Recombinant plasmid dna providing synthesis of borrelia garinii immunodominant protein for lyme-borreliosis diagnosis

FIELD: gene engineering, biotechnology, medicine.

SUBSTANCE: invention relates to production of polypeptides bearing specific antigen determinants of OspC protein and FlaB flagellin fragment appropriate to genus Borrelia garinii being prevalent in Russia. Recombinant plasmid pREB9-H6-F7 DNA providing synthesis of B.garnii FlaB protein fragment contains: fragment with size of 100 b.p. encoding signal amino acid sequence of Staphylococcus aureus α-toxin (CAT) and eight N-terminated amino acid residues of mature CAT; B.garnii flaB gene fragment with size of 500 b.p; nucleotide sequence in flaB gene reading frame encoding amino acid residues of glycin and 6 histidins; pIL-2/21 plasmid BamHI - EcoR1 DNA fragment with internal unique Xmal restriction site, containing β-lactamase bla gene and regulatory region of Proteus mirabilis recA gene; unique Xmal, EcoR I, BstEII and BamHI restriction sites. Recombinant plasmid pREB9-H6-C25 DNA providing synthesis of B.garnii OspC protein contains fragment with size of 660 b.p. encoding B.garnii OspC protein; nucleotide sequence in ospC gene reading frame encoding amino acid residues of glycin and 6 histidins; pIL-2/21 plasmid BamHI - EcoR1 DNA fragment with internal unique Xmal restriction site, containing β-lactamase bla gene and regulatory region of Proteus mirabilis recA gene; unique Xmal, EcoR I, BstEII and BamHI restriction sites.

EFFECT: high specific diagnosis method with improved accuracy.

2 cl, 2 dwg, 5 ex

 

The invention relates to medicine, microbiological industry, genetic engineering and biotechnology can be used to produce recombinant polypeptides bearing specific antigenic determinants of a protein OspC and fragment flagellaria protein FlaB Borrelia burgdorferi sensu lato (s.l.).

Lyme borreliosis (LB), caused by spirochaetes of the three genocidal complex Borrelia burgdorferi s.l. (B.garinii, B.afzelii and .burgdorferi sensu stricto - B.burgdorferi s.s.), is a sharp transition in the chronic form, natural focal disease, transmitted by ticks of the Ixodes group. LB is widely distributed in the Northern hemisphere. In the early stages of the disease quite effectively treatable with antibiotics, while in the transition to the chronic form of treatment is very difficult and requires much more time and more complex regimens. Diagnosis, especially in the early stages of the disease LB, on the basis of only one of the symptoms is very difficult due to the huge diversity of clinical manifestations of LB, similar to other diseases. On the territory of Russia are common only two genovia pathogens LB - B.garinii and B.afzelii, although in recent messages are data detected in Ixodes ticks in North-West region of Russia and Moscow region of Borrelia of genovia .burgdorferi s.s. (Semenov A.V., Alekseev A.N., Dubinin A.N., Kaufmann., Jensen M. the Study of genetic heterogeneity of populations of Ixodes persulcatus Schulze (Acari: Ixodidae) in the North-West Russia and the prevalence of tick-borne pathogen, causative agents of Lyme disease and ehrlichiosis, in the grip of various genotypes // Medical Parasitology and parasitic diseases, 2001; (3): 11-15; Masuzawa T, Naumov R.L., Codegen M., Kharitonenkov I., Detection of Borrelia burgdorferi sensu stricto in the Moscow region, Russia // Medical Parasitology and parasitic diseases, 2001; (2):52.). The incidence of LB was in 1999 and in 2000 8470 and 7533 people, respectively. However, these figures do not reflect the full picture, as in medical practice reliably diagnosed only erythematous form LB in the presence of a typical erythema migrans at the site of the tick bite. Besaratinia shape and chronic stages of tick-borne borreliosis almost never diagnosed in Russia due to the lack of domestic sets for serodiagnosis of LB, import the kits are very expensive. If you consider the fact that on the territory of the Urals, Siberia and the Far East, the share of the pathogen erythematous form b accounts for only 10-20% of Borrelia (genomed B.afzelii), and the prevalence of other genocide (B.garinii) significantly dominates, it becomes obvious that tick-borne borreliosis in the great majority of the persons bitten by ticks, does not yet diagnosed. Thus, the creating systems for diagnostics of tick-borne borreliosis, especially in its early stages, is an important task of health of Russia.

Since cultivation of Borrelia is a lengthy and expensive process, is a promising approach to the development of tests for the serodiagnosis of LB is the identification of specific causative agent of immunodominant antigens, the preparation of recombinant forms of these proteins and the design on the basis of their enzyme immunoassay systems.

One of the most powerful antigens .burgdorferi s.l., inducing humoral immune response in the early stages of infection, is flagellaria protein FlaB encoded by the genome of flaB (Berland R, Fikrig E., D. Rahn, Hardin J. and Flavell R. Molecular characterization of the humoral response to the 41 - kilodalton flagellar antigen of Borrelia burgdorferi, the Lyme disease agent// Infection and Immunity. 1991, v.59, p.3531-35; Walich R.; Moter S. E., Simon, M.M., K. Ebnet, A. Heiberger and Kramer M.D. The Borrelia burgdorferi flagellum-associated 41-kilodalton antigen (flagellin): molecular cloning, expression, and amplification of the gene// Infection and Immunity, 1990, v.58, p.1711-1719).

However, the use of full-size FlaB difficult to diagnose because of its high antigenic of intersection with similar proteins from other microorganisms, primarily syphilis (Luft .J., Dunn J.J., R.J. Dattwyler, Gorgone g, Goveric P.D. and Schubach W.H. Cross-reactive antigenic domains of the flagellin protein of Borrelia burgdorferi/ Res. Microbiology, 1993, v.144, p.251-257; Pavia C.S. Overview of the pathogenic spirochetes//Journal of Spirochetal and Tick-Born Diseases, 1. 1994, v.1; G. Subramanian, E. Koonin and Aravind L. Comparative genome analysis of the pathogenic spirochetes Borelia burgdorferi and Treponema pallidium //Infection and Immunity, 3.2000, v.68, p.1633-1648).

This problem can be circumvented using for diagnostics only a fragment of FlaB, which has, according to some researchers, high antigenic specificity for pathogens LB (Ge Y., Li S., L. Corum, Slaughter, S. and N.W. Charon Structure and expression of the FlaA periplasmic flagellar protein of Borrelia burgdorferi //Journal of Bacteriology, 5. 1998, v.180, p.2418-2425; J.M. Robinson, Pilot-Matias TJ, Pratt S.D., Patel SV, Bevirt T.S. and Hunt, J.S. Analysis of the humoral response to the flagellin protein of Borrelia burgdorferi: cloning of regions capable of differentiating Lyme disease from syphilis// Journal of Clinical Microbiology, 3. 1993, v.31, p.629-635).

Famous U.S. patent No. 5618533 "Flagellin-based polypeptides for the diagnosis of lyme disease" on flagellaria polypeptides. Work done on microorganisms of genovia .burgdorferi s.s., no significant spread in Russia, in particular missing in most parts of European Russia and is completely absent in the Asian part of it. Used the following polypeptides of amino acid sequence of the protein FlaB .burgdorferi s.s str. B31: 165-273, 197-273, 197-241.

In this paper, as an example of a vector for expression specified GEX-2T with promoter PtaqI. Using this vector does not allow polypeptide products in pure form, you can get them only in the form of a fused protein with glutathione-S-transferase, which causes some problems during their production and use, namely:

- can in some cases lead the distortion results in the diagnosis of LB because of their own immune reactivity glutathione-S-transferase,

- requires more expensive materials for purification of recombinant proteins

- allows cleaning only in native conditions,

- due to the fact that inside the cell is synthesized not only the target product, but also more extensive amino acid sequence, the number of accumulating the target product decreases

- used in plasmid vector regulatory region is not rigidly controls the activity of the promoter Ptaql, resulting in significant gene expression in the absence of inducer and, as a consequence, the decrease in stability of recombinant plasmids.

Known U.S. patents No. 5643733 "Borrelia burgdorferi antigens and uses thereof" and No. 5965702 "Borrelia burgdorferi antigens and uses thereof". These works are also performed on non-proliferation in Russia genocide .burgdorferi s.s. Used the following polypeptides of amino acid sequence of the protein FlaB .burgdorferi s.s: 137-262, 64-311. In the patents used plasmids RV, RVT, RVT and RVT. Used in these patents vector systems allow you to get flagellaria polypeptides in the form of a fused protein fragment β-galactosidase, which also creates additional difficulties for their production and use, namely:

slice β-galactosidase can give artifact results in ELISA analysis (monopolar the positive diagnostic results),

- this system allows for fast and efficient purification using affinity chromatography (protein obtained by sequential centrifugation and clean enough),

- the insolubility or poor solubility of the fused protein in aqueous solutions complicates the manufacturing test systems and their use,

in addition, the use of this expression system imposes significant constraints on the choice of the strain of the host and the composition of the nutrient medium to obtain the target product,

- due to the fact that inside the cell is synthesized not only the target product, but also more extensive amino acid sequence, the number of accumulating the target product is reduced.

Not described in literature genetically engineered design that allows you to get flagellar protein FlaB and its fragments, characteristic of Vdap and, in particular, characteristic of the Western-Siberian isolates B.garinii.

Another strong antigen B.hurgdorferi s.l., inducing humoral immune response in the early stages of infection, is encoded by the genome of ospC OspC protein, belonging to the family of surface lipoproteins of Borrelia (Wilske Century, Preas-Mursic V, Jarius, S., Hofmann, A., Pradel I., E. Soutschek, E. Schwab, Will G. and G. Wanner Immunological and molecular polymorphism of OspC, an immunodominant major outer surface protein of Borrelia burgdorferi //Infection and Immunity, 5. 1993, v.61, p.2182-2191).

OspC and FlaB is Vlada first antigens causing the immune response in patients with Lyme borreliosis. Immunoglobulin M against these proteins are present in the blood in high titer after one to two weeks after infection (Rauer, S., Spohn N., Rasiah., Neubert U. and A. Vogt Enzyme-linked immunosorbent assay using recombinant OspC and internal 14-kDa flagellin fragment for serodiagnosis of early Lyme disease// Journal of Clinical Microbiology, 4. 1998, v.36, p.857-861).

Known patent US6464985 "Compositions arid methods using the borreliacidal an epitope(s) of Borrelia burgdorferi outer surface protein C (OspC) for the diagnosis and prevention of Lyme disease". This work was performed also on genocide Borrelia burgdorferi s.s. Used DraI fragment-SmaI ospC gene of Borrelia burgdorfen s.s., encoding a fragment of the protein OspC with 145 194 amino acid residue (A.S.). However, OspC protein is characterized by a high heterogeneity among different genocidal, reaching 40% of amino acid composition. With amino acid variability correlates and antigenic variability. Serum of individuals infected with any genovia Borrelia burgdorferi s.l., as a rule, bad contact OspC antigen other genocidal (Bunkis J., Olsen C., Westman G. and Bergstrum S. Variable serum immunoglobulin responses against different Borrelia burgdorferi sensu lato species in population at risk for patients with Lyme disease // Journal of Clinical Microbiology, 6. 1995, v.33, p.1473-1478). Inside genocidal, and especially groups of strains, the variability is much smaller and usually does not exceed several percent (Wang, I.-N., Dykhuezen D.., Qiu W., Dunn J.J., E.M. Bosler and B.J. Luft Genetic diversity of ospC in a local population of Borrelia burgdorferi sensu stricto // Genetics, 1.1999, v.151, p.15-30). ispolzovaniya in this work plasmid for cloning genes coupled with nucleotide sequence that encodes an Oligopeptide capable of biotinylated in vivo. When the expression of cloned genes are synthesized chimeric proteins containing biotinylated polypeptide, which allows affinity purification of the target recombinant proteins on columns with Avidya or streptavidin. However, this cleaning method is relatively expensive and is suitable for the purification of proteins only in native conditions. In addition, the obtained purified antigens cannot be used in test systems with the use of biotinylated antibodies.

Known patent WO 0216422 "Recombinant constructs of Borrelia burgdorferi". The work is performed on Borrelia burgdorferi s.s. In E.coli cells were expressed as full OspC protein and its fragments containing amino acid residues 19 to 204, with 19 and 211, from 19 to 213. The resulting hybrid protein consisting of the amino acid sequence of Mature OspC, merged with the amino acid sequence of the Mature OspA, resulting in both sequences are palleroni form and thus lose the corresponding antigenic determinants of native proteins.

Known patent US 5620862 "Methods for diagnosing early Lyme disease".

The work is performed on Borrelia burgdorferi s.s. In this paper, as an example of a vector for expression specified GEX-2T with promoter PtaqI. Using this vector allows produces the ü polypeptide products in the form of a fused protein with glutathione-S-transferase. Above (US 5618533) have already been identified problems during their production and use.

Not described in literature genetically engineered design that allows you to get OspC or its fragments, characteristic of B.garinii, in particular characteristic of the Western-Siberian isolates B.garinii.

The objective of the invention is the creation of recombinant polypeptides bearing specific antigenic determinants of a protein OspC and fragment flagellaria protein FlaB characteristic of isolates of Borrelia garinii, common in Russia, in particular in Western Siberia.

Another object of the invention is the creation of such recombinant plasmid constructions, which would provide:

(a) effective strictly controlled inducible expression of embedded structural regions of genes immunodominant proteins of B. garinii (OspC and FlaB) in E.coli cells

b) subsequent quick and efficient affinity purification of recombinant proteins in a wide range of conditions (denaturing and native) without the use of expensive reagents,

(C) the absence of any restrictions on the modification of the antibodies when designing test systems.

Target proteins obtained using the proposed plasmid DNA pREB9-H6-F7 and pREB9-H6-C25, do not contain extensive alien amino acid sequence, because they will not give non-specific signals in the ELISA and alisah. This, in turn, increase the specificity of diagnosis. Target protein obtained using the proposed plasmid DNA pREB9-H6-C25 is expressed entirely and contains all of the antigenic determinants of a native protein.

In the constructed plasmids the expression of the cloned gene is under the strict control of the regulatory region of the gene recA Proteus mirabilis, allowing virtually eliminated pindorama expression of cloned genes whose products can be toxic to the host cells. This provides a higher stability of recombinant plasmids and productivity of recombinant strains.

To solve these tasks were constructed recombinant plasmid DNA pREB9-H6-F7 and pREB9-H6-C25.

Recombinant plasmid DNA pREB9-H6-F7 provides a synthesis specific for Borrelia garinii fragment protein FlaB in Rec+the E. coli strains under the influence of inducers that activate the system SOS repair. It contains:

• fragment size of 0.10 thousand base pairs (KBP)encoding amino acid signal sequence α-toxin of Staphylococcus aureus (CAT) and eight N-terminal amino acid residues of the Mature CAT;

• specific for Borrelia garinii gene fragment flaB size of 0.50 KBP;

• the nucleotide sequence in reading frame flaB gene encoding the amino acid OST the key glycine and 6 histidine;

• BamHI - EcoRI DNA fragment from the plasmid pIL-2/21 (SU1761805 A1) with an internal unique XmaI restriction site containing the gene bla β-lactamase as a genetic marker that indicates the stability of the transformed plasmid of E.coli cells to ampicillin, and regulatory region of the gene recA Proteus mirabilis;

• unique restriction sites: XmaI, EcoRI, BstEII and BamHI.

Below is a verbal description of the plasmids pREB9-H6-F7, which is presented in the sequence listing SEQ ID NO 1. The indicated plasmid has a size 4061 BP, molecular weight - 2.8 km megadalton and consists of the following elements (all positions of nucleotide residues shown relative to the plasmid pREB9-H6-F7):

I. fragment encoding the signal sequence α-toxin of Staphylococcus aureus and the first eight N-terminal amino acid residues of the Mature CAT (position 195-296 BP) containing the codon of translation initiation (nucleotide positions 195-197);

II. fragment of the gene flaB Vdip (position 297-800 BP), which encodes the amino acid sequence of a fragment of the protein FlaB Vdip (100-267 amino acid residues (S.A.) of the original sequence). The nucleotide sequence of the fragment of the flaB gene of Borrelia garinii and coded them amino acid sequence of a fragment of the protein FlaB presented in the sequence listing: SEQ ID NO 2, SEQ ID NO 3;

III. the nucleotide sequence is in the reading frame of the gene flaB, the coding amino acid residue glycine (position 801-803) and polyhistidine tract (position 804-821 BP) - 6-his-tag sequence for the subsequent purification of recombinant protein using affinity chromatography on Ni2+-chelate sorbent (Ni2+-NTA-sepharose-Cl-6B). Glycine is needed in order to make the mobility of the 6-his-tag sequence;

IY. codon translation termination (position 822-824 BP);

Y. BamHI - EcoRI DNA fragment of the plasmid pIL-2/21 (825-194 BP), which contains:

• fragment of the genome of bacteriophage lambda (position 1662-1756 BP), which contains t0-terminator of transcription (position 1719-1745);

• the DNA fragment of the plasmid pBR322 (position 1763-4059 BP) in length 2297 BP, corresponding to the fragment (positions 2065-4361 BP) original sequence of pBR322, which contains:

A. the plot early replication (position 2233 BP),

b. gene bla, encoding β-lactamase as a genetic marker that indicates the stability of the transformed plasmid of E.coli cells to ampicillin;

C. regulatory region of the gene recA Proteus mirabilis, providing under the influence of inducers (nalidixic acid, mitomycin C, UV exposure, radiation) initiation of transcription of messenger RNA that encodes a target product (position 44-194 BP).

Unique recognition sites of the restriction endonucleases have the following coordination is s:

XmaI - (CCCGGG) 5-10, EcoRI (GAATTC) - 189-194; BstEII (GGTCACC) - 801-807, BamHI (GGATCC) - 825-830.

Fragments III, IV and V are vector pREB9-H6.

Recombinant plasmid DNA pREB9-H6-C25 provides a fusion protein OspC Vdgp in RecA+the E. coli strains under the influence of inducers that activate the system SOS repair. It contains:

• fragment size 0,66 thousand base pairs (KBP)encoding a protein OspC VAGP and the nucleotide sequence in reading frame ospC gene, coding for amino acid residues glycine and 6 histidine;

• BamHI - EcoRI DNA fragment from the plasmid pIL-2/21 (SU1761805 A1) with an internal unique XmaI restriction site containing the gene bla β-lactamase as a genetic marker that indicates the stability of the transformed plasmid of E.coli cells to ampicillin, and regulatory region of the gene recA Proteus mirabilis,

• unique restriction sites: XmaI, EcoRI, BstEII and BamHI.

Below is a verbal description of the plasmids pREB9-H6-C25, which is presented in the sequence listing SEQ ID NO 4. The indicated plasmid has a size 4097 BP, molecular weight -2,8 megadalton and consists of the following elements (all positions of nucleotide residues shown relative to the plasmid pREB9-H6-C25):

I. structural part of the ospC gene Vdip (position 195-836 BP), which encodes the amino acid sequence of the protein OspC Vdgp. The nucleotide sequence of the ospC gene Borelia garinii and coded them with the amino acid sequence of the OspC protein is presented in the sequence listing: SEQ ID NO 5, SEQ ID NO 6;

II. the nucleotide sequence in reading frame ospC gene that encodes amino acid residue glycine (position 837-839) and 6-his-tag sequence (positions 840-857 BP) for subsequent purification of recombinant protein using affinity chromatography on Ni2+-chelate sorbent. Glycine is needed in order to make the mobility of the 6-his-tag sequence is:

III. codon translation termination (position 858-860);

IV. BamHI - EcoRI DNA fragment of the plasmid pIL-2/21 (861-194), which contains:

• fragment of the genome of phage lambda (position 1698-1792), which contains t0-terminator of transcription (position 1755-1781);

• the DNA fragment of the plasmid pBR322 1799-4095 BP (2297 BP), corresponding 2065-4361-fragment of the original sequence of pBR322, which contains:

A. the plot early replication (position 2269 BP),

Ü. gene bla β-lactamase as a genetic marker that indicates the stability of the transformed plasmid of E. coli cells to ampicillin;

C. regulatory region of the gene recA Proteus mirabilis, providing under the influence of inducers (nalidixic acid, mitomycin C, UV exposure, radiation) initiation of transcription of messenger RNA that encodes a target product (position 44-194 BP).

Unique recognition sites of restriction endonucleases have the following coordinates:

XmaI - (CCCGGG) 5-10, EcoRI (GATTC) - 189-194; BstEII (GGTCACC) - 837-843, BamHI - (GGATCC) 861-866.

Fragments II, III and IV constitute the vector pREB9-H6.

List of figures illustrative material:

Figure 1. Physical-genetic map of the recombinant plasmid DNA pREB9-H6-F7.

Figure 2. Physical-genetic map of the recombinant plasmid DNA pREB9-H6-C25.

Examples of the construction of plasmids.

Example 1.

Obtaining vector pREB9-H6 was carried out in two steps.

(A) Plasmid DNA pIL-2/21 (SU 1761805 A1) hydrolyzed in restrictase EcoRI and BamHI, then annealed and ligated with the oligonucleotideAATTCCGGCCGGGTCACCG andGATCCGGTGACCCGGCCGG. When this happened tenderloin gene interleukin and its replacement by a linker sequence containing the recognition sites of restrictase ESO and BstEII.

The obtained plasmid was transformed (transformation method described below) cells of E. coli strain DH5α (SRC VB "Vector" Sri ECR) was then acquired the necessary amount of plasmid DNA for the second phase (Maniatis T. and other Molecular cloning. M.: Mir, 1984, p.98-106).

B) the second stage of plasmid DNA from (A) hydrolyzed in restrictase BsfEII and BamHI, and then annealed with oligonucleotide 5'-GTCACCAT-CACCATCACCATTAAG andGATCCTTAATGGTGATGGTGATG. At this stage, we insert in plasmid molecule nucleotide sequence that encodes S.A. glycine and 6 histidines (sntihistamine tract). The obtained plasmid in the ktoroy transformed cells of E. coli strain DH5α and after his experience was used for further preparation of recombinant plasmids pREB9-H6-F7 and pREB9-H6-C25.

Hydrolysis of DNA by restrictase and joining of DNA fragments using DNA ligase of phage T4 was performed according to the attached enzyme products the instructions of the manufacturers.

Example 2.

Obtaining plasmids pREB9-H6-F7 and pREB9-H6-C25.

a) Introduction of the gene fragment flaB and leader sequence of staphylococcal alpha-toxin in the vector pREB9-H6 and the preparation of recombinant plasmids pREB9-H6-F7.

As the source of DNA of Borrelia served ixodid ticks of the species Ixodes persulcatus infected B.garinii NT29 and collected in a forested area of NSC. For amplification of the structural regions of genes coding for CAT S.aureus strain Wood 46 (NII them. Nframe) and protein FlaB B.garinii NT29 used two pairs of primers PR22+PR31 and PR87+PR88, respectively. Nucleotide sequences of primers:

PR22 - 5'-GGAATTCATGAAAACACGTATAGTC-3'

PR31 - 5'-AGGTCACCATTTGTCATTTCTTCTTTTTC 3'

PR87 - 5'-GTTAACGGCACATATTCAGATGC-3'

PR88 - 5'-GAGGTGACCTAAATTTGCCCTTTGATC-3'

For cloning and expression of the gene fragment flaB used bacterial strain E. coli C600 (SRC VB "Vector" Sri ECR) and plasmid vector pREB9-H6, in which the expression of the cloned gene is under the control of the regulatory region of the gene recA P.mirabilis.

DNA isolation from ticks. As a sorbent in the DNA isolation was used a commercial preparation on the silicon oxide "Sigma" (USA)-the trade name "Silicone".

Live mites were placed for 2 min in a solution of 70% ethanol and dried by soaking on filter paper. The edge of the abdomen of the tick cut with a razor blade on a glass slide, after which the contents of the abdominal cavity was dispensed in 50 μl of buffer No. 1 the following composition: 4M guanidine-isothiocyanate, 1% lauryl-sarcosyl sodium, 10 mm EDTA, 0.01% of 2-mercaptoethanol. The mixture was transferred into a test tube type Eppendorf, kept at 65°With 1 hour and proteins were removed by extraction with a mixture of phenol-chloroform (1:1). In the aqueous phase, containing the DNA, was made 5 µl of the suspension of the soft-feel (3 mg/ml) with sorption capacity in relation to DNA, 2.5 mg/ml and incubated at room temperature on a shaker for 30 min silicon Dioxide with sorbirovannoe it DNA precipitated with centrifugation at 2000×g 5 min. the Precipitate was twice washed with buffer No. 1, twice with 70% ethanol 96% ethanol and dried. DNA was suirable from the sorbent using an incubation buffer THOSE 8-10 min at 50°C.

Polymerase chain reaction. PCR was performed in 50 µl reaction mixture of the following composition: 67 mm Tris-Cl pH 8.3, 16.6 mm (NH4)2SO4, 1.5 mm MgCl2, 0.03%(V/V) tween-20, 10% (V/V) glycerol, 10 pmol of each primer, 0.05 mm of each 4 deoxynucleotidase, 4 μl of DNA solution (10% of the total DNA isolated from the tick), 1.5 u Taq polymerase firm "Simanim" (Novosibirsk). Amplification of a fragment of structuretable flab gene was performed under mineral oil in test tubes 0.5 ml ('QSP", USA) on multi-channel thermal cycler MC2 ("DNA-technology", Moscow) in the active regulation of the temperature of the reaction mixture in the following temperature and time conditions for each cycle: denaturation of DNA at 94°With 0.4 min; annealing of primers to DNA at 60°C 0,6 min; polymerization chain DNA at 72°From 0.6 min; the number of cycles was 30. 31-th cycle, the time of annealing and polymerization was 5 min and 9 min, respectively.

For amplification of full-size structural region of the gene CAT used DNA S.aureus Wood pieces 46, selected according to the following scheme. Cells of Staphylococcus aureus S.aureus grown in 1 l cultures (4 tubes containing 5 ml mycopathologia broth seeded with cells of S.aureus and incubated under conditions of aeration 18 h at 37°C. 20 ml of the obtained culture inoculant 1 l mycopathologia broth and incubated under conditions of aeration for another 18 h at 37°). Cells of Staphylococcus aureus from 1 l of culture precipitated by centrifugation at 5000 g, 20 min at 0-4°C and washed twice with buffer a containing 50 mm Tris-HCl, pH 7.5, 145 mm NaCl, using centrifugation of cell suspension at 5000g, 15 min at 0-4°C. the precipitated cells after the last washing is suspended in 12.5 ml of buffer a and add 1-1,5 ml of lysostaphin (100 µg/ml). The suspension is incubated for 1 hour at 37°C. In the slurry make-ordinator (dodecyl-sulfate sodium) to a final con is entrale 1% and heated 5 min at 60° C. DNA deproteinizer, extragere equal volume of phenol saturated with 100 mm Tris-HCl, pH 8.5, and then double-extragere a mixture of phenol-chloroform (1:1) and twice with chloroform. DNA from the aqueous phase precipitated with two volumes of ethanol in the presence of 0.2 M sodium acetate. The precipitated DNA was washed with 70%ethanol, dried in a vacuum thermostat at 20°C, dissolved in 10 ml of TE buffer (10 mm Tris - Cl pH 8.0, 1 mm EDTA). To the solution add ribonuclease a to a final concentration of 100 μg/ml and incubated 1 hour at 37°C. In the incubation mixture make the proteinase K To a final concentration of 100 μg/ml and incubated for 3 hours at 37°C. DNA purified from protein, as described above. The final aqueous phase, containing the DNA, dialist against 3 changes of TE buffer (300 volumes each).

For PCR the full-size structural region of the gene CAT used the primers PR22 and PR31. Conditions for amplification were similar to that described above for gene flaB, but the annealed primers with DNA was carried out at 58°and the polymerization of the chain on each cycle was 1.5 minutes

Electrophoresis of DNA was performed in a 5% polyacrylamide, or 0.8% agarose gels.

Selection of DNA fragments from gels. DNA fragments smaller than 700 BP were extracted from the cut zone of the plate 5% SDS page using passive elution of 5-10-fold volume of buffer No. 2 (2 mm EDTA, 10 mm Tris-Cl pH 8.0, 100 mm NaCl) in those who tell 4-6 hours at 65° With followed by deproteinization of the eluate by phenol and chloroform. DNA from the aqueous phase was besieged by 2 volumes of ethanol in the presence of 20 μg/ml glycogen. In the case of the separation of DNA fragments in agarose gel, the desired DNA fragment was recovered by dissolving the appropriate section of the gel in an equal volume of 8 M NaClO4. The resulting solution is incubated with a suspension of the soft-feel for 30-40 min on a shaker, after which the silica compound adsorbed DNA precipitated with centrifugation at 2000×g, 1 min Precipitate the soft-feel resuspendable in 200 μl of 4M NaClO4again besieged by centrifugation and repeated washing 4M NaClO4again. In order to rid of NaClO4, sediment "soft-feel" washed twice with 70% ethanol, then obezvozhivani 96% ethanol and dried. Sorbed on the "hand" DNA was suirable with incubation on a shaker in 10-50 μl of buffer TE (1 mm EDTA, 10 mm Tris-Cl pH 8.0) for 8-10 min at 50°C. After removal of the soft-feel by centrifugation at 10000g for 5 min in the solution was about 70% of the original DNA that does not contain impurities in the form of mono - or oligonucleotides.

The purified amplicon fragment of the gene flaB West Siberian isolates B.garinii NT29 ligated hydrolyzed with the restriction enzyme SspI full sequence of the structural gene region CAT. The products of ligation were performed additional PCR using p is amerov PR22 and PR88, when the mode: denaturation of DNA at 94°With 0.4 min; annealing of primers to DNA at 58°From 0.6 min; polymerization chain DNA at 72°From 0.6 min; the number of cycles - 12. The product of amplification hydrolyzed in restrictase EcoRI and ESO (isolator BstEII), purified using the "soft-feel", ligated with the vector pREB9-6H, pre-hydrolyzed by the same restrictases, and received the target plasmid pREB9-H6-F7. Recombinant plasmid pREB9-H6-F7 transform cells of gram-negative bacteria with genotype RecA+sensitive to nalidixic acid (or other substance used as an inductor), for example, E. coli strains BL21 or S which are the expression of the recombinant antigen. The synthesis of the target protein in cells determined by electrophoresis in SDS page, and its identification is carried out using an enzyme immunoassay.

b) Obtaining plasmids pREB9-H6-C25

As the source of DNA of Borrelia served the same ixodid ticks of the species Ixodes persulcatus infected B.garinii NT29 and collected in a forested area of NSC. Cloning of the gene ospC used the same methodology as for the flaB gene.

For amplification of the structural gene region of ospC used DNA isolated from ticks infected B.garinii NT29. PCR was performed in two rounds. In the first round, conducted with primers PR56 and PR57

(PR56: 5' ATGAAAAAGAATACATTAAGTGCGATATT 3'

and PR57 5' TTAAGGTTTTTTTGGACTTTCTGC 3') with abuses temperature:

1) denaturation - 94° - 0,4 min; annealing at 58° to 0.6 min; polymerization 72°C - 0.8 min; - 30 cycles;

2) denaturation - 94° - 0,4 min; annealing at 58°C - 6 min; polymerization 72°C - 8 min - 30 cycles; - 31-th cycle

In the second round, consisting of 8 cycles, the nucleotide sequence of the amplicon was injected sites of recognition for restricted EcoRI and ESO, carrying out PCR in the presence of primers PR47 and PR48, the structure of which is shown below:

PR47: (5'-CGGAATTCATGAAAAAGAATACATTAAGTGC-3')

PR48:(5'-TTGGTGACCAGGTTTTTTTGGACTTTCTGC-3').

PCR was performed under the following temperature conditions: denaturation - 94° - 0,4 min; annealing at 58°to 0.6 min; polymerization 72°C - 0.8 min; - 8 cycles.

The concentration of the target amplicon after the second round was about 15 μg/ml After the second round PCR product amplification hydrolyzed in restrictase EcoRI and ESO, purified using the "soft-feel", and ligated with the vector pREB9-6H, pre-hydrolyzed by the same restrictases, resulting in a received target plasmid pREB9-N6-C25.

Example 3. Transformation of E. coli cells with recombinant plasmid DNA.

Overnight culture of E.coli cells PC-600 were transferred into 5 ml of LB medium (Maniatis T. and other Molecular cloning. M.: Mir, 1984, str) and derisively to optical density (OD595) 0.5-0.8 PU Received preculture was transferred to 60 ml LB and grown to a density of 0.5-0.6 PU is sleduushie steps were performed at 4° C. the Cells were collected by centrifugation at 3000×g, 10 min twice washed with deionized water, suspended in 100 μl of deionized water. In a cell suspension was made ligase mixture containing plasmids of examples 2 (a) and (b), and after a five minute incubation were subjected to electroporation. After electroporation transformed cells are immediately transferred in 1.5 ml of LB medium, incubated 1 hour at 37°and then was concentrated by centrifugation at 3000×g and landed on a Petri dish with agar LB medium containing ampicillin at a concentration of 150 µg/ml.

From grown clones secrete plasmid DNA pREB9-H6-F7 and pREB9-H6-C25 and confirm the final structure by sequencing.

Example 4. Expression of recombinant fragment flagellaria protein FlaB and recombinant protein OspC of Borrelia garinii in BL21 E.coli cells.

Recombinant plasmid transformed into cells of E. coli BL21 (SRC VB "Vector" Sri POS). Bacterial cells were cultured in 5 ml LB-medium containing ampicillin with initial concentration of 100 µg/ml, to a density of 1.5-2.0 od units at a wavelength of 600 nm, then add nalidixic acid up to a concentration of 50 μg/ml and continue cultivation with intensive aeration within 3-4 hours (nalidixic acid can be replaced by another substance that activates the SOS repair, such as mitomycin C). 1 the l cell suspension is centrifuged and the cells resuspended 200 ál lyse buffer (0.15 M Tris-HCl, pH 6.8, 10 mm 2-mercaptoethanol, 2% LTOs, 5% glycerol, 0.1% bromophenol blue). 10 μl of the resulting lysate is applied on 12% SDS page (polyacrylamide gel) 0.1% LTOs and carry out electrophoresis. Plate gel treated within 20 minutes 10% THU (trichloroacetic acid) and placed for 30 minutes in 0.25% solution of Kumasi R-250 in 20% ethanol. Then allowed to stand for 1 hour in 15% acetic acid. Recombinant protein is observed as a distinct colored band of about 20 kDa to FlaB and about 24 kDa for OspC. The level of synthesis of fragment flagellaria protein Vdgp FlaB constructed in the E. coli strain is when culture density of 109cells/ml to about 10 mg/l or 10-15% of the total cellular protein, for OspC the corresponding figures 6 mg/l and 8-12%.

Example 5. Purification and enzyme-linked immunosorbent assay of purified recombinant proteins VAGP: fragment flagellaria protein FlaB and OspC protein.

Cells of E. coli pieces BL21 containing plasmid pREB9-H6-F7 or plasmid pREB9-H6-C25, grown in 100 ml LB-medium and induce nalidixic acid, as described in the previous example. After induction, the bacterial cells are harvested by centrifugation and are lysed in 5 ml of 6 M guanidine hydrochloride. The lysate centrifuged at 40,000×g for 30 min and the supernatant passed through a chromatographic column containing affinity sorbent - Ni2+-NTA-sepharose 6V. Rivers is minantly protein (FlaB or OspC), containing a C-terminal 6 his-tag tract, remains bound to the sorbent, while bacterial proteins freely pass through the column. Wash recombinant proteins Vdgp FlaB or OspC provide 0.5 M imidazole pH 6.8. The yield of recombinant protein is on average 10 mg with one liter of induced culture of E.coli cells with a purity of more than 95%.

Purified antigens applied on the nitrocellulose membrane and exposed for 2-3 minutes with ultraviolet light with a wavelength of λmax302 nm. The nitrocellulose with a sewn fragment flagellaria protein B. garinii FlaB or protein OspC is placed for 1 hour in saline containing 0.2% skimmed milk, then in saline containing 0.1% tween-20, and the serum of the patient Lyme borreliosis in a dilution of from 1:50 to 1:200 and incubated for 1 h with mild shaking. Then washed with saline solution and make for one hour in a saline solution containing the conjugate antelo-horseradish peroxidase against human immunoglobulins M Nitrocellulose strip was washed with water and placed in a solution containing 10% ethanol, 0.1% Tris-HCl, pH 10.0, 0.05% hydrogen peroxide and 0.05% 2-chloroptera. Recombinant antigen appears as well dark colored, almost black spots.

Recombinant fragment FlaB specifically binds with antibodies sera of all patients with Lyme borreliosis (were investigated about azzy sera from 38 patients with Lyme borreliosis), but do not react with antibodies sera of healthy individuals was surveyed 10 people). 8 investigated sera of patients with syphilis weak positive signal was obtained only with one antibody serum. On the restricted sample serum sensitivity of the detection of antibodies to recombinant FlaB was 100%, specificity 97%.

Recombinant OspC specifically binds with antibodies sera the most part 79% (11 of 14) of patients with Lyme borreliosis, but does not react with the antibodies of sera of healthy individuals was surveyed 10 people) and serum of patients with syphilis (was investigated 8). The detection sensitivity is 79%, specificity definition - 100%.

The list of nucleotide and amino acid sequences are given in the end of the description.

1. Recombinant plasmid DNA pREB9-H6-F7 for synthesis specific for Borrelia garinii the FlaB protein fragment containing the fragment size of 0.10 thousand base pairs (KBP)encoding amino acid signal sequence α-toxin Staphylococcusaureus (CAT) and eight N-terminal amino acid residues of the Mature CAT; specific to Borrelia garinii gene fragment flaB size of 0.50 KBP; the nucleotide sequence in reading frame flaB gene encoding amino acid residues glycine and 6 histidine; BamHI - EcoRI DNA fragment from the plasmid pIL-2/21 internal unique Xmal restriction site containing the gene bla β-lactamase and regulatory region of the gene recA Proteus mirabilis; unique restriction sites XmaI, EcoRI, BstEII and BamHI.

2. Recombinant plasmid DNA pREB9-H6-C25, providing a fusion protein OspC of Borrelia garinii, containing a fragment of 0.66 thousand base pairs (KBP)encoding the protein of B. garinii OspC; the nucleotide sequence in reading frame ospC gene, coding for amino acid residues glycine and 6 histidine; BamHI - EcoRI DNA fragment from the plasmid pIL-2/21 internal unique Xmal restriction site containing the gene bla β-lactamase and regulatory region of the gene recA Proteus mirabilis; unique restriction sites XmaI, EcoRI, BstEII and BamHI.



 

Same patents:

FIELD: molecular biology, medicine, pharmaceutical industry.

SUBSTANCE: method for detecting analyzed DNA sequence involves DNA hybridization with probes and visualization the prepared product wherein probes represent oligonucleotides with length of nucleotide sequence 12-30 nucleotides showing complementary to site of the same size in analyzed DNA that are modified with insertions based on alkyldiols or ethylene glycols. Applying the proposed method provides obtaining more reliable and selective results in detecting analyzed DNA sequences.

EFFECT: improved detecting method of DNA sequence.

11 cl, 12 dwg, 13 ex

FIELD: molecular biology, biotechnology.

SUBSTANCE: dry mixture of reagents for polymerase chain reaction (PCR) is prepared by lyophilic drying an aqueous solution containing DNA polymerase, deoxyribonucleoside triphosphates, buffer components, dye for electrophoresis, D-glucose, inulin and D-mannitol. For carrying out PCR-analysis the indicated mixture is dissolved in buffer solution containing magnesium ions, specific primers are added to the solution and DNA to be analyzed and amplification of nucleic acid is carried out under condition of polymerase chain reaction. Applying the invention allows retaining the reaction activity of components for polymerase chain reaction in prolonged storage and simplifies carrying out PCR-analysis. Invention can be used in veterinary science, medicine and food industry.

EFFECT: improved method for carrying out PCR-analysis.

9 dwg, 7 ex

FIELD: biotechnology, genetic engineering, molecular biology, veterinary science.

SUBSTANCE: invention proposes synthetic primers that are complementary to highly conservative region in cattle infectious rhinotracheitis virus genome in region of thymidine kinase (tk) gene. Proposed primers are used for detecting cattle infectious rhinotracheitis virus DNA using polymerase chain (PCR) reaction method. Proposed method involves carrying out amplification by PCR method. For carrying out PCR method involves using synthetic primers that are complementary to highly conservative region in cattle infectious rhinotracheitis virus genome in region of thymidine kinase gene (tk). Results of the reaction are evaluated without preliminary restriction of the prepared product. Result is considered to be positive if PCR product corresponds to fragment size 298 base pairs. Method can be used in veterinary virology for detection of infectious diseases in agricultural animals, in particular, for detection of infectious rhinotracheitis in cattle.

EFFECT: improved detecting method.

2 tbl, 7 ex

FIELD: biochemistry, molecular biology.

SUBSTANCE: invention proposes a method for isothermic amplification reaction that involves incubation in buffer system of an analyzed single-stranded nucleic acid with polymerase, T7 exonuclease, α-S-dNTPs and two pairs of specific deoxyribonucleotide primers wherein sequence of the first pair of primer is identical with 5'-terminal sequence of the sense chain in analyzed nucleic acid and sequence of the second pair of primers is complementary with 3'-terminal sequence of the sense chain. Primers of each pair differ by the presence one of additional nucleotides by 3'-end. Applying the invention provides reducing cost in detection of microorganisms. Invention can be used in molecular-genetic diagnosis.

EFFECT: improved method for detection of microorganisms.

3 dwg

FIELD: biochemistry, molecular biology.

SUBSTANCE: invention proposes method of isothermic amplification reaction that involves incubation in buffer system of a single-stranded analyzed nucleic acid sample with reverse transcriptase M-MuLV or AMV with Klenow's fragment (3' - 5' exo-) or without the latter, deoxyribonucleoside triphosphates and two pairs of specific ribooligonucleotide primers wherein sequence of the first pair of primers is identical with 5'-terminal sequence of sense chain of analyzed nucleic acid and sequence of the second pair of primers is complementary with sense chain. Primers of each pair differ by the presence of one of additional nucleotides by 3'-end. Applying of invention provides reducing cost of detection of microorganisms. Invention can be used in carrying out the molecular-genetic diagnosis.

EFFECT: improved method for detection of microorganisms.

2 cl, 3 dwg

FIELD: biotechnology, in particular immunological and genetic investigations and educatory process.

SUBSTANCE: Claimed avirulent strain of bacteria Vibrio cholerae biovar eltor, serovar Ogava (ctxA-, tcpA-, toxR-, zot-) is isolated from natural water source of open basin in Turkmenistan, doesn't contain ctxA, tcpA, toxR, zot genes and has stable avirulent atoxigenic properties for long-time storage.

EFFECT: strain useful in screening of new drugs for cholera immunoprophylaxis, including ones being obtained by gene engineering methods; as well as in various educatory processes.

5 ex

FIELD: biotechnology, in particular pharmaceutical industry and medicine.

SUBSTANCE: method and kit for nuclear acid synthesis are disclosed. Said kit includes DNA-polymerase, catalyzing synthesis of complementary chain according to replacement mechanism, substrate therefore, two inner primer, and two oligonucleotide. Claimed method includes mixing of said kit with nuclear acid sample and mixture incubation at temperature sufficient for saving enzymatic activity of DNA-polymerase and stable coupling of sequence bases of inner primers with sequences being complementary thereto. Method of present invention makes it possible to obtain nuclear acid with nucleotide sequence wherein complementary nucleotide sequences are alternately bonded in one chain.

EFFECT: inexpensive method with increased synthesis specificity.

9 cl, 18 dwg, 8 ex

FIELD: genetic engineering, medicine.

SUBSTANCE: invention relates to T-cell receptor sequence being detected in patients with extended sclerosis and is useful in diagnosis and therapy. Oligonucleotide including sequence which represents or is derived from 5'-CTAGGGCGGGCGGGACTCACCTAC-3' or nucleotide sequence being fully complementary thereto. Oligonucleotide together with nuclear acid including nearly 15-30 oligonucleotides, which doesn't comprise oligonucleotide sequence and presents in region from Vβ to Jβ of Vβ13.1 gene in T-cell Vβ13.1-subgroup, wherein oligonucleotide and nuclear acid sequences don't present in the same chain of pair sequences of Vβ13.1 gene, is used in Vβ13.1 gene part amplification. In method for detection of LGRAGLTY motive, which is present in T-cell receptors of T-cell Vβ13.1-subgroup, oligonucleotide is used in combination with labeling particle. Once LGRAGLTY motive is detected, development monitoring and treatment are carried out by removing of LGRAGLTY motive-containing peptide.

EFFECT: simplified methods for detection of LGRAGLTY motive in T-cell receptors and treatment of patients with extended sclerosis.

21 cl, 7 dwg, 3 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: method involves taking blood sample and dividing it plasma and blood cells fraction. The blood cells fraction is divided into erythrocytes and leukocytes and extracellular nucleic acids bound to erythrocytes and leukocytes surface are eluted. Extracellular nucleic acids fraction is separated and amplification analysis of not less than two known specific nucleic acid sequences associated to particular disease by applying appropriate method (polymerase chain reaction, ligase chain reaction, multiplex polymerase chain reaction and others).

EFFECT: high accuracy of diagnosis.

6 cl, 1 dwg, 4 tbl

FIELD: genetic engineering and medicine genetic.

SUBSTANCE: method for detection of gene resistance of subjects to infection by HIV1 is disclosed. Method includes DNA isolation, CCR5 gene PCR-amplification by using two primers complementary to two gene CCR5 sites. Further amplification products are restricted with endonuclease HincII (HindII), sizes of formed amplified fragments are determined, and on the base of obtained data deletion and single-nucleotide mutations are detected. Method of present invention makes it possible to simultaneously diagnose the presence of two mutation in human CCR5 gene, and (if individual has both mutation in heterozygote state) to distinguish cys- and trans-configurations.

EFFECT: method for diagnosis of congenital gene resistance to infection by HIV1.

2 dwg, 1 tbl, 2 ex

FIELD: biotechnology, veterinary science, microbiology.

SUBSTANCE: strain is prepared by fusion of E. coli genes isolated from mink intestine that induce biosynthesis of microcine C51 and B-subunit of escherichia thermolabile enterotoxin into the genome. Microcine inhibits growth and development of enterobacteria producing thermolabile, thermostable and shiga-like (verotoxin) enterotoxins, and B-subunit screens intestine receptors for enterotoxin and initiates specific immunity in intestine as far as intestine comprises determinants of protective antigen of toxin molecule. The strain is used for preparing curative-prophylactic preparations with prolonged action. Microcines synthesized by the strain inhibit enterotoxic enterobacteria and synthesized B-subunits of escherichia thermolabile enterotoxin screen receptors for enterotoxin and stimulate specific immunity in intestine. Resident properties of a carrier don't cause rejection of the strain by the mink intestine microecosystem that allows applying these preparations based on thereof more rarely and in smaller doses.

EFFECT: valuable properties of preparation.

2 cl, 4 ex

FIELD: biotechnology, medicine, in particular treatment, prevention and diagnosis of diseases, associated with Neisseria meningitides.

SUBSTANCE: Claimed protein includes one or more N. meningitides protein fragments with known amino acid sequences, wherein said fragment contains one or more antigen determinants and has not more than 1977 amino acid from SEQ ID NO:1 and/or not more than 1531 amino acid from SEQ ID NO:2 which are described in specification with the proviso, that general protein sequence is not characterized by amino acid sequences represented in NO:1 and NO:2. Each claimed protein is encoded by nuclear acid (NA) with nucleotide sequence that defines protein amino acid sequence according to gene code. Peptides and nuclear acid of present invention are useful in drug production for treatment and prophylaxis of infections induced neisseria, as well as in production of diagnostic reagent for detection of neisseria or specific antibodies. Aldo disclosed is peptide- or NA-based pharmaceutical composition in effective amount with acceptable carrier. Said composition is useful for treatment of N. meningitides mediated infection. For prophylaxis composition is applied in vaccine form. Invention makes it possible to overcome diversity of neisseria antigen properties.

EFFECT: improved method for neisseria infection prophylaxis and treatment.

24 cl, 2 tbl

FIELD: biotechnology, in particular provision storage.

SUBSTANCE: bacteriocin represents polypeptide isolated from lactobacillus sakei 2512 and is capable to suppress lysteria growth and reproducing. Bactericin has specific amino acid sequence represented in claims. Nuclear acid sequence encoding said polypeptide is disclosed. Also disclosed is a vector including nuclear acid sequence for cloning and/or expression of polypeptide, for example in transformed cells, selected from Lactococcus, Lactobacillus, etc. Method for production of recombinant polypeptide is developed. Claimed bactericin or strain 2512 are used as component of bactericide composition, being capable to suppress growth of gram positive pathogenic bacteria, in particular Listeria monocytogenes.

EFFECT: large scale application of bacteriocin against pathogenic or undesired flora in food industry.

13 cl, 2 dwg, 1 tbl, 3 ex

FIELD: biotechnology, microbiology, medicine.

SUBSTANCE: invention represents group of Neisseria proteins eliciting antigen properties. Protein eliciting antigen properties comprises fragment of protein ORF 40 (amino acid sequence of ORF 40 is given in the invention claim) that involves 7 or more conservative amino acids arranging in succession. Proteins as components of proteins in the claimed group are used as a medicinal agent or for it manufacturing for treatment and prophylaxis of infection caused by Neisseria, and for manufacturing the diagnostic preparation. Invention relates also nucleic acid encoding the Neisseria protein. Nucleic acid is used as the protein. Applying the invention provides the maximal recognition and reactivity between strains of Neisseria. Invention can be used in manufacturing curative-prophylactic preparations with respect to Neisseria meningitides.

EFFECT: valuable biological and medicinal properties of antigen.

27 cl, 51 dwg, 10 ex

The invention relates to biotechnology and can be used for the treatment and prevention of disease associated with infection by Streptococcus or G+ bacteria
The invention relates to biotechnology, namely, construction of Escherichia coli - producer cholera toxin, and can be used to create a diagnostic test systems, allowing to detect toxigenic clones of Vibrio cholerae and Escherichia coli, as well as for the design of live vaccine strains against diarrhoeal diseases caused by pathogenic strains of V. cholerae and E.

The invention relates to biotechnology, in particular to global regulators of bacterial pathogenic genes used to make the resistance of plants to diseases

FIELD: medicine, genetics, biochemistry.

SUBSTANCE: invention relates to new NOS-variants or mutants that comprise structural modifications in site Akt-dependent phosphorylation. Modified NOS-proteins or peptides, in particular, human proteins or eNOS-peptides having change of amino acid residue corresponding to S/T in motif of the consensus-sequence RXRXXS/T of NOS-polypeptide of wild type and nucleic acid molecules encoding thereof can be used in genetic therapy and proteins and NOS-peptides can be used in screening methods of agents modulating activity of NOS. The advantage of invention involves the creature of new NOS-variants or mutants that can be used in genetic therapy.

EFFECT: valuable medicinal properties of mutants.

25 cl, 1 tbl, 9 dwg, 3 ex

Up!