Fused polypeptide able for binding with vegf polypeptide and nucleic acid molecule encoding thereof, their preparing and using

FIELD: genetic engineering, pharmaceutical and medical-biological industry.

SUBSTANCE: invention proposes a chimeric sequence of nucleic acid encoding a fused polypeptide able to bind with the vessel endothelium growth factor (VEGF) and to inhibit its specific mitogenic effect. The fused polypeptide molecule comprises immunoglobulin-like domain 2 of VEGF-receptor Flt1, immunoglobulin-like domain 3 of VEGF-receptor Flk 1 or Flt4 and multimerizing component represented by either domain Fc IgG or heave chain IgG. By expression of the proposed chimeric sequence or its two successively joined copies in a host-cell a monomer or dimer of the fused polypeptide are prepared, respectively, that can be used for suppression of VEGF activity in mammals, in particular, in humans. New VEGF inhibitors differ from the known one by the improved pharmacokinetics.

EFFECT: improved preparing method, valuable biological properties of polypeptide.

23 cl, 67 dwg, 1 tbl, 35 ex

 

This application claims priority of the provisional application U.S. No. 60/138133, filed June 8, 1999 In this application contains links to various publications. Such publication in full included in this application by reference.

Introduction

The present invention relates to modified polypeptides with improved pharmacokinetics. In particular, this invention relates to a polypeptide receptors Flt1, which are modified to improve their pharmacokinetic profile. This invention relates also to methods for production and application of modified polypeptides, which include the use of modified polypeptides for reducing or suppressing the loss of plasma and/or vascular permeability in a mammal, but are not limited to the specified application.

Background of the invention

The ability of polypeptide ligands to contact the cells and thus cause a phenotypic response, such as growth, maintenance of viability, the secretion of waste products or cell differentiation, often mediated by transmembrane receptors on the cells. The extracellular domain of these receptors (i.e. part of the receptor located on the cell surface) is the most pronounced part of the molecule, as it contains protein, is able to communicate with all possible is consistent with the ligand. The binding of ligand to the extracellular domain usually initiates signal transduction through which the biological signal is transmitted to intracellular targets. Signal transduction usually occurs through intracellular catalytic domain. A certain set of elements in the sequence specified catalytic intracellular domain determines its access to potential kinase substrates (Mohammadi, et al., 1990, Mol. Cell. Biol. 11:5068-5078; Fantl et al., 1992, Cell 69:413-413). Examples of receptors, transducers signals via intracellular catalytic domains, are receptor tyrosine kinase (RTK), in particular the family of Trk receptors, which is normally restricted to cells of the nervous system, a family of receptors cytokines, including ternary receptor complex CNTF (Stahl & Yancopoulos, 1994, J. Neurobio, 25:1454-1466), which is also limited to cells of the nervous system, receptors associated with G-protein, such as β2-adrenergic receptor, found, for example, the cells of the heart muscle, and multimeric receptor FcεRI with high affinity for immunoglobulin E (IgE), which is mainly on mast cells and basophils (Sutton & Gould, 1993, Nature 366:421-428).

All of the above receptors, apparently, prone to dimerization, multimerization or some related structural changes in the cut is ltate binding ligand (Schlessinger, J., 1988, Trend Biochem. Sci. 13:443-447; Ullrich &Schlessinger, 1990, Cell 61:203-212; Schlessinger & Ullrich, 1992, Neuron 9:383-391), while intermolecular interaction between gimelshein intracellular domains lead to activation of the catalytic function. For example, in the case derived from platelet growth factor (PDGF) ligand is a dimer that binds the molecules of the two receptors (Hart, et al., 1988, Science, 240:1529-1531; Heldin, 1989, J. Biol. Chem. 264:8905-8912), and in the case of epidermal growth factor (EGF) ligand is a monomer (Weber, et al., 1984, J. Biol. Chem. 259:14631-14636). In the case of Fc receptorεRI ligand IgE bound to FcεRI as a monomer and is activated only when the antigen binds to the complex of IgF/FcεRI and forms a cross-linkage with the adjacent IgE molecules (Sutton & Gould, 1993, Nature 366:421-428).

The allocation of specific receptor in the tissues of higher organisms often allows to reveal the biological function of this receptor. Some growth factors and differentiation, such as fibroblast growth factor (FGF), strongly expressed RTK, implying that they play a role in growth and tissue maintenance. Members of the family of Trk receptors RTK (Glass & Yancopoulos, 1993, Trends in Cell Biol. 3:262-268), generally limited to cells of the nervous system, and the family of growth factors, nerve tissue, including nerve growth factor tissue (NGF), secreted from the brain-derived neurotrophic factor (BDNF), is eurotrain-3 (NT-3) and neurotrophin-4/5 (NT-4/5), which bind to the receptors of the Trk family RTK, stimulate the differentiation of different groups of neurons in the brain and peripheral system (Lindsay, R., 1993, in Neurotrophic Factors, S.E. Loughlin & J.H.Fallon, eds., pp.257-284, San Diego, CA, Academic Press). The receptor FcεRI is in a very limited number of cell types such as mast cells and basophils. Fat cells are produced by line poly potent hematopoietic stem cells in the bone marrow, but Mature in the tissue after the migration from the bloodstream (see Janeway &Travers, 1996, in Immunobiology, 2d. Edition, M. Robertson & E. Lawrence, eds., pp.1:3-1:4, Current Biology Ltd., London, UK, Publisher) and participate in allergic reactions.

Many studies show that the extracellular domain of the receptor has the property of binding of specific ligands. In addition, the cellular environment in which the downregulation of the receptor, can affect the biological reaction that occurs when the binding of the ligand to the receptor. For example, the neural cell expressing the receptor Trk, neurotrophins that binds to this receptor leads to the survival and differentiation of neurons. When the same receptor expressed by fibroblast, under the action of neurotrophin is the proliferation of fibroblasts (Glass, et al., 1991, Cell 66:405-413).

Identified class secreted from cells dimeric mitogens with selectivity against endothelial the x cells of blood vessels, which is called the growth factor, endothelial cells of blood vessels (VEGF). VEGF isolated from air-conditioned nutrient medium of glioma cells in rats [Conn et al., (1990), Proc. Natl. Acad. Sci. U.S.A., 87. pp.2628-2632]; air-conditioned nutrient medium stellate cells pituitary follicle in cattle [Ferrara and Henzel, (1989), Biochem. Biophys. Res. Comm., 161, pp.851-858; Gozpadorowicz et al., (1989), Proc. Natl. Acad. Sci. U.S.A., 86, pp.7311-7315] and air-conditioned nutrient medium U937 cells [Connolly, D.T. et al. (1989), Science, 246, pp.1309-1312]. VEGF is a dimer with an average molecular mass of about 46 kDa that each subunit has an average molecular mass of about 23 kDa. VEGF has some structural similarities with those obtained from platelet growth factor (PDGF), which is a mitogen for connective tissue cells and is a mitogen for endothelial cells of large vessels.

It is established that membrane-bound receptor tyrosine kinase, known as Flt, is a receptor for VEGF [DeVries, S. et al., (1992), Science, 255, pp.989-991]. Receptor Flt binds VEGF, which induces mitogenes. It is known that another form of the VEGF receptor, referred to as KDR, also binds VEGF and induces mitogenes. In addition, the known partial sequence of cDNA and nearly full-size protein sequence KDR [Terman. B.I. et al., (1991), Oncogene 6, pp.1677-1683; Terman, V et al., (1992), Biochem. Biophys. Res. Comm. 187. pp.1579-1586].

Permanent angiogen the C can cause or aggravation of certain diseases, such as psoriasis, rheumatoid arthritis, hemangioma, angiofibroma, diabetic retinopathy and neovascular glaucoma. The inhibitor of VEGF activity should be useful for treating such diseases and other types of VEGF-induced pathological angiogenesis, diseases associated with vascular permeability, such as vascularization of the tumor. The present invention relates to a VEGF inhibitor-based receptor Flt1 VEGF.

Loss of plasma, which is the main indicator of the inflammatory process that occurs in a separate set of microvessels. In particular, the loss of plasma in most organs occurs in venules. Unlike the arterioles and capillaries plasma loss from venules occurs under the action of numerous inflammatory mediators, including histamine, bradykinin and serotonin. One distinctive feature of inflammation is the loss of plasma, which comes from the intercellular gaps formed in the endothelium of venules. Experimental models of inflammatory process show that these intercellular gaps occur between the endothelial cells of postcapillary and collecting venules (Baluk, P., et al., Am. J. Pathol. 1998, 152:1463-76). Certain lectins can be used to detect lesions loss of plasma endothelial gaps and pathological processes at the boundaries of endothelially cells in inflamed venules (Thurston, G., et al., Am. J. Physiol, 1996, 271: N-62). In particular, plant lectins are used to visualize morphological changes at the borders of endothelial cells in inflamed venules, for example, the trachea of rats. Lectins, such as concanavalin a and ricin, which focal contact inflamed venules, can detect areas in the wall of the subendothelial vessel with porous corresponding to the places of loss of plasma (Thurston, G., et al., Am. J. Physiol, 1996, 271: H2547-62).

Capillary vessels are characterized by dynamic properties. Chronic inflammatory diseases are caused, in particular, changes in the microvessels, including angiogenesis and increased capillary microvessels. Capillary vessels can also change as a result of the acquisition wrong phenotypic properties. In the mouse model of chronic airway inflammation capillaries respiratory acquire properties venules, manifested in the increase in the diameter of blood vessels, increased immunoreactivity for factor a background of Villebranda and increased immunoreactivity for P-selectin. In addition, proactivenet modified vessels may occur under the influence of such inflammatory mediators, which do not impact on similar vessels of the respiratory tract in healthy mice.

Certain substances reduce or inhibit the vascular permeability and/or loss of plasma. For example, mistissini are synthetic polypeptides that inhibit the loss of plasma, not blocking the formation of endothelial gaps (Baluk, P., et al., J. Pharmacol. Exp. Ther., 1998, 284: 693-9). In addition, formoterol agonist beta-2-adrenergic receptors reduces proactivenet capillary vessels, inhibiting the formation of endothelial gaps (Baluk, P., and McDonald, D.M., Am. J. Physiol., 1994, 266:L461-8).

Angiopoetin and members of the family of growth factors, endothelial cells of blood vessels (VEGF) are the only growth factors that are known to be highly specific for endothelial cells of blood vessels. Studies on the inactivation of the target genes in mice show that VEGF is necessary for the early development of vascular and Ang-1 is required in the later stages of vascular changes.

In U.S. patent No. 6011003, issued January 4, 2000, the company Metris Therapeutics Limited, described the modified soluble form of the polypeptide FLT ability to communicate with VEGF and provide thus inhibiting effect on the factor, and this polypeptide contains five or fewer full domain of immunoglobulin.

In U.S. patent No. 5712380, issued January 27, 1998 Merck & Co., described inhibitors of growth factor endothelial cells of blood vessels (VEGF), which are natural or obtained by the method of recombinantly DNA soluble form, the content is appropriate or not containing C-terminal transmembrane region of the receptor for VEGF.

Merck & Co. also belongs to the PCT application no WO 98/13071, published April 2, 1998, which describes methods of haemotherapy to suppress primary tumor growth and metastasis by gene transfer of a nucleotide sequence that encodes a soluble receptor protein, binding to VEGF.

In the application of the firm Genentech, Inc. PCT No. WO 97/44453, published on November 27, 1997, describes the new chimeric proteins of the VEGF receptors containing the amino acid sequence derived from receptors Flt1 and KDR growth factor endothelial cells of blood vessels (VEGF), including murine homologue of the receptor FLK1 KDR person, in which the aforementioned chimeric protein receptors VEGF binds to VEGF and have an antagonistic effect on the proliferative and angiogenic activity of endothelial cells.

In the application of the company Toa Gosei Co., LTD PCT No. WO 97/13787, published April 17, 1997, described low molecular weight VEGF inhibitor used for the treatment of diseases accompanied by the formation of new blood vessels, such as solid tumors. The polypeptide containing the first and second immunoglobulinlike domains in the extracellular region of the receptor FLT VEGF, but not having sixth and seventh immunoglobulinovogo domain has an inhibitory effect on VEGF.

Sharifi, J. et al., 1998, The Quarterly Jour. of Nucl. Med. 42:242-249, indicate that as monoclonal antibodies (MAb) are the I key, positively charged proteins, and mammalian cells are negatively charged, the electrostatic interaction between these elements can cause higher levels of background binding, which leads to a low correlation between tumor volume and normal body. To overcome these effects, researchers have tried to increase the excretion of MAb different methods, in particular by means of the secondary agents as well as chemical modification and changes in the charge of the MAb.

Jensen-Pippo, et al., 1996, Pharmaceutical Research 13:102-107, indicate that treatment with polyethylene glycol therapeutic protein, recombinant granulocyte colony-stimulating factor (PEG-G-CSF) human increases stability and retains the biological activity in vivo when intra-duodenal way of introduction.

Tsutsumi, et al., 1997, Thromb Haemost. 77:168-73, describe experiments in which thrombopoetin activity in vivo modified polyethylene glycol interleukin-6 (MPEG-IL-6), in which 54% 14 amino groups of lysine in IL-6 is associated with PEG, was compared with the activity of natural IL-6.

Yang, et al., 1995, Cancer 76:687-94, indicate that conjugase polyethylene glycol with recombinant interleukin-2 (IL-2) man, you can get a connection, namely modified with polyethylene glycol IL-2 (PEG-IL-2), which remains in vitro and in vivo activity of IL-2, but is characterized by significant is but a longer half-life in the blood stream.

R. Duncan and F. Spreafico, Clin. Pharmacokinet. 27: 290-306, 296 (1994)describe experiments to increase the half-life in plasma asparaginase by conjugation with polyethylene glycol.

In international patent application no WO 99/03996 company Regeneron Pharmaceuticals, Inc. and the Board of the University of California, published January 28, 1999, described the modified polypeptides of the person with divisions of regions of basic amino acids. It is established that modified "noggin" - polypeptides person retain biological activity, with lower affinity to heparin and higher pharmacokinetics in serum of the animal compared to non-modified "noggin" polypeptides of the person.

A brief statement of the substance of the invention

The present invention relates to antagonists of VEGF with improved pharmacokinetic properties. The preferred embodiment of the invention relates to the selected nucleic acid molecule that encodes a fused polypeptide capable of binding VEGF polypeptide, comprising (a) a nucleotide sequence encoding a component of the VEGF receptor, functionally associated with (b) a nucleotide sequence that encodes multimediali component, and in which a component of the VEGF receptor is the only component of the VEGF receptor fused polypeptide and the nucleotide is the first sequence (a) consists essentially of the nucleotide sequence, the coding amino acid sequence of Ig domain 2 of the extracellular domain of the VEGF receptor, and of the nucleotide sequence that encodes the amino acid sequence of Ig domain 3 of the extracellular domain of the second VEGF receptor.

In another embodiment of the invention selected nucleic acid of the first VEGF receptor Flt1 is.

In another embodiment of the invention selected nucleic acid of the second VEGF receptor Flk1 is.

In another embodiment of the invention selected nucleic acid of the second VEGF receptor is Flt4.

In another preferred embodiment of the invention the nucleotide sequence encoding Ig domain 2 of the extracellular domain of the VEGF receptor, is located above the nucleotide sequence that encodes a domain 3 of the extracellular Ig domain of the second VEGF receptor.

In another preferred embodiment of the invention the nucleotide sequence encoding Ig domain 2 of the extracellular domain of the VEGF receptor, is located below the nucleotide sequence that encodes a domain 3 of the extracellular Ig domain of the second VEGF receptor.

In a preferred embodiment of the invention multimediali component contains the domain of the immunoglobulin.

In another embodiment, the zebrette domain immunoglobulin selected from the group consisting of the Fc domain of IgG, the heavy chain of IgG and light chains of IgG.

Preferred embodiments of the invention relate to the selected nucleic acid molecule containing the nucleotide sequence encoding a modified fused polypeptide receptor Flt1, in which the coding region of the nucleic acid molecule consists of the nucleotide sequence selected from the group consisting of:

(a) the nucleotide sequence shown in Fig. 13A-13D;

(b) the nucleotide sequence shown in Fig. 14A-14C;

(c) the nucleotide sequence shown in Fig. 15A-15C;

(d) the nucleotide sequence shown in Fig. 16A-16D;

(e) the nucleotide sequence shown in Fig. 21A-S;

(f) the nucleotide sequence shown in Fig. 22A-22P;

(g) the nucleotide sequence shown in Fig. 24A-24 C and

(h) a nucleotide sequence that due to the degeneracy of the genetic code differs from the nucleotide sequence of (a), (b), (C), (d), (e), (f) or (g) and which encodes a molecule fused polypeptide having the biological activity of modified fused polypeptide receptor Flt1.

In another embodiment of the invention fused polypeptide is encoded above the selected molecules nuclein the howling acid.

The preferred embodiment of the invention relates to compositions capable of binding the molecule VEGF with the formation of non-functional complex containing multimer fused polypeptide.

Also preferred is a composition in which multimer is a dimer.

In another embodiment of the invention, this composition is in the media.

Another variant embodiment of the invention relates to a vector, which contains the above-described nucleic acid molecules, including expressing a vector containing the described nucleic acid molecule, where the nucleic acid molecule is functionally linked to regulatory expression sequence.

Other embodiments of the invention relate to a system of vector-host intended for producing fused polypeptide, which comprises expressing a vector in an acceptable cage-the master; to the system of vector-host, in which acceptable a host cell is a bacterial cell, a yeast cell, an insect cell or a cell of the mammal; to the system of vector-host, in which acceptable a host cell is E. coli; to the system of vector-host, in which acceptable a host cell is a COS cell; to the system of vector-host, in which acceptable a host cell a is the cell SNO.

Another variant embodiment of the invention relates to a method for producing a fused polypeptide which comprises growing cells of the system vector-host under conditions which assure the production and isolation of the thus obtained fused polypeptide.

Additional embodiments of the invention relates to fused to the polypeptide encoded by the nucleotide sequence shown in Fig. 10A-10D or 24A-24C, which is modified by acetylation or by treatment with polyethylene glycol, and acetylation produce at least 100-fold molar excess acetylides reagent or in molar excess acetylides reagent in the range from about 10-fold molar excess of up to about 100-fold molar excess of either treatment with ethylene glycol is produced using PEG with molecular weight of 10000 or 20000.

The preferred embodiment of the invention relates to a method of reducing or suppressing the loss of plasma in a mammal which comprises the administration to a mammal the above fused polypeptide, including variants of the invention, in which the mammal is a human, fused polypeptide acetiminophen or treated with polyethylene glycol.

Other embodiments of the invention relates to fused to the polypeptide, the cat is which specifically binds the receptor ligand VEGF.

The preferred embodiment of the invention relates to a method of blocking blood vessel growth in humans, which includes the introduction of an effective amount of the above-described fused polypeptide.

In addition, preferred is a method of suppressing the activity of the ligand VEGF receptor in a mammal which comprises the administration to a mammal an effective amount of the above-described fused polypeptide.

Preferred embodiments of the invention relate to specific ways in which the mammal is a human.

Other embodiments of the invention relate to a method of slowing or preventing tumor growth in humans; reduce or prevent edema in humans, in particular of brain edema; reduce or prevent the formation of ascites in humans, in particular of ascites due to ovarian cancer.

Preferred embodiments of the invention relates to fused to a polypeptide capable of binding VEGF polypeptide, which includes: (a) a component of the VEGF receptor, functionally associated with (b) multimerization component, and a component of the VEGF receptor is the only component of the VEGF receptor merged in the polypeptide consists essentially of the amino acid sequence of Ig domain 2 of the extracellular domain is, I can pay tithing VEGF receptor and amino acid sequence of Ig domain 3 of the extracellular domain of the second VEGF receptor.

Another variant embodiment of the invention relates to fused to the polypeptide, in which the first VEGF receptor Flt1 is.

Another variant embodiment of the invention relates to fused to the polypeptide, in which the second VEGF receptor Flk1 is.

Another variant embodiment of the invention relates to fused to the polypeptide, in which the second VEGF receptor is Flt4.

Preferred embodiments of the invention relates to fused to the polypeptide, which amino acid sequence of Ig domain 2 of the extracellular domain of the first VEGF receptor is located above the amino acid sequence of Ig domain 3 of the extracellular domain of a second receptor for VEGF, and fused to the polypeptide, which amino acid sequence of Ig domain 2 of the extracellular domain of the first VEGF receptor is located below the amino acid sequence of Ig domain 3 of the extracellular domain of the second VEGF receptor.

In another embodiment of the invention multimediali component fused polypeptide contains a domain of immunoglobulin, including the option of carrying out the invention, in which the domain of the immunoglobulin chosen from the group comprising the Fc domain of IgG, the heavy chain of IgG and light chain of IgG.

Preferred embodiments of the invention relates to fused to a polypeptide containing the amino acid sequence of alnost modified receptor Flt1, moreover, the amino acid sequence selected from the group consisting of:

(a) amino acid sequence shown in Fig. 13A-13D;

(b) amino acid sequence shown in Fig. 14A-14C;

(C) the amino acid sequence shown in Fig. 15A-15C;

(d) the amino acid sequence shown in Fig. 16A-16D;

(e) the amino acid sequence shown in Fig. 21A-S;

(f) the amino acid sequence shown in Fig. 22A-22P; and

(g) the amino acid sequence shown in Fig. 24A-24C.

Another preferred embodiment of the invention relates to a method of reducing or suppressing the loss of plasma in a mammal, which includes an introduction to the specified mammal above the fused polypeptide.

An alternative preferred embodiment of the invention relates to a method for suppressing the activity of the ligand VEGF receptor in a mammal which comprises the administration to a mammal an effective amount of the above-described fused polypeptide.

Brief description of drawings

Fig. 1. IEF analysis in gel unmodified and acetylated protein Flt1(1-3)-Fc. Unmodified protein Flt1(1-3)-Fc is not able to penetrate into the gel due to its pl>9,3, while acetylated protein Flt1(1-3)-Fc gets in GE the ü and equilibrated at pl 5/2.

Fig. 2. Linking of unmodified and acetylated protein Flt1(1-3)-Fc with tablets coated with Matrigel®. Unmodified protein Flt1(1-3)-Fc well associated with components of the extracellular matrix in Matrigel®, while the acetylated protein Flt1(1-3)-Fc is not associated with the specified components.

Fig. 3. Linking of unmodified, acetylated, and treated with polyethylene glycol protein Flt1(1-3)-Fc when performing analysis based on the Biacore. Acetylated protein (columns 13-16), treated with polyethylene glycol protein (columns 17-20) and treated with heparin protein Flt1(1-3)-Fc (columns 21-24) are able to compete successfully with the associated with the Biacore chip protein Flt1(1-3)-Fc binding VEGF compared with the control protein (columns 1-4) and the extraneous protein (columns 5-8). Unmodified protein Flt1(1-3)-Fc (columns 5-6), apparently only partially compete with the associated with the Biacore chip protein Flt1(1-3)-Fc binding to VEGF.

However, as a result of leaching associated samples 0.5 M NaCl (columns 7-8) get the profile link, similar modified forms of Flt1(1-3)-Fc, which suggests that the unmodified protein shows non-specific binding to the chip, which can be destroyed by washing with salt solution.

Fig. 4. Linking of unmodified, acetylated and processed by what etilenglikolem protein Flt1(1-3)-Fc with VEGF when performing enzyme-linked immunosorbent assay (ELISA). Treated with polyethylene glycol and acetylated proteins Flt1(1-3)-Fc binds to VEGF with an affinity approaching the value characteristic of the unmodified protein Flt1(1-3)-Fc.

Fig. 5. The pharmacokinetic profiles of unmodified, acetylated, and treated with polyethylene glycol protein Flt1(1-3)-Fc. Mice Balb/C (23-28 g) injected subcutaneously with 4 mg/kg of unmodified, acetylated, or treated with polyethylene glycol protein Flt1(1-3)-Fc. Mice from the tail blood sample after 1, 2, 4, 6, 24 hours, 2 days and 3 days after injection of the protein and analyze the serum, performing a standard ELISA designed to detect protein Flt1(1-3)-Fc. Tmaxfor all proteins Flt1(1-3)-Fc is in the range from 6 to 24 hours. Withmaxfor different proteins has the following values: unmodified protein: 0,06 µg/ml to 0.15 µg/ml; acetylated protein: 1/5 µg/ml - 4.0 µg/ml and treated with polyethylene glycol protein: approximately 5 mg/ml

Fig. 6A-6B. IEF analysis of the unmodified gel and step-acetylated Flt1 protein(1-3)-Fc. Unmodified protein Flt1(1-3)-Fc is not able to penetrate into the gel due to its pl>9,3, while most samples step acetylated protein Flt1(1-3)-Fc (samples, acetylated 30-100-fold molar excess) penetrate into the gel and balanced when pl 4/55-8,43 depending on the degree acetiminophen who I am.

Fig. 7. Linking of unmodified and step-acetylated Flt1 protein(1-3)-Fc with tablets coated with Matrigel®. As in the case of foreign control protein, rTie2-Fc, step-acetylated Flt1 protein(1-3)-Fc (samples, acetylated 20 - and 30-fold molar excess) is not associated with the tablet coated with Matrigel, while deacetylating protein Flt1(1-3)-Fc is characterized by significant binding. Sample, acetylated 10-fold molar excess, has less binding, but the degree of acetylation is not sufficient to completely block binding to components of the extracellular matrix.

Fig. Linking of unmodified and step-acetylated Flt1 protein(1-3)-Fc when performing analysis based on the Biacore. When substochiometric ratio (0.5 μg/ml of unmodified or step acetylated protein Flt1(1-3)-Fc 0.2 μg/ml VEGF) in solution is not enough protein Flt1(1-3)-Fc (unmodified or step acetylated protein) to bind VEGF. At a concentration of 1.0 microgram/ml, which is approaching the stoichiometric ratio of 1:1 as the unmodified protein, and step acetylated protein Flt1(1-3)-Fc better compete for preferential binding to VEGF, but still not enough protein Flt1(1-3)-Fc (unmodified or with opendata acetylated protein) for full saturation of available VEGF. However, at concentrations of 5, 0 µg/ml, which is several times higher than the stoichiometric ratio 1:1, as protein Flt1(1-3)-Fc, and step acetylated protein Flt1(1-3)-Fc is able to saturate VEGF regardless of the degree of acetylation.

Fig. 9. The pharmacokinetic profiles of unmodified and step-acetylated Flt1 protein(1-3)-Fc. Mice Balb/c mice (23-28 g) injected subcutaneously with 4 mg/kg of unmodified protein or step acetylated 10-, 20-, 40-, 60-and 100-fold excess of protein Fit1(1-3)-Fc (3 mice for unmodified protein and samples, acetylated for 10-, 20 - and 40-fold excess, 2 mouse samples, acetylated 60-and 100-fold excess). Mice from the tail blood sample after 1, 2, 4, 6, 24 hours, 2 days and 3 days after injection. Serum analyzed using the standard analysis based ELISA kit is intended for detection of protein Flt1(1-3)-Fc. Tmaxfor all tested proteins Flt1(1-3)-Fc corresponds to 6 hours. Withmaxhas the following values: unmodified protein Flt1(1-3)-Fc - 0/06 µg/ml; sample, acetylated 10-fold excess, - 0/7 µg/ml, sample, acetylated 20-fold excess of 2 μg/ml, sample, acetylated 40-fold excess of 4 µg/ml, sample, acetylated 60-fold excess of 2 μg/ml, sample, acetylated 100-fold excess of 1 mg/ml

Fig. 10A-10D. Nucleotide and deduced amino acid placentas is the activity of the protein Flt1(1-3)-Fc.

Fig. 11. Schematic illustration of the structure of Flt1.

Fig. 12A and 12B. Analysis of hydrophilicity amino acid sequence of Ig domain 2 and domain 3 Flt1 Ig.

Fig. 13A-13D. Nucleotide and deduced amino acid sequence Mut1:

Fig. 14A-14C. Nucleotide and deduced amino acid sequence Mut2;

Fig. 15A-15C. Nucleotide and deduced amino acid sequence Mut3: Flt1(2-3)-Fc.

Fig. 16A-16D. Nucleotide and deduced amino acid sequence Mut4:

Fig. 17. The binding of the unmodified protein Flt1(1-3)-Fc mutant protein with a deletion of the basic region of Flt1(1-3)-Fc and mutant proteinwhen performing analysis based on the Biacore. When substochiometric ratio (0.25 microgram/ml Flt1(1-3)-Fc unmodified, acetylated, or genetically modified samples at 0.1 ág/ml VEGF) protein Flt1(1-3)-Fc is not sufficient to block the binding of VEGF protein Flt1(1-3)-Fc immobilized on the Biacore chip. At a concentration of 0.5 μg/ml of unmodified, acetylated, or genetically modified protein Flt1(1-3)-Fc, the stoichiometric ratio is approaching 1:1 and it increases the ability to block the binding of VEGF to the Biacore chip. At a concentration of 1.0 microgram/ml unmodified, ceciliano or genetically modified protein Flt1(1-3)-Fc, which approximately corresponds to the stoichiometric ratio of 10:1, proteins Flt1(1-3)-Fc is able to block the binding of VEGF with a Biacore chip, but their action is not equivalent. Unmodified and acetylated protein and the mutant protein Mut1:essentially the same block the binding of VEGF, whereas the mutant protein Mut4:blocks the binding is less efficient.

Fig. 18. The binding of the unmodified protein Flt1(1-3)-Fc, Mut1:, Mut2:and Flt1(2-3) mutant proteins with tablets coated with Matrigel®. Unmodified protein Flt1(1-3)-Fc intensively associated with these holes, protein Mut3: Flt1(2-3)-Fc binds somewhat weaker protein Mlt1;binds weaker and protein Mut2:has the best profile, binding is much weaker than any other mutant proteins. Glycosylated mutant protein Mut4:has a minimal advantage when performing analysis using Matrigel.

Fig. 19. The binding of the unmodified protein Flt1(1-3)-Fc, Mut1:, Mut2:and Flt1(2-3) mutant proteins when performing analysis on the basis of ELISA. When tested concentrations nomodifier the cell protein Flt1(1-3)-Fc and mutant proteins Mut1: , Mut2:and Flt1(2-3) equally bind VEGF.

Fig. 20. The pharmacokinetic profiles of unmodified protein Flt1(1-3)-Fc, Mut1:, Mut2:and Flt1(2-3) mutant proteins. These reagents have the following values of Cmax: unmodified protein Flt1(1-3)-Fc - 0.15 ug/ml; protein Flt1(1-3)-Fc, acetylated 40-fold molar excess of 1.5 μg/ml; and Mut1:- 0,7 mg/ml

Fig. 21A-C. Nucleotide and deduced amino acid sequence of the modified receptor Flt1 marked Flt1D2.Flk1D3.FcΔC1 (a).

Fig. 22A-22P. Nucleotide and deduced amino acid sequence of the modified receptor Flt1, receptor Flt1 marked Flt1D2.VEGFR3D3.FcΔC1 (a).

Fig. 23. Analysis of extracellular matrix (ECM). The results of this analysis show that proteins Flt1D2.Flk1D3.FcΔC1 (a) and Flt1D2.VEGFR3D3.FcΔC1 (a) much worse contact the ESM than protein Flt1(1-3)-Fc.

Fig. 24A-24C. Nucleotide and deduced amino acid sequence of the modified receptor Flt1 marked VEGFR1R2-FcΔC1 (a).

Fig. 25A-25C. Analysis of phosphorylation. At 1.5-molar excess of protein Flt1(1-3)-Fc, Flt1(1-3)-Fc (A40) or temporarily expressed protein Flt1D2F1k1D3.FcΔC1 (a) completely blocked the stimulation of the receptor of the above three modificirowan the mi receptors Flt1 compared with the stimulation control environment. In contrast, temporarily expressed protein Flt1D2VEGFR3D3.FcΔC1 (a) does not cause significant block at the specified molar excess compared to the positive control stimulation by VEGF protein. Similar results are shown in Fig. 25V, where the modified receptors Flt used in a threefold molar excess relative to the VEGF165 ligand. In Fig. 25C, where the modified receptors Flt1 used in a sixfold molar excess relative to the VEGF165 ligand, it is shown that temporarily expressed protein Flt1D2VEGFR3D3.FcΔC1 (a) partially blocked due to VEGF165 stimulation of receptors on the cell surface.

Fig. 26A-26C. Analysis of phosphorylation. The discovery by Western blotting of phosphorylated tyrosine protein VEGFR2(Flk1) as a result of stimulation by VEGF165 ligand shows that the receptors on the cell surface is not fosfauriliruyutza stimulating samples, soderjasimi VEGF165, which is pre-incubated with 1 - and 2-fold molar excess (Fig. 26A) or 3 - or 4-fold molar excess (Fig. 26V) temporarily expressed protein Flt1D2Flk1D3.FcΔC1 (a), constantly expressed protein Flt1D2Flk1D3.FcΔC1 (a), or temporarily expressed protein VEGFR1R2-FcΔC1 (a). At all tested concentrations of the modified receptor Flt1 is full the binding of VEGF165 ligand while p is adveritising incubation, there is no detected stimulation of receptors on the cell surface of unrelated VEGF165 compared with the stimulation control environment.

Fig. 27. Analysis of cell proliferation MG/R2. These modified receptors Flt, in particular Flt1(1-3)-Fc, Flt1D2.Flk1D3.FcΔC1 (a) and Flt1D2.VEGFR3D3.FcΔC1 (a), as well as outside the receptor, designated as Tie2-Fc, used as negative control sample is titrated in the range from 40 nm to 20 PM, and incubated on cells for 1 hour at 37°C. Then all wells add VEGF165 recombinant protein of human rights in the concentration of 1.56 nm in the environment of a particular composition. Negative control receptor Tie2-Fc used in any concentration that does not block due to VEGF165 cell proliferation, while Flt1D2.Flk1D3.FcΔC1 (a) blocks of 1.56 nm VEGF165 at half maximum dose, equal to 0.8 nm. Proteins Flt1(1-3)-Fc and Flt1D2.VEGFR3D3.FcΔC1 (a) less effectively inhibit VEGF165 in this analysis, if half of the maximum dose, equal to ˜2 nm. Used separately VEGF165 protein gives a result equal to 1.2 units of absorption, the background absorption is equal to 0.38 units.

Fig. 28. Determination of the stoichiometry of binding analysis based on Biacore. The stoichiometry of binding is calculated in the molar ratio of bound VEGF165 to immobilized Flt1D2.Flk1D3.FcΔC1 (a) or VEGFRl2-FcΔ C1 (a), using the transformation coefficient, equal to 1000 rat units (RU), which is equivalent to 1 ng/ml. the Results show that the stoichiometry of binding is equal to one dimer molecule VEGF165 on one molecule Flt1D2Flk1D3.FcΔC1 (a) or VEGFRlR2-FcΔC1 (a).

Fig. 29 and 30. Determination of the stoichiometry of displacement chromatography. Flt1D2Flk1D3.FcΔC1 (a) or VEGFR1R2-FcΔC1 (a) at a concentration of 1 nm (which is 1000 times greater than the KD of the interaction Flt1D2Flk1D3.FcΔC1 (a) or VEGFR1R2-FcΔC1 (a) /VEGF165 mixed with VEGF165 in different concentrations. After incubation, measure the concentration of free Flt1D2Flk1D3.FcΔC1 (a) in solution. Data show that the addition of 1 nm VEGF165 in solution Flt1D2Flk1D3.FcΔC1 (a) completely blocks the binding Flt1D2Flk1D3.FcΔC1 (a) with the surface of VEGF165. The result suggests that the stoichiometry of binding is equal to one molecule of VEGF165 on one molecule Flt1D2Flk1D3.FcΔC1 (a).

Fig. 31. Pressure chromatography (SEC) under natural conditions. Peak No. 1 corresponds to the complex Flt1D2Flk1D3.FcΔC1 (a) /VEGF165 and peak No. 2 corresponds to the unbound protein VEGF165. Faction, erwerbende within 1.1 and 1.2 ml, combine and add guanidine hydrochloride (GuHCl) to a final concentration of 4.5 M for the dissociation of the complex.

Fig. 32. Pressure chromatography (SEC) in terms of dissociation. To separate the components of the complex receptor-ligand and determine alamae ratio, 50 µl of the dissociated complex is loaded onto a column supersoy Superose 12 PC 3.2/30, balanced 6 M GuHCl solution, and elute. Peak No. 1 corresponds Flt1D2Flk1D3.FcΔC1 (a) and peak No. 2 corresponds to VEGF165.

Fig. 33, 34 and 35. Pressure chromatography (SEC) with scattering in online mode. To determine the molecular weight (MW) of the complex receptor-ligand used column for pressure chromatography with light scattering detector online MiniDawn (Wyatt Technology, Santa Barbara, California) and detectors refractive index (RI) (Shimadzu, Kyoto, Japan). As shown in Fig. 33, the elution profile includes two peaks. Peak No. 1 corresponds to the complex receptor-ligand and peak No. 2 corresponds to the unbound protein VEGF165. The molecular weight is calculated on the basis of signals from the light scattering (LS) and refractive index (RI). A similar procedure is used to determine the molecular weight of the individual components of the complex receptor-ligand. Below are the results of the above definitions: the molecular mass of the complex Flt1D2Flk1D3.FcΔC1 (a)/VEGF165 in the position of the peak is equal to 157300 (Fig. 33), a molecular weight of VEGF165 in the position of the peak is equal to 44390 (Fig. 34) and molecular weight R1R2 in the position of the peak is equal to 113300 (Fig. 35).

Fig. 36. Peptide mapping and analysis of glycosylation. Disulfide patterns and sites of glycosylation in Flt1D2Flk1D3.FcΔC1 (a) set the ut method for peptide mapping. Flt1D2Flk1D3.FcΔC1 (a) contains a total of ten cysteines, six of which relate to the field Fc. Cys27 linked by a disulfide bond with Cys76. Cys121 linked by a disulfide bond with Cys182. The first two cysteines in the field Fc (Cys211 and Cys214) form intermolecular disulfide bonds with two similar cysteine in another circuit Fc. However, it is impossible to determine whether formed disulfide bonds between identical cysteine (for example, Cys211 with Cys211) or between Cys211 and Cys214. Cys216 linked by a disulfide bond with Cys 306. Cys352 linked by a disulfide bond with Cys410.

In Flt1D2Flk1D3.FcΔC1 (a) there are five probable N-linked glycosylation sites, which are known to be glycosylated to varying degrees. Full glycosylation occurs on sites Asn 33, Asn193 and Asn282. Partial glycosylation occurs on sites Asn65 and Asn120. Sites of glycosylation in the drawing underlined.

Fig. 37. The pharmacokinetics of Flt1(1-3)-Fc (A40), Flt1D2Flk1D3.FcΔC1 (a) or VEGFR1R2-FcΔC1 (a). Mice Balb/c mice injected subcutaneously with 4 mg/kg of Flt1(1-3)-Fc (A40), Flt1D2Flk1D3.FcΔC1 (a), temporarily expressed in Chinese hamster ovary (Cho), Flt1D2Flk1D3.FcΔC1 (a), constantly expressed in Cho and VEGFRlR2-FcΔd(a), temporarily expressed in Cho. Mice from the tail blood sample after 1, 2, 4, 6, 24 hours, 2 days, 3 days and 6 days after injection. Serum analyzed using ELISA designed to detect Flt1(1-3)-Fc (A4), Flt1D2Flk1D3.FcΔC1 (a) or VEGFR1R2-FcΔC1 (a). Tmaxfor Flt1(1-3)-Fc (A40) corresponds to 6 hours, while Tmaxfor temporarily and permanently expressed protein Flt1D2Flk1D3.FcΔC1 (a) and temporarily expressed protein VEGFR1R2-FcΔC1 (a) is 24 hours. Withmaxfor Flt1(1-3)-Fc (A40) is equal to 8 micrograms/ml, Cmaxfor temporarily expressed proteins Flt1D2Flk1D3.FcΔC1 (a) and VEGFR1R2-FcΔC1 (a) is 18 mcg/ml and Cmaxfor constantly expressed protein VEGFR1R2-FcΔC1 (a) is 30 mcg/ml

Fig. 38. The pharmacokinetics of Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.FcΔC1 (a) and Flt1D2.VEGFR3D3-FcΔC1 (a). Mice Balb/c mice injected subcutaneously with 4 mg/kg Fltl(1-3)-Fc (A40), Flt1D2.Flk1D3.FcΔC1 (a), temporarily expressed in Chinese hamster ovary (Cho), and Flt1D2.VEGFR3D3-FcΔC1 (a), temporarily expressed in Cho. Mice from the tail take blood through 1, 2, 5, 6, 7, 8, 12, 15 and 20 days after injection. Serum analyzed using ELISA designed to detect Flt1(1-3)-Fc, Flt1D2.Flk1D3.FcΔC1 (a) or Flt1D2.VEGFR3D3-FcΔC1 (a). Flt1(1-3)-Fc (A40) is not detected in the serum after 5 days, and Flt1D2.Flk1D3.FcΔC1 (a) and Flt1D2.VEGFR3D3-FcΔC1 (a) detected after 15 days and more.

Fig. 39. The ability Flt1D2.Flk1D3.FcΔC1 (a) to suppress the growth of tumor fibrosarcoma HT-1080 in vivo. Introduction SCID mice every other day or 2 times a week FltlD2.Flk1D3.FcΔC1 (a) at a dose of 25 mg/kg significantly reduces the growth of subcutaneous tumors fibrosarcoma HT-1080.

Fig. 40. The ability Ft1D2.Flk1D3.FcΔ C1 (a) to suppress tumor growth of C6 glioma cells in vivo. Introduction SCID mice every other day or 2 times a week Flt1D2.Flk1D3.FcΔC1 (a) at a dose of 2.5 mg/kg significantly reduces the growth of subcutaneous tumors C6 glioma cells.

Fig. 41. VEGF-induced hyperpermeability of the uterus. Subcutaneous injection of PMSG (5 M.E. Ter-Minassian) for ovulation of female rats in the prepubertal period stimulates the release of estradiol 2 days, which in turn causes the induction of VEGF in the uterus. This induction increases the permeability of the uterus and the content of the liquid. Subcutaneous administration Flt(1-3)-Fc (A40), Flt1D2.Flk1D3.FcΔC1 (a) or FltD2,VEGFR3D3-FcΔC1 (a) at a dose of 25 mg/kg within 1 hour after administration of PMSG approximately 50% reduction in the mass of fluid in the uterus.

Fig. 42A-42. Assessment of angiogenesis yellow body with the use of progesterone as a testing agent. Subcutaneous injection of PMSG (5 M.E. Ter-Minassian) to induce ovulation of female rats in the prepubertal period causes the formation of an active yellow body with a dense network of blood vessels, which secretes progesterone in the bloodstream, preparing the uterus for fertilization. For the formation of blood vessels in the yellow body needed VEGF. The levels of progesterone in the state of rest is approximately 5 ng/ml and can be increased to 25-40 ng/ml after administration of PMSG. Subcutaneous injection of Flt1(1-3)-Fc (A40) or Flt1D2.Flk1D3.FcΔC1 (a) at a dose of 25 mg/kg or 5 mg/kg within 1 hour after administration of PMSG p the color suppresses the induction of progesterone on day 4.

Detailed description of the invention

In this area there has long been a problem of getting a VEGF antagonist on the basis of the receptor, the pharmacokinetic profile which would be considered the antagonist as a potential drug. The authors of the present invention for the first time describe the molecule chimeric polypeptide capable of inhibiting the activity of VEGF, which has improved pharmacokinetic properties compared with other known antagonists of VEGF-based receptor. The chimeric molecules of the polypeptide described in this description of the invention, the first steel suitable for use in medical practice, the purpose of which is to suppress the activity of VEGF.

The present invention relates to novel chimeric molecules of the polypeptide obtained by merging the modified extracellular ligand binding domain of the receptor Flt1 with the Fc region of immunoglobulin G (IgG).

Extracellular ligand binding domain is defined as part of the receptor, which in its native conformation in the membrane of the cell is the extracellular orientation, where it may come in contact with cognate ligand. Extracellular ligand binding domain does not contain hydrophobic amino acids characteristic of the transmembrane domain of the receptor, or any other amino acids, characteristic glamorisation domain of the receptor. Intracellular or cytoplasmic domain of the receptor usually includes positively charged or polar amino acids (lysine, arginine, histidine, glutamic acid, aspartic acid). Previous (15-30), predominantly hydrophobic or nonpolar amino acids (leucine, valine, isoleucine and phenylalanine) form a transmembrane domain. The extracellular domain contains amino acids that precede hydrophobic transmembrane fragment of the amino acids. The transmembrane domain is usually flanked by positively charged or polar amino acids such as lysine or arginine. Von Heine published detailed rules that allow experts to determine which amino acids of this receptor belong to the extracellular, transmembrane or intracellular domains (see von Heijne, 1995, BioEssays 17:25-30). Information on the prediction domain protein can alternatively be obtained on such other Web sites the Internet as http://ulrec3.unil.ch/software/TMPRED_form.html.

The present invention relates to the design of molecules of nucleic acid molecules encoding chimeric polypeptides, which is inserted into a vector that can Express the chimeric molecules of the polypeptide when introduced in a suitable cell host. Appropriate cell hosts include, but are not limited to, bacterially cells, yeast cells, insect cells and mammalian cells. To construct expressing vectors encoding the molecules of the chimeric polypeptide under the control of signals transcriptional/translational control, you can use any methods used by experts in this field to embed the DNA fragments into a vector. These methods may include methods of recombinant DNA and methods of synthesis in vitro and recombination in vivo (genetic recombination) (see Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory; Current Protocols in Molecular Biology, Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience, NY).

The expression of molecules of the nucleic acid molecules encoding chimeric polypeptides, can be adjusted second nucleotide sequence so that the molecule is chimeric polypeptide was expressed in a host transformed with the recombinant DNA molecule. For example, the expression of the described molecules of the chimeric polypeptides can be controlled by any promoter/enhancer known in this field. Promoters that can be used to regulate the expression of molecules of the chimeric polypeptides include, but are not limited to, the long terminal repeat as described in the article by Squanto and others (Squinto et al., 1991, Cell 65:1-20); the early SV40 promotor region (Bernoist and Chambon, 1981, Nature 290:304-310), the CMV promoter, the 5'-terminal repeat M-MuLV, a promoter located in long 3'-terminal repeat of rous sarcoma virus (Yamamoto, et al., 1980, Cell 22:787-797), the promoter timedancing herpes (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:144-1445), the regulatory sequences of the gene of metallothionine (Brinster et al., 1982, Nature 296:39-42); Pro-kriticheskie expressing vectors, such as promoter β-lactamase (Villa-Kamaroff, et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731), or tac-promoter (DeBoer, et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25); see also "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242:74-94); promoters from yeast or other fungi such as the promoter Gal 4 promoter, the ADH (alcohol dehydrogenase)promoter, PGK (phosphoglycerate), alkaline phosphatase promoter, and the following animal transcriptional control region of the animals that are characterized by tissue specificity and are used in transgenic animals: the area of gene control elastase I, which is active in the acinar cells of the pancreas (Swift et al., 1984, Cell 38:639-646; Ornitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol. 50:399-409; MacDonald, 1987, Hepatology 7:425-515); the genetic control of insulin that is active in the beta cells of the pancreas (Hanahan, 1985, Nature 315:115-122), the area of genetic control of immunoglobulin, which is active in lymphoid cells (Grosschedl et al., 1984, Cell 38:647-658; Adames et al., 1985, Nature 318:533-538; Alexander et al., 1987, Mol. Cell. Biol. 7:1436-1444), the area of viral control mammary gland tumors in mice, which is active in cells of the testis, breast, lymphoid and mast cells (Leder et al., 1986, Cell 45:85-495), the area of genetic control of the albumin, which is active in liver (Pinkert et al., 1987, Genes and Devel. 1:268-276), the area of genetic control of alpha-fetoprotein, which is active in liver (Krumlauf et al., 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et al., 1987, Science 235:53-58); the genetic control of alpha-1-antitrypsin, which is active in liver (Kelsey et al., 1987, Genes and Devel. 1:161-171), the area of gene control beta-globin, which is active in myeloid cells (Mogram et al., 1985, Nature 315:338-340; Kollias et al., 1986, Cell 46:89-94); the genetic control of the basic protein of myelin, which is active in oligodendrocyte brain (Readhead et al., 1987, Cell 48:703-712); region gene control light chain 2 myosin, which is active in skeletal muscle (Shani, 1985, Nature 314:283-286), and the area of genetic control of gonadotropic hormone that is active in the hypothalamus (Mason et al., 1986, Science 234:1372-1378).

Thus, in accordance with the present invention expressing vectors that can replicate in a bacterial or eukaryotic host containing a nucleic acid encoding the above-described chimeric molecule polypeptide, used for transfection of the host, thereby regulating the expression of such nucleic acids with the aim of producing chimeric molecules of the polypeptide, which can then be allocated in a biologically active form. Used here is the term "biologically active form of oznacza the t form, the ability to communicate with VEGF.

Expressing the vectors containing molecules described chimeric nucleic acid can be identified by three General characteristics: (a) hybridization DNA-DNA, (b) the presence or absence of gene functions-"token" and (C) the expression of the built-in sequences. In accordance with the first sign of the presence of a foreign gene integrated in expressing vector can be detected by hybridization DNA-DNA using probes comprising sequences that are homologous to the inserted sequences of molecules of the chimeric polypeptide. In accordance with the second approach, the recombinant system vector/host can be identified and selected with respect to the presence or absence of certain functions of the gene-marker" (e.g., activity timedancing, the antibiotic resistance phenotype transformation, education Taurus inclusion in baculovirus, etc)caused by the introduction of foreign genes in the vector. For example, if the DNA sequence of the chimeric molecules of the polypeptide is embedded in the sequence of the gene marker of the vector, recombinants containing the insert can be detected by the lack of function of the gene marker. In accordance with the third approach, recombinant expressing vectors can be identified by analyzing the product of a foreign gene, expressed recombinant is. Such assays can be based, for example, on the physical or functional properties of the molecules of the chimeric polypeptides.

Cells of the present invention can temporarily or preferably structurally and constantly to Express the molecules of the chimeric polypeptides.

The molecules of the chimeric polypeptides can be cleaned by any method which allows to obtain a stable, biologically active molecule is a chimeric polypeptide. As an example, not limiting the scope of invention, it can be noted that the factors can be isolated from cells as a soluble protein or Taurus enable of which they can be extracted quantitatively 8 M solution of guanidine hydrochloride and dialysis (see, for example, Builder, et al., U.S. patent No. 5663304). For further purification of the factors you can use the standard ion-exchange chromatography, hydrophobic chromatography, chromatography with reversed-phase and gel filtration.

In accordance with one embodiment of the invention the nucleotide sequence encoding the first component is located at the top from the nucleotide sequence. encoding the second component. In accordance with another embodiment of the invention the nucleotide sequence encoding the first component is located below the nucleotide after the outermost, encoding the second component. Other embodiments of the invention, which changed the order of first, second and third components of the fused polypeptide. For example, if the nucleotide sequence encoding the first component, labeled 1, the nucleotide sequence encoding the second component, denoted by 2 and the nucleotide sequence of the third component, denoted by 3, then the order of the components in the selected nucleic acid according to this invention when read from 5'-end to 3'-end can be any of the following six combinations: 1, 2, 3; 1, 3, 2; 2, 1, 3; 2, 3, 1; 3, 1, 2 or 3, 2, 1.

The present invention can also be used for diagnostic and therapeutic purposes. In accordance with certain variants of the invention, methods of detecting aberrations in the function or expression of the above molecules of the chimeric polypeptides can be used to diagnose disorders. In accordance with other variants of the invention, manipulating the molecules of the chimeric polypeptides, agonists or antagonists, which bind the molecules of the chimeric polypeptides, it is possible to treat the disease. In accordance with other variants of the invention, the chimeric molecule of the polypeptide can be used as an agent that blocks the existing binding of a binding agent with its target.

As an example, not limiting the scope of invention, it should be noted that the method according to this invention can be used effectively for the treatment of clinical conditions which are characterized by vascular permeability, edema or inflammation, such as swelling of the brain caused by trauma, stroke or tumor; swelling caused by inflammation, such as psoriasis or arthritis, including rheumatoid arthritis; asthma, generalized edema caused by burns; ascites and pleural effusion caused by tumors, inflammation or trauma; chronic inflammation of the Airways; the syndrome permeability of capillary vessels; sepsis; kidney disease caused by high loss protein; and eye diseases, such as senile macular degeneration and diabetic retinopathy.

Analysis of the amino acid sequence of Flt1(1-3)-Fc indicates the presence of an unusually large number (46) of the basic amino acid lysine residue. IEF analysis of protein Fltl(1-3)-Fc shows that the value of the pl protein exceeds 9,3, confirming the hypothesis that this protein is highly basic. There is a hypothesis that the basic nature of the protein Flt1(1-3)-Fc causes him to communicate with components of the extracellular matrix and that this interaction may be caused by extremely short detectable PE the iodine half-life of serum, characteristic of Flt1(1-3)-Fc, when injecting the mice. To test this hypothesis protein Flt1(1-3)-Fc will acetimidoyl at lysine residues, to reduce the basicity. Acetylated protein Flt1(1-3)-Fc experience, performing the following tests.

The following examples are given for illustration only and do not limit the scope of the invention.

EXAMPLES

Example 1. Expression of protein Flt1(1-3)-Fc K1 cells Cho

Using standard methods of molecular biology (see, for example, Molecular Cloning, A Laboratory Manual (Sambrook, et al., Cold Spring Harbor Laboratory), Current Protocols in Molecular Biology (Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience, NY)), the gene encoding Flt1(1-3)-Fc, introducing expressing vector REE (Lonza Biologies, plc) at the multiple cloning site below the CMV promoter. Cells K1 SNO transferout design DNA REE/Flt1(1-3)-Fc, using lipofectamine (Gaithersburg, MD). Transfected cells K1 CHO grown in not containing the glutamine DMEM (JRH, Kansas City, MO), containing 25 μm methanesulfonamide (MSX) company Sigma Inc., St. Louis, MO, and get expressor recombinant protein, exploring supernatant K1 cells CHO from more than 100 hand-picked isolates colonies using standard immunoassay that can detect and highlight Fc man. Selected handpicked clone amplified in the presence of 100 μm MSX and perform a second series of studies of the amplified clones. JV is Titicaca productivity of recombinant protein Flt1(1-3)-Fc producing the clone is equal to 55 PG/cell/day.

The selected clone propagated in T-shaped flasks with a capacity of 225 cm2(Corning, Acton, MA) and then injected into the rotating bottles 8/5 l (Corning, Acton, MA), using the above media for culturing cells. Cells are removed from the rotating vials with standard treatment with trypsin and placed in a 3.5 l suspendida environment. Suspendida environment is not containing glutamine environment ISCHO (Irvine Scientific, Santa Ana, CA)containing 5% fetal calf serum (FBS firm Hyclone Labs, Logan, UT), 100 μm MSX and additive GS (JRH Scientific, Kansas City, MO), which is located in the Celligen bioreactor with a capacity of 5 l (New Brunswick Scientific, New Brunswick, NJ) with a density of 0.3×106cells/ml When the cells reach a density of 3.6×106/ml and adapted to suspension, transferred into a bioreactor with a capacity of 60 l (ABEC, Allentown, PA) with a density of 0.5×106cells/ml in 20 l environment ISCHO with 5% fetal calf serum. After two days in bioreactor impose additional 20 l ISCHO+5% fetal calf serum. Cells are grown for a further two days to achieve final density, 3,1×106cells/ml, while the final concentration of Fltl(1-3)-Fc during the collection of cells equal to 95 mg/L. Collected cells are removed by filtration tangential flow using 0.45 µm filters Prostak (Millipore, Inc., Bedford, MA).

Example 2. The protein purification Flt1(1-3)-Fc, obtained from K1 cells Cho

the trees Flt1(1-3)-Fc initially purified by affinity chromatography. To bind with high specificity to the Fc portion of the molecule using Protein a column A. Purified by affinity protein concentrate and passed through a column of SEC. Then elute protein in the buffer. Details about these methods.

Materials and methods

All chemicals provided by the company J.T. Baker, Phillipsburg, NJ, with the exception of PBS, which is provided in the form of a 10-fold concentrate of the firm Life Technologies, Gaithersburg, MD. Resins for drugs Protein A Fast Flow and Superdex 200 provided by the company Pharmacia, Piscataway, NJ. Equipment and membranes for the concentration of the protein provided by the company Millipore, Bedford, MA.

About 40 liters filtered through 0.45 µm filters, air-conditioned cells SNO environment containing protein Flt1(1-3)-Fc, enter in 290 ml column of Protein A Fast Flow (diameter 10 cm), which is pre-PBS balance. The column was washed with PBS containing 350 mm NaCl and 0.02% CHAPS, and associated protein elute 20 mm citric acid, containing 10 mm Na2HPO4. In the elution received one peak and the pH brought to the neutral values of 1M NaOH solution. Fractions of the eluate concentrated to about 9 mg/ml filtration tangential flow through a regenerated cellulose membrane with a molecular weight of 10000 and concentration of mixed cells. To remove aggregates and other impurities, concentrated b the Lok injected into the column, filled with resin to drugs Superdex 200 (10 cm ×5 cm), and examined in PBS containing 5% glycerol. The main peak fractions unite, filtered under sterile conditions, take an aliquot of the protein and stored at -80°C.

Example 3. Acetylation of protein Fltl(1-3)-Fc

Two milligrams of protein Fltl(1-3)-Fc will acetimidoyl in accordance with the instructions attached to the kit to modify sulfo-NHS-acetate (Pierce Chemical Co., Rockford, IL, Cat.#26777).

Example 4. The study acetylated protein Flt1(1-3)-Fc

(a) IEF analysis. Protein Fltl(1-3)-Fc and acetylated protein Flfc1(1-3)-Fc analyze, performing standard IEF analysis. As shown in Fig. 1, protein Flt1(1-3)-Fc is not able to penetrate into the gel, so it must have an indicator above pl of 9.3, which is the highest indicator pl in control. However, acetylated protein Flt1(1-3)-Fc can penetrate into the gel and equilibrated at about 5.2 pl. The result shows that acetylation significantly reduces the total positive charge of the protein, and the indicator pl.

(b) Binding to components of the extracellular matrix

Binding of the protein Flt1(1-3)-Fc and acetylated protein Flt1(1-3)-Fc with components of the extracellular matrix experience, performing analysis, simulating the interaction with components of the extracellular matrix. When performing this analysis 96-well tablets for culturing tissue is facilitated with Matrigel (96-well plate with a thin layer of matrix Biocoat MATRIGEL® No. of catalog 40607, Becton Dickinson Labware, Bedford, MA). Tablets incubated by adding to the wells of different concentrations of protein Flt1(1-3)-Fc, acetylated protein Flt1(1-3)-Fc, or rTie2-Fc (foreign control protein). Tablets incubated for 1-2 hours at room temperature or 37°and detects associated proteins, adding to the wells of the secondary conjugated with alkaline phosphatase antibody against the Fc man. Then in the wells add the substrate on the basis of alkaline phosphatase and measure the optical density. Figure 2 shows the results of this analysis. Like outside the control protein rTie2-Fc acetylated protein Flt1(1-3)-Fc is not associated with the tablet coated with Matrigel, while deacetylating protein Flt1(1-3)-Fc is characterized by significant binding. The results show that acetylation of basic amino acid residues is an effective way to suppress the interaction of charges, which occurs between the positively charged protein and the negatively charged components of the extracellular matrix in vivo.

Example 5. Processing protein Flt1(1-3)-Fc polyethylene glycol

Although it is known that the processing of proteins by polyethylene glycol (PEG) increases their activity in vivo, thereby increasing the stability and biological availability and minimizing immunogenicity (see above links), there is the anti-Christ. ologne opinion, what molecule is polyethylene glycol, which are too large and cannot be filtered by the glomeruli of the kidney, improve the pharmacokinetic properties of proteins. Not limited by theory, the authors present invention concluded that the treatment of molecules Flt1(1-3)-Fc polyethylene glycol can improve pharmacokinetic properties, but not due to a change of a positive charge or decrease the value pl Flt1(1-3)-Fc, and the physical protection of positive charges from the interaction with extracellular matrix. The authors of the present invention have attempted to improve the pharmacokinetic properties of molecules Flt1(1-3)-Fc by attaching chains of polyethylene glycols with a molecular weight of 20,000, as described below.

Materials and methods

Purified protein Flt1(1-3)-Fc, was isolated from the cells Cho (see above), is used in the following experiments on the processing of polyethylene glycol. Functional glycols provided by the firm Shearwater Polymers, Huntsville, AL.; bitin provided by the company Sigma, St. Louis, MO; column supersoy Superose 6 provided by the company Pharmacia, Piscataway, NJ; PBS in a 10-fold concentrate provided by the firm Life Technologies, Gaithersburg, MD; glycerin provided by the company J..Baker, Phillipsburg, NJ; and preformed gels Bis-Tris granted by the company Novex, CA.

In laboratory studies used the PEG chain with a molecular what assay 20000, having functional adminsparadise end parts, which are designed to assess different conditions of the reactions, which changes the stoichiometry of PEG:protein. Performing the reaction and analyzing the samples to the standard method of polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate (SDS-PAGE), protein Flt1(1-3)-Fc at a concentration of 1.5 mg/ml is subjected to interaction at pH 8.1 with molecules of SPA-PEG (succinimidylester poly (ethylene glycol) with molecular weight of 20000 at a molar ratio of PEG and monomer Flt1(1-3)-Fc, equal to 1:6. The reaction is carried out by 8°With during the night. For the primary purification of the reaction products enter in column supersoy Superose 6, 10 mm×30 cm, equilibrated PBS containing 5% glycerol. In column separates treated with polyethylene glycol molecules Flt1(1-3)-Fc in accordance with the degree of processing polyethylene glycol. Combine the fractions corresponding to the singly and doubly treated with polyethylene glycol dimeric protein Flt1(1-3)-Fc, judging by the nature of the bands on reducing and non gels for SDS-PAGE. The protein concentration determined by measuring the optical density at 280 nm. Treated with polyethylene glycol protein Flt1(1-3)-Fc is filtered under sterile conditions, take an aliquot of the protein and stored at -40°C.

Example 6. Linking of unmodified, azetilirovannah and treated with polyethylene glycol protein Flt1(1-3)-Fc when performing analysis based on Biacore

Unmodified, acetylated, and treated with polyethylene glycol proteins Flt1(1-3)-Fc experience, performing analysis based on the Biacore, to assess their ability to bind with the ligand Flt1, VEGF. When performing this analysis unmodified protein Flt1(1-3)-Fc immobilized on the surface of a Biacore chip (see instructions for using the Biacore chip, the firm Pharmacia, Inc., Piscataway, NJ, performing standard analyses) and the sample containing 0.2 μg/ml VEGF and unmodified, acetylated, or treated with polyethylene glycol protein Flt1(1-3)-Fc (each at a concentration of 25 μg/ml) is passed through the chip, covered Flt1(1-3)-Fc. In order to minimize the effects of nonspecific binding, related samples washed with 0.5 M NaCl. In one sample of unmodified protein Flt1(1-3)-Fc mixed with heparin. Heparin is a negatively charged molecule, and protein Flt1(1-3)-Fc has a positively charged molecule, so when mixing two such molecules they must interact with their charges. This is essentially neutralizes the inherent protein Flt1(1-3)-Fc positive charge, the molecule acquires properties of chemically or genetically modified molecules, and therefore decreases its charge and the ability to communicate as a result of interaction of charges. As shown in Fig. 3, acetylated (columns 13-16), processed what poliatilenglikole (columns 17-20) and treated with heparin proteins Flt1(1-3)-Fc (columns 21-24) is able to fully compete with the associated with the Biacore chip protein Flt1(1-3)-Fc for binding to VEGF compared with the control sample (columns 1-4) and the extraneous protein (columns 5-8). Unmodified protein Flt1(1-3)-Fc (columns 5-6), appears to be only partially competes with the associated with the Biacore chip protein Flt1(1-3)-Fc for binding to VEGF. However, rinsing related samples of 0.5 M NaCl (columns 7-8), get the profile link, similar to modified forms of the protein Flt1(1-3)-Fc, which suggests that non-modified protein forms a non-specific communication with the chip, which can be destroyed by washing with salt solution.

Example 7. Linking of unmodified, acetylated, and treated with polyethylene glycol protein Flt1(1-3)-Fc when performing analysis on the basis of ELISA

Unmodified, acetylated, and treated with polyethylene glycol proteins Flt1(1-3)-Fc experience using the standard analysis based ELISA to assess their ability to bind the ligand VEGF receptor Flt1. As shown in Fig. 4, treated as polyethylene glycol, and acetylated proteins Flt1(1-3)-Fc is able to communicate with VEGF, suggesting that modification of the protein by treatment with polyethylene glycol or acetylation does not affect its ability to bind the specified ligand.

Example 8. Pharmacokinetic analysis of unmodified, acetylated, and treated with polyethylene glycol protein Flt1(1-3)-Fc

The in vivo experiments performed to assess Farmak is kineticheskikh profiles unmodified, acetylated and treated with polyethylene glycol protein Flt1(1-3)-Fc. Mice Balb/c mice (23-28 g; 3 mice per group) injected subcutaneously with 4 mg/kg of unmodified, acetylated, or treated with polyethylene glycol protein Flt1(1-3)-Fc. Mice from the tail blood sample after 1, 2, 4, 6, 24 hours, 2 days and 3 days after injection of the protein. Serum analyzed using the standard analysis based ELISA kit is intended for detection of protein Flt1(1-3)-Fc. The analysis procedure can be summarized as follows: tablet cover for ELISA VEGF bind serum containing unmodified, acetylated, or treated with polyethylene glycol protein Flt1(1-3)-Fc, and read the results using the antibody against the Fc associated with alkaline phosphatase. As shown in Fig. 5, Tmaxfor all proteins Flt1(1-3)-Fc is in the range from 6 to 24 hours. Withmaxfor different proteins has the following values: unmodified protein: 0,06 µg/ml to 0.15 µg/ml; acetylated protein: 1.5 mcg/ml - 4.0 µg/ml and treated with polyethylene glycol protein: approximately 5 mg/ml

Example 9. Step acetylation protein Flt1(1-3)-Fc

To determine the minimum degree of acetylation necessary to eliminate binding to components of the extracellular matrix, produce a stepped acetylation protein Flt1(1-3)-Fc, using the increasing number of molar isback acetylides reagent in acatalasemia the reaction mixture. Use the following molar excess: 0, 10, 20, 30, 40, 50, 60, 70, 80, 90 and 100 moles acetylides reagent per 1 mol of the monomer Flt1(1-3)-Fc. The reaction is carried out according to instructions attached to the kit to modify sulfo-NHS-acetate (Pierce Chemical Co., Rockford, IL, Cat. #26777).

Example 10. Study manual acetylated protein Flt1(1-3)-Fc

(a) IEF analysis. Unmodified protein Flt1(1-3)-Fc and step-acetylated proteins Flt1(1-3)-Fc analyze, performing standard IEF analysis. As shown in Fig. 6A-6B, unmodified protein Flt1(1-3)-Fc is not able to penetrate into the gel due to the extremely high values of pl (above and 9.3). However, most speed acetylated proteins Flt1(1-3)-Fc (samples, acetylated 30-100-fold molar excess) is able to penetrate into the gel and balanced when values of pl 4,55-8,43 depending on the degree of acetylation. The result shows that acetylation can alter the positive charge of the protein, depending on the dose and that the value of pl can be reduced by adjusting the degree of acetylation.

(b) Binding speed acetylated protein Flt1(1-3)-Fc with components of the extracellular matrix

Protein Flt1(1-3)-Fc and step-acetylated Flt1 protein(1-3)-Fc experience on binding to components of the extracellular matrix by performing the above analysis, which allows to simulate the interaction of the components of the extracellular matrix. In wells add different concentrations of unmodified protein Flt1(1-3)-Fc, step-acetylated Flt1 protein(1-3)-Fc (samples, acetylated for 10-, 20 - and 30-fold molar excess) or protein rTie2-Fc (foreign control protein). Tablets incubated for 1-2 hours at room temperature or 37°and detects associated proteins, adding to the wells of the secondary conjugated with alkaline phosphatase antibody against the Fc man. Then in the wells add the substrate on the basis of alkaline phosphatase and measure the optical density. In Fig. 7 shows the results of this analysis. Like outside the control protein rTie2-Fc step acetylated protein Flt1(1-3)-Fc (samples, acetylated 20-and 30-fold molar excess) marginally associated with the tablet coated with Matrigel, while deacetylating protein Flt1(1-3)-Fc is characterized by significant binding. The binding is saturable, indicating that protein Flt1(1-3)-Fc most likely associated with specific sites, and shall not become more common due to charge interaction, which cannot be saturated. Sample, acetylated 10-fold molar excess, characterized by a lower bound, but the degree of acetylation is insufficient to completely block binding to components of the extracellular matrix. the samples acetylated 20x and a large molar excess, detective binding absent despite the fact that when performing IEF analysis (Fig. 6A and 6B) samples, acetylated lower molar excess, found a large total positive charge. The result shows that it is not necessary to completely azetilirovanie all available essential amino acids to eliminate binding to components of the extracellular matrix.

(C) Linking step acetylated protein Flt1(1-3)-Fc when performing analysis based on Biacore

Unmodified and step-acetylated proteins Flt1(1-3)-Fc experience, performing analysis based on the Biacore, to assess their ability to bind with the ligand Flt1, VEGF. When performing this analysis unmodified protein Flt1(1-3)-Fc (0.5, 1.0, or of 5.0 μg/ml) immobilized on the surface of a Biacore chip (see instructions for using the Biacore chip, the firm Pharmacia, Inc., Piscataway, NJ, performing standard analyses) and a solution containing 0.2 ág/ml VEGF and unmodified protein Flt1(1-3)-Fc (at concentrations of 0.5, and 1.0 or 5.0 μg/ml) or 10 different samples of step acetylated protein Flt1(1-3)-Fc (at concentrations of 0.5, and 1.0 or 5.0 mg/ml each), put on a chip, covered Flt1(1-3)-Fc. As shown in Fig. 8, when substochiometric ratio (0.5 μg/ml of unmodified or step acetylated Flt1(1-3)-Fc on 0/2 μg/ml VEGF) protein Flt1(1-3)-Fc (as unmodified, and step acetylated) not enough solution to fully bind VEGF. At a concentration of 1.0 microgram/ml, which is approaching the stoichiometric ratio of 1:1, as unmodified, and step acetylated proteins Flt1(1-3)-Fc better compete for preferential right to bind VEGF, but protein Flt1(1-3)-Fc (as unmodified, and step acetylated) is still insufficient for complete bonding of available VEGF. However, at a concentration of 5.0 μg/ml, which exceeds several times the stoichiometric ratio of 1:1, as protein Flt1(1-3)-Fc, and step acetylated proteins Flt1(1-3)-Fc can bind VEGF regardless of the degree of acetylation. This clearly shows that acetylation does not change the ability of the protein Flt1(1-3)-Fc to bind VEGF.

(d) Pharmacokinetic analysis step acetylated protein Flt1(1-3)-Fc

The in vivo experiments performed to evaluate the pharmacokinetic profiles of unmodified and step-acetylated Flt1 protein(1-3)-Fc. Mice Balb/c mice (23-28 g) injected subcutaneously with 4 mg/kg of unmodified protein Flt1(1-3)-Fc, or stepped acetylated proteins Flt1(1-3) - Fc (samples, acetylated for 10-, 20-, 40-, 60 - and 100-fold molar excess) (3 mice injected with unmodified protein, as well as samples, acetylated for 10-, 20 - and 40-fold molar excess, and 2 mice injected samples, atilirovanie 60 - and 100-fold molar excess). Mice from the tail blood sample after 1, 2, 4, 6, 24 hours, 2 days and 3 days after injection. Serum analyzed using analysis based ELISA designed to detect Flt1(1-3)-Fc (described above). In Fig. 9 shows the results of this study. Tmaxfor all tested proteins Flt1(1-3)-Fc corresponds to 6 hours, andmaxhas the following values: unmodified protein Flt1(1-3)-Fc - 0,06 µg/ml; sample, acetylated 10-fold molar excess, and 0.7 μg/ml, sample, acetylated 20-fold molar excess of 2 μg/ml, sample, acetylated 40-fold molar excess, 4 ág/ml, sample, acetylated 60-fold molar excess of 2 μg/ml, sample, acetylated 100-fold molar excess of 1 µg/ml. the results show that acetylation or processing polyethylene glycol protein Flt1(1-3)-Fc improves its pharmacokinetic profile.

Example 11. Creating a mutant with a deletion of the basic region of Flt1(1-3)-Fc, marked Mut1:

Considering the fact that acetylated protein Flt1(1-3)-Fc, whose index is below pl 6, characterized by a much better pharmacokinetics than the unmodified protein Flt1(1-3)-Fc with a high positive charge (pl>9,3), the question arises whether it can be attributed to differences in pharmacokinetics due to the total charge of the protein, which vyzyvaet adhesion to negatively charged component of the extracellular matrix, or are on the surface of the protein Flt1(1-3)-Fc specific areas, which form a specific binding sites for components of the extracellular matrix. For example, it is known that many proteins have binding sites of heparin, which often form a cluster of basic residues. Sometimes these remains are found in a cluster in the primary sequence of the protein; in some scientific sources described "consensus sequence" for such binding sites of heparin (see, for example, Hileman, et al., 1998, Bioassays 20 (2):156-67). In other cases, the known crystal structure of a protein allows to detect the cluster of positively charged residues on the surface of the protein, but these remains come from different regions of the primary sequence and combined with three-dimensional packing of the chains in the protein. Thus, it is difficult to establish, forms whether the selected amino acid residue is part of a cluster of basic residues on the surface of the protein. However, if the primary sequence has a cluster of positively charged amino acid residues, can reasonably be assumed that these residues are located close to each other in spatial terms, and therefore can be part of a binding site of extracellular matrix components. Conducted a comprehensive study of receptor Flt1 and description which have different domains (see, for example, Tanaka et al., 1997, Jpn. J. Cancer Res. 88:867-876). Considering the nucleotide and amino acid sequence shown in Fig. 10A-10D, it is possible to identify the signal sequence that regulates the secretion, which is located at the beginning of the sequence and comes to glycine, encoded by nucleotides 76-78. The Mature protein begins with Ser-Lys-Leu-Lys, starting with nucleotide 79 nucleotide sequence. Domain 1 Ig receptor Flt1 covers nucleotides 79-393 and ends with the amino acids Ser-Asp-Thr. Domain 2 Ig receptor Flt1 covers nucleotides 394-687 (encoding amino acids from Gly-Arg-Pro to Asn-Thr-Ile), and domain 3 Ig receptor Flt1 covers nucleotides 688-996 (encoding amino acids from Ile-Asp-Val to Asp-Lys-Ala). This protein has a binding amino acid sequence, Gly-Pro-Gly, encoded by nucleotides 997-1005, followed by nucleotide sequence encoding a Fc man (nucleotides 1006-1701 or amino acids from Glu-Pro-Lys to Pro-Gly-Lys-termination codon).

A more detailed analysis of the amino acid sequence of Flt1 shows that there is a cluster, namely amino acid residues 272-281 (KNKRASVRR), shown in Fig. 10A-10D, in which 6 out of 10 amino acid residues are basic. This sequence is located in the Ig domain 3 of the receptor Flt1 (see Fig. 11) and by itself is not significant for swazilan what I ligand VEGF, but calls defines high affinity binding with the ligand. Comparative sequence analysis of Ig domain 3 with a sequence of Ig domain 2 shows that in this area the two Ig domain have low matching with each other and Ig domain 3 has about 10 more amino acids. The analysis of the profiles of hydrophilicity (MacVector software) these two domains clearly indicates the presence of a hydrophilic region of the protein (Fig. 12A-12B). On the basis of the obtained data it can be assumed that the actual three-dimensional folding of Ig domain 3 of the receptor Flt1 makes possible some expansion, which is impossible in the domain 2 Ig receptor Flt1. To test this hypothesis remove an additional 10 amino acids and investigate protein obtained to determine, does this has a favorable effect on the pharmacokinetics of without serious deterioration of the affinity of the receptor for VEGF. Design DNA, created by standard methods of molecular biology (see, for example. Molecular Cloning, A Laboratory Manual (Sambrook, et al., Cold Spring Harbor Laboratory), Current Protocols in Molecular Biology (Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience, NY)expressing the vector RMT mammal (Genetics Institute, Inc., Cambridge, MA), referred to as Mut1:. Design Mut1:get out of Flt1(1-3)-Fc by deletions of nucleotides 814-843 (showing what the R in Fig. 10A-10D), allowing you to remove the highly basic sequence consisting of 10 amino acid residues Lys-Asn-Lys-Arg-Ala-Ser-Val-Arg-Arg-Arg, Ig domain 3 of the receptor Flt1.

The sequence of the final design DNA sequenced using DNA sequencing machine (ABI 373A and set to cycle sequencing terminator, dideoxy method (Applied Biosystems, Inc., Foster City, CA). The sequence Mut1:it is shown in Fig. 13A-13D.

Example 12. Creating a mutant with a deletion of the basic region of Flt1(1-3)-Fc, denoted Mut2:

The second deletion mutant construction, denoted Mut2:derived from the design Mut1:by deletion of the Ig domain 1 of receptor Flt1 encoded by nucleotides 79-393 (see Fig. 10A-10D); for convenience, the nucleotides 73-78 (TCA GGT) replaced TCC GGA. Thanks to that introduced restriction site (BspE1) without changing the associated amino acid sequence Ser-Gly. In this design DNA, created by standard methods of molecular biology (see, for example. Molecular Cloning, A Laboratory Manual (Sambrook, et al., Cold Spring Harbor Laboratory), Current Protocols in Molecular Biology (Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience, NY)expressing the vector RMT mammal (Genetics Institute, Inc., Cambridge, MA), the sequence was sequenced using DNA sequencing machine (ABI 373A and cyclizes the CSOs sequencing terminator, dideoxy method (Applied Biosystems, Inc., Foster City, CA). The sequence Mut2:it is shown in Fig. 14A-14C.

Example 13. The creation of a deletion mutant of Flt1(1-3)-Fc, marked Mut3: Flt1(2-3)-Fc

The third deletion mutant construction, denoted Mut3: Flt1(2-3)-Fc, created similar mutant constructs Mut2:except that the domain is 3 Ig receptor Flt1 upheld (amino acid core region is not removed). This design is created by standard methods of molecular biology and the sequence of the sequenced as described above. The sequence Mut3: Flt1(2-3)-Fc is shown in Fig. 15A-15C.

Example 14. Creating N-glycosylated mutant core area of Flt1(1-3)-Fc, marked Mut4:

Was created the final design, in which the N-glycosylation sites introduced in the middle of the base region of the Ig domain 3 of the receptor Flt1. This design, designated as Mut4:created by substituting nucleotides 824-825 with GA on AC while replacing the encoded residue Arg (AGA) residue Asn (AAC) (see Fig. 10A-10D). So the resulting amino acid sequence modified with Arg-Ala-Ser to Asn-Ala-Ser, which corresponds to the binding signal (Asn-Xxx-Ser/Thr) to add site N-glycosylation at Asn residue. The sequence Mut4: shown in figa-16D.

Example 15. The study acetylated protein Flt1(1-3)-Fc and mutants Mut1:and Mut4:

(a) Binding to components of the extracellular matrix

To determine whether three modified protein improved pharmacokinetic properties, 96-well plates, coated with Matrigel (described above), incubated with different concentrations of mutant proteins and detect conjugated with alkaline phosphatase antibodies against Fc man. As shown in Fig. 18, performed the experiment shows that if unmodified protein Flt1(1-3)-Fc intensively associated with these wells, the protein Mut3: Flt1(2-3)-Fc binds somewhat weaker protein Mut1:binds weaker and protein Mut2:has the best profile, binding is weaker than any other mutant proteins. Glycosylated mutant protein Mut4:has a minimal advantage, as evidenced by the results of the analysis on Matrigel. The results obtained support the hypothesis that a linear sequence of positively charged amino acids can be deleted from the primary sequence, which in turn decreases the interaction of charges with components wncl the exact matrix.

(b) Binding Mut1:and Mut4:when performing analysis on the basis of Biacore

Unmodified and acetylated proteins Flt1(1-3)-Fc, and genetically modified proteins Mut1:and Mut4:experience performing analysis based on the Biacore, to assess their ability to bind with the ligand Flt1, VEGF. When performing this analysis unmodified protein Flt1(1-3)-Fc (0.25, 0.5 or 1.0 microgram/ml) immobilized on the surface of a Biacore chip (see instructions for using the Biacore chip, the firm Pharmacia, Inc., Piscataway, NJ, performing standard analyses) and a solution containing 0.1 ág/ml VEGF and purified unmodified protein Flt1(1-3)-Fc, or the supernatant of COS cells containing unmodified protein Flt1(1-3)-Fc (at a concentration of about 0.25, 0.5 or 1.0 μg/ml), purified acetylated protein Flt1(1-3)-Fc (at a concentration of 0.25, 0.5 or 1.0 μg/ml), the supernatant of COS cells containing Mut1:(at a concentration of about 0.25, 0.5 or 1.0 microgram/ml), or supernatant of COS cells containing Mut4:(at a concentration of 0.25, 0.5 or 1.0 μg/ml), passed through the chip, covered Flt1(1-3)-Fc. As shown in Fig. 17, when substochiometric ratio (0.25 microgram/ml Flt1(1-3)-Fc unmodified, acetylated, or genetically modified samples of 0.1 MK who/ml VEGF) protein Flt1(1-3)-Fc is not enough to block the binding of VEGF with Flt1(1-3)-Fc immobilized on the Biacore chip. At a concentration of 0.5 μg/ml unmodified, acetylated, or genetically modified proteins Flt1(1-3)-Fc, the stoichiometric ratio is approaching 1:1, this increases the ability of proteins to block the binding of VEGF to the Biacore chip. At a concentration of 1.0 microgram/ml unmodified, acetylated, or genetically modified proteins Flt1(1-3)-Fc stekhiometricheskie ratio approaching 10:1, resulting proteins Flt1(1-3)-Fc provide the VEGF binding by Biacore chip, but their ability is not equivalent. Unmodified, acetylated proteins and Mut1:essentially equally block the binding of VEGF, while Mut4:blocks the binding is less efficient. The results obtained support the hypothesis that it is possible to reduce nonspecific binding of positively charged molecules, removing genetic by a linear sequence of predominantly negatively charged amino acids.

(C) Binding Muti:, Mut2:and Mut3: Flt1(2-3)-Fc when performing analysis on the basis of ELISA

The ability of three mutant proteins to bind ligand VEGF receptor Flt1 determined by performing experiments on hydrogen bonds is aniu, in which 96-well plates, coated with VEGF, incubated with different concentrations of the corresponding mutant protein, after washing, detect bound the number of ligand, incubare culture with conjugated with alkaline phosphatase antibody against Fc human, and produce quantitative determination by colorimetric method by adding the appropriate substrate on the basis of alkaline phosphatase. As shown in Fig. 19, the results of this experiment indicate that all mutant proteins equally able to bind VEGF at the tested concentrations.

Example 16. Pharmacokinetic analysis of the acetylated protein Flt1(1-3)-Fc, Mut1:and unmodified protein Flt1(1-3)-Fc

The in vivo experiments performed to evaluate the pharmacokinetic profiles of unmodified protein Flt1(1-3)-Fc, Mut1:and acetylated 40-fold molar excess of protein Flt1(1-3)-Fc. Mice Balb/C (25-30 g) injected subcutaneously with 4 mg/kg of unmodified protein Flt1(1-3)-Fc, acetylated 40-fold molar excess of protein Flt1(1-3)-Fc protein and Mut1;(4 mice in each group). Mice from the tail blood sample after 1, 2, 4, 6, 24 hours, 2 days, 3 days and 5 days after injection. Serum analyzed using ELISA designed to detect protein Flt1(1-3)-Fc, which enables the fast is tablets for ELISA cover VEGF, tie Flt1(1-3)-Fc, and read the data using the antibody against the Fc associated with alkaline phosphatase. As shown in Fig. 20, Cmaxfor these reagents has the following values: unmodified protein Flt1(1-3)-Fc - 0.15 ug/ml; acetylated 40-fold molar excess of protein Flt1(1-3)-Fc - 1.5 mcg/ml and Mut1:- 0,7 mg/ml

Example 17. Create a vector of modified receptor Flt1

The rationale for creating modified versions of the receptor Flt1 (also known as VEGFR1) is the fact that the protein sequence Flt1 is highly basic, and likely, therefore, associated with extracellular matrix (ECM). The main character Flt1, apparently, explains why the unmodified protein Flt1(1-3)-Fc (described above) has a poor pharmacokinetics, which complicates its use as a drug. As mentioned above, a chemically modified form of acetylated 40-fold molar excess of protein Flt1(1-3)-Fc, hereinafter referred to as A40, has much better pharmacokinetic (PK) profile compared to deacetylating protein Flt1(1-3)-Fc. Therefore, attempts were made to construct DNA molecules that can be used for recombinant expression of modified forms of the molecule, d is aptara Flt1, with improved pharmacokinetic profile, characteristic of the A40, but keeping the ability to tightly contact with VEGF.

From the scientific literature it is known that the first Ig domain of the receptor Flt1 (which has a total charge of +5 at neutral pH) is not important for strong binding to VEGF, therefore, this domain is removed. The third Ig domain (having a total charge of +11) is not important for binding, but calls defines a higher affinity for VEGF than the second Ig domain, so it is not completely removed and replaced with equivalent domains Flk1 (also known as VEGFR2) and Flt4 (also known as VEGFR3), cognate receptor Flt1. The obtained chimeric molecules, denoted respectively R1R2 (Flt1.D2.Flk1D3.FcΔC1 (a) and VEGFR1R2-FcΔC1 (a)) and R1R3 (Flt1D2.VEGFR3D3-FcΔC1 (a) and VEGFR1R3-FcΔC1 (a)), where R1 and Flt1D2 mean Ig domain 2 receptor Flt1 (VEGFR1); R2 and Flk1D3 mean domain 3 Ig receptor Flk1 (VEGFR2) and R3 and VEGFR3D3 means domain 3 Ig receptor Flt4 (VEGFR3), much less contact with the ECM, as evidenced by the results of the following analysis of binding to ECM in vitro, and have a much better pharmacokinetics, as described below. In addition, these molecules are capable closely associated with VEGF and block phosphorylation of the native receptor Flk1, expressed in endothelial cells, as described below.

(a) Sosteniendola plasmids pFlt1D2.Flk1D3.FcΔ C1 (a)

Expressing plasmids 21.Flt1(1-3).Fc (6519 BP) and 21.Flk-1(1-3).Fc (5230 BP) is a plasmid that encodes resistance to ampicillin and Fc-tagged variants of domains 1-3 Ig receptors Flt1 and Flk1 person. These plasmids used to generate a DNA fragment consisting of chimeras domain 2 Ig receptor Flt1 with Ig domain 3 of the receptor Flk1 achieved by amplification of the corresponding domain Ig using polymerase reaction synthesis chain (PCR) with subsequent execution cycle PCR to merge these two domains in one piece. For domain 2 Ig receptor Flfc1 used the following seed for amplification of 5'- and 3'-ends:

5': bsp/flt1D2 (5'-GACTAGCAGTCCGGAGGTAGACCTTTCGTAGAGATG-3')

3': Flt1D2-Flk1D3.as (5'-CGGACTCAGAACCACATCTATGATTGTATTGGT-3')

The seed for amplification of the 5'end encodes the website BspE1 restriction enzyme, located above the Ig domain 2 receptor Flfc1 and determined the amino acid sequence GRPFVEM (corresponding to amino acids 27-33 of Fig. 21A-C). The seed for the 3'end encodes the reverse complement of the 3'end of domain 2 Ig receptor Flt1, bonded directly to the 5'-end of the beginning of Ig domain 3 of the receptor Flk1, where the point merge designated as TIID receptor Flt1 (corresponding to amino acids 123 to 126 in Fig. 21A-C), and reaching VVLS (corresponding to amino acids 127-130 in Fig. 21A-C) receptor Flk1.

For Ig domain 3 of the receptor Flkl used SL is blowing the seed for amplification of 5'- and 3'-ends:

5': Flt1D2-Flk1D3.s (5'-ACAATCATAGATGTGGTTCTGAGTCCGTCTCATGG - 3')

3': Flk1D3/apa/srf.as (5'-GATAATGCCCGGGCCCTTTTCATGGACCCTGACAAATG-3')

The seed for amplification of the 5'end encodes the end of domain 2 Ig receptor Flt1, merged directly with the beginning of Ig domain 3 of the receptor Flk1, as described above. The seed for amplification of the 3'end encodes the end of the Ig domain 3 of the receptor Flk1, defined by amino acids VRVHEK (corresponding to amino acids 223-228 in Fig. 21A-C), followed by a linking sequence that includes a recognition sequence for a restriction enzyme Srf1 and encodes amino acids GPG. Connecting the sequence corresponds to amino acids 229-231 in Fig. 21A-C.

After a cycle of PCR amplification with the aim of obtaining individual domains products combine in vitro and subjected to one cycle of PCR with the use of nucleating bsp/Flt1D2 and Flk1D3/apa/srf.as (described above) to obtain a fused product. Then the PCR product digested with restriction enzymes BspEI and Smal and the obtained fragment length 614 P.O. subcloning on the restriction enzymes cut sites with BspEI no Srfl vector RMT/Δ2.Fc, thus creating plasmid pMT21/FltD2.Flk1D3.Fc. The nucleotide sequence fused insert gene Flt1D2-Flk1D3 check, performing a standard sequencing. The indicated plasmid is then digested with restriction enzymes EcoRI and Srfl and the obtained fragment length 702 P.O. transferred to sa what you restriction with EcoRI for Srfl plasmids pFlt1(1-3)B2-FcΔ C1 (a), thus obtaining plasmid pFlt1D2.Flk1D3.FcΔC1 (a). Full DNA and deduced amino acid sequence of the chimeric molecule Flt1D2.Flk1D3.FcΔC1 (a) shown in Fig. 21A-C.

(b) the Creation of expressing plasmids pFlt1D2VEGFR3D3FcΔC1 (a)

Expressing plasmid 21.Flt1(1-3).Fc (6519 BP) encodes resistance to ampicillin and Fc-tagged variant of the domains 1-3 Ig receptor human Flt1. This plasmid is used to obtain the DNA fragment containing the Ig domain 2 receptor Flt1 using PCR. RNA from cell line HEL921.7 used for Ig domain 3 of the receptor Flk1 using standard RT-PCR method. One cycle of PCR amplification is performed to merge the two Ig domains in one merged fragment. For domain 2 Ig receptor Flt1 use the following seed for amplification of 5'- and 3'-ends:

5': bsp/Flt1D2 (5'-GACTAGCAGTCCGGAGGTAGACCTTTCGTAGAGATG-3')

3': Flt1D2.VEGFR3D3.as(TTCCTGGGCAACAGCTGGATATCTATGATTGTATTGGT)

The seed for amplification of the 5'end encodes a BspE1 restriction site located above the Ig domain 2 receptor Flt1 defined amino acid sequence GRPFVEM (corresponding to amino acids 27-33 of Fig. 22A-22P). The seed for amplification of the 3'end encodes the reverse complement of the end of domain 2 Ig receptor Flt1, merged directly with the beginning of Ig domain 3 of the receptor VEGFR3, where the point merge designated as TIID receptor Flt1 (corresponding to amino acids 123 to 126 in Fig. 22A-22P), and so is included to IQLL receptor VEGFR3 (corresponding to amino acids 127-130 in Fig. 22A-22P).

For Ig domain 3 of the receptor VEGFR3 using the following 5'- and 3'-terminal priming to perform RT-PCR:

5': R3D3.s (ATCCAGCTGTTGCCCAGGAAGTCGCTGGAGCTGCTGGTA)

3': R3D3.as (ATTTTCATGCACAATGACCTCGGTGCTCTCCCGAAATCG)

Seed for amplification of 5'- and 3'-ends correspond to the sequence VEGFR3. The amplification product length 296 BP obtained by performing the reaction RT-PCR, isolated by standard methods and subjected to the second cycle of PCR for the introduction of acceptable sequences necessary to merge domains Flt1D2 and Flk1D3 and domains Flk1D3 and Fc using bridge GPG (see below). Use the following seed for amplification:

5': Flt1D2.VEGFR3D3.s (TCATAGATATCCAGCTGTTGCCCAGGAAGTCGCTGGAG)

3': VEGFR3D3/srf.as (GATAATGCCCGGGCCATTTTCATGCACAATGACCTCGGT)

The seed for amplification of the 5'end encodes the 3'end of domain 2 Ig receptor Flt1, merged directly with the beginning (5'end) of Ig domain 3 of the receptor VEGFR3, as described above. The seed for amplification of the 3'end encodes the 3'end of the Ig domain 3 of the receptor VEGFR3, defined by amino acids VIVHEN (corresponding to amino acids 221-226 in Fig. 22A-22P), followed by a linking sequence that includes a recognition sequence for Srf1 and encodes amino acids GPG. Connecting the sequence corresponds to amino acids 227-229 in Fig. 22A-22P.

After one cycle (domain 2 Ig receptor Flt1) or two cycles (for Ig domain 3 of the receptor Ft4) PCR, performed to obtain individual Ig domains, the PCR products are combined in a test tube and subjected to one cycle of PCR amplification using the above amplificating nucleating bsp/Flt1D2 and VEGFR3D3/srf.as to obtain a fused product. Then the PCR product digested using restriction enzymes BspEl and Smal and the obtained fragment length 625 BP subcloning in the BspEI restriction enzymes cut sites-Srfl vector pMT21/Flt1ΔB2.Fc (described above) to create the plasmid pMT21/Flt1D2.VEGFR3D3.Fc. The sequence fused insert gene Flt1D2-VEGFR3D3 check, performing a standard sequencing. The indicated plasmid is then digested with restriction enzymes EcoRI and Srfl and the obtained fragment length 693 BP subcloning in the restriction sites EcoRI-Srfl plasmids pFlt1(1-3)ΔB2-FcΔC1 (a) and obtain plasmid, denoted pFlt1D2.VEGFR3D3.FcΔC1 (a). Full DNA and deduced amino acid sequence of the chimeric molecule Flt1D2.VEGFR3D3.FcΔC1 (a) shown in Fig. 22A-22P.

Example 18. Analysis of the binding of extracellular matrix (ECM)

Covered ECM tablets (No. 35-4607 catalog Becton Dickinson) re hydratious warm DME, with added glutamine (2 mm), 100 units penicillin, 100 units of streptomycin and 10% BCS, for at least 1 hour before the introduction of the samples. Then the tablets incubated for 1 hour at room temperature with different concentrations Flt1D2.Flk1D3.FcΔC1 (a) and Flt1D2.EGFR3D3.FcΔ C1 (a), starting with a concentration of 10 nm with subsequent 2-fold dilution in PBS and addition of 10% BCS. Then the tablets thrice washed with PBS with 0.1% Triton-X and incubated with conjugated with alkaline phosphatase antibody against Fc man (Promega, 1:4000 in PBS with 10% BCS) for 1 hour at room temperature. Tablets 4 times washed with PBS with 0.1% Triton-X, add buffer on the basis of alkaline phosphatase and pNPP solution (Sigma) for staining of culture. The results read at I=405-570 nm. The results of the experiment shown in Fig. 23 and suggests that proteins Flt1D2.Flk1D3.FcΔC1 (a) and Flt1D2.VEGFR3D3.FcΔC1(a) much less contact with the ECM compared with protein Flt1(1-3)-Fc.

Example 19. Transient expression pFlt1D2.FlklD3.FcΔC1 (a) in cells K1-CHO (E1A)

A large number (2 l) cell culture DH10B E. coli containing plasmid pFlt1D2.Flk1D3.FcΔC1 (a), described above in example 17(a), grown overnight in broth TV containing 100 μg/ml ampicillin. The next day, plasmid DNA is extracted using a set of QIAgen Endofree Megaprep in accordance with the manufacturer's instructions. The concentration of purified plasmid DNA determined by standard methods using UV spectrophotometer and fluorometer. Plasmid DNA test standard method of cleavage with restriction enzyme aliquot samples using restriction enzymes EcoRI with Notl and Ael. All fragments cleaved with restriction enzymes, consistent with the predicted size on the results of the analysis on 1% agarose gel.

Forty-15 cm Petri dishes seeded with cells Cho-K1/EA with a density of 4×106 cells/plate. As the environment for Petri dishes using a medium F-12 the company Gibco Ham with the addition of 10% fetal calf serum (FBS), 100 units penicillin/100 units of streptomycin and glutamine (2 mm). The next day all of the cups with cells transferout 6 μg of plasmid DNA pFlt1D2.Flk1D3.FcΔC1 (a), using drugs Optimem and Lipofectamine company Gibco in a volume of 12 ml in accordance with the manufacturer's instructions. Four hours after addition to the cells transfairusa mixture of 12 ml/Cup drug Optimem containing 10% FBS. Cup incubated at 37°C incubator with 5% CO2throughout the night. The next day, the medium is removed from all cups and add 25 ml ekspressiruyushchie medium (CHO-S-SFM II company Gibco, with the addition of glutamine (2 mm) and 1 mm sodium butyrate). Cup incubated at 37°C for 3 days. After incubation for 3 days, the medium is sucked off from all cups and centrifuged at a speed of 400 revolutions/minute in the rotor with swinging basket for the deposition of cells. The supernatant is decanted into sterile bottles of 1 l and the expressed protein was then purified, as described below.

Example 20. The creation of expressing the sector of pVEGFR1R2-FcΔ C1 (a)

Expressing plasmid pVEGFR1R2.FcΔC1 (a) is generated by the introduction of DNA encoding amino acids SDT (corresponding to amino acids 27 to 29 in Fig. 24A-24C), between amino acids 26 and 27 Flt1D2-Flk1D3-FcΔC1 (a) of Fig. 21A-S (GG), and removal of DNA that encodes amino acids GPG corresponding to amino acids 229-231 on this drawing. Amino acid sequence SDT related receptor Flt1 and its injected to reduce the likelihood of heterogeneous processing of the N-end. GPG (connecting sequence) is removed to obtain a direct merge domains Flt1 and Flk1 Ig with each other. Full DNA and deduced amino acid sequence of the chimeric molecule pVEGFR1R2.FcΔC1 (a) shown in Fig. 24A-24C.

Example 21. The method of cultivation of cells used for production of modified receptors Flt1

(a) Method of culturing cells used for producing Flt1D3.Flk1D3.FcΔC1(a)

Method of producing protein Flt1D2.Flk1D3.FcΔC1 (a) using expressing plasmids pFlt1D2.Flk1D3.FcΔC1 (a), described above in example 1, includes the use of suspension cultures of recombinant cells of the Chinese hamster ovary (K1/EA SNO), which is structurally Express a protein product. These cells are grown in bioreactor, protein isolate and purify affine and displacement chromatography. This pic is b described in more detail below.

The multiplication of cells

The cell line expressing Flt1D2.Flk1D3.FcΔC1 (a), in providing two-cell fusion flasks T-225 cm2, multiply, passiria cells in eight flasks T-225 cm2with the medium (GMEM+10% serum, the company GIBCO) and incubated at 37°C and 5% CO2. When the flasks merge cells (approximately 3-4 days), the cells are separated with trypsin. Add a fresh environment to protect cells from further exposure to trypsin. Cells are centrifuged, re-suspended in fresh medium, transferred into eight rotating bottles with a capacity of 850 cm2and incubated at 37°C and 5% CO2prior to the merger.

Suspension culture bioreactors

Cells grown in rotating flasks, separated from the surface by treatment with trypsin, and washed medium for suspension culture. Cells are transferred under aseptic conditions in a bioreactor with a capacity of 5 l (New Brunswick Celligen Plus), where cells virasat 3.5 liter suspension culture. Medium for suspension culture is a modified environment IS-CHO without glutamine with low glucose (Irvine Scientific), which adds 5% fetal calf serum (Hyclone), additive GS (Life Technologies) and 25 μm methanesulfonamide (Sigma). The pH was adjusted to 7.2 by adding in bioreator carbon dioxide gas supplied to the gas or liquid RA is solution of sodium carbonate. Dissolved oxygen is maintained at 30% saturation by adding oxygen or nitrogen to the supplied gas at a temperature of 37°C. After reaching a density equal to 4×106cells/ml, cells are transferred into a bioreactor with a capacity of 40 l, with the same environment and with the same settings. The temperature is reduced to 34°to slow the growth of cells and to increase the relative rate of protein expression.

(b) the Method of cultivation of cells used for producing Flt1D2.VEGFR3D3.FcΔC1 (a)

For producing Flt1D2.VEGFR3D3.FcΔC1 (a) use the same methods described above for obtaining Flt1D2.Flk1D3.FcΔC1 (a).

Example 22. The collection and purification of modified receptors Flt1

(a) the Collection and purification Flt1D2.Flk1D3.FcΔC1 (a)

The protein product is collected under aseptic conditions from bioreator, keeping cells using modules for filtration tangential flow Millipore Prostak and mechanical pump with a weak shearing force (Fristam). In the bioreactor add a fresh environment to replace the environment, the remote during the filtration of the collected cells. About 40 liters of filtrate collected cells injected into 400 ml column filled with resin Protein A Sepharose (Amersham Pharmacia). The resin was washed with buffer containing 10 mm sodium phosphate, 500 mm sodium chloride, pH 7/2 to remove any unbound contaminating proteins. Protein Flt1D2.Flk1D3.Fc” C1 (a) elute citrate buffer with pH 3.0. Suirvey protein is neutralized by adding Tris-base and frozen at -20°C.

A few frozen parties Flt1D2.Flk1D3.FcΔC1 (a) protein a obtained in the above stage, thawed, pooled and concentrated using membrane filtration tangential flow separating substances with a nominal molecular weight of 30 kDa (NMWCO). Protein is transferred to the hub by mixing cells (Millipore) and concentrated to 30 mg/ml using the NMWCO membrane for 30 kDa. The concentrated protein is injected into the pressure column filled with resin Superdex 200 (Amersham Pharmacia), which is balanced saline solution with phosphate buffer and 5% glycerol. The same buffer used to wash the column. Fractions corresponding to the dimer Flt1D2.Flk1D3.FcΔC1 (a), unite, filtered under sterile conditions through the filter of 0.22 micron, selected alkota protein and freeze.

(b) the Collection and purification Flt1D2.VEGFR3D3.FcΔC1 (a)

For collection and treatment of Flt1D2.VEGFR3D3.FcΔC1 (a) use the same methods described above for obtaining Flt1D2.Flk1D3.FcΔC1 (a).

Example 23. Analysis of the phosphorylation temporarily downregulation of VEGFR2 Primary endothelial cells Pupkova Vienna human (HUVEC), the passage 4-6, incubated for 2 hours in serum-free medium DME high glucose content is. Samples containing 40 ng/ml (1 nm) human VEGF165, which is a ligand for receptors Flt1, Flk1, and Flt4 (VEGFR3) VEGF, pre-incubated for 1 hour at room temperature with various amounts of modified receptors Flt1, such as Flt1(1-3)-Fc, Flt1(1-3)-Fc (A40), Flt1D2Flk1D3.FcΔC1 (a) and Flt1D2VEGFR3D3.FcΔC1 (a), in serum-free medium DME high glucose content, containing 0.1% of BSA. Cells are stimulated for 5 minutes obtained above samples +/-VEGF165 and are lysed whole cells using a buffer for complete lysis. Cell lysates immunoassay antibody against the C-end receptor VEGFR2. Immunosurgery lysates placed on 4-12% Novex gel for SDS-PAGE and then transferred onto PVDF membrane using standard methods of transfer. Phosphorylated VEGFR2 detect by Western blot turns using antiphosphotyrosine mAb, denoted by 4G10 (UBI), and stained using ECL-reagent (Amersham).

In Fig. 25A-25C and 26A-26C shows the results of this experiment. In Fig. 25A-25C is shown that the detection Western blotting of phosphorylated tyrosine VEGFR2(Flk1) as a result of stimulation by VEGF165 ligand suggests that the receptors on the cell surface is phosphorylated to varying degrees depending on whether the modified receptor Flt1 used during the pre-incubation with VEGF. As for Asano in Fig. 25A, when a 1.5-molar excess of Flt1(1-3)-Fc, Flt1(1-3)-Fc (A40) or temporarily expressed Flt1D2Flk1D3.FcΔC1 (a) completely blocked the stimulation of the receptor, these three modified receptors Flt1 compared with the stimulation control environment. In contrast, temporarily expressed protein Flt1D2VEGFR3D3.FcΔC1 (a) does not significantly block at the specified molar excess compared to the positive control stimulation by VEGF protein. Similar results are shown in Fig. 25V, where the modified receptors Flt used in a threefold molar excess relative to the VEGF165 ligand. In Fig. 25C shows that in the case when the modified receptors Flt1 used in a sixfold molar excess relative to the VEGF165 ligand, temporarily expressed protein Flt1D2VEGFR3D3.FcΔC1 (a) partially blocking caused by VEGF165 stimulation of receptors on the cell surface.

In Fig. 26A-26C shown that the detection Western blotting of phosphorylated tyrosine VEGFR2 (Flk1) as a result of stimulation by VEGF165 ligand suggests that the receptors on the cell surface is not phosphorylated stimulating samples containing VEGF165, pre-incubated with 1 - and 2-fold molar excess (Fig. 26A) or 3 - and 4-fold molar excess (Fig. 26V) temporarily expressed protein Flt1D2Flk1D3.FcΔthe 1 (a), constantly expressed protein Flt1D2Flk1D3.FcΔC1 (a), or temporarily expressed protein VEGFR1R2FcΔC1 (a). At all tested concentrations of the modified receptor Flt1 is full the binding of VEGF165 ligand during the pre-incubation, resulting not found stimulation of receptors on the cell surface of unrelated VEGF165 compared with the stimulation control environment.

Example 24. The bioanalysis cell proliferation

The population of test cells is a MG87 cells, which stably expressing transfected with plasmid containing a DNA insert encoding the extracellular domain of VEGFR2 (Flk1), merged with the intracellular domain of the kinase TrkB, thus forming a chimeric molecule. The reason for using the intracellular domain of the kinase TrkB instead of native intracellular domain kinase VEGFR2 (Flk1) is that the intracellular domain of the kinase VEGFR2 (Flk1) does not cause a strong proliferative response upon stimulation with VEGF165 in these cells. It is known that in the MG87 cells containing full-receptor TrkB, there is a strong proliferative response upon stimulation with BDNF, therefore, the intracellular domain of the kinase VEGFR2 (Flk1) replace the intracellular domain of the kinase TrkB, to take advantage of the opportunities provided by this proliferative response.

5×103CL is current/well were cultured in 96-well tablet for 2 hours at 37° C. These modified receptors Flt, such as Flt1(1-3)-Fc, Flt1D2.Flk1D3.FcΔC1 (a) and Flt1D2.VEGFR3D3.FcΔC1 (a), as well as outside the receptor, referred to as Tie2-Fc, and used as negative control sample is titrated in the range from 40 nm to 20 PM, and incubated on cells for 1 hour at 37°C. Then all wells add recombinant human VEGF165 in the environment of a particular composition with a concentration of 1.56 nm. Tablets incubated for 72 hours at 37°add (MTS reagent Aries, Promega) and tablets incubated for another 4 hours. Then the tablets read by spectrophotometer at 450/570 nm. The results of this experiment are shown in Fig. 27. Control receptor Tie2-Fc used in any concentration that does not block VEGF165 induced cell proliferation, while Flt1D2.Flk1D3.FcΔC1 (a) blocks of 1.56 nm VEGF165 at half maximum dose, equal to 0.8 nm. Flt1(1-3)-Fc and Flt1D2.VEGFR3D3.FcΔC1 (a) less effectively inhibit VEGF165 in this analysis, if half of the maximum dose, equal to ˜2 nm. Used separately VEGF165 gives a result equal to 1.2 units of absorption, the background radiation is equal to 0.38 units of absorption.

Example 25. The stoichiometry of binding of modified receptors Flt with VEGF165

(a) Analysis based on BIAcore

The stoichiometry of the interaction Flt1D2FlkD3.FcΔC1 (a) and VEGFR1R2-FcΔC1 (a) with VEGF165 person determined by measuring the level is asimenia bind VEGF with surfaces Flt1D2Flk1D3.FcΔ C1 (a) or VEGFR1R2-FcΔC1 (a) or measuring the concentration of VEGF165 necessary to prevent binding Flt1D2Flk1D3.FcΔC1 (a) or VEGFR1R2-FcΔC1 (a) with the surface of a BIAcore chip, covered with VEGF.

Modified receptors Flt, such as Flt1D2Flk1D3.FcΔC1 (a) and VEGFR1R2-FcΔC1 (a), captured with a specific antibody against the Fc, which first immobilized on the Biacore chip (BIACORE) by binding to the amine. As a negative control sample using surface control antibodies. VEGF165 is injected with a concentration of 1 nm, 10 nm and 50 nm on the surface Flt1D2Flk1D3.FcΔC1 (a) and VEGFR1R2-FcΔC1 (a) at a rate of 10 μl/min for one hour. Register for signal linking in real time and at the end of each injection reaches saturation binding. The stoichiometry of binding is calculated in the molar ratio of bound VEGF165 to immobilized Flt1D2Flk1D3.FcΔC1 (a) or VEGFR1R2-FcΔC1 (a), using a conversion factor equal to 1000 mouse units, which is equivalent to 1 ng/ml. the Results show that the stoichiometry of binding is equal to one dimer molecule VEGF165 on one molecule Flt1D2Flk1D3.FcΔC1 (a) or VEGFR1R2-FcΔC1 (a) (Fig. 28).

Protein Flt1D2Flk1D3.FcΔC1 (a) or VEGFR1R2-FcΔC1 (a), in solution with a concentration of 1 nm (which is 1000 times higher than the KD of the interaction Flt1D2Flk1D3.FcΔC1 (a) or VEGFR1R2-FcΔC1 (a) with VEGF165), mixed with varying the concentrations of VEGF165. The mixture is incubated for one hour and measure the concentration of free Flt1D2Flk1D3.FcΔC1 (a) in solution in the form of a signal link with the surface associated with the amine VEGF165. The calibration curve used to convert the signal binding Flt1D2Flk1D3.FcΔC1 (a) BIAcore its molar concentration. The data show that the addition of 1 nm VEGF165 in solution Flt1D2Flk1D3.FcΔC1 (a) completely blocks the binding Flt1D2Flk1D3.FcΔC1 (a) with the surface of VEGF165. The result suggests that the stoichiometry of binding is equal to one molecule of VEGF165 on one molecule Flt1D2Flk1D3.FcΔC1 (a) (Fig. 29 and 30). When constructing a curve of concentration Flt1D2Flk1D3.FcΔC1 (a) from the increased concentration of VEGF165 slope of the linear part equal -1,06 for Flt1D2Flk1D3.FcΔC1 (a) and-1/07 for VEGFR1R2-FcΔC1 (a). The magnitude of the slope near -1 indicates that one molecule of VEGF165 binds to one molecule of Flt1D2Flk1D3.FcΔC1 (a) or VEGFR1R2-FcΔC1 (a).

(b) Displacement chromatography

Flt1D2Flk1D3.FcΔC1 (a) is mixed with a threefold excess of VEGF165 and complex receptor-ligand purified using column pressure chromatography Pharmacia Superose 6. Then the complex receptor-ligand incubated in buffer containing 6M solution of guanidine hydrochloride, splitting it into its component proteins.

Flt1D2Flk1D3.FcΔC1 (a) is separated from the VEGF165 in the column for vytesnitelya the chromatography Superose 6 using 6 M guanidine chloride solution. To determine the stoichiometry of the complex is injected multiple doses Flt1D2Flk1D3.FcΔC1 (a) and VEGF165 and build a graph of the height or the total peak intensity depending on the concentration of the introduced protein. The calibration is performed in conditions identical to the split components of the complex Flt1D2Flk1D3.FcΔC1 (a)/VEGF. Quantitative determination of composition of complex Flt1D2Flk1D3.FcΔC1 (a)/VEGF is produced on the basis of the calibration curves. The results of this experiment, shown in Fig. 28, show that the ratio of VEGF165 and Flt1D2Flk1D3.FcΔC1 (a) in the complex is 1:1.

Example 26. Determination of the stoichiometry of binding of the complex Flt1D2Flk1D3.FcΔC1 (a)/VEGF165 using displacement chromatography

Obtaining complex Flt1D2Flk1D3.FcΔC1 (a)/VEGF165

VEGF165 (concentration =3,61 mg/ml) is mixed with Flt1D2.Flk1D3.FcΔC1 (a), temporarily expressed in cells Cho (concentration of 0.9 mg/ml), in a molar ratio of 3:1 (VEGF165:Flt1D2.Flk1D3.FcΔC1 (a)) and incubated overnight at 4°C.

(a) Pressure chromatography (SEC) in vivo

To separate the complex from excess unbound VEGF165, 50 μl of the complex is injected into the column Pharmacia Superose 12 PC 3.2/30, which is equilibrated in the buffer based on the PBS. The sample elute with the same buffer, with a flow rate of 40 μl/min at room temperature. The SEC results shown in Fig. 31. Peak No. 1 corresponds to the complex, and the peak of No. 2 sootvetstvuyuschemu VEGF165. France, erwerbende within 1.1 and 1.2 ml, combine and add guanidine hydrochloride (GuHCl) to a final concentration of 4.5 M to dissociation of the complex.

(b) Pressure chromatography (SEC) in terms of dissociation

To separate the components of the complex receptor-ligand and to determine their molar ratio, 50 μl of the above-described dissociated complex is injected into a column of Superose 12 PC 3.2/30, balanced 6 M GuHCl solution and elute with the same solution with a flow rate of 40 μl/min at room temperature. The SEC results shown in Fig. 32. Peak No. 1 corresponds Flt1D2Flk1D3.FcΔC1 (a) and peak No. 2 corresponds to VEGF165.

(C) calculation of the stoichiometry of the complex Flt1D2Flk1D3.FcΔC1 (a) VEGF165

The stoichiometry of the complex receptor-ligand determined taking into account the area or height of the peaks of the components. Concentrations of VEGF165 and Flt1D2Flk1D3.FcΔC1 (a), corresponding to the height or area of the peaks are given on the basis of standard curves for VEGF165 and Flt1D2Flk1D3.FcΔC1 (a). To construct the standard curve, four different concentrations (0.04 mg/ml 0.3 mg/ml) of any component is injected into the column Pharmacia Superose 12 PC 3,2/30, balanced 6 M guanidine chloride solution and elute with the same solution with a flow rate of 40 μl/min at room temperature. A standard curve is obtained by drawing a graph of the area or the peak height depending on the concentration of proteins is. The molar ratio of VEGF165:Flt1D2Flk1D3.FcΔC1 (a), defined on the basis of the peak areas of the components is equal to 1.16. The molar ratio of VEGF165:Flt1D2Flk1D3.FcΔC1 (a), defined on the basis of the height of the peaks of the components, as well 1,10.

Example 27. Determination of the stoichiometry of the complex Flt1D2Flk1D3.FcΔC1 (a)/VEGF165 using displacement chromatography with light diffusing online

Obtaining complex

VEGF165 is mixed with temporarily expressed in cells SNO protein Flt1D2.Flk1D3.FcΔC1 (a) in a molar ratio of 3:1 (VEGF165: Flt1D2Flk1D3.FcΔC1 (a)) and incubated overnight at 4°C.

(a) Pressure chromatography (SEC) with light diffusing online

To determine the molecular weight (MW) of the complex receptor-ligand used column for pressure chromatography with light scattering detector online MiniDawn (Wyatt Technology, Santa Barbara, California) and the detectors refractive index (RI) (Shimadzu, Kyoto, Japan). Samples are injected into a column of Superose 12 HR 10/30 (Pharmacia), equilibrated with buffer based on the PBS, and elute with the same buffer with a flow rate of 0.5 ml/min at room temperature. As shown in Fig. 33, the elution profile has two peaks. Peak No. 1 corresponds to the complex receptor-ligand, and peak No. 2 corresponds to unbound VEGF165. The molecular weight is calculated based on the signals LS and RI. The same procedure used for the form to determine the molecular weight of the individual components of the complex receptor-ligand. The following results are obtained above definitions: the molecular mass of the complex Flt1D2Flk1D3.FcΔC1 (a)/VEGF165 in the position of the peak is equal to 157300 (Fig. 33), a molecular weight of VEGF165 in the position of the peak is equal to 44390 (Fig. 34) and molecular weight R1R2 in the position of the peak is equal to 113300 (Fig. 35).

The data obtained indicate that the stoichiometry ratio of components in the complex Flt1D2Flk1D3.FcΔC1 (a)/VEGF equal to 1:1, as this corresponds to the sum of molecular masses for Flt1D2Flk1D3.FcΔC1 (a) and VEGF165. It is important to note that this method allows to prove ultimately that complex Flt1D2Flk1D3.FcΔC1 (a)/VEGF165 really consists of one molecule of ligand VEGF165 and one molecule Flt1D2Flk1D3.FcΔC1 (a).

Example 28. Peptide mapping Flt1D2.Flk1D3.FcΔC1 (a)

Disulfide patterns and sites of glycosylation in Flt1D2.Flk1D3.FcΔC1 (a) determine the method for peptide mapping. In accordance with this method the protein is first cleaved by trypsin. Split by trypsin fragmani analyze and identify using HPLC coupled with mass spectrometry and sequencing of the N-end. Recovery trypsinogen of hydrolysate helps to identify the fragments that have disulfide bonds. Processing trypsinogen of the hydrolyzate product PNGase F (Glyko, Novato, CA) to identify fragments with N-linked glycosylation sites. The results of the sum is iravani on the accompanying Fig. 36.

Flt1D2.Flk1D3.FcΔC1 (a) contains a total of ten cysteines, six of which relate to the field Fc. It is established that Cys27 linked by a disulfide bond with Cys76. Cys121 linked by a disulfide bond with Cys182. The first two cysteines in the field Fc (Cys211 and Cys214) form intermolecular disulfide bonds with the same two cysteine in another circuit Fc. However, since the two cysteine cannot be separated from each other by enzymatic method, it is impossible to determine whether disulfide bonds between identical cysteine (for example, between Cys211 and Cys211) or between Cys211 and Cys214. It is established that Cys216 linked by a disulfide bond with Cys306. It is established that Cys352 linked by a disulfide bond with Cys410.

Flt1D2.Flk1D3.FcΔC1 (a) contains five probable N-linked glycosylation sites. It is established that all five sites are glycosylated to varying degrees. Full glycosylation occurs on sites Asn33 (amino acid sequence NIT), Asn193 (amino acid sequence NST) and Asn282 (amino acid sequence NST). In addition, partial glycosylation found on sites Asn65 and Asn120. The glycosylation sites are underlined in Fig. 36.

Example 29. Pharmacokinetic analysis of modified receptors Flt

(a) Pharmacokinetic analysis of Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.FcΔC1 (a) and VEGFR1R2-FcΔC1 (a)

Mice Balb/ c mice (25-30 g) subcutaneously injec the shape of 4 mg/kg of Flt1(1-3)-Fc (A40), temporarily expressed in cells SNO protein Flt1D2.Flk1D3.FcΔC1 (a), constantly expressed in cells SNO protein Flt1D2.Flk1D3.FcΔC1 (a) and temporarily expressed in cells SNO protein VEGFR1R2-FcΔC1 (a). Mice from the tail blood sample after 1, 2, 4, 6, 24 hours, 2 days, Z. days and 6 days after injection. Serum analyzed using ELISA designed to detect Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.FcΔC1 (a) or VEGFR1R2-FcΔC1 (a). When performing ELISA tablets for ELISA cover VEGF165, associated with the detected protein Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.FcΔC1 (a) or VEGFR1R2-FcΔC1 (a) and read the results using antibodies against the Fc, linked to horseradish peroxidase. The results of the experiments shown in Fig. 37. Tmaxfor Flt1(1-3)-Fc (A40) corresponds to 6 hours, while Tmaxfor temporarily and permanently expressed protein Flt1D2.Flk1D3.FcΔC1 (a) and temporarily expressed protein VEGFR1R2-FcΔC1 (a) is 24 hours. Cmaxfor Flt1(1-3)-Fc (A40) is equal to 8 micrograms/ml For both temporarily expressed proteins (Flt1D2.Flk1D3.FcΔC1 (a) and VEGFR1R2-FcΔC1 (a))maxis 18 µg/ml andmaxfor constantly expressed protein VEGFR1R2-FcΔC1 (a) is 30 mcg/ml

(b) Pharmacokinetic analysis of Flt1(1-3)-Fc (A40) Flt1D2.Flk1D3.FcΔC1 (a) and Flt1D2.VEGFR3D3.FcΔC1 (a)

Mice Balb/c mice (25-30 g) injected subcutaneously with 4 mg/kg of Flt1(1-3)-Fc (A40), temporarily expressed in the cell is Cho protein Flt1D2.Flk1D3.FcΔ C1 (a) and temporarily expressed in cells SNO protein Flt1D2.VEGFR3D3.FcΔC1 (a). Mice from the tail take blood through 1, 2, 5, 6, 7, 8, 12, 15 and 20 days after injection. Serum analyzed using ELISA designed to detect Flt1(1-3)-Fc, Flt1D2.Flk1D3.FcΔC1 (a) and Flt1D2.VEGFR3D3.FcΔC1 (a). When performing ELISA tablets for ELISA cover VEGF165, associated with protein Flt1(1-3)-Fc, Flt1D2.Flk1D3.FcΔC1 (a) or Flt1D2.VEGFR3D3.FcΔC1 (a) and read the results using antibodies against the Fc associated with the peroxidase .Flt1(1-3)-Fc (A40) is not detected in the serum after 5 days, while Flt1D2.FlklD3.FcΔC1 (a) and Flt1D2.VEGFR3D3.FcΔC1 (a) detected after 15 days or more. The results of this experiments are shown in Fig. 38.

Example 30. Evaluation of the ability Flt1D2.Flk1D3.FcΔC1 (a) to suppress tumor growth in vivo

To assess the ability of Flt1D2.Flk1D3.FcΔC1 (a) to suppress tumor growth in vivo using an animal model, which is obtained, implantarea suspension of tumor cells subcutaneously in the right flank of male mice with severe combined immunodeficiency (SCID). When performing this analysis using two lines of cells, in particular cell line of fibrosarcoma human HT-1080 (No. access ATSS CCL-121) and the line of glioma rat C6 (No. access ATSS CCL-107), which have very different morphology and growth characteristics. The first dose Flt1D2.Flk1D3.FcΔC1 (a) (at a dose of 25 mg/kg or campocatino in Fig. 39 and 40) to impose on the day of tumor implantation. Then animals do subcutaneous injections of Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.FcΔC1 (a) or media every other day or twice a week for 2 weeks. After 2 weeks, the animals are treated retainer, tumors were removed and the samples analyzed blind. Tumor volume determined by measuring the length and width of visible subcutaneous tumors. As Flt1(1-3)-Fc (A40), and Flt1D2.Flk1D3.FcΔC1 (a) significantly reduce the growth of tumors formed by cells HT-1080 and C6. The results of these experiments are shown in Fig. 39 and 40.

Example 31. The effect of VEGF165 and modified receptors Flt on the female reproductive system

Stereotypically the picture changes in the blood vessels that takes place in the uterus and ovary during the reproductive cycle, well-researched, which makes these fabrics are particularly suitable for studying the mechanisms regulating the creation, alteration and destruction of blood vessels. Indeed, studies in situ hybridization in reproductive tissues for the first time indicate that VEGF acts as a mediator of physiological angiogenesis in adult rodents and humans and primates besides humans (Phillips et al., 1990; Ravindranafch et al., 1992; Shweiki et al., 1993; Kamat et al. 1995). Since cyclic emergence and change of blood vessels are the main characteristics of normal ovary and uterus,not surprisingly, what abnormal growth and/or abnormal functioning of the blood vessels began to be considered as a feature of many pathological conditions that affect these organs. In addition, it is believed that these pathogenic abnormalities of the blood vessels caused by or due to improper expression of one or more angiogenic or antiangiogenic factors, in particular VEGF.

For example, the abnormal development of blood vessels is characteristic of polycystic ovarian disease, endometriosis and endometrial cancer, and in each case, VEGF redundantly expressed in the affected tissue (Kamat et al., 1995, Shifren et al., 1996; Guidi et al., 1996; Donnez et al., 1998). It is also believed that overexpression of VEGF is involved in the pathogenesis of increased vascular permeability in the case of ovarian hyperstimulation syndrome ovarian (McClure et al., 1994; Levin et al., 1998) and pre-eclampsia (Baker et al., 1995; Sharkey et al., 1996). In addition, VEGF acts as a factor of increasing permeability, causing ascites, characteristic of ovarian cancer and other tumors (Senger et al., 1983; Boocock et al., 1995). It is highly likely that substances that effectively neutralize the biological effects of VEGF, must have a therapeutic effect in the treatment of the above and related diseases.

The emergence and change of vessels are also signs of implementation of the blastocyst and placenta development (indlay, 1986). VEGF is expressed intensively in the falling the lining of the uterus and embryonic trophoblast, where the factor is first stimulated and increased permeability of the vascular network of the uterus during fertilization and subsequent education in maternal and fetal components in the vascular network of the placenta (Shweiki et al., 1993; Cullinan-Bove and Koos, 1993; Chakraborty et al., 1995; Das et al., 1997). VEGF also causes the development of blood vessels luteum and by the secretion of progesterone, which is necessary to prepare the uterus for fertilization (Ferrara et al., 1998). Thus, substances which inhibit the biological activity of VEGF may be useful as contraceptives (to prevent fertilization) or substances that cause abortion in the early stages of pregnancy. The latter application may be particularly useful as a non-surgical way of interrupting ectopic pregnancies.

Although the expression of VEGF receptors largely restricted to vascular endothelium in normal reproductive tissues, Flt1 is also expressed by trophoblasts in the placenta of humans and animals (Clark et al., 1996; He et al., 1999), where, as expected, this protein is involved in invasion of trophoblasts. Interestingly, Flt1 and KDR (Flk1) is expressed by the cell line of choriocarcinoma BeWo (Charnock-Jones et al., 1994), while installed, Thu the VEGF stimulates DNA synthesis and phosphorylation of tyrosine MAR-kinase in these cells. In addition, primary and metastatic tumors of the ovary not only Express large amounts of VEGF, but in addition to the vascular endothelium of the tumor cells themselves secrete KDR and/or Flt1 (Boocock et al., 1995). The results suggest that VEGF not only plays a significant role in the formation and survival of a tumor vascular network, but at least in some tumors of the reproductive organs VEGF plays a supporting role, contributing to the survival and proliferation of tumor cells. Thus, substances that block the action of VEGF, can be effectively used in the treatment of tumors of the reproductive organs.

Methods and results

(a) Assessment of VEGF-induced increased permeability of the uterus

Serum of gonadotropin pregnant mares (PMSG) is injected subcutaneously (5 ppm) female rats to induce ovulation in prepubertal period. It stimulates the release of estradiol 2 days, which in turn causes the induction of VEGF in the uterus. As you know, this induction causes increased permeability of the uterus and an increase in wet weight of the uterus after 6 hours, which can potentially block modified receptors Flt, such as Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.FcΔC1 (a) and Flt1D2.VEGFR3D3.FcΔC1 (a). In this model, in vivo normal weight of the uterus of the rat equivalent to about 50 mg, and it can be expanded to 300-30 mg using PMSG. The dehydration of the tissue shows that the mass increases due to water. Subcutaneous injection of Flt1(1-3)-Fc (A40), Flt1D2.Flk1D3.FcΔC1 (a) and Flt1D2.VEGFR3D3.FcΔC1 (a) at a dose of 25 mg/kg within 1 hour after injection of PMSG about 50% suppresses the increase in wet weight of the uterus. Increasing the dose of the modified receptor Flt does not reduce the increase in wet weight, suggesting that this model is independent of VEGF component. The results of this experiment are shown in Fig. 41.

(a) Assessment of angiogenesis yellow body with the use of progesterone as a testing agent

Serum gonadotropin pregnant mares (PMSG) is injected subcutaneously (5 ppm) female rats for their ovulation in prepubertal period. 4 days into active yellow body with a dense network of blood vessels, which secretes progesterone in the bloodstream, preparing the uterus for fertilization. To induce the formation of blood vessels in the yellow body needed VEGF; therefore, blocking VEGF should eliminate the formation of new blood vessels and, therefore, reduce the amount of progesterone secreted into the bloodstream. In this model, in vivo levels of progesterone in the state of rest is approximately 5 ng/ml and can be increased to 25-40 ng/ml after administration of PMSG. Subcutaneous injection of Flt1(1-3)-Fc (A40) or Flt1D2.Flk1D3.FcΔC1 (a) at a dose of 25 mg/kg or 5 mg/kg che is ez 1 hour after administration of PMSG completely suppresses the induction of progesterone on day 4. The results of this experiment are shown in Fig. 42A-42.

Example 33. Pharmacokinetic analysis of Flt1(1-3)-Fc (A40) and treated with polyethylene glycol Flt1(1-3)-Fc

Flt1(1-3)-Fc treated with polyethylene glycol with a chain length of 10 kDa or 20 kDa and explore their pharmacokinetic profile, using Balb/c mice. It is established that both treated with polyethylene glycol form of Flt1(1-3)-Fc have a better pharmacokinetic profile than Flt1(1-3)-Fc (A40), with Tmaxfor processed polyethylene glycol molecules corresponds to 24 hours compared to 6 hours for Flt1(1-3)-Fc (A40).

Example 34. Analysis of VEGF165 using ELISA to determine the affinity of modified variants of receptors Flt1

10 PM VEGF165 incubated overnight at room temperature with modified versions of the receptors Flt1 in the amount of from 160 PM to 0.1 PM. When performing this experiment used these modified variants of receptors Flt1, as Flt1(1-3)-Fc, Flt1(1-3)-Fc (A40), temporarily expressed Flt1D2Flk1D3.FcΔC1 (a), temporarily expressed Flt1D2VEFGFR3D3-FcΔC1 (a), Flt1 (1-3NAS)-Fcand Tie2-Fc. Flt1(1-3NAS)-Fc is a modified version of Fit1(1-3)-Fc, which is highly basic amino acid sequence KNKRASVRRR replaced NASVNGSR that allows you to enter two new glycosylation site and summarily remove five positive charge is s in order to reduce the adverse effects of this sequence on the pharmacokinetic profile. is a modification in which a single residue arginine (R) in the same primary amino acid sequence is replaced by a cysteine (C) (KNKRASVRRR→KNKCASVRRR), which makes possible the processing of the polyethylene glycol at a given residue, allowing the main area ceases to have an adverse effect on the pharmacokinetic profile. After incubation, the solution is transferred to a tablet containing immobilized antibody for VEGF165 (R&D). Then determine the amount of free VEGF165 using antibody to read free VEGF165. The results show that a modified version of the receptor Fit1 with the highest affinity for VEGF165 (defined as the lowest amount of free VEGF165) is Flt1D2Flk1D3.FcΔC1 (a), followed by Flt1(1-3)-Fc, and Flt1(1-3)-Fc (A40) and then, Flt1(1-3NAS)-Fc and Flt1D2VEFGFR3D3-FcΔC1 (a). Tie2Fc has no affinity for VEGF165.

Example 35. Variants fused proteins of the VEGF receptor domains with different orientation

1. Construction and expression of variants fused proteins of the VEGF receptor domains with different orientation

Each separate domain fused protein receptor VEGF, Flt1.Ig2 ("R1"), Flk1.Ig3 ("R2") and hFcΔC1(a) ("Fc"), was empiricially by PCR using specific oligonucleotide primers, all of which contain the same additional linker is of the selected DNA enabling split her sequentially by restrictase and ligitamate DNA in a predetermined order so that each separate domain could be attributed to any of the three regions of the sequence that encodes the final broadcast protein. For example, restriction cleavage enzymes "a" and "b" will send a DNA fragment in position one, splitting enzymes "b" and "C" will send a DNA fragment in position two, and splitting enzymes "D" and "E" will fragment DNA in position three. This strategy allows the use of PCR product of each source separate domain for constructing the six possible combinations of three domains, which are components of the fused protein(1) R1.R2.Fc, (2) R2.R1.Fc, (3) Fc.R1.R2, (4) Fc.R2.R1, (5) R1.Fc.R2 and (6) R2.Fc.R1), with a standard peptide linkers between them.

After purification of plasmid DNA with the desired sequence, each of the six types of plasmids and empty vector as a negative control, were individually transfusional cells SNO RGC38 using Lipofectamine. After transliterowany cells were cultured for three days in F12 medium containing fetal calf serum with very low concentration of IgG. Conditioned medium was collected and identified by Western analysis of the expression level for different designs. Also analiziroval the ability of the variations in air-conditioned environment to bind VEGF.

2. The ability to bind VEGF when performing analysis based on BiaCore

The analysis based on the BiaCore was performed as described in example 6 of this specification to assess the ability to contact the surface treated with VEGF, each of the six fused proteins VEGF-receptor. In this analysis, we used the following parameters: chip CM; buffer - HBS-T; a flow rate of 5 μl/min; injection of 150 µl; sample - IX supernatant, double injection; surface - hVEGF165-aminomethane 3400RU.

3. Results

Table 1 shows the relative binding of VEGF each of the fused protein receptor VEGF: pTE903=R1.R2.Fc, pTE904=R2.R1.Fc, pTE905=Fc.R1.R2, pTE906=Fc.R2.R1, pTE907=R1.Fc.R2, pTE908=R2.Fc.R1. Each of the six fused proteins of the VEGF receptor demonstrated specific active relative response (RU) in hVEGF165-surface. In addition, the relative binding variants with different orientation domains were compared with the relative binding of the protein to its original orientation (RTE). No background binding was not detected by culture supernatant of cells transfected with the empty vector.

Table 1
PlasmidConfigurationEnvironments. EN
RTER1.R2.Fc2449
R is E R2.R1.Fc1474
RTEFc.R1.R21430
RTEFc.R2.R12188
RTER1.Fc.R22090
RTER2.Fc.R1.1016
"Blank"-12

4. Conclusions

These experimental data show that specific binding to VEGF was obtained for each of the six fused proteins of the VEGF receptor. Accordingly, the position of the components in the claimed designs may vary, while the ability to bind VEGF is stored.

1. The nucleic acid molecule encoding a fused polypeptide, capable of contacting VEGF polypeptide comprising functionally related

(a) a nucleotide sequence encoding a component of the first growth factor receptor endothelial cells of blood vessels (VEGF), consisting, essentially, of immunoglobulinemia (Ig) domain 2 of a first VEGF receptor,

(b) a nucleotide sequence encoding a component of the second VEGF receptor consisting essentially of immunoglobulinemia domain 3 of a second VEGF receptor,

(c) a nucleotide sequence encoding multimediali component

while the first VEGF receptor Flt1 is, the second VEGF receptor is Flk1 or Flt4, and components of the VEGF receptor according to a) and b) are the only components of the VEGF receptor fused polypeptide.

2. The nucleic acid molecule according to claim 1, characterized in that the nucleotide sequence encoding Ig-domain 2 of the extracellular domain of the VEGF receptor, is located above the nucleotide sequence that encodes a Ig domain 3 of the extracellular domain of the second VEGF receptor.

3. The nucleic acid molecule according to claim 1, characterized in that the nucleotide sequence encoding Ig-domain 2 of the extracellular domain of the VEGF receptor, is located below the nucleotide sequence that encodes a Ig domain 3 of the extracellular domain of the second VEGF receptor.

4. The nucleic acid molecule according to any one of claims 1 to 3, characterized in that multimediali component includes an immunoglobulin domain.

5. The nucleic acid molecule according to claim 4, wherein the immunoglobulin domain is selected from the group consisting of the Fc domain of IgG heavy chain IgG.

6. The nucleic acid molecule according to claim 1, characterized in that it comprises a nucleotide sequence selected from the group consisting of

(a) the nucleotide sequence presented on figure 21A-C;

(b) nucleotide consequently the STI, presented in figure 22A-22P;

(c) a nucleotide sequence represented in figure 24A-24C;and

(d) a nucleotide sequence which differs from the nucleotide sequence of (a), (b) or (C) due to the degeneracy of the genetic code.

7. The nucleic acid molecule according to claim 1, characterized in that the components of the fused polypeptide are as 1, 2, 3; 1, 3, 2; 2, 1, 3; 2, 3, 1; 3, 1, 2; or 3, 2, 1, 1 is a component of a first VEGF receptor, 2 is a component of the second VEGF receptor and 3 is multimerization component.

8. Fused polypeptide, capable of contacting VEGF polypeptide encoded by the nucleic acid molecule according to any one of claims 1 to 7.

9. Cloning vector comprising the nucleic acid molecule according to any one of claims 1 to 7.

10. Expressing a vector comprising the nucleic acid molecule according to any one of claims 1 to 7, which is functionally connected with regulating the expression of the sequence.

11. Method to get the vector - host for the production of the fused polypeptide, including the introduction of expressing the vector of claim 10 in a suitable cell host.

12. The method according to claim 11, characterized in that the acceptable cell host is a bacterial cell, yeast cell, insect cell or a cell of a mammal.

13. The method according to item 12, distinguishing the I, what is acceptable cell host cell is E. coli or Cho.

14. The method of obtaining the fused polypeptide, comprising culturing cells of the system vector - host, obtained by the method according to any of § § 11-13, in conditions that ensure the production of the fused polypeptide, and the allocation thus obtained fused polypeptide.

15. Dimeric antagonist of the growth factor, endothelial cells of blood vessels (VEGF), consisting of two fused polypeptide according to claim 1.

16. Dimeric antagonist indicated in paragraph 15, wherein said modified by acetylation or by treatment with polyethylene glycol.

17. Fused polypeptide, capable of contacting VEGF polypeptide, including

(a) a component of the VEGF receptor, consisting, essentially, of immunoglobulinemia (Ig) domain 2 of the VEGF receptor Fit1 and Ig domain 3 of the VEGF receptor Flk1 or Fit4; and

(b) multimediali component

when this component of the VEGF receptor according to (a) is the only component of the VEGF receptor fused polypeptide.

18. Fused polypeptide according to 17, characterized in that multimediali component includes an immunoglobulin domain.

19. Fused polypeptide according p, wherein the immunoglobulin domain is selected from the group consisting of the Fc domain of IgG heavy chain IgG.

20. Fused polypeptide according to claim 19, characterized in that it comprises the amino acid posledovatel the face, presented on figure 21A-C, figure 22A-22P or figure 24A-24C.

21. The way inhibit the activity of growth factor endothelial cells of blood vessels (VEGF) in a mammal, comprising administration to the mammal of an effective amount of the fused polypeptide according to any one of p-20 or dimeric antagonist indicated in paragraph 15 or 16.

22. The method according to item 21, wherein the mammal is man.

23. The method according to item 21 or 22, characterized in that is used to reduce or prevent tumor growth, to reduce or prevent swelling, to reduce or prevent the formation of ascites, to reduce or suppress the loss of plasma or to block the growth of blood vessels in humans.



 

Same patents:

FIELD: biotechnology, microbiology, genetic engineering.

SUBSTANCE: invention proposes a new recombinant plasmid pR752 (5269 pair bases) comprising genetic construction under control of bacteriophage T5 promoter and encoding a module polypeptide consisting of 6 histidine residues, hemoglobin-like protein of E. coli, modified fragment of large T-antigen SV-40, translocation domain of diphtheria toxin, spacer sequence (Gly-Ser)5 and human epidermal growth factor (6 His-HMP-NLS-Dtox-(Gly-Ser)5-EGF) and designated for the directed transfer of photosensitizers into target-cell nuclei. By transformation of the strain E. coli M15 (rep 4) with plasmid pR752 the recombinant strain E. coli VKPM B-8356 as a producer of new polypeptide vector is prepared. The usage of this new strain is able to enhance the effectiveness of effect of photosensitizers by some orders. Invention can be used in medicinal-biological industry in preparing agents providing the directed transport of photosensitizing agents into tumor cell nuclei.

EFFECT: valuable biological and medicinal properties of polypeptide.

3 dwg, 4 ex

FIELD: medicine, oncology, biochemistry.

SUBSTANCE: invention relates to fused proteins, namely to the multifunctional fused protein cytokine-antibody. This fused protein involves immunoglobulin region and cytokine fused protein of the formula IL-12-X or X-IL-12 wherein interleukin-12 (IL-12) represents the first cytokine and X represents the second cytokine taken among the group comprising IL-2, IL-4 and GM-CSF bound covalently either by amino-end or carboxyl-end to subunit p35 or p40 of interleukin-12 (IL-12) in its heterodimeric or a single-chain form. Indicated fused cytokine protein is fused by either its amino-end or carboxyl-end with indicated region of immunoglobulin. Multifunctional fused protein cytokine-antibody shows an anticancer activity.

EFFECT: valuable medicinal properties of protein complexes.

13 cl, 40 dwg, 18 ex

FIELD: genetic engineering, proteins, medicine, pharmacy.

SUBSTANCE: invention relates to a method for preparing a fused protein representing immunoglobulin Fc-fragment and interferon-alpha and can be used in treatment of hepatitis. Method involves construction of a fused protein comprising immunoglobulin Fc-fragment prepared from Ig G1 or Ig G3 in direction from N-end to C-end and the end protein comprising at least one interferon-alpha. Fc-fragment and the end protein are joined directly or by a polypeptide bridge. The fused protein is used for preparing a pharmaceutical composition used in treatment of liver diseases and in a method for targeting interferon-alpha into liver tissues. Invention provides preparing the fused protein eliciting with biological activity of interferon-alpha providing its concentrating in liver and showing enhanced solubility, prolonged half-time life in serum blood and enhanced binding with specific receptors.

EFFECT: improved targeting method, valuable biological properties of fused protein.

10 cl, 5 dwg, 9 ex

FIELD: biotechnology, microbiology, medicine.

SUBSTANCE: method involves selection of signal sequence suitable for the effective expression of Leu-hirudine in E. coli cells by the polymerase chain reaction-screening method. Method involves construction of a protein as a precursor of hirudine based on the selected signal sequence of surface membrane protein from Serratia marcescens, oprF protein from Pseudomonas fluorescens or fumarate reductase from Shewanella putrifaciens by joining the Leu-hirudine amino acid sequence with C-end of selected signal sequence. Prepared precursor of Leu-hirudine is used in a method for preparing Leu-hirudine. Invention provides preparing Leu-hirudine by the direct secretion in E. coli cells with the high yield. Invention can be used in preparing the hirudine precursor.

EFFECT: improved preparing method.

4 cl, 1 dwg, 2 tbl, 12 ex

FIELD: biotechnology, medicine.

SUBSTANCE: Zalpha 11-ligand is isolated from cDNA library generated from activated cells of human peripheral blood that have been selected from CD3. Animal is inoculated with Zalpha 11-ligand and antibodies are prepared that are able to bind specifically with epitopes, peptides or polypeptides of Zalpha 11-ligand. Invention provides effective regulation and/or development of hemopoietic cells in vitro and in vivo. Invention can be used for preparing Zalpha 11-ligand and antibodies for it.

EFFECT: valuable properties of new cytokine.

18 cl, 5 tbl, 1 dwg, 55 ex

FIELD: genetic and tissue engineering, biotechnology, medicine, agriculture.

SUBSTANCE: invention relates to the development of simple with constructive relation peptide vector (PGE-κ) consisting of polypeptide sequence of epidermal growth factor (EGF) and modified sequence of signal peptide T-antigen SV-40. New vector PGE-κ is able to provide the selective delivery of genetic material in target-cell cytoplasm carrying external receptors to EGF and the following its transport across nuclear membrane. Also, invention proposes a method for preparing peptide vector PGE-κ involving its expression as a fused protein "mutant thioredoxine-linker-vector" and cleavage of product expressed in E. coli in the linker region with specific protease. Invention provides preparing the recombinant strain E. coli B-8389 VKPM as a producer of the fused protein comprising PGE-κ. Proposed vector shows simple structure, absence of toxicity and immunogenicity and these properties provide its usefulness for the directed genetic modification of epithelial, embryonic and tumor cells in vivo.

EFFECT: improved preparing method, valuable medicinal properties of vector, improved genetic modification.

7 cl, 12 dwg, 4 tbl, 16 ex

FIELD: genetic engineering, molecular biology.

SUBSTANCE: invention proposes a method for detecting genes encoding membrane-bound transmembrane proteins. Method involves expression of the nucleic acid chimeric sequence in the cell-host consisting of DNA fragment encoding secreting protein that is able to bind antigen and DNA fragment to be tested; interaction of cells expressing the fused protein with antigen; selection of cells on surface of that indicated antigen is bound; isolation of recombinant vector containing in selected cells of DNA fragment to be tested and, if necessary, determination of its sequence. Also, invention proposes the developed vector constructions and comprising their sets designated for realization of the proposed method. Invention provides significant simplifying the screening process of libraries and cloning genes encoding transmembrane proteins. Invention can be used for detecting and preparing genes encoding any membrane-bound proteins used in different branches of science and practice.

EFFECT: improved isolating method, valuable biological properties of protein.

27 cl, 7 dwg, 1 tbl, 8 ex

FIELD: biotechnology, molecular biology, medicine, genetic engineering, pharmacy.

SUBSTANCE: the hemopoietic protein comprises the amino acid sequence of the formula: R1-L1-R1, R2-L1-R1, R1-R2 or R2-R1 wherein R1 represents the modified ligand flt-3; R2 represents the modified human IL-3, the modified or unmodified colony-stimulating factor. Modification of R1 is carried out by addition of N-end with C-end directly or through linker (L2) that is able to join N-end with C-end to form new C- and N-ends. The modified human IL-3 is prepared by replacing amino acids at positions 17-123. The human G-CSF is modified by exchange of amino acids. The hemopoietic protein is prepared by culturing cells transformed with vector comprising DNA that encodes the hemopoietic protein. The hemopoietic protein stimulates producing hemopoietic cells and this protein is used as a component of pharmaceutical composition used in treatment of humans suffering with tumor, infectious or autoimmune disease. Invention provides preparing multifunctional hemopoietic proteins eliciting the enhanced activity with respect to stimulation of hemopoietic cells and eliciting the improved physical indices. Invention can be used for preparing chimeric multifunctional hemopoietic proteins.

EFFECT: improved preparing and producing method, valuable medicinal properties of protein.

22 cl, 19 dwg, 18 tbl, 117 ex

FIELD: genetic engineering, immunology, medicine.

SUBSTANCE: invention relates to new antibodies directed against antigenic complex CD3 and can be used in therapeutic aims. Antibody IgG elicits the affinity binding with respect to antigenic complex CD3 wherein heavy chain comprises skeleton of the human variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 2, 4 and 6 and their corresponding conservatively modified variants. Light chain comprises skeleton of the rodent variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 8, 10 and 12 and their corresponding conservatively modified variants. Antibody is prepared by culturing procaryotic or eucaryotic cell co-transformed with vector comprising recombinant nucleic acid that encodes antibody light chain and vector comprising recombinant nucleic acid that encodes antibody heavy chain. Antibody is administrated in the patient suffering with malignant tumor or needing in immunosuppression in the effective dose. Invention provides preparing chimeric antibodies against CD3 that are produced by expression systems of procaryotic and eucaryotic cells with the enhanced yield.

EFFECT: improved preparing methods, valuable medicinal properties of antibody.

33 cl, 5 dwg, 1 ex

The invention relates to genetic engineering and can be used for therapeutic purposes, in particular in the treatment of neoplastic processes

FIELD: medicine, genetic engineering.

SUBSTANCE: invention proposes a method that involves construction of bacteriophage library of random peptides based on oligonuleotide fragments encoding their, selection of bacteriophages binding with target-cells but not binding with cells of other types that can be involves in pathological process or able to show effect on its diagnosis and therapy, and confirmation of specificity of selected bacteriophages by using combination of different tests. Oligonucleotide fragments encoding random peptides are prepared by reaction of reverse transcription by using random primers and total RNAs isolated from indicated target-cells and cells of other types. Applying this invention provides preparing bacteriophages binding with target-cells with high degree of selectivity. Invention can be used in diagnosis, therapy and pharmaceutical industry.

EFFECT: improved preparing method.

3 cl, 2 dwg, 8 ex

FIELD: biotechnology, genetic engineering, immunology.

SUBSTANCE: invention proposes: isolated nucleic acid encoding feline ligand CD86; diagnostic oligonucleotide; cloning vector; vaccine for modulation of the immune response in cat; method for induction, enhancement and suppression of immune response in cats. Proposed group of inventions allows designing effective vaccines used in prophylaxis of immunodeficiency in felines and infectious peritonitis in domestic cats. Invention can be used in veterinary science.

EFFECT: valuable properties of nucleic acid.

27 cl, 13 dwg, 5 tbl, 8 ex

FIELD: biology, genetic engineering, biotechnology, medicine.

SUBSTANCE: invention relates to preparing glycosylated polypeptide (glycoprotein) as a component of human erythropoietin by using the technology of recombinant DNAs. This polypeptide shows ability to increase production of reticulocytes and erythrocytes, to enhance the level of hemoglobin synthesis and consumption of iron by marrow cells and characterized by the higher molecular mass as compared erythropoietin isolated from human urine. Invention describes variants DNA sequences encoding this polypeptide that comprise vector constructions with these sequences, a method for preparing transformed mammalian cell lines producing the recombinant human erythropoietin, and a method for its preparing and purification. Also, invention proposes pharmaceutical compositions comprising glycosylated polypeptide (glycoprotein) of erythropoietin as an active component. Applying this invention provides scaling the process for preparing active human erythropoietin useful for its using in medicine.

EFFECT: improved preparing method, valuable properties of polypeptide.

10 cl, 4 dwg, 21 tbl, 12 ex

FIELD: biotechnology, genetic engineering, pharmaceutical industry.

SUBSTANCE: plasmid DNA pET23-a(+)/PrxVIhumΔ178 with molecular weight of 19691.61 Da is constructed. DNA contains RNA-polymerase T7 promoter; replication initiation site; genetic marker which determinates resistance of cells transformed by said plasmid to ampicillin; and nucleotide sequence encoding N-terminal fragment of human peroxiredoxine VI containing 177 of amino acid residues. E.coli strain BL21/DE3/pET23-a(+)/PrxVIhumΔ178 being producer of N-terminal fragment of human peroxiredoxine VI is obtained by transformation of E.coli cells with plasmid DNA pET23-a(+)/PrxVIhumΔ178. Method of present invention makes it possible to obtain human peroxiredoxine VI fragment having reduced molecular weight, improved tissue permeability, and antioxidant activity of full-scale peroxiredoxine.

EFFECT: human peroxiredoxine VI fragment with improved tissue permeability.

2 cl, 3 dwg, 4 ex

FIELD: biotechnology, in particular epithelial cell growth factors useful in production of new keratinocyte growth factor (KGF).

SUBSTANCE: KGF protein is obtained by cultivation of recombinant host cell, transformed with vector containing DNA which encodes amini acid sequence of KGF protein. Obtained KGF protein in pharmaceutical composition is used for forcing of epithelial cell proliferation. Method of present invention makes it possible to produce KGF protein with specific mitogenic activity of 3.4 x 104 U/mg of protein in relation to keratinocyte cells.

EFFECT: new keratinocyte growth factor.

52 cl, 14 dwg, 3 tbl

FIELD: biotechnology, molecular biology.

SUBSTANCE: method involves transfection of cells HKB with vector pCIS25DTR comprising a selective marker and a sequence encoding protein eliciting procoagulating activity of factor VIII. Cells are selected using the selecting agent and clones with high level for expressing protein eliciting procoagulating activity of factor VIII are isolated. Invention provides preparing the protein eliciting activity of factor VIII with high yield, and strain of cells HKB with improved production under protein-free conditions also. Invention can be used for preparing the protein eliciting activity of factor VIII in industrial scale.

EFFECT: improved preparing and isolating methods.

8 cl,, 6 dwg, 1 tbl, 5 ex

FIELD: genetic engineering, molecular biology.

SUBSTANCE: invention proposes a method for detecting genes encoding membrane-bound transmembrane proteins. Method involves expression of the nucleic acid chimeric sequence in the cell-host consisting of DNA fragment encoding secreting protein that is able to bind antigen and DNA fragment to be tested; interaction of cells expressing the fused protein with antigen; selection of cells on surface of that indicated antigen is bound; isolation of recombinant vector containing in selected cells of DNA fragment to be tested and, if necessary, determination of its sequence. Also, invention proposes the developed vector constructions and comprising their sets designated for realization of the proposed method. Invention provides significant simplifying the screening process of libraries and cloning genes encoding transmembrane proteins. Invention can be used for detecting and preparing genes encoding any membrane-bound proteins used in different branches of science and practice.

EFFECT: improved isolating method, valuable biological properties of protein.

27 cl, 7 dwg, 1 tbl, 8 ex

FIELD: medicine, diagnostics.

SUBSTANCE: the present innovation deals with genetic trials, with diagnostic field of oncological diseases due to analyzing DNA by altered status of gene methylation that take part in intracellular regulation of division, differentiating, apoptosis and detoxication processes. One should measure the status of methylation in three genes: p16, E-cadherine and GSTP1 in any human biological samples taken out of blood plasma, urine, lymph nodes, tumor tissue, inter-tissue liquid, ascitic liquid, blood cells and buccal epithelium and other; one should analyze DNA in which modified genes of tumor origin or their components are present that contain defective genes, moreover, analysis should be performed due to extracting and purifying DNA out of biological samples followed by bisulfite treatment of this DNA for modifying unprotected cytosine foundations at keeping 5-methyl cytosine being a protected cytosine foundation followed by PCR assay of bisulfite-treated and bisulfite-untreated genes under investigation and at detecting alterations obtained according to electrophoretic result of PCR amplificates, due to detecting the difference in the number and electrophoretic mobility of corresponding fractions at comparing with control methylated and unmethylated samples containing normal and hypermethylated forms of genes one should diagnose oncological diseases. The method provides higher reliability in detecting tumors, detection of remained tumor cells after operation.

EFFECT: higher efficiency of therapy.

1 cl, 3 dwg, 4 ex

Thrombopoietin // 2245365

FIELD: medicine, molecular biology, polypeptides.

SUBSTANCE: invention describes homogenous polypeptide ligand mpI representing polypeptide fragment of the formula: X-hTPO-Y wherein hTPO has amino acid sequence of human fragments TPO (hML); X means a amino-terminal amino-group or amino acid(s) residue(s); Y means carboxy-terminal carboxy-group or amino acid(s) residue(s), or chimeric polypeptide, or polypeptide fragment comprising N-terminal residues of amino acid sequence hML. Also, invention relates to nucleic acid encoding polypeptide and expressing vector comprising nucleic acid. Invention describes methods for preparing the polypeptide using cell-host transformed with vector, and antibodies raised against to polypeptide. Invention describes methods and agents using active agents of this invention. The polypeptide ligand mpI effects on replication, differentiation or maturation of blood cells being especially on megacaryocytes and progenitor megacaryocyte cells that allows using polypeptides for treatment of thrombocytopenia.

EFFECT: valuable medicinal properties of polypeptide.

21 cl, 92 dwg, 14 tbl, 24 ex

FIELD: biotechnology, medicine, proteins.

SUBSTANCE: invention describes new polypeptide in isolated form relating to subfamily of superfamily human immunoglobulins (Ig-Sf). This polypeptide shows at least 70% of homology level with amino acid sequence of murine molecules CRAM-1 or CRAM-2 regulated by the confluence of adhesive (figures 3, 6 are represented in the claim). Also, invention relates to antibodies showing specificity with respect to the polypeptide. Antibodies and soluble polypeptide can be used for treatment of inflammation and tumors. Invention describes polynucleotide or oligonucleotide encoding the full-size polypeptide or its moiety and represents primer, probe, anti-sense RNA and shows the nucleotide sequence that is identical conceptually with human CRAM-1. Invention provides preparing new adhesive proteins from superfamily Ig-Sf that are regulated at the transcription level in endothelium by effect of tumors. Invention can be used for treatment of different diseases, in particular, inflammatory responses.

EFFECT: valuable medicinal properties of polypeptide.

19 cl, 33 dwg, 1 ex

FIELD: biotechnology, microbiology, genetic engineering.

SUBSTANCE: invention proposes a new recombinant plasmid pR752 (5269 pair bases) comprising genetic construction under control of bacteriophage T5 promoter and encoding a module polypeptide consisting of 6 histidine residues, hemoglobin-like protein of E. coli, modified fragment of large T-antigen SV-40, translocation domain of diphtheria toxin, spacer sequence (Gly-Ser)5 and human epidermal growth factor (6 His-HMP-NLS-Dtox-(Gly-Ser)5-EGF) and designated for the directed transfer of photosensitizers into target-cell nuclei. By transformation of the strain E. coli M15 (rep 4) with plasmid pR752 the recombinant strain E. coli VKPM B-8356 as a producer of new polypeptide vector is prepared. The usage of this new strain is able to enhance the effectiveness of effect of photosensitizers by some orders. Invention can be used in medicinal-biological industry in preparing agents providing the directed transport of photosensitizing agents into tumor cell nuclei.

EFFECT: valuable biological and medicinal properties of polypeptide.

3 dwg, 4 ex

Up!