flour swelling seed BC2F2
LineVolume swell
C5/1 Plant 1 L:T>3,52,118
C5/1 Plant 1 L:T<3,56,913
65/2 Plant 1 L:T>3,5KZT 2,382
65/2 Plant 1 L:T<3,57,565
65/2 Plant 2 L:T>3,52,409
65/2 Plant 2 L:T<3,56,707

EXAMPLE 2

Development and design of vectors

Lots SSII gene of barley (as defined in Fig) cloned into a vector for transformation. Got three designs for each of the target genes in the strategy of gene suppression (1) semantic compress what I (3) and antisense (3) - mediated duplex suppression.

On Fig illustrated configuration sequences in the DNA structures that are designed to suppress the expression of endogenous gene target. The promoter may be selected either from the endosperm-specific (such as a promoter glutenin, high molecular weight, High Molecular Weight Glutenin, the promoter SSI wheat, promoter BEII wheat), any of the promoters, not specific to the endosperm (such as ubiquitin or 35S). Design can also contain other elements that enhance transcription, such as nos 3 item OCS. Illustrated stretches of DNA should be included in the vectors containing the appropriate sequence of breeding marker genes and other elements, or vectors, which cotransformation with vectors containing these sequences.

Transformation of cereals

Methods of transformation of barley (Tingay et al., 1997; Wan et al., 1994), oat (Somers et al., 1992, 1994; Gless et al., 1998; Zhang et al., 1999, Cho et al., 1999) and rye (Castillo et al., 1994; Pena et al., 1984) described, and can be used to transfer DNA structures, obtaining transgenic plants.

Analysis of transgenic plants

Identification of transgenic plants carried out through the identification of DNA structure DNA using PCR or hybridization on Southern. The levels of expression of individual genes Biotin is ESA starch barley as measured at the mRNA level, and at the protein level using standard techniques, such as hybridization to Nozero and Western blotting, respectively. The content and composition of grain and starch measured using standard methods, such as methods described in Example 1.

Links

Abel et al., (1996). The Plant Journal 10, 981-991.

Ahokas, (1979). Barley genetics Newsletter 9, 7-9.

Akerberg et al., (1998). Journal of Cereal Science 28, 71-80.

Andersson et al., (2000). Cereal Chemistry 77, 463-467.

Andersson et al., (1999). Journal of the science of food and agriculture 79, 979-986.

Andreev et al., (1999). StarchStarke 51, 422-429.

Banks et al., (1971). Starch 23, 12-15.

Batey and Curtin (1997). Starch 48, 338-344.

Batey et al., (1997). Cereal Chemistry 74, 497-501.

Bergh et al., (1999). Animal Feed Science and Technology 78, 215-226.

Bhatty (1999). Cereal Chemistry 76, 589-599.

Biyashev et al., (1986). Soviet Genetics 22, 296-303.

Boyer and Preiss, (1978). Carbohydrate research 61, 321-334.

Boyer and Preiss, (1981). Plant discrimination 67, 1141-1145.

Boye et al., (1980). Starch 32, 217-222.

Buleon et al., (1998). International Journal of Biological Macromolecules 23, 85-112.

Calvert et al., (1976). Nutrition Reports. International 14, 55-61.

Campbell et al., (1994). Cereal Chemistry 71, 464-468.

Cao et al., (2000). Achives. of Biochemistry and Biophysics. 373, 135-146.

Case et al., (1998). Journal of Cereal Science 27, 301-314.

Castillo, et al., (1994). Biotechnology 12, 1366-1371.

Cho, et al. (1999). Plant Science (Limerick) 148, 9-17.

Craig et al. (1998). Plant Cell 10, 413-426.

Czuchajowska et al. (1998). Cereal Chemistry 75, 747-754.

Czuchajowska et al. (1992). Cereal Chemistry 69, 413-418.

Denyere et al. (1996). Plant discrimination 112, 779-785.

Elfverson et al. (1999). Cereal Chemistry 76, 434-438.

Eslick and Ries, (1976). Barley Genetics Newsletter 6, 21-22.

Fastnaught et al. (1996). Crop Science 36, 941-946.

Fedak et al. (1972). Canadan Journal of Genetics and Cytology 14, 949-957.

Filpse et al. (1996). Planta 198, 340.

Fontaine et al. (1993). Journal of Biological Chemistry 268, 16223-16230.

Fujita et al. (1999). Breeding Science 49, 217-219.

Fuwa et al. (1999). Starch/Starke 51, 147-151.

Gao et al. (1998). Plant Cell 10, 399-412.

Giroux and Hannah (1994). Molecular and General Genetics 243, 400-408.

Gless et al. (1998). Journal of Plant discrimination 152, 151-157.

Goering and DeHaas, (1974). Cereal Chemistry 51, 573-578.

Granfeldt et al. (1994). American Journal of Clinical Nutrition 59, 1075-1082.

Green et al. (1997). Plant discrimination 114, 203-212.

After Gubler et al. (2000). Plant discrimination 122, 1457.

Hedman and Boyer (1982). Biochemical Genetics 20, 483-492.

Izydorczyk et al. (2000). Journal of Agricultural and Food Chemistry 48, 982-989.

James et al. (1995). Plant Cell 7, 417-429.

Jane et al. (1999). Cereal Chemistry 76, 629-637.

Jarvi and Eslick, R.F. (1975). Crop Science 15, 363-366.

Jobling et al. (1999). Plant Journal 18, 163-171.

Katz et al. (1993). Carbohydrate polymers 21, 133-136.

Knight et al. (1998). Plant Journal 14, 613-622.

Konik-Rose et al. (2001). Sfarch 53, 14-20.

Krueger et al. (1987). Cereal Chemistry 64, 187-190.

Kubo et al. (1999). Plant discrimination 121, 399-409.

Li et al. (1999). Plant discrimination 120, 1147-1155.

Li et al. (2000). Plant discrimination 123, 613-624.

Li et al. (1999). Theoretical and Applied Genetics 98, 1208-1216.

Mizuno et al. (1993). Journal of Biological Chemistry 268, 19084-19091.

Mizuno et al. (1992). Journal of Biochemistry 112, 643-651.

Morell et al. (1997). Plant discrimination 113, 201-208.

Morell et al. (1998). Electrophoresis 19, 2603-2611.

Morrison et al. (1984). Journal of Cereal Science 2, 257-271.

Mouille et al. (1996). The Plant Cell 8, 1353-1366.

Myers et al. (2000). Plant discrimination 122, 989-997.

Netsvetaev (1990). Nauchno-Tekh. Bull VSGI, Odessa. No. 175, 31-35.

Netsvetaev (1992). Cytology and Genetics (Kiev) 26, 26-30.

Netsvetaev and Krestinkov (1993). Barley Genetics Newsletter 22, 44-45.

Newman et al. (1978). Journal of Animal Science 47, 448-455.

Ng et al. (1997). Cereal Chemistry 74, 288288.

Oscarsson et al. (1998). Journal of the science of food and agriculture 78, 359-366.

Oscarsson et al. (1996). Journal of Cereal Science 24, 161-170.

Oscarsson et al. (1997). Journal of Cereal Science 26, 259-264.

Pena et al. (1987). Nature, UK 325, 274-276.

Persson and Christerson, (1997). Sveriges. Utsadesforenings. Tidskrift. 107, 141-153.

Persson et al. (1996). Sveriges. Utsadesforenings. Tidskrift. 106, 79-86.

Pomeranz, (1992). European Journal of Clinical Nutrition 46, S63-S68.

Pomeranz et al. (1972). Cereal Chemistry 49, 629-635.

Rahman et al. (1995). Australian Journal of Plant discrimination 22, 793-803.

Ramage and Eslick (1975). Barley Genetics Newsletters 5, 114.

Ramage and Eslick, (1975). Barley Genetics Newsletter 6, 115.

Schondelmaier et al. (1992). Plant Breeding 109, 274-280.

Shulmann and Kammiovirta, (1991). Starch 43, 387-389.

Schwall et al. (2000). Nature Biotechnology 18, 551-554.

Shure et al. (1983). Cell 35, 225-233.

Somers et al. (1992). Fertile, transgenic oat plants. Bio/technology 10, 1589-1594.

Somers et al. (1994). Genetic engineering of oat. 37-46.

Song and Jane (2000). Carbohydrate Polymers 41, 365-377.

Sun et al. (1997). The New Phytologist 137, 215-215.

Sundberg et al. (1998). Journal of the Science of Food and Agriculture 76, 457-463.

Swanston (1992). Barley Genetics Newsletter 22, 66-67.

Swanston et al. (1995). Journal of Cereal Science 22, 265-273.

Takeda et al. (1993). Carbohydrate Research 246, 273-281.

Thorbjornsen et al. (1996). Plant Journal 10, 243-250.

Tingay et al. (1997). Plant Journal 11, 1369-1376.

Topping (1999). Asia Pacific Journal of Clinical Nutrition 8, S22-S26.

Topping et al. (1997). The Journal of Nutrition 127, 615-615.

Vasanthan and Bhatty (1995). Cereal Chemistry 72, 379-384.

Vasanthan and Bhatty (1998). Starch-Starke 50, 286-291.

Walker and Merritt (1968). Nature 221, 482-484.

Wan and Lemaux (1994). Plant discrimination 104, 37 to 48.

Wang et al. (1998). Journal of Experimental Botany 49, 481-502.

Wang et al. (1993). Cereal Chemistry 70, 521-525.

Wilson and McNab (1975). British Poultry Science 16, 497-504.

Xue et al. (1996). Cereal Chemistr 73, 588-592.

Yamamori (1998) (Anon.), pp.300-302. University Extension Press, University of Saskatchewan, Saskatoon.

Yamamori and Endo (1996). Theoretical and Applied Genetics 93, 275-281.

Yoshimoto et al. (2000). Cereal Chemistry 77, 279-285.

Zhang et al. (1999). Plant Celt Reports. 18, 959-966.

Zheng et al. (2000). Cereal Chemistry 77, 140-144.

Zwar and Chandler (1995). Planta 197, 39-48.

1. The grain obtained from barley plants containing the introduced mutation in SSII gene or a transgene, which lowers the level of activity SSII, and the specified grain is useful for industrial production of food.

2. Grain according to claim 1, containing at least 6% β-glucan, expressed as a percentage of the total mass of nesluchaino grain.

3. Grain according to claim 1, which is crushed, milled grain, in the form of barley, in the form of cereal flakes, crushed, split or whole grains.

4. Grain according to claim 1, having a characteristic selected from the group consisting of the presence of starch content bolee% of the non-coated grains, ability to easy grinding, lack of purple coloring, respecrively and availability of the ratio of the length to the thickness of less than approximately 5.8.

5. Grain according to claim 1, having a length to thickness of less than about 5.5.

6. Grain according to claim 1, having a ratio of length to thickness in the range from 4 to 5.

7. Grain according to claim 1, which contains a transgene and a transgene selected from the group consisting of

DNA that directs the synthesis of an antisense molecule that inhibits the transcription or processing SSII gene,

SSII-specific ribozyme,

extra copies of the gene SSII for compressie SSII gene and

DNA that directs the synthesis donateware product RNA mediating suppression SSII gene.

8. The grain obtained from barley plants containing the introduced mutation in SSII gene or a transgene, which lowers the level of activity SSII, and which is useful for industrial production of food, and the starch from the grain contains at least 50% (wt./wt.) amylose, as measured by HPLC.

9. The starch grains according to any one of claims 1 to 8.

10. The starch according to claim 9, which shows a lower gelatinization temperature, as measured using differential scanning calorimetry.

11. The starch of claim 10, the lowered temperature of gelatinization which is characterized by low temp is the temperature of the first peak, defined using differential scanning calorimetry.

12. The starch of claim 10, the lowered temperature of gelatinization which is characterized by low temperature peaks, the first peak determined by differential scanning calorimetry.

13. The starch of claim 10, the lowered temperature of gelatinization which is characterized by low enthalpy (ΔN) of the first peak determined by differential scanning calorimetry.

14. The starch according to claim 9, having a volume of swelling of less than 3.2.

15. The starch 14, having a volume of swelling at least about 2.

16. The starch according to claim 9, which gelatinization shows a lower peak viscosity.

17. The starch according to claim 9, temperature pastravanu above 75°C.

18. The starch according to claim 9, having a modified structure, and in this modified structure specifies one or more than one characteristic selected from the group consisting of physical inaccessibility due to the presence of high content of β-glucans, modified the morphology of the granules, the presence of appreciable associated with starch lipid, low crystallinity and low chain length of amylopectin.

19. The starch according to claim 9, which contains at least 50% (wt./wt.) amylose.

20. The starch according to claim 19, which contains at least 60% (wt./wt.) amylose.

21. To Ajmal according to claim 9, containing appreciable quantities associated with starch, lipid, and starch with an associated lipid exhibits a V-complex crystalline form, where the V-complex crystalline form present in an amount of at least 10% of crystalline starch.

22. The starch according to item 21, which contains less than 5% And is a complex form of starch.

23. The starch p, whose degree of crystallinity is reduced compared to normal starch isolated from barley, and the proportion of starch that exhibits crystallinity is less than about 20%.

24. The starch p, which is characterized by a modified chain length of amylopectin after removal of the branching circuit, and this modified chain length of amylopectin is characterized by one or more than one of the following:

(a) the percentage of chains having a length in the range from 6 to 11 residues, at least 25%,

b) the percentage of chains having a length in the range from 12 to 30 residues, is less than 65%, and

C) the percentage of chains having a length in the range from 31 to 60 residues is less than 10%.

25. The starch in paragraph 24, in which the proportion of chains of amylopectin, which have a length in the range from 31 to 60 residues constitutes more than about 5%.

26. Plant barley with lower level of activity SSII able to give grain according to any one of claims 1 to 8./p>

27. The method of obtaining barley plants with a reduced activity level SSII able to give grain according to any one of claims 1 to 8, comprising a stage on which

a) introducing a genetic variation into a parent plant of barley, which is either a mutation in the SSII gene, or transgene, which lowers the level of activity SSII,

b) receive seed from this parent plants of barley and

C) carry out the selection of seeds resulting from stage (b), for those seeds that have a reduced level of activity SSII, and

g) growing the plant barley seeds from stage (b).

28. The method according to item 27, in which stage (a) comprises mutagenesis of the parent plants of barley.

29. The method according to item 27, in which stage (b) includes seed selection for phenotype wrinkled endosperm or seed selection for high levels of amylose.

30. The method of producing starch, including the stage at which

a) milled grain according to any one of claims 1 to 8 and

b) extracted starch from this crushed grain.

31. Starch granules of barley obtained from grain according to any one of claims 1 to 8, and these starch granules contains at least 50% (wt./wt.) amylose, as measured by HPLC.

32. Flour or wholemeal flour produced from grain according to any one of claims 1 to 8, otlichayushiesya, what is the amount of swelling of less than 3.2.

33. Flour or wholemeal flour produced from grain according to any one of claims 1 to 8, characterized in that it has a volume swell at least about 2.



 

Same patents:

The invention relates to a heterophase polymeric compositions having high resistance to aging under conditions of low temperature and humidity

The invention relates to the pulp and paper industry and can be used for the preparation of adhesives in the manufacture of cardboard and corrugated Board

The invention relates to the production of plastics based on natural polymers used in the production of termoformovannyh products of various configurations

The invention relates to a process of manufacturing molded sheets having a linked starch matrix, reinforced fiber, and can be used for the manufacture of ordinary paper and cardboard

The invention relates to methods for manufacturing compositions based on starch with uniformly distributed fibers, which can be used for the manufacture of packaging products and packaging materials

The invention relates to biologically destroy molded product based on vegetable fibrous material, which is integrated in a matrix of at least translated at elevated temperature and elevated pressure in gillespeterson state, termoplasticheskie processed, biogenic material, and method of its manufacture

The invention relates to the production of plastic materials, in particular cellulose acetate plastics (acrolaw), used in production of various thermodormancy products, including consumer packaging, houseware and others, used in contact with food products

The invention relates to the field of printing and dyeing textile materials and can be used for geological research, geological, hydrogeological, specifically construction, printing, food and perfume industry

FIELD: food industry.

SUBSTANCE: starch-based food thickener contains starch product in the form of powder enrobed by alkali or alkali-earth metal stearate, amount of stearate constituting no more than 2.0% of the weight of thickener. Manufacture process comprises mixing starch powder with stearate at 30 to 210 followed by grinding and sieving resulting product.

EFFECT: improved dispersibility of starch product in hot liquids without conglomeration.

12 cl, 9 tbl, 9 ex

The invention relates to a food thickener having an increased resistance to shear and stability during storage, the method of its production and the product of it

FIELD: biotechnology, in particular production of genetically modified plants with altered level of one metabolite secondary product.

SUBSTANCE: claimed method includes selection of nuclear acid sequence encoding enzyme, which is absent in secondary metabolite process, but is capable to modify utilization of intermediate substrate in secondary metabolite process connected with plant nutrient profile. Then recombinant molecule is constructed, which contains abovementioned sequence, to transform plant cell. From this cell genetically modified plant is regenerated. Obtained plant is useful in animal feed preparation.

EFFECT: plants with high nutrient value and improved quality.

35 cl, 33 dwg, 22 ex

FIELD: gene engineering, in particular plant selection.

SUBSTANCE: chimera gene encoding protoporphyrinogen oxydase is introduced into plant.

EFFECT: plants transformed by chimera gene and generation thereof with herbicide resistance.

16 cl, 2 tbl, 27 ex

FIELD: biotechnology, agriculture.

SUBSTANCE: invention relates to a system used for eradication of vegetable cells. Invention involves construction of the biological functional expression vector that carries a chimeric gene comprising promoter associated functionally with a nucleotide sequence that encodes the combination of α- and β-domains of maize inactivating mature protein RIP. Then method involves carrying out the transformation of the plant. Invention provides effective removal of required cells in the plant organism.

EFFECT: improved and valuable properties of system.

21 cl, 15 dwg, 3 tbl, 21 ex

FIELD: genetic engineering, agriculture.

SUBSTANCE: invention relates to a method for preparing transgenic plants. Method involves selection of the strain of the required plant, preparing mother plants and carrying out the multiplication of the vegetable material for preparing leaf explants. Then method involves making a vector for transfer of genetic material expressing the end protein that enhances resistance of plants against phytopathogens followed by the agrobacterial transformation of explants with agrobacterium Agrobacterium tumifaciens and the following selection of transgenic tissue and multiplication of transformants. At the transformation stage method involves stage-by-stage co-cultivation of explants with steps amount taken in the range from 2 to 5 and wherein leaf disks with the ratio of cut length to the area disk is in the range 0.1-0.2 mm/mm2 are used as explants. Invention provides preparing transgenic plants showing the enhanced resistance against phytopathogens and also to enhance frequency of the transient expression, frequency in formation of transgenic tissues, frequency in regeneration of transgenic sprouts, part of direct transformants and to reduce frequency of somaclonal alterations.

EFFECT: improved preparing method, valuable properties of transgenic plants.

5 cl, 9 dwg, 12 tbl, 16 ex

FIELD: biotechnology and cellular engineering.

SUBSTANCE: invention relates to a method for preparing bent-grass (Agrostis) plants tolerated to copper ions. Method involves culturing bent-grass callus for 2-3 passages in Murasige-Skuga medium with 2,4-dichlorophenoxyacetic acid taken in the concentration 1-3 mg/l and with copper substance taken in the concentration 100-200 mg/l up to preparing regenerating calluses. Then method involves carrying out the regeneration in Murasige-Skuga medium with copper substance taken in the concentration 100-150 mg/l and rooting plants in Murasige-Skuga medium with copper substance taken in the concentration 100-150 mg/l. Invention provides rapid and effective preparing bent-grass plants with the hereditary determined resistance to copper ions and retention of high decorative qualities.

EFFECT: improved preparing method.

2 tbl, 2 ex

FIELD: biotechnology and cellular engineering.

SUBSTANCE: invention relates to a method for preparing salt-resistant plants. Method involves culturing fescue and bent-grass lawn grasses up to preparing callus in Murasige-Skuga medium with 2,4-dichlorophenoxyacetic acid in the concentration from 3 to 10 mg/l followed by passage of callus for 2-4 passages in Murasige-Skuga medium with 2,4-dichlorophenoxyacetic acid in the concentration 1-3 mg/l and 1% sodium chloride up to preparing regenerating calluses. Then method involves regeneration and rooting plants in Murasige-Skuga medium with 1% of sodium chloride. Invention provides rapid and effective preparing plants of fescue (Festuca) and bent-grass (Agrostis) with the stable and inherited resistance against the salinization factor.

EFFECT: improved preparing method.

3 tbl, 3 ex

FIELD: biotechnology, in particular production of genetically modified plants with altered level of one metabolite secondary product.

SUBSTANCE: claimed method includes selection of nuclear acid sequence encoding enzyme, which is absent in secondary metabolite process, but is capable to modify utilization of intermediate substrate in secondary metabolite process connected with plant nutrient profile. Then recombinant molecule is constructed, which contains abovementioned sequence, to transform plant cell. From this cell genetically modified plant is regenerated. Obtained plant is useful in animal feed preparation.

EFFECT: plants with high nutrient value and improved quality.

35 cl, 33 dwg, 22 ex

Up!