Recombinant plasmid dna ptes-his-oph and producer of oligohistidine-containing organophosphate hydrolase

FIELD: genetic engineering, molecular biology, biochemistry.

SUBSTANCE: recombinant plasmid DNA pTES-His-OPH is constructed for expression of polypeptide eliciting properties of organophosphate hydrolase comprising Cla I/Hind III fragment of plasmid pTrcTEGF, fragment of plasmid pTES-OPH with nucleotide sequence that encodes amino acid sequence of the matured form of organophosphate hydrolase, and nucleotide sequence encoding 6 histidine residues that is located by 5'-end of nucleotide sequence encoding organophosphate hydrolase. Based on indicated plasmid the strain Escherichia coli TSKMIBKH-29 - a producer of polypeptide eliciting properties of organophosphate hydrolase is obtained. Applying the invention provides preparing polypeptide with properties of organophosphate hydrolase by simplified technology and this polypeptide elicits the improved catalytic effectiveness of action with respect to thio-containing phosphoric acid triesters. Invention can be used for carrying out hydrolysis of organophosphate compounds.

EFFECT: valuable biochemical properties of producer.

2 cl, 4 dwg, 2 tbl, 4 ex

 

The invention relates to biotechnology, in particular genetic engineering, and is designed in vitro recombinant plasmid DNA containing DNA protestirovanny form of the enzyme organophosphorous (RSAs), DNA encoding the synthesis of affine sequence consisting of six amino acid residues histidine (6x-His), trc-promoter of Escherichia coli and synthetic plot - power broadcast, causing the biosynthesis of His-OPH, and Escherichia coli producing this protein.

Organophosphorous (ORN) (ridiuculous, paraoxonase, phosphotriesterase, EC 3.1.8.1) is an enzyme that catalyzes the hydrolysis of its ester linkages in trifiro phosphoric acid, contains two ions of bivalent metal (Zn2+or With2+on one subunit. The enzyme in different degrees capable of catalyzing the hydrolysis of P-O, P-F and P-S bonds in trifiro phosphoric acid [Efremenko E.N., Sergeeva, B.C., Organophosphorous - enzyme that catalyzes the degradation of organophosphorus warfare agents and pesticides.// News of Academy of Sciences Ser. Chem., No. 10, s-1749, (2001)].

The need of obtaining ORN on an industrial scale is determined by the necessity of its use in the form of a catalytically active element biosensor devices for the determination of organophosphorus compounds in various object is (agricultural products, food, textile, water and wastewater) [P. Mulchandani, W. Chen, A. Mulchandani Flow injection amperometric enzyme biosensor for direct determination of organophosphate nerve agents.// Environ. Sci. Technol., V.35, p.2562-2565, (2001); A.L. Simonian, Efremenko E.N., J.R. Wild Discriminative detection of neurotoxins in multi-component samples.// Anal. Chim. Acta, V.444, p.179-186, (2001)], and the possibility of effective biodegradation of organophosphorus neurotoxins, which include all of organophosphorus pesticides widely used in agriculture, and warfare chemical agents (sarin, soman and Vx) [Hoskin F.C., Walker J.E., Dettbarn W.D., J.R. Wild Hydrolysis of tetriso by an enzyme derived from Pseudomonas diminuta as a model for the detoxication of O-ethyl S-(2-diisopropylaminoethyl) methylphosphonothiolate (VX).// Biochem. Pharmacol., V.49, p.711-715, (1995); V.K. Rastogi, J.J. DeFrank, T.C. Cheng, J.R. Wild Enzymatic hydrolysis of Russian-VX by organophosphorus hydrolase.// Biochem. Biophys. Res. Commun., V. 241, p.294-296, (1997)], the destruction of which is stipulated by the International Convention on chemical disarmament [United Nation Convention on the prohibition of the development, production, stockpiling and use of chemical weapons and on their destruction, corrected version in accordance with Depositary Notification C.N.246.1994. <http://www.opcw.org/html/db/cwc/eng/cwc frameset.html>].

The existing process for isolation and purification of the Orne, consisting of five consecutive stages [J.K. Grimsley, J.M. Scholtz, Pace, C.N., J.R. Wild Organophosphorus hydrolase is a remarkably stable enzyme that unfolds through a homodimeric intermediate.// Biochemistry, V.36, p.14366-14374, (1997)], is tedious, time-consuming and therefore-low-tech. Creating a design that Express genetically modi is p enzyme, containing oligoglycines sequence can afford to allocate a highly purified enzyme in two stages using a metal-chelating chromatography. This method of protein purification is based on the formation of the affinity complex between oligohistidine sequence of the protein and metal, which modified chromatographic media.

Known attempts konstruirovanie effective genetic engineering producers His-OPH-based E.coli cells.

Was established genetic construct pGFP-OPH [C.F. Wu, H.J. Cha, Rao G., Valdes J.J., and W.E. Bentley A green fluorescent protein fusion strategy for monitoring the expression, cellular location, and separation of biologically active organophosphorus hydrolase.// Appl. Environ. Biotechnol., V.54, R-83, (2000)], encoding the synthesis of a hybrid protein with the properties of the Orne, with the aim of obtaining the expressed enzyme. As vector was used a commercial plasmid pTrcHis (Invitrogen). In this vector was introduced the gene encoding the synthesis of green fluorescent protein (green fluorescent protein", GFP)to monitor the expression of RSAs in the cells of E. coli BL21. The final design gene encodes a hybrid protein containing oligoglycines sequence, GFP, site recognition by enterokinase (EC) and ORN (His-GFP-EK-OPH). Analysis of the level of expression of His-OPH was carried out indirectly through the registration of the level of GFP fluorescence. The yield of protein with properties of the Orne in the generated biological the system (plasmid pGFP-OPH, the strain of E.coli BL21) was not more than 1.4 mg of protein from 1 liter of culture fluid. According to the data given by the authors, the maximum biomass yield was about 3 grams to a liter of the culture liquid, therefore, the yield of protein His-GFP-OPH did not exceed 0.5 mg from 1 g of cells. The disadvantage of this design is not only low level expression of the protein, but rather complicated procedure of cleaning, due to the fact that the necessary processing of the selected hybrid protein enterokinase (within 12 h at 37° (C) to the Department of His-GFP-EK fragment of the protein. Next, you'll need additional cleaning Orne from extraneous proteins (GFP and the EC), the presence of which reduces the activity of ORN 3 times.

An attempt was made to increase the output of ORN by creating different hybrid proteins containing in its composition ORN [C.F. Wu, J.J. Valdes, G. Rao, W.E. Bentley Enhancement of organophosphorus hydrolase yield in Escherichia coli using multiple gene fusions.// Biotechnol Bioeng., V.75, p.100-103, (2001)]. Were created genetic constructions on the basis of commercial plasmid pTrcHis (Invitrogen)encoding the synthesis of various hybrid proteins containing two copies of the gene ORN in one protein. As strain-owner used cells E. coli BL21. In all cases, between the gene coding for RSAs, and oligohistidine sequence was the site of recognition by enterokinase (EC). In the case of the construction of His-GFP-EK-OPH-EK-OPH, containing the her two copies of the gene encoding ORN, located after His-GFP, the output of the Orne has doubled and amounted to about 1 mg of protein from 1 g of cells. This approach to increasing the yield of the RSAs in addition to the disadvantages of the previous analogue is still the one associated with the high mass of the obtained genetic structure (4,8 Md), leading to unsustainable existence of gene-expression system. The activity data on the final protein authors are not given.

This solution, as the closest to the claimed its purpose, namely, to obtain expression system, providing the maximum yield of His-OPH, taken as a prototype.

The present invention solves the problem of obtaining His-OPH by creating genetically engineered designs and strain cells, which provide a synthesis of significant amounts of active soluble form ORN containing oligoglycines the sequence in the cytoplasm of cells by inducible synthesis of the enzyme with inducer (isopropyl-β -D galactopyranoside, IPTG).

The problem is solved by constructing recombinant plasmid DNA pTES-His-OPH, encoding the inducible enzyme synthesis ORN containing oligoglycines sequence, and Escherichia coli strain SG13009[pREP4]/pTES-His-ORN, providing a synthesis of this protein expression level, allowing you to get at least 5 mg oceanog the protein from 1 g of wet biomass for the two stages (ultrasonic destruction of cells and metal-chelating chromatography).

Inducible high-level synthesis of the target polypeptide is provided by the presence in plasmids pTES-His-OPH trc-promoter of E. coli and synthetic amplifier broadcast of the gene 10 of bacteriophage T7.

Recombinant plasmid DNA pTES-His-OPH, encoding the enzyme organophosphites, characterized by the following features:

- has a molecular weight of 3.48 Md (5,276 KBP);

- encodes the amino acid sequence of the enzyme organophosphites;

- contains optimized hexaglycine sequence at the 5'end of the gene encoding the amino acid sequence of the enzyme organophosphites;

- consists of Cla I/Hind III DNA fragment of plasmid pTrcTEGF (Patent RU 2185438 C2, CL 12 N 15/12, 1/21, 2002) length 4,232 KBP containing the trc-promoter of E. coli, a synthetic amplifier broadcast TREN gene 10 of bacteriophage T7 gene bla β -lactamase, which determines the stability of the transformed plasmid pTES-His-OPH cells to ampicillin and plot ori of replication initiation; and DNA enzyme organophosphorous length 1,011 KBP, flanked by restriction sites for You HI and Hind III and optimized hexaglycine sequence;

- contains: trc-promoter of E. coli, a unique recognition sites of restriction endonucleases, with the following coordinates: Nco I - 265, Eco RI - 270, the PKK I - 286, Xba I - 340, Cla I - 377, Hind III - 1427.

Especially the part proposed plasmid constructions is the presence of trc-promoter that is coli that controls DNA synthesis enzyme Orne, and to enhance the broadcast, we use a synthetic amplifier broadcast, which gives the inducible synthesis of the target protein with reliable regulation and high yield, achieved at low concentrations of inducer.

To obtain strain-producer of the enzyme ORN competent cells of Escherichia coli SG13009[pREP4] transformed with recombinant plasmid pTES-His-OPH.

The resulting strain Escherichia coli SG13009[pREP4]/pTES-His-OPH has the following features:

Morphological features. Cells are small rod-shaped, gram-negative, risperadone, 1× 3-5 µm, motile.

Cultural characteristics. During growth on agar LB medium (LB medium: tripton - 10.0 g/l; yeast extract 5.0 g/l; NaCl 5.0 g/l; and 1.7% of baktagir) colonies are round, smooth, translucent, shiny, grey, smooth edge, the diameter of the colonies 1-3 mm; the pasty consistency. Growth in liquid medium LB (tripton - 10.0 g/l; yeast extract 5.0 g/l; NaCl 5.0 g/l) is characterized by smooth blushing with the formation of light draught.

Physical and biochemical characteristics. Cells grow at temperatures 4-42° s at the optimum pH of 6.8 to 7.2. As the source of nitrogen used as a mineral salt in ammonium form, and organic compounds in the form of peptone, tryptone, yeast extract, amino acids as a carbon source use amino acids, glycerol, carbohydrates.

Resistance to antibiotics. Cells are resistant to ampicillin (200 μg/ml), due to the presence of plasmid gene β -lactamase, and kanamycin (40 μg/ml).

The E. coli strain SG13009[pREP4]/pTES-His-OPH provides inducible synthesis of the enzyme organophosphorous containing oligoglycines sequence, with a high content of soluble forms of the enzyme in the cytoplasm, which allows to obtain not less than 5 mg of purified protein from 1 g of wet biomass per stage. The combination of the above-mentioned properties of the E. coli strain SG13009[pREP4]/pTES-His-OPH makes the preparation of recombinant His-ORN high-tech process.

The resulting strain was deposited in the culture collection of microorganisms of the Institute of Bioorganic chemistry named. Shemyakin-Y.A. Ovchinnikov, Russian Academy of Sciences at number 29.

Figure 1 shows the physical map of recombinant plasmid pTES-His-OPH; figure 2 - nucleotide DNA sequence of the enzyme organophosphorous with adjacent regulatory elements: trc - promoter (1-30 BP), power broadcast TREN (93-188 BP), the gene encoding hexanucleotide sequence (189-221), gene organophosphorous (222-1232 BP); initiation and termination codons are underlined, in the framework taken sites restricts: Eco RI, Cla I and Hind III; figure 3 - amino consistently the th enzyme organophosphites, the encoded recombinant plasmid pTES-His-OPH; figure 4 - electrophoregram lysates of cells of strain-recipient E. coli SG13009[pREP4] (track 1), producer strain E. coli SG13009[pREP4]/pTES-His-OPH (lane 2), protein molecular weight standards (lane 3) in 12%polyacrylamide gel (the arrow indicates the enzyme organophosphorous).

The invention is illustrated by the following examples.

Example 1. Construction of recombinant plasmino DNA pTES-His-ORN.

Conduct modification gene organophosphorous by attaching at the 5'end of the nucleotide sequence encoding 6 histidine residues and a few additional amino acid residues. Such modification is as follows.

Carry out the amplification of the gene of organophosphorous with two primers: primer For-Bam having the nucleotide sequence CTTCCGGATCCATCGGCACAGGCGATC, and Seq-Rev, having the nucleotide sequence GTAACCACTCACACGGCA. Primer For-Bam allows you to enter a restriction site for the endonuclease You HI in the beginning of the coding region of the gene of organophosphites. Primer Seq-Rev complementary internal region of the gene of organophosphites. Amplification is as follows. To 5 μl of a solution of plasmid DNA pTES-OPH, consisting of Cla I/Hind III DNA fragment of plasmid pTrcTEGF (Patent RU2185438 C2, CL 12 N 15/12, 1/21, 2002) length 4,232 KBP DNA enzyme organovo is fatherly length 1,011 KBP (10 ng/μl) (isolated from chromosomal DNA of cells of Pseudomonas diminuta VKM B-1297 polymerase chain reaction with primers FOR-Cla nucleotide sequence CTT CCA TCG ATA TGA GAG GAT CGC ATC and REV-Hind with nucleotide sequence CCA CAA AGC TTC ATG ACG CCC GCA AGG TC), was added 60 pmol of primer For-Bam and 60 pmol of primer Seq-Rev, 8 μl of a mixture containing 2.5 mm each of deoxynucleotidase, 10 ál of 10x buffer (100 mm Tris-HCl, pH 8.8, 500 mm KCl, 15 mm MgCl2), 2 units of Taq DNA polymerase and water to a total volume of 100 μl reaction mixture. Polymerase chain reaction (PCR) is conducted as follows: denaturation - 40 sec, 94° s; annealing - 50 sec, 55°; completion - 1 min, 72° s; number of cycles - 25. In the amplification gain of DNA 530 BP Reaction mixture after completion of PCR extracted with an equal volume of chloroform, and then precipitated with ethanol. After centrifugation and drying, the DNA was dissolved in 20 μl 10 mm Tris-HCl, 1 mm EDTA, pH 8.0. 5 µl of amplified DNA is treated with 10 units of restrictase You HI and 15% restrictase Sal I (Fermentas, Lithuania) for 1 h at 37° With 20 μl of buffer solution containing 33 mm Tris-acetate (pH of 7.9), 10 mm magnesium acetate, 66 mm potassium acetate, and the obtained hydrolysate are migrating from a 1.5%agarose gel DEAE-membrane fragment DNA organophosphorous length 218 KBP (BAM HI - Sal fragment), precipitated with ethanol, dried and dissolved in 20 μl of N2O.

5 μg of plasmid DNA pTES-OPH size 5243 KBP (0.5 μg/μl) is treated with 10 units of restrictase la I, 10 units of restrictase Sal I and 15% restrictase Hind III for 2 h at 37° With 30 μl of a buffer containing 33 mm Tris-acetate (pH of 7.9), 10 mm magnesium acetate, 66 mm potassium acetate, and the obtained hydrolysate are migrating from a 0.8%agarose gel DEAE-membrane NA-45 3'-terminal portion of the cDNA of organophosphorous length 796 KBP (Sal I - Hind III fragment), and the vector portion of the plasmid DNA length 4,232 KBP (Sal I - Hind III fragment). Selected fragments precipitated with ethanol, dried and dissolved in 20 μl of N2O. Oligoglycines sequence added in the composition of the synthetic oligonucleotide duplex the following structure:

This duplex was prepared as follows: 20 pmol each of the oligonucleotides (I) and (II) are mixed in aqueous solution with a volume of 20 μl containing 40 mm Tris-HCl, pH 7.8 and 10 mm MgCl2, after which the resulting mixture was heated to 80° C in a water bath and cooled to 20° C for 1 hour.

2 μl of a solution of the oligonucleotides after the formation of the duplex is mixed with 0.02 μg Sal I - Hind III DNA fragment of the enzyme organophosphorous length 69 KBP, 0,03 µg Bam HI - SalI fragment length 418 and 0.05 μg of the vector part of the plasmid DNA pTrcTEGF(b) length 4,232 KBP and spend ligase reaction for 3 h at 10° With 15 µl of a solution containing 40 mm Tris-Hcl (pH of 7.8), 10 mm MgCl2, 10 mm dithiothreitol, 0.5 mm ATP and 2 units of Weiss T4 DNA ligase. 5 μl of the reaction mixture used to transform 200 ál of competent cells XL-1 Blue. 1/10 cells used for transformation, plated on LB-agar containing 100 μg/ml ampicillin. From grown clones secrete plasmid DNA containing a DNA enzyme organophosphorous modified by adding getservletinfo sequence.

Finally the structure of the recombinant DNA pTES-His-OPH confirmed by determining the nucleotide sequence in a region gene of organophosphites. Amino acid sequence of organophosphorous modified by adding getservletinfo sequence shown in Figure 3.

Example 2. Obtaining strain-producer of the enzyme organophosphites.

Competent cells of Escherichia coli SG13009[pREP4]: NalSStrSrifS, lac-ara-gal-mtl-F-recA+uvr+transform the recombinant plasmid DNA pTES-His-OPH and get producing strains of enzyme His-OPH.

Example 3. Isolation and purification of recombinant what armenta organophosphites, containing oligoglycines sequence.

For accumulation of biomass cells use liquid nutrient medium TYE (tripton - 12.0 g/l, yeast extract - 24,0 g/l, glycerol - 4,0 ml/l KN2RHO4- 6,95 g/l, K2HPO4·3H2O - 12,54 g/l, pH 7,0), which add l2·6N2About to the concentration of 237 mg/l Before seeding cells in medium was added a solution of ampicillin (concentration in environment 100 μg/ml) and kanamycin (concentration in the environment of 25 µg/ml).

To obtain inoculum produce culture of the loop with Petri dishes in 20 ml of LB medium containing ampicillin 100 µg/ml, kanamycin 25 ág/ml 16-hour inoculum introduced into the flask containing 100 ml of complete culture medium, the culture is grown at 30° and With constant stirring (200 rpm) up until the optical density at a wavelength of 540 nm reaches of 0.6, then add IPTG to a concentration of 0.4 mm. Cells cultured for 24 hours. The obtained biomass was separated by centrifugation (5000 g, 15 min), weighed and resuspended in 50 mm phosphate buffer, pH 8.0, containing 300 mm sodium chloride (buffer for reading aloud) (mass ratio of biomass:buffer 1:5). Cells destroy sonification (frequency of 44 kHz) 6 times in 45 seconds between treatments biomass was incubated for 1 min in ice. The precipitate separated is EUT by centrifugation (15000 g, 30 min.)

To the supernatant add an equal volume of 50% slurry of Ni-NTA agarose pre-equilibrated in buffer for reading aloud, and stirred for 1 h Column is filled with the obtained suspension, washed (0.5 ml/min) eluting buffer (50 mm sodium phosphate (pH 6.0), 300 mm sodium chloride, 10% glycerol) and elute the enzyme from the column with a gradient solution of imidazole (from 0 to 0.5 M) in the eluting buffer. The obtained fractions containing His-OPH, combined and subjected to dialysis against 20 mm phosphate-carbonate buffer (pH 8.5).

In the cleaning process of 1 g of wet biomass receive 5 mg of purified enzyme with an average specific activity 6870 u/mg protein. The output of the enzyme is to 81.7% from the initial amount of His-OPH, synthesized by the cells (table 1).

Table 1.

The balance of the cleanup and highlight His-OPH from 1 g of biomass.
Cleanup stepTotal protein mgTotal activity, uSpecific activity, units/mg proteinClearance timeExit

%
Treatment of cells312436801401100
ultrasound      
Ni-NTA column5,23573068706081,7

Example 4. The study of the properties of the recombinant enzyme organophosphorous containing oligoglycines sequence.

The speed of the investigated reaction is monitored spectrophotometrically by the accumulation of the product 4-nitrophenolate anion (ε =18000 M-1cm-1pH of 10.7, λ =405 nm). To determine the catalytic activity of His-OPH in aqueous solutions using 0.05 M carbonate buffer (pH of 10.5). As the substrate used 1 mm aqueous solutions paraoxon, parathion and methyl-parathion.

The catalytic reaction is initiated by introducing into the cell buffer and substrate solution of His-OPH in 20 mm phosphate-carbonate buffer (pH 8.5). The concentration of enzyme in the cell is 10-10-10-9M

Per unit of enzyme activity take that amount of enzyme needed to hydrolyze 1 mm of substrate in 1 min at pH 10.5 and 20° C.

The calculation of the velocity of the enzymatic reaction is carried out on the initial linear parts of the kinetic curves (vo=tgα ). The maximum rate of the enzymatic reaction (Vm) and the Michaelis constant (Kmdetermine with ispolzovaniem reverse coordinates 1/v o-1[S] (Leinweber-Burke).

Kinetic characterization of recombinant organophosphites are given in table 2. the pH optimum of the enzyme is 10.5.

Table 2.

Hydrolysis constants FOS oligodendroglioma organophosphites.
Substratekcatwith-1Km, mcmkcat/KmM-1c-1
Paraoxon5100± 10010± 0,55,1× 108
Parathion530± 3015± 0,53,5× 107
Methyl-parathion310± 2073± 1,04,2× 106

Thus, the claimed technical solution is a plasmid with a unique design for microbial synthesis of the polypeptide having the properties of the Orne, and the strain of E.coli that ensures the expression of this plasmid. The solution provides a high yield of soluble protein His-OPH (not less than 5 mg from 1 g of cells) (Example 3), which is 5 times higher than the similar outputs of the hybrid proteins containing oligoglycines the sequence in known expression systems.

Unlike Izv the local analogues, the proposed solution allows you to:

to obtain the polypeptide, the catalytic efficiency is increased 10 times for a range of major substrates in comparison with the native enzyme ORN (Example 4);

to reduce the process of allocating His-OPH to two stages, allowing to obtain more than 80% of the original synthesized protein in the cells (Example 3) and to obtain a catalytically active enzyme without the need of the Department of Orne of extraneous protein markers, in particular, from His-GFP-EK.

All this greatly increases the adaptability and efficiency of the process of obtaining a highly active recombinant enzyme organophosphites.

The recombinant enzyme can be used for the preparation of kits for analytical determination of organophosphorus compounds, and also for the production of drugs based RSAs destined for degradation of organophosphorus compounds.

1. Recombinant plasmid DNA pTES-His-OPH encoding a polypeptide with properties of organophosphites, with a molecular weight of 3.48 Md (5,276 KBP), including

laI/Hind III DNA fragment from plasmid pTrcTEGF length 4,232 KBP,

fragment of plasmid pTES-OPH length 1,011 KBP having a nucleotide sequence that encodes the amino acid sequence of the Mature form of organophosphites, and fencerow the config site restriction Barn HI and Hind III, and

the nucleotide sequence of the GGGGGGG located at the 5'-end a nucleotide sequence that encodes the amino acid sequence of the Mature form of organophosphites, as well as containing a unique recognition sites of restriction endonucleases: Nco I - 265, Eco R1 - 270, Kpn I - 286, Xba I - 340, Cla I - 377, Hind III - 1427.

2. The bacterial strain Escherichia coli CMIBH-29 - producer of the polypeptide with properties of organophosphites.



 

Same patents:

FIELD: biotechnology, genetic engineering, pharmaceutical industry.

SUBSTANCE: plasmid DNA pET23-a(+)/PrxVIhumΔ178 with molecular weight of 19691.61 Da is constructed. DNA contains RNA-polymerase T7 promoter; replication initiation site; genetic marker which determinates resistance of cells transformed by said plasmid to ampicillin; and nucleotide sequence encoding N-terminal fragment of human peroxiredoxine VI containing 177 of amino acid residues. E.coli strain BL21/DE3/pET23-a(+)/PrxVIhumΔ178 being producer of N-terminal fragment of human peroxiredoxine VI is obtained by transformation of E.coli cells with plasmid DNA pET23-a(+)/PrxVIhumΔ178. Method of present invention makes it possible to obtain human peroxiredoxine VI fragment having reduced molecular weight, improved tissue permeability, and antioxidant activity of full-scale peroxiredoxine.

EFFECT: human peroxiredoxine VI fragment with improved tissue permeability.

2 cl, 3 dwg, 4 ex

FIELD: genetic and tissue engineering, biotechnology, medicine, agriculture.

SUBSTANCE: invention relates to the development of simple with constructive relation peptide vector (PGE-κ) consisting of polypeptide sequence of epidermal growth factor (EGF) and modified sequence of signal peptide T-antigen SV-40. New vector PGE-κ is able to provide the selective delivery of genetic material in target-cell cytoplasm carrying external receptors to EGF and the following its transport across nuclear membrane. Also, invention proposes a method for preparing peptide vector PGE-κ involving its expression as a fused protein "mutant thioredoxine-linker-vector" and cleavage of product expressed in E. coli in the linker region with specific protease. Invention provides preparing the recombinant strain E. coli B-8389 VKPM as a producer of the fused protein comprising PGE-κ. Proposed vector shows simple structure, absence of toxicity and immunogenicity and these properties provide its usefulness for the directed genetic modification of epithelial, embryonic and tumor cells in vivo.

EFFECT: improved preparing method, valuable medicinal properties of vector, improved genetic modification.

7 cl, 12 dwg, 4 tbl, 16 ex

The invention relates to genetic engineering, in particular the production of proinsulin Lyspro person, and can be used to create drugs of new generation for the treatment of insulin-dependent diabetes mellitus

The invention relates to medicine and biotechnology and concerns of soluble mutant CTLA4 molecules that bind to the antigen CD86 with higher avidity than wild type CTLA4

The invention relates to medicine and relates to peptides that can be used for cell adhesion and wound healing

The invention relates to biotechnology, in particular genetic engineering

The invention relates to biotechnology, in particular genetic engineering, and can be used to produce secreted modified colony-stimulating factor granulocyte person (hG-CSF)

The invention relates to the field of genetic engineering and biotechnology

FIELD: biotechnology, in particular method for production of L-amino acid except L-glutamic acid.

SUBSTANCE: claimed method includes cultivation of bacteria Methylophilus, which is capable to grow utilizing methanol as a main carbon source and to produce L-amino acid; and collection L-amino acid from culture. For example, bacteria Methylophilus with increased activity of dihydrodipicolinate synthase and aspartokinase is used. Said activity is increased by introducing DNA encoding dihydrodipicolinate synthase which is not inhibited with L-lysine by negative back coupling, and DNA encoding aspartokinase which is not inhibited with L-lysine by negative back coupling, into cells.

EFFECT: increased yield of L-amino acids.

10 cl, 7 dwg, 6 tbl, 7 ex

FIELD: biotechnology, in particular prephenate dehydrotase-chorismatmutase and DNA fragment encoding the same.

SUBSTANCE: prephenate dehydrotase-chorismatmutase is isolated from Methylophilus methylotropus and may contain replacements, deletions, inserts, or incorporations of one or more amino acids. Said enzyme plays an important role in L-phenylalanine biosynthesis. Method of present invention makes it possible to improve L-phenylalanine production due to increased activity of enzymes involving in L-phenylalanine biosynthesis pathway.

EFFECT: improved L-phenylalanine production.

2 cl, 2 dwg, 1 tbl

The invention relates to the field of biotechnology and concerns get a new polyketide-synthase, required for biosynthesis epothilones a and b

The invention relates to biotechnology, in particular genetic engineering

The invention relates to a microbiological method of obtaining aminoacids collection aspartate and/or glutamate on PP 1-17 claims, genes of providerbased on PP 18-23 claims, gene structures by p. 24 claims, vectors for p. 25 claims, transformed cells in PP 26-31 claims, as well as to their application on PP 32-37 claims

The invention relates to biotechnology, in particular the obtaining of cephalosporins using genetically modified organisms-owners

The invention relates to biotechnology, in particular to 3-deoxy-D-arabinoheptulosonate-7-phosphadites and fragment DNA, this enzyme codereuse

FIELD: biochemistry, gene engineering, in particular amidation of hormones and other peptides used in medicine and agriculture.

SUBSTANCE: peptide sequence obtained in process of triptic digesting of peptidylglycine alpha-amidating monooxygenase (PAM) from fat thyroid encephaloid carcinoma is determined. On the base of obtained data oligonucleotide sequences are synthesized and used for isolation of full-sized PAM encoding DNA. Expression of obtained DNA fragments in heterogeneous systems makes it possible to obtain recombinant PAM useful in amidation reaction of peptide substrate with C-terminated glycine providing the same effect that for native enzyme.

EFFECT: effective method for production of amidated peptides.

12 dwg, 2 tbl, 9 ex

Up!