Recombinant plasmid dna pes6-1 encoding human polypeptide interferon beta-1b and strain escherichia coli bdees6 as producer of human recombinant interferon beta-1b

FIELD: biotechnology, genetic and protein engineering.

SUBSTANCE: invention reports construction of plasmid DNA pES6-1 based on plasmid pET22b(+) and DNA fragment comprising a sequence of artificial gene encoding human interferon β-1b providing expression of human recombinant interferon β-1b. Also, the strain Escherichia coli BDEES6 (BL21(DE3)/pES6-1) as producer of human recombinant interferonβ-1b is prepared. Invention provides enhancing yield of human recombinant interferon β-1b. Invention can be used in medicine and pharmaceutical industry.

EFFECT: valuable biological and medicinal properties of strain.

2 cl, 2 dwg, 2 ex

 

The invention relates to biotechnology, in particular genetic and protein engineering, and can be used to produce recombinant interferon β-1b person.

Interferon β person (IFN β, synonym: fibroblast interferon) is secreted mainly by fibroblasts. IFN β man is a glycoprotein with a molecular mass of about 20 kDa. The peptide part IFN β presents 166 amino acid residues and contains three cysteine amino acid residue and one intramolecular disulfide bridge. IFN β possesses immunomodulatory, antiproliferative, antiviral and antimicrobial activity. There are dosage forms on the basis of interferon β-1A (IFN β-1A)obtained by expression of the natural gene of interferon β in mammalian cells. IFN β-1A glycosylated and has a natural amino acid sequence, i.e. identical to natural IFN β. Because glycosylation is not required for biological activity of IFN βbecomes an attractive easy-to-use and cheap bacterial expresii instead of an expensive expression in mammalian cells. Interferon β-1b (IFN β-1b) man - artificially created, adapted for expression in bacteria, deglycosylation form interf the Ron β bearing replacement of cysteine in position 17 on serine and a deletion of the N-terminal methionine. Replacement of cysteine in position 17 on serine addresses the cause of the formation of dimers through disulfide bonds. Interferon β-1b retains all of the biological properties of natural interferon βbut, thanks to the amendments significantly simplified procedure of obtaining drugs based on it [Derynck R., Content, J., DeClercq E., Volckaert G., Tavernier J., Devos, R., Fiers, W. // Isolation and structure of a human fibroblast interferon gene. Nature, 1980, v.285, p.542-547. Lin L. // Betaseron. Dev. Biol. Stand. 1998, v.96, p.97-104. Pat. U.S. No. 4737462, C 12 N 1/20, 1988].

IFN β exerts its activity through binding to specific receptor [Stark G.R., Kerr I.M., Williams BR, Silverman, R.H., R.D. Schreiber//How cells respond to interferons. Annual; Review of Biochemistry, 1998, v.67, p.227-264].

Dosage form IFN β-1b (Betaferon (Schering AG, Germany) is widely used in medicine for the treatment of multiple sclerosis.

A method of obtaining recombinant IFN β-1A in mammalian cells [U.S. Pat. U.S. No. 5795779, C 12 N 15/22, 1998]. The disadvantages of this method are the low output (200-600 million Units with 1 l of cell culture), a long time expression (4-6 days) and high cost.

A method of obtaining recombinant IFN β in yeast cells, Pichia Pastoris [U.S. Pat. Of the Russian Federation No. 2180687, C 12 N 1/19, 2002]. The disadvantages of this method are the low output (120 million Units with 1 l of culture CL is current) and long expression (6 days).

A method of obtaining recombinant IFN β (not IFN β-1b) in Escherichia coli cells [SU 1703692, C 12 N 15/23, 1992]. In this case, the product will be different from IFN β-1b by only one amino acid at position 17 (IFN β-cysteine, IFN β-1b - serine). The disadvantage of this method is the oligomerization of protein obtained in the process of renaturation, which made it impossible for its further use for the production of medicinal drugs.

Known closest to the claimed method of receiving IFN β-1b, which consists in the biosynthesis of the bacterial cells of Escherichia coli recombinant IFN β-1b [U.S. Pat. U.S. No. 4737462, C 12 N 1/20, 1988]. Receiving IFN β-1b in this invention is achieved by constructing plasmids pSY2501 and producer, obtained by transformation of Escherichia coli strain MM294 this plasmid. Plasmid pSY2501 shall be under the tryptophan promoter of natural gene IFN β replacing T→And for replacement of cysteine 17 on serine. The disadvantages of plasmids pSY2501 and producer on its basis are mutated natural gene IFN β and tryptophan promoter. Natural gene contains rare genes in Escherichia coli (minor) codons, resulting in lower levels of protein biosynthesis, amounting to 600 million Units with 1 l of cell culture (table 1, example 4, Pat. U.S. No. 4737462). Using tryptophan promoter restricts the use of the Finance nutrient media for fermentation only environments does not contain tryptophan, and greatly increases the fermentation time (up to 15-25 hours).

The invention solves the problem of constructing plasmids determining the synthesis of the recombinant protein, and the creation of highly productive bacterial strain-producer, allowing to obtain recombinant IFN β-1b high yield (170-200 mg (5.3 to 6.4 billion Units) with 1 l of cell culture) and simplified technology for reducing the total fermentation time up to 8 hours.

The problem is solved by constructing recombinant plasmid DNA PES6, examples-1, encoding the polypeptide sequence of IFN β-1b, having a molecular weight 3,61 MDA (5880 BP); consisting of NdeI/HindIII-fragment DNA plasmids 22b(+), containing the promoter and terminator of transcription of the T7-RNA polymerase and the amplifier broadcast of gene 10 of phage T7, and NdeI/HindIII-fragment of DNA containing the sequence of the synthetic gene recombinant IFN β-1b; containing as a genetic marker gene β-lactamase determining the stability of the transformed plasmid PES6, examples-1 cells E. coli to ampicillin; containing a unique recognition sites of restriction endonucleases that are located in the following distance to the right of the NdeI site: XbaI - 38 BP, HpaI - 1332 BP, PST - 4065 P.O., Pvul - 4190 P.O., XhoI - 5363 BP, and at the expense of the producer strain of Escherichia coli BDEES6 containing recombina is tnou plasmid DNA PES6, examples-1 - the producer of recombinant IFN β-1b. The proposed strain provides a synthesis of recombinant IFN β-1b in the amount of approximately 10-12% of the total protein content of the cells.

The advantages of the invention are, first, to use when chemical-enzymatic synthesis of gene IFN β-1b widest possible set of codons that are optimal for production of the protein in Escherichia coli; the location in which the synthetic gene eliminates the possibility of formation of synthesized on mRNA longest "studs", potentially inhibiting translation. Figure 1 shows the amino acid sequence of IFN β-1b and the corresponding nucleotide sequence of the gene and amino acid and nucleotide sequence of the natural gene IFN β. Secondly, the application for recombinant protein biosynthesis optimal regulatory elements that control its expression: T7-lac promoter to prevent basal gene expression prior to induction and a high level of transcription of the corresponding mRNA induction, highly efficient transcription terminator T7, and the block stop codons, excluding the biosynthesis of elongated variants of recombinant IFN β-1b. The advantages of the proposed E. coli strain BL21(DE3) consist in the use of bacteria phenotype OmpT Lon, which eliminates the possibility of proteolytic cleavage of the synthesized de novo recombinant IFN α -2b and pollution emitted the most active protein by E. coli proteases. Also BL21(DE3) carrying the gene for T7-RNA polymerase that when using the T7-lac promoter and T7 terminator in the plasmid pES4-4 leads to a rapid and efficient production of the protein by the E. coli cells and, unlike plasmids pSS5, significantly expands the choice of nutrient medium for fermentation.

Construction of the gene encoding IFN β-1b person, carried out on the basis of plasmids 22b(+). Artificial gene encoding IFN β-1b, flanked by sites restricts NdeI and HindIII, get chemical-enzymatic synthesis of a set of oligonucleotide fragments and their subsequent Assembly and amplification using polymerase chain reaction (PCR). Before legirovaniem to generate sticky ends of amplificat and vector plasmid is treated with restrictase NdeI and HindIII. Ligase mixture used to transform competent cells of E. coli DH5α. Selection of positive clones was carried out using PCR using specific primers, followed restrictum the analysis of isolated plasmid DNA restrictase NdeI and HindIII. The structure of the gene encoding the recombinant IFN β-1b, determine the sequencing method Singer. It must fully comply with the nucleotide sequence of the source of artificial gene IFN β-1b (figure 1).

Recombine the Naya plasmid DNA PES6, examples-1, encoding a polypeptide IFN β-1b, characterized by the following features:

- has a molecular weight 3,61 MDA;

- encodes the polypeptide IFN β-1b;

- consists of: NdeI/HindIII-fragment DNA plasmids 22b(+), containing the promoter and terminator of transcription of the T7-RNA polymerase, power broadcast of gene 10 of phage T7 gene β-lactamase, and NdeI/HindIII-fragment DNA, including artificial gene IFN β-1b;

- has a unique set of features: the promoter and terminator of transcription RNA polymerase of bacteriophage T7, power broadcast of the gene 10 of bacteriophage T7; artificial gene encoding IFN β-1b; gene β-lactamase determining the stability of the transformed plasmid PES6, examples-1 cells E. coli to ampicillin; unique recognition sites of restriction endonucleases that are located in the following distance to the right of the NdeI site: XbaI - 38 BP, HpaI - 1332 BP, PST - 4065 P.O., Pvul - 4190 P.O., XhoI - 5363 BP

To obtain strain-producer of recombinant IFN β-1b plasmid DNA PES6, examples-1 is used to transform competent cells of Escherichia coli BL21(DE3) and direct the selection of clones that retain the level of biosynthesis of recombinant polypeptide is not lower than 10-12% of the total cellular protein for at least six consecutive passirovanny. To do this, the clones transformed with plasmid PES6, examples-1 cells E. coli BL21(DE3) grown in rich medium is e (YT-, LB-broth and others) with the addition of ampicillin to 100 μg/ml and glucose solution up to 1% for 12-14 hours, inoculant a new portion of the nutrient medium at a ratio of 1:100, grow the culture to achieve an optical density of 1 PU, induce isopropylthio-β-D-galactoside, and raise another 3-6 hours. Obtaining from cells producing recombinant IFN β-1b includes the following stages: separation of bacteria from the culture medium, their destruction is one of the commonly used methods; washing buffer solutions Taurus inclusion of the water-soluble components of the cells; the solubilization and recovery of the target protein, its refolding and final cleaning.

Obtained producing strains of Escherichia coli BDEES6 characterized by the following features.

Morphological features of the cells are rod-shaped, gram-negative, risperadone.

Cultural characteristics: the growth on agar LB medium colonies are round, smooth, dull, shiny grey, smooth edge. With the growth in liquid medium (minimal medium with glucose or YT-broth) intensive form a smooth suspension.

Physical-biological characteristics: the cells grow at temperatures from 4°C to 40°s at the optimum pH of from 6.8 to 7.5. As the source of nitrogen used as a mineral salt in ammonium form, and organic compounds in the form of peptone, tryptone, dragiev the first extract, amino acids, etc. as a source of carbon use amino acids, glycerol, carbohydrates.

Antibiotic resistance: the cells are resistant to ampicillin (500 µg/ml), due to the presence of plasmid gene β-lactamase (bla).

The advantages offered by the producer strain is to use bacteria phenotype OmpT Lon, which excludes the possibility of proteolytic cleavage of the synthesized de novo recombinant IFN β-1b and pollution emitted the most active protein by E. coli proteases.

Cells of E. coli BDEES6 are superproduction. When induction of isopropylthio-β-D-galactoside, there is an effective biosynthesis of recombinant IFN β-1b, which accumulates in the cells in more than 10% of the total protein of bacteria.

Figure 1 shows the nucleotide sequence and encoded by its amino acid sequence NdeI/HindIII fragment of plasmid PES6, examples-1; figure 2 - physical map of the plasmid PES6, examples-1.

The invention is illustrated by the examples.

Example 1.

Construction of recombinant plasmid DNA PES6, examples-1.

The nucleotide sequence corresponding to the gene of IFN β-1b, receive chemical-enzymatic synthesis. This theoretically calculated DNA sequence is divided into overlapping fragments of a size of 45-55 P.O. Chemical synthesis ol is gonucleotide, corresponding to these fragments, perform solid-phase fostamatinib method using, for example, a DNA synthesizer ASM-102U (BIOSSET, Novosibirsk) with increasing oligonucleotide chain in the direction from the 3'end to the 5'-end using secure phosphamidon - 5'-dimethoxytrityl-N-acyl-2'-deoxynucleoside-3'-O-(β-caitididmarie)-phosphites activated by tetrazole. The synthesis is carried out in the scale of 0.5-0.7 µm, using as a carrier of porous glass (pore size 500 Å), to which 3'-succinate connection joining the first nucleoside link (load 20-30 µmol/g). The resulting oligonucleotides were subjected to 5'-terminal phosphorylation using T4 polynucleotide kinase (Fermentas, Lithuania). For this purpose oligonucleotides in 20 pmol mixed with the enzyme in an amount of 10 units in a buffer solution containing 50 mm Tris-HCl (pH 7.6 at 25° (C), 10 mm MgCl2, 5 mm dithiothreitol, 1 mm spermidine, 0.1 mm ATP and 0.1 mm EDTA. The reaction of the lead 30 minutes, polynucleotides inactivate by heating to 65°C for 10 minutes

Phosphorylated oligonucleotides were mixed in equimolar ratio in 50 μl of buffer containing 20 mm Tris-HCl, pH 7,56, 10 mm MgCl2, 0.2 mm rATP, 10 mm dithiothreitol, heated to 65°C, slowly cooled to 37°C for one hour and add 10 EDUC. T4-DNA-ligase. The reaction ligating DNA check is completed 4 h at 37° C. 0.1 μl of the obtained solution is used as template in polymerase chain reaction (PCR) in the presence of thermostable DNA polymerase Pfu and specific primers:

5' ATAATATCATATGTCTTATAACCTGCTGGGTTTTCTGCAACGTTCTTCTAACTTTCAA 3' and 5' TATATTAAAGCTTTCATTAGTTACGCAGATAACCAGTCAGA 3'.

Spend 25 cycles of amplification (95°C, 20 s; 62°C, 40 s; 72°S, 60 s) for synthesis of full length DNA fragment containing the gene sequence of IFN β-1b, flanked by recognition sites of restricted NdeI and HindIII. The product of amplification hydrolyzing restrictase NdeI and HindIII, purified by electrophoresis in 5% acrylamide the gel, the DNA band size of approximately 500 BP isolated from the gel by the method of electroelution and precipitate DNA from solution by ethanol.

For preparation of vector DNA plasmid pet-22b(+) (3 μg, 1 pmol) treated with 40 μl of buffer R (10 mm Tris-HCl, pH 8.5, 10 mm MgCl2, 100 mm KCl, 0.1 mg/ml BSA) restrictase NdeI (10 edict.) and HindIII (10 edict.) for 1 h at 37°C. the resulting DNA fragment size of 5.4 KBP after electrophoretic separation in 1% agarose gel, isolated from the gel by the method of electroelution and precipitate DNA from solution by ethanol.

1 μg of the obtained vector fragment are ligated with 2 pmol NdeI/HindIII-fragment size of 500 BP, containing the synthetic gene recombinant IFN β-1b, 10 μl of buffer (20 mm Tris-HCl, pH 7,56, 10 mm MgCl2, 0,2 mm gatr, 10 mm dithiothreitol) using 10 e is.actt-DNA-ligase for 12 hours at 10° C.

1 μl of ligase obtained mixture is used to electrotransformation competent cells E. coli BL21(DE3), which is carried out, for example, by using the apparatus for electrotransformation WITH when the gap between the plates electroporation cuvettes 1 mm, and the discharge voltage of 1.4 kV. After transformation, the suspension of bacteria is mixed with a nutrient medium SOC, raise 1 hour at +37°and plated on Petri dishes with LB-agar containing 50 μg/ml ampicillin.

Initial selection of clones containing the desired plasmid, carried out by the method of PCR clones using specific primers:

5' ATAATATCATATGTCTTATAACCTGCTGGGTTTTCTGCAACGTTCTTCTAACTTTCAA 3' and 5' TATATTAAAGCTTTCATTAGTTACGCAGATAACCAGTCAGA 3'.

Spend 25 cycles of amplification (95°C, 20 s; 62°C, 40 s; 72°S, 60 s), followed by electrophoretic analysis of PCR products in 1% agarose gel in the presence of a PCR product with a length of about 500 BP were Selected clones used for growth in liquid medium and selection of plasmid DNA plasmid, which is examined for the presence of inserts using restriction endonucleases NdeI and HindIII, followed by separation of the products of hydrolysis in 5% polyacrylamide gel. The final structure of the plasmids containing NdeI/HindIII-fragment of about 500 BP, confirmed by determining the nucleotide sequence of the method of sequencing by Tengeru. According to the sequencing select the plasmid, the nucleotide is Aya and corresponding amino acid sequences NdeI/HindIII fragment which is completely identical to the originally planned (figure 1). Spend the transformation of E. coli cells BL21(DE3) selected plasmid, as described above, the loop transfer 5-10 colonies in 5 ml of liquid 2xYT medium containing 50 μg/ml ampicillin, for 2 h on a rocking chair with speed 190 rpm to turbidity And550of 0.7-0.8, selected aliquot of the culture for further analysis, add an inductor - isopropylthio-β-D-galactoside to a concentration of 0.2 mm and continue to grow for another 2 hours Equal aliquots of cell suspension taken up to make the inductor and after the completion of growth centrifuged, separating the supernatant and analyze sediment cells by electrophoresis in SDS page as described in example 2. The appearance is clearly visible protein bands in the region of 20 kDa in the sample the samples after induction proves the ability of the strain to synthesize recombinant IFN β-1b after induction of IPTG and fully confirms the correctness of the Assembly plasmids.

Example 2.

Getting a producer strain E. coli BDEES6 with recombinant IFN β-1b and determine its productivity.

Producing strains of E. coli BL21(DE3)/PES6, examples-1 is produced by transformation of competent cells E. coli BL21(DE3) with plasmid PES6, examples-1 as described in example 1.

The producer strain E. coli BDEES6 grown at 37°With 100 ml YT-broth (pH 7.0) with 50 mcg/ml ampicillin for 2 h on a rocking chair with speed 190 rpm to turbidity And550of 0.7-0.8, add isopropylthio-2 -D-galactoside to a concentration of 0.2 mm and continue the process for another 6 hours So the total fermentation time is 8 o'clock Every hour take a sample of 2 ml, And determine550and the amount of culture, corresponding to 1 ml And5501,0, centrifuged 5 min at 6000 Rev/min the Precipitated cells in 100 ál lyse buffer with dye bromophenol blue handle 20 sec ultrasound, heated 3 min at 100°and samples of 1 μl used for electrophoresis in 15% SDS-PAG. Gel stain, Kumasi R-250 according to standard methods and scan to determine the relative amount of protein in the band of the target protein. According to scan the contents of recombinant IFN β-1b is 10-12% of all cellular proteins, which allows you to get 170-200 mg (5.3 to 6.4 million IU) of interferon d-1b with 1 l of cell culture.

1. Recombinant plasmid DNA PES6, examples-l, encoding the polypeptide sequence of interferon β-1b, made from

NdeI/HindIII-fragment DNA plasmids 22b(+), containing the promoter and terminator of transcription of the T7-RNA polymerase and the amplifier broadcast of gene 10 of phage T7,

NdeI/HindIII fragment containing DNA artificial sequence recombinant interferon β-1b person, shown in Fig.1,

and containing the gene β-lactamase determining the stability of the transform is reported to the plasmid PES6, examples-1 cells E. coli to ampicillin, as a genetic marker.

2. The strain Escherichia coli BDEES6 (BL21(DE3)/PES6, examples-1) producing recombinant interferon β-1b person.



 

Same patents:

FIELD: biotechnology, biochemistry, amino acids.

SUBSTANCE: invention describes a polynucleotide showing activity of glucose-6-phosphate isomerase and comprising polynucleotide sequence taken among the group including: a) polynucleotide encoding polypeptide that comprises amino acid sequence identical at least by 90% with amino acid sequence represented in SEQ ID NO:2; b) polynucleotide that is complementary with polynucleotides given in sub-paragraph a). Also, invention describes a method for enhancing the metabolism intensity in pentose phosphate cycle by attenuation of pgi gene and a method for preparing L-amino acids. Invention provides preparing L-amino acids with the high effectiveness degree.

EFFECT: improved preparing method, valuable properties of polynucleotide.

16 cl, 7 dwg, 3 tbl, 6 ex

FIELD: biotechnology, in particular production of feed supplement and feed for farmer animals.

SUBSTANCE: Invention relates to strain Penicillium funiculosum producing enzyme complex such as cellulase, endo-1,4-beta-xylanase, cellobiohydrolase, beta-glucosidase, endo-1,3(4)-beta-glucanase, feruloyl-esterase. Liquid feed supplement for farmer animals such as poultry, pigs and ruminants contains microbial product obtained from strain Penicillium funiculosum and optionally enzymes disclosed in claim 1, antimicrobial agent, sorbitol, antifreeze, concentrated filtered fermentation broth in specific ratio. Dry feed for farmer animals such as poultry, pigs and ruminants contains microbial product obtained from strain Penicillium funiculosum and optionally enzymes disclosed in claim 1, carrier, components of dry fermentation broth in specific ratio.

EFFECT: improved accessibility of feed and amino acids; reduced phosphorus and ammonia emanation.

25 cl, 4 dwg, 32 tbl, 6 ex

FIELD: microbiology, agriculture.

SUBSTANCE: actinomyces strain Streptomyces lateritius 19/97-M is isolated from tree nursery soil (56°04' North latitude; 92°42 East longitude) in Krasnoyarsk region in 1997 year and deposited in All-Russian Collection of Industrial Microorganissms, FGUPSosNIIgenetics at number VKPM Ac-1637. The actinomyces strain Streptomyces lateritius 19/97-M VKPM Ac-1637 is used for stimulation of growth and protection of coniferous seedlings against pathogens of vascular mycosis. The strain shows high competition ability and growth rate. Invention provides rapid biomass accumulation and high reproductive capacity. Invention can be used for stimulation of growth and protection coniferous seedlings against pathogens of diseases caused by fungi of genus Fusarium and Alternaria.

EFFECT: enhanced effectiveness and valuable properties of strain.

1 tbl, 6 dwg, 3 ex

FIELD: food processing industry, in particular cannery industry.

SUBSTANCE: claimed method includes potato washing, inspection, peeling, post-peeling, cutting, and blanching to obtain half-finished product, pre-packing in vacuum into packets from duplex or laminated film followed by sealing and pasteurization. Prior post-peeling potato is treated with preparation, obtained from biomass of Pythium catenulatum micromycete by sequential extraction with non-polar extractant in above-critical state, water, alkali, water, acid, water, alkali, and water and blending of the first extract with solid precipitate in amount of 0.7-1.105 mg/t and conditioned by approximately 5 hours.

EFFECT: garnish potato of improved organoleptic properties.

FIELD: food processing industry, in particular cannery industry.

SUBSTANCE: claimed method includes potato washing, inspection, peeling, post-peeling, cutting, and blanching to obtain half-finished product, pre-packing in vacuum followed by sealing and pasteurization. Prior post-peeling potato is treated with preparation, obtained from biomass of Mortierella hygrophila micromycete by sequential extraction with non-polar extractant in above-critical state, water, alkali, water, acid, water, alkali, and water and blending of the first extract with solid precipitate in amount of 0.7-1.105 mg/t and conditioned by approximately 5 hours.

EFFECT: garnish potato of improved organoleptic properties.

FIELD: food processing industry, in particular cannery industry.

SUBSTANCE: claimed method includes potato washing, inspection, peeling, post-peeling, cutting, and blanching to obtain half-finished product, pre-packing in vacuum into packets from duplex or laminated film followed by sealing and pasteurization. Prior post-peeling potato is treated with preparation, obtained from biomass of Mortierella minutissima micromycete by sequential extraction with non-polar extractant in above-critical state, water, alkali, water, acid, water, alkali, and water and blending of the first extract with solid precipitate in amount of 0.7-1.105 mg/t and conditioned by approximately 5 hours.

EFFECT: garnish potato of improved organoleptic properties.

FIELD: immunology, proteins.

SUBSTANCE: invention proposes a method for preparing affinity surfaces based on chemically cross-linked staphylococcus protein A. Method involves applying a layer of staphylococcus protein A on hydrophobic surface followed by chemical cross-linkage of protein A. Also, method involves additional applying specific antibodies on the prepared affinity surface with a layer of chemically cross-linked staphylococcus protein A. This method provides preparing the affinity surface eliciting the enhanced strength that can be separated from a backing if necessary and with retaining its integrity. Also, the flat and uniform surface of layer of crossed-linked staphylococcus protein A provides low level of interferences in carrying out study by different methods of microscopy. Invention can be used in investigation of biological objects by different methods, among them by method of atomic-force microscopy. Invention can be used in immunological researches of biological objects.

EFFECT: improved preparing method.

3 dwg, 3 ex

FIELD: veterinary virology.

SUBSTANCE: the virus strain of bursal infectious disease (IBB) "52/70-M" is isolated from bursas of Fabricius of sick and killed chickens. The strain shows the expressed precipitating and infectious activity. Invention can be used for producing inactivated vaccine against IBB virus and for evaluation of properties of vaccines against IBB virus.

EFFECT: valuable properties of strain.

4 tbl, 3 ex

FIELD: biotechnology, microbiology, vitamins.

SUBSTANCE: method relates to a method for preparing riboflavin by culturing the microorganism Bacillus subtilis as a producer in the nutrient medium containing rib-operon from Bacillus amyloliquefaciens, or microorganism able for utilization of glycerophosphate as a single carbon source, or eliciting the resistance against inhibition of growth by glyoxylate, and extraction of riboflavin prepared. Invention uses the following strains as producers of riboflavin: B. subtilis GM51/pMX45, B. subtilis GM41/pMX45, B. subtilis GM44/pMX45. Invention provides preparing riboflavin of the high degree of effectiveness.

EFFECT: improved preparing method.

5 cl, 4 ex

FIELD: biotechnology, microbiology, amino acids.

SUBSTANCE: invention proposes the strain Enterobacter agglomerans/FERM BP-7207 that is able to metabolize the carbon source at pH value when L-glutamic acid precipitates in liquid cultural medium containing L-glutamic acid in the saturation concentration and the carbon source. Also, the strain is able to accumulate L-glutamic acid in the amount exceeding the amount that corresponds to its saturation concentration in liquid cultural medium at this pH value. Also, invention relates to a method for preparing L-glutamic acid by fermentation that involves culturing this microorganism in liquid cultural medium wherein pH value is brought about to the value when L-glutamic acid precipitates to prepare and accumulate L-glutamic acid and to precipitate L-glutamic acid in this cultural medium. The proposed microorganism is prepared by addition of a sample comprising microorganisms to acid cultural medium containing L-glutamic acid in the saturation concentration and the carbon source followed by removal of strain that is able to metabolize this carbon source. Invention provides preparing L-glutamic acid with the high degree of effectiveness.

EFFECT: improved preparing method, valuable properties of strain.

20 cl, 9 dwg, 3 tbl, 8 ex

FIELD: genetic engineering, molecular biology, biochemistry.

SUBSTANCE: recombinant plasmid DNA pTES-His-OPH is constructed for expression of polypeptide eliciting properties of organophosphate hydrolase comprising Cla I/Hind III fragment of plasmid pTrcTEGF, fragment of plasmid pTES-OPH with nucleotide sequence that encodes amino acid sequence of the matured form of organophosphate hydrolase, and nucleotide sequence encoding 6 histidine residues that is located by 5'-end of nucleotide sequence encoding organophosphate hydrolase. Based on indicated plasmid the strain Escherichia coli TSKMIBKH-29 - a producer of polypeptide eliciting properties of organophosphate hydrolase is obtained. Applying the invention provides preparing polypeptide with properties of organophosphate hydrolase by simplified technology and this polypeptide elicits the improved catalytic effectiveness of action with respect to thio-containing phosphoric acid triesters. Invention can be used for carrying out hydrolysis of organophosphate compounds.

EFFECT: valuable biochemical properties of producer.

2 cl, 4 dwg, 2 tbl, 4 ex

FIELD: biotechnology, genetic engineering, pharmaceutical industry.

SUBSTANCE: plasmid DNA pET23-a(+)/PrxVIhumΔ178 with molecular weight of 19691.61 Da is constructed. DNA contains RNA-polymerase T7 promoter; replication initiation site; genetic marker which determinates resistance of cells transformed by said plasmid to ampicillin; and nucleotide sequence encoding N-terminal fragment of human peroxiredoxine VI containing 177 of amino acid residues. E.coli strain BL21/DE3/pET23-a(+)/PrxVIhumΔ178 being producer of N-terminal fragment of human peroxiredoxine VI is obtained by transformation of E.coli cells with plasmid DNA pET23-a(+)/PrxVIhumΔ178. Method of present invention makes it possible to obtain human peroxiredoxine VI fragment having reduced molecular weight, improved tissue permeability, and antioxidant activity of full-scale peroxiredoxine.

EFFECT: human peroxiredoxine VI fragment with improved tissue permeability.

2 cl, 3 dwg, 4 ex

FIELD: genetic and tissue engineering, biotechnology, medicine, agriculture.

SUBSTANCE: invention relates to the development of simple with constructive relation peptide vector (PGE-κ) consisting of polypeptide sequence of epidermal growth factor (EGF) and modified sequence of signal peptide T-antigen SV-40. New vector PGE-κ is able to provide the selective delivery of genetic material in target-cell cytoplasm carrying external receptors to EGF and the following its transport across nuclear membrane. Also, invention proposes a method for preparing peptide vector PGE-κ involving its expression as a fused protein "mutant thioredoxine-linker-vector" and cleavage of product expressed in E. coli in the linker region with specific protease. Invention provides preparing the recombinant strain E. coli B-8389 VKPM as a producer of the fused protein comprising PGE-κ. Proposed vector shows simple structure, absence of toxicity and immunogenicity and these properties provide its usefulness for the directed genetic modification of epithelial, embryonic and tumor cells in vivo.

EFFECT: improved preparing method, valuable medicinal properties of vector, improved genetic modification.

7 cl, 12 dwg, 4 tbl, 16 ex

The invention relates to genetic engineering, in particular the production of proinsulin Lyspro person, and can be used to create drugs of new generation for the treatment of insulin-dependent diabetes mellitus

The invention relates to medicine and biotechnology and concerns of soluble mutant CTLA4 molecules that bind to the antigen CD86 with higher avidity than wild type CTLA4

The invention relates to medicine and relates to peptides that can be used for cell adhesion and wound healing

The invention relates to biotechnology, in particular genetic engineering

The invention relates to biotechnology, in particular genetic engineering, and can be used to produce secreted modified colony-stimulating factor granulocyte person (hG-CSF)

The invention relates to biotechnology, genetic engineering, Microbiology and medical industry and can be used to obtain fibroblastoma interferon person
Up!