Glucopyranosyloxybenzylbenzene derivatives, medicinal compositions comprising these derivatives and intermediate compounds for preparing indicated derivatives

FIELD: organic chemistry, medicine, pharmacy.

SUBSTANCE: invention relates to new derivatives of glucopyranosyloxybenzylbenzene represented by the formula (I): wherein R1 represents hydrogen atom or hydroxy(lower)alkyl; R2 represents lower alkyl group, lower alkoxy-group and lower alkylthio-group being each group is substituted optionally with hydroxy- or (lower)alkoxy-group, or to its pharmaceutically acceptable salts. Also, invention relates to pharmaceutical composition eliciting hypoglycemic activity and to a method for treatment and prophylaxis of hyperglycemia-associated diseases, such as diabetes mellitus, obesity and others, and to their intermediate compounds. Invention provides preparing new derivatives of glucopyranosyloxybenzylbenzene that elicit the excellent inhibitory activity with respect to human SGLT2.

EFFECT: valuable medicinal properties of compounds.

13 cl, 2 tbl, 2 ex

 

The scope to which the invention relates.

The present invention relates to glucopyranosyloxy derivatives and pharmaceutically acceptable salts, which can be used as drugs, pharmaceutical compositions containing these derivatives, and their intermediate compounds.

Prior art

Diabetes is one of the diseases associated with lifestyle and developing on the background of changing food habits and lack of exercise. Therefore, patients with diabetes shows dietetics and physiotherapy. In addition, if sufficient control and duration of such therapy is difficult, at the same time conduct the drug therapy. Currently, as antidiabetics used biguanides, sulfonylureas, and agents that reduce insulin resistance. However, sometimes, the biguanides and sulfonylureas side effects such as lactic acidosis and hypoglycemia, respectively. In the case of agents that lower insulin resistance, sometimes there are side effects such as swelling and progressive obesity. Therefore, to solve these problems it is necessary to develop antidiabetic agents, with the new mechanism of action.

In recent years there has been great progress in the development of antidiabetics new type, which stimulate the release of glucose in the urine and decrease the levels of glucose in the blood by preventing reabsorption of excess glucose in the kidney (J.Clin. Invest., Vol.79, pp.1510-1515 (1987)). In addition, it was reported that SGLT2 (Na+/antiport glucose 2) is present in the segment S1 of the proximal renal tubules and is involved mainly in the reabsorption of glucose that is filtered through the glomeruli (J.Clin. Invest., Vol.93, pp.397-404 (1994)). In accordance with this, the inhibition activity of human SGLT2 leads to the prevention of excessive reabsorption of glucose in the kidneys and, consequently, to the stimulation of excess glucose through the urine, and, thus, to normalize glucose levels in the blood. Therefore, necessary to quickly develop antidiabetics, who would possess inhibitory activity against human SGLT2, and which would have a new mechanism of action. In addition, since these agents stimulate the release of excess glucose through the urine, and consequently, a decrease in the accumulation of glucose in the body, it also assumes that they will have an action aimed at the prevention of obesity.

Description of the invention

The authors of the present invention there has been significant study, the directional to obtain compounds possessing inhibitory activity against human SGLT2. As a result of these studies it was found that glucoronosyltransferase derivative represented by the following General formula (I)have excellent inhibitory activity against human SGLT2, as will be shown below, and this fact was the basis of the present invention.

The present invention relates to the following glucoronosyltransferase derivatives and their pharmaceutically acceptable salts, which possess inhibitory activity against human SGLT2 In vivo and detect hypoglycemic effect through the release of excess glucose from the urine, preventing thereby the reabsorption of the indicated glucose in the kidney, as well as to pharmaceutical compositions containing these derivatives and intermediate compounds.

Thus, the present invention relates to glucoronosyltransferase derivative represented by the General formula:

where R1represents a hydrogen atom or hydroxy(lower)alkyl; and R2represents a lower alkyl group, lower alkoxygroup, lower allylthiourea, hydroxy(lower)alkyl or a group:hydroxy(lower)alkoxy, hydroxy(lower)alkylthio, lower alkoxy-substituted n is SSI alkyl, lower alkoxy-substituted lower alkoxy or lower alkoxy-substituted lower alkylthio, or its pharmaceutically acceptable salt.

The present invention relates to pharmaceutical compositions containing as active ingredient glucoronosyltransferase derivative represented by the above General formula (I)or its pharmaceutically acceptable salt.

The present invention relates to a method for prevention or treatment of diseases associated (affiliated) with hyperglycemia, introducing glucoronosyltransferase derivative represented by the above General formula (I) or its pharmaceutically acceptable salt.

The present invention relates to the use glucoronosyltransferase derivative represented by the above General formula (I) or its pharmaceutically acceptable salt for the manufacture of pharmaceutical compositions for the prevention or treatment of a disease associated with hyperglycemia.

The present invention also relates to benzylphenol derivative represented by the General formula:

where R11represents a hydrogen atom or a protected hydroxy(lower)alkyl; and R12represents a lower alkyl group or the Shui alkoxygroup, the lower allylthiourea, protected hydroxy(lower)alkyl, protected hydroxy(lower)alkoxy, protected hydroxy(lower)alkylthio, lower alkoxy-substituted lower alkyl, lower alkoxy-substituted lower alkoxy or lower alkoxy-substituted (lower)alkylthio; provided that R12not a methyl group, ethyl group, isopropyl group, tert-butilkoi group or methoxy group, when R11represents a hydrogen atom; or its salt.

In the present invention, the term "lower alkyl group" means a straight or branched alkyl group having from 1 to 6 carbon atoms, such as methyl group, ethyl group, through the group, isopropyl group, bucilina group, isobutylene group, sec-bucilina group, tert-bucilina group, pencilina group, isopentyl group, neopentyl group, tert-pencilina group, exilda group or the like; the term "lower alkoxygroup" means a straight or branched alkoxygroup having from 1 to 6 carbon atoms, such as methoxy group, ethoxypropan, propoxylate, isopropoxide, butoxypropan, isobutoxy, second-butoxypropan, tert-butoxypropan, pentyloxy, isopentylamine, neopentadactyla, tert-pentyloxy, hexyloxy or the like; and the term "lower allylthiourea" oznacza the t of a straight or branched allylthiourea, having from 1 to 6 carbon atoms, such as methylthiourea, ethylthiourea, PropertyGroup,isopropylthio, butylthiourea, isobutylthiazole, second-butylthiourea, tert-butylthiourea, intelligroup, isopentype, pointertype, tert-intelligroup, vexillographer or the like, the Term "hydroxy(lower)alkyl" means a straight or branched hydroxyalkyl group having from 1 to 6 carbon atoms, such as hydroxymethylene group, 2-hydroxyethylene group, 1-hydroxyethylene group, 3-hydroxiproline group, 2-hydroxiproline group, 1-hydroxiproline group, 2-hydroxy-1-mtilatila group, 4-hydroxybutyrate group, 3-hydroxybutyrate group, 2-hydroxybutyrate group, 1-hydroxybutylidene group, 5-hydroxymethylene group, 4-hydroxymethylene group, 3-hydroxymethylene group, 2-hydroxymethylene group, 1-hydroxymethylene group, 6-hydroxyhexyl group, 5-hydroxyhexyl group, 4-hydroxyhexyl group, 3-hydroxyhexyl group, 2-hydroxyhexyl group, 1-hydroxyhexyl group or the like; the term "hydroxy(lower)alkyloxy" means a straight or branched hydroxyalkoxy having from 1 to 6 carbon atoms, such as 2-hydroxyethoxy, 3-hydroxypropoxy, 2-hydroxypropoxy, 2-hydroxy-1-methylethoxy the PA, 4-hydroxybutyrate, 3-hydroxybutyrate, 2-hydroxybutyrate, 5-hydroxyphenylacetate, 4-hydroxyphenylacetate, 3-hydroxyethylacrylate, 2-hydroxyethylacrylate, 6-hydroxyhexyloxy, 5-hydroxyhexyloxy, 4-hydroxyhexyloxy, 3-hydroxyhexyloxy, 2-hydroxyhexyloxy or the like; the term "hydroxy(lower)alkylthio" means a straight or branched hydroxyalkyloxy having from 1 to 6 carbon atoms, such as hydroxymethylbutyrate, 2-hydroxyethylthio, 1-hydroxyethylthio, 3-hydroxypropionate, 2-hydroxypropionate, 1-hydroxypropionate, 2-hydroxy-1-metilethylchlorophos, 4-hydroxybutyrate, 3-hydroxybutyrate, 2-hydroxybutyrate, 1-hydroxybutyrate, 5-hydroxypethidine, 4-hydroxypethidine, 3-hydroxypethidine, 2-hydroxypethidine, 1-hydroxypethidine, 6-hydroxyhexyloxy, 5-hydroxyhexanoate, 4-hydroxyhexanoate, 3-hydroxyhexanoate, 2-hydroxyhexyloxy, 1-hydroxyacetone or the like, the Term "lower alkyl-substituted lower alkyl group" means the above hydroxy(lower)alkyl group, O-alkilirovanny the above-mentioned lower alkyl group; the term "lower alkoxy-substituted lower alkoxy means Visayas is nnow hydroxy(lower)alkyloxy, O-alkilirovanny the above-mentioned lower alkyl group; and the term "lower alkoxy-substituted lower alkylthio" means hydroxy(lower)allylthiourea, O-alkilirovanny above the lowest alkalino group.

The term "hidroxizina group" means hydroxyamino group used in General organic reactions, such as benzyl group, methoxymethyl group, acetyl group or the like

As Deputy R1preferred are a hydrogen atom and a hydroxyalkyl group having from 1 to 3 carbon atoms. As Deputy R2preferred are the lower alkyl group, lower alkoxygroup and hydroxy(lower)alkyl, and more preferred are an alkyl group having from 1 to 4 carbon atoms, alkoxygroup having from 1 to 3 carbon atoms and hydroxyalkyl group having from 1 to 3 carbon atoms.

So, for example, compounds represented by the above General formula (I) of the present invention, can be obtained using benzylphenol derivative of the present invention represented by the General formula (II) in accordance with the following procedure:

where R11represents a hydrogen atom or a protected hydroxy(lower)alkyl; R12 represents a lower alkyl group, lower alkoxygroup, lower allylthiourea, protected hydroxy(lower)alkyl, protected hydroxy(lower)alkoxy, protected hydroxy(lower)alkylthio, lower alkoxy-substituted lower alkyl, lower alkoxy-substituted lower alkoxy or lower alkoxy-substituted (lower)alkylthio; X represents a leaving group, such as trichloroacetimidates, acetochlor, bromine atom or fluorine atom; and R1and R2have the meanings given above.

Method 1

Glucoside represented by the above General formula (IV)can be obtained by glucoseamine benzylphenol derivative represented by the above General formula (II), or salts thereof, using donor glycosyl represented by the above General formula (III), such as 2,3,4,6-Tetra-O-acetyl-1-O-trichloroacetamido-α-D-glucopyranose, 1,2,3,4,6-Penta-O-acetyl-β-D-glucopyranose, 2,3,4,6-Tetra-O-acetyl-α-D-glucopyranoside and 2,3,4,6-Tetra-O-acetyl-β-D-glucopyranoside in the presence of an activating reagent, such as a complex of boron TRIFLUORIDE - diethyl ether, triftorbyenzola silver chloride tin (IV) or trimethylsilyltrifluoromethane in an inert solvent. Examples of the solvent used can serve as dichloromethane, toluene, acetonitrile, nitrome is h, the ethyl acetate, diethyl ether, chloroform, a mixture of these solvents and the like, the reaction Temperature is usually in the range from -30°C to the boiling temperature under reflux (reflux distilled), and the reaction time is usually from 10 minutes to 1 day, depending on the starting material, solvent and reaction temperature.

Method 2

The compound (I) of the present invention can be obtained by alkaline hydrolysis of the glucoside represented by the above General formula (IV), removing hydroxyamine groups. Examples of the solvent used can serve as water, methanol, ethanol, tetrahydrofuran, a mixture of these solvents and the like, as well as alkaline materials can be used sodium hydroxide, sodium methoxide, ethoxide sodium or other treatment Temperature is usually in the range of 0°to the temperature of reflux distilled, and the processing time is usually from 30 minutes to 6 hours, depending on the starting material, solvent and temperature processing. Such processing can be accomplished by appropriate modification of this procedure or by performing additional procedures in a standard way depending on hydroxyamino group.

So, for example, the compounds of the present invention represented by the above the General formula (II), and their salts, which are used as starting materials in the above method of production, can be obtained in accordance with the following procedure.

where M represents a hydrogen atom or hydroxyamino group; R4represents a hydrogen atom, a protected hydroxy(lower)alkyl or lower alkoxycarbonyl group; one of Y and Z represents MDG, gl, gl or the lithium atom and the other represents a formyl group; and R11and R12have the meanings given above.

Method And

Compounds represented by the above General formula (VII)can be obtained by condensation benzaldehyde derivative represented by the above General formula (V)with a Grignard reagent or a lithium reagent represented by the above General formula (VI), or condensation of the Grignard reagent or a lithium reagent represented by the above General formula (V), with benzaldehyde derivative represented by the above General formula (VI), in an inert solvent. Examples of the used solvent can be tetrahydrofuran, diethyl ether, a mixture of these solvents and the like, the reaction Temperature is usually in the range from -78°to the temperature of reflux distilled and the reaction time is usually from 10 minutes to 1 day, depending on the COI is lsemaj source material, solvent and reaction temperature.

Method In

The connection represented by the above General formula (VIII) can be obtained by oxidation of compounds represented by the above General formula (VII), using reagent dess-Martin in an inert solvent. Examples of the solvent used can serve as dichloromethane, chloroform, acetonitrile, a mixture of these solvents and the like, the reaction Temperature is usually in the range of 0°to the temperature of reflux distilled and the reaction time is usually from 1 hour to 1 day depending on the starting material, solvent and reaction temperature.

Way

The connection represented by the above General formula (II)can be obtained by removing the protective group of the compound represented by the above General formula (VIII), (1) condensing the obtained compound with methylchloroform in the presence of a base, such as triethylamine, diisopropylethylamine or N,N-dimethylaminopyridine, in an inert solvent, and (2) recovery obtained carbonate derived using a reducing agent such as borohydride sodium. As the solvent used in the reaction (1)can serve as tetrahydrofuran, dichloromethane, acetonitrile, ethyl acetate, diethyl ether, a mixture of these solvents, etc. the Temperature the reaction is usually in the range of 0° With up to the temperature of reflux distilled and the reaction time is usually from 30 minutes to 1 day, depending on the starting material, solvent and reaction temperature. As the solvent used in the reaction (2)may serve a mixed solvent of tetrahydrofuran and water and the like, the reaction Temperature is usually in the range of 0°to the temperature of reflux distilled and the reaction time is usually from 1 hour to 1 day, depending on the starting material, solvent and reaction temperature. In the case when R4represents the lower alkoxycarbonyl group, the compounds of the present invention represented by the above General formula (II)can be obtained by reduction of the specified group to hydroxymethylene group using a reducing agent such as alumalite lithium, in an inert solvent and protection of the hydroxy-group in the standard way. Examples of the solvent used can serve as diethyl ether, tetrahydrofuran, a mixture of these solvents and the like, the reaction Temperature is usually kept in the range of 0°to the temperature of reflux distilled and the reaction time is usually from 10 minutes to 1 day, depending on the starting material, solvent and reaction temperature. Compounds of the present invention, presents vishey is marks General formula (II), can be converted into their salt, such as sodium or potassium salt, in a standard way.

Method D

The compound of the present invention represented by the above General formula (II)can be obtained by catalytic hydrogenation of compounds represented by the above General formula (VII), using a palladium catalyst such as palladium on powdered charcoal, in the absence or in the presence of acid, such as hydrochloric acid in an inert solvent, and removal or introduction of a protective group in the standard way, if necessary. As the solvent used in the reaction of catalytic hydrogenation, can serve as methanol, ethanol, tetrahydrofuran, ethyl acetate, acetic acid, isopropanol, a mixture of these solvents and the like, the reaction Temperature is usually in the range from room temperature to the temperature of reflux distilled and the reaction time is usually from 30 minutes to 1 day, depending on the starting material, solvent and reaction temperature. If R4represents the lower alkoxycarbonyl group, the compounds of the present invention represented by the above General formula (II)can be obtained by reduction of the specified group to hydroxymethylene group using a reducing agent, so the th as alumalite lithium in an inert solvent, and the protection of this hydroxy-group in the standard way. As the solvent used in this reaction, recovery, can serve as diethyl ether, tetrahydrofuran, a mixture of these solvents and the like, the reaction Temperature is usually in the range of 0°to the temperature of reflux distilled and the reaction time is usually from 10 minutes to 1 day, depending on the starting material, solvent and reaction temperature. The compound of the present invention represented by the above General formula (II)may be converted into its salt, such as sodium or potassium salt, in a standard way.

Compounds of the present invention obtained by the above methods can be isolated and purified by standard methods of separation, such as fractional recrystallization, purification using chromatography, solvent extraction and solid phase extraction.

Glucoronosyltransferase derivatives of the present invention represented by the above General formula (I)can be converted into their pharmaceutically acceptable salts in a standard way. Examples of such salts are salts of inorganic bases such as sodium salt or potassium salt.

The compounds of the present invention presented is suspended above General formula (I), are their hydrates and their solvate with pharmaceutically acceptable solvents such as ethanol.

Compounds of the present invention represented by the above General formula (I)and their pharmaceutically acceptable salts possess excellent inhibitory activity against human SGLT2 and represent a highly valuable agents for the prevention or treatment of diabetes, diabetic complications, obesity or the like, for example, in the following analysis of the inhibitory effect on the activity of SGLT2 person compounds of the present invention have found a strong inhibitory activity against human SGLT2.

When using the pharmaceutical compositions of the present invention for practical treatment can be used in various dosage forms depending on the purpose of their use. Examples of such dosage forms include powders, granules, fine granules, dry syrups, tablets, capsules, injections, solutions, ointments, suppositories, poultices, etc. that are administered orally or parenterally.

These pharmaceutical compositions can be obtained by mixing with the appropriate pharmaceutical additives or dilution specified additives or dilution of these additives, such as fillers; dezintegriruetsja agents; binding the e agents; lubricating agents; diluents; buffers; agents, giving isotonicity; antiseptics; humidifiers; emulsifying agents; dispersing agents; stabilizers; substances that contribute to the dissolution, and the like, and a mixture in a standard way.

When using the pharmaceutical compositions of the present invention for practical treatment, the dose of a compound of the present invention represented by the above General formula (I)or its pharmaceutically acceptable salt, used as the active ingredient, appoint depending on age, sex, body weight, severity of symptoms and phases of treatment for each individual patient, and this dose is approximately from 0.1 to 1,000 mg per day per adult human in the case of oral administration and approximately within the range from 0.01 to 300 mg per day per adult human in the case of parenteral administration, the daily dose may be appropriate way entered as a single dose or multiple doses per day.

The best ways of carrying out the invention

The present invention is illustrated in more detail in the following Comparative examples, in the Examples and in the Examples of the test. However, the present invention is not limited to the given examples.

Comparative example 1

4-(3-benzyloxyphenyl)bramasol

Suspe is the Zia sodium hydride (60%, 0.97 g), 3-(4-bromophenyl)-1-propanol (1.0 g) and benzylbromide (0,69 ml) in benzene (24 ml) is stirred for 7 hours while boiling under reflux. After cooling to room temperature, to the reaction mixture is added saturated aqueous solution of ammonium chloride (50 ml) and the mixture extracted with ethyl acetate (100 ml). The organic layer was washed with water (40 ml) and saturated salt solution (40 ml) and dried over anhydrous sodium sulfate. The solvent is removed under reduced pressure and the residue purified column chromatography on silica gel (eluent: hexane/ethyl acetate = 20/1) to obtain 4-(3-benzyloxyphenyl)bromine benzol (1.4 g).

1H-NMR (Dl3) δ ppm:

1,85 is 2.00 (2H, m), 2,60-of 2.75 (2H, m), 3,47 (2H, t, J=6.2 Hz), 4,50 (2H, s), 7,00-7,10 (2H, m), 7,20 was 7.45 (7H, m).

Comparative example 2

Methyl-4-(4-active compounds)-3-hydroxybenzoate

To a solution of 1-bromo-4-ethylbenzene (0,41 ml) in tetrahydrofuran (15 ml) is added to 1.45 mol/l solution of tert-utility in n-pentane (2.3 ml) in an argon atmosphere at -78°C. After stirring the mixture at -78°within 10 minutes to the reaction mixture add a solution of methyl 4-formyl-3-hydroxybenzoate (0.18 g) in tetrahydrofuran (5 ml). After stirring the mixture under ice cooling for 45 minutes to the reaction mixture is added saturated aqueous solution of ammonium chloride and water and the mixture extracted with ethyl acetate. Extract prom the live water and dried over anhydrous magnesium sulfate and the solvent is removed under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate = 3/1) to obtain diphenylmethanone compound (0.27 g). Received diphenylmethane compound (0.27 g) was dissolved in methanol (5 ml) and to the solution was added concentrated hydrochloric acid (0,08 ml) and 10% palladium on powdered coal (54 mg). After stirring the mixture in an atmosphere of hydrogen at room temperature for 18 hours, the catalyst was removed by filtration and the filtrate concentrated under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate=3/1) to give methyl-4-(4-active compounds)-3-hydroxybenzoate (0.20 g).

1H-NMR (Dl3) δ ppm:

to 1.22 (3H, t, J=7,6 Hz), 2,62 (2H, kb, J=7,6 Hz)to 3.89 (3H, s), of 4.00 (2H, s), free 5.01 (1H, s), 7,05-of 7.25 (5H, m), 7,47 (1H, d, J=1.6 Hz), 7,56 (1H, DD, J=1,6, 7,8 Hz).

Comparative example 3

Methyl-3-hydroxy-4-(4-propoxyphenyl)benzoate

To a solution of 1-allyloxy-4-bromine benzol (3.1 g) in tetrahydrofuran (70 ml) is added to 1.45 mol/l solution of tert-utility in n-pentane (11 ml) in an argon atmosphere at -78°C. After stirring the mixture at -78°C for 5 minutes to the reaction mixture add a solution of methyl 4-formyl-3-hydroxybenzoate (0,89 g) in tetrahydrofuran (15 ml). After stirring the mixture under ice cooling for 30 minutes to the reaction mixture is added saturated aqueous races is the thief of ammonium chloride and water and the mixture extracted with ethyl acetate. The extract is washed with water and dried over anhydrous magnesium sulfate and the solvent is removed under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate=3/1) to obtain diphenylmethanone connection (0,99 g). Received diphenylmethanone connection (0,99 g) dissolved in methanol (10 ml) and to the solution was added 10% palladium on powdered coal (0,30 g). After stirring the mixture in an atmosphere of hydrogen at room temperature for 24 hours, the catalyst was removed by filtration and the filtrate concentrated under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate=3/1) to give methyl-3-hydroxy-(4-propoxyphenyl)benzoate (0.50 g).

1H-NMR (CDCl3) δ ppm:

of 1.02 (3H, t, J=7.4 Hz), 1.70 to of 1.85 (2H, m), 3,80-of 3.95 (5H, m), of 3.97 (2H, s), 4,99 (1H, s), 6.75 in-6,90 (2H, m), 7,05-7,20 (3H, m), 7,47 (1H, d, J=1.5 Hz), 7,56 (1H, DD, J=1.5 and 7.8 Hz).

Comparative example 4

Methyl-3-hydroxy-4-[4-(2-hydroxyethyl)benzyl]benzoate

To a solution of 2-(bromophenyl)ethanol (1.7 g) in tetrahydrofuran (100 ml) is added to 1.45 mol/l solution of tert-utility in n-pentane (of 12.6 ml) in an argon atmosphere at -78°C. After stirring the mixture at -78°within 10 minutes to the reaction mixture add a solution of methyl 4-formyl-3-hydroxybenzoate (0.50 g) in tetrahydrofuran (10 ml). After stirring sm is si with ice cooling for 30 minutes to the reaction mixture is added saturated aqueous solution of ammonium chloride and water and the mixture extracted with ethyl acetate. The extract is washed with water and dried over anhydrous magnesium sulfate and the solvent is removed under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate=1/3) to obtain diphenylmethanone compound (0.28 g). Received diphenylmethane compound (0.28 g) was dissolved in methanol (5 ml) and to the solution was added 10% palladium on powdered coal (0.14 g). After stirring the mixture at room temperature for 14 hours in an atmosphere of hydrogen, the catalyst was removed by filtration and the filtrate concentrated under reduced pressure. The residue is purified column chromatography on silica gel (eluent:hexane/ethyl acetate=1/1) to obtain methyl 3-hydroxy - 4-[4-(2-hydroxyethyl)benzyl]benzoate (0.26 g).

1H-NMR (CDCl3) δ ppm:

of 1.37 (1H, t, J=5,9 Hz), 2,84 (2H, t, J=6.5 Hz), 3.75 to of 3.95 (5H, m)to 4.01 (2H, s), 5,10 (1H, s), 7,05-of 7.25 (5H, m), 7,47 (1H, d, J=1.6 Hz), 7,56 (1H, DD, J=1,6, 7,8 Hz).

Comparative example 5

2-(4-isobutylphenyl)phenol

The Grignard reagent derived from 2-benzyloxyphenol (0.20 g), magnesium (0,026 g), a catalytic amount of iodine and tetrahydrofuran (1 ml). The resulting Grignard reagent is added to a solution of 4-isobutylbenzene (0.16 g) in tetrahydrofuran (2 ml) and the mixture is stirred at room temperature for 30 minutes. The reaction mixture was purified column chromatography on aminopropyl is imagele (eluent: tetrahydrofuran) to give diphenylmethanone connection (0,23 g). Received diphenylmethane compound is dissolved in ethanol (3 ml) and concentrated hydrochloric acid (0.1 ml). To the solution was added a catalytic amount of 10% palladium on powdered coal and the mixture is stirred in hydrogen atmosphere at room temperature overnight. The catalyst was removed by filtration and the filtrate concentrated under reduced pressure. The residue is purified column chromatography on silica gel (eluent: dichloromethane/hexane=1/1) to give 2-(4-isobutylphenyl)phenol (0.10 g).

1H-NMR (Dl3) δ ppm:

0,89 (6N, d, J=6.6 Hz), 1,75-1,90 (1H, m), 2,43 (2H, d, J=7,2 Hz), of 3.97 (2H, s), of 4.66 (1H, s), 6.75 in-6,85 (1H, m), 6,85-to 6.95 (1H, m), 7,00-7,20 (6N, m).

Comparative example 6

2-(4-isopropoxyphenyl)phenol

Specified in the title compound is obtained by a method described in comparative example 5, using 4-isopropoxybenzonitrile instead of 4-isobutylbenzene.

1H-NMR (CDCl3) δ ppm:

1,31 (6N, d, J=6,1 Hz), 3,93 (2H, s), 4,50 (1H, septet, J=6,1 Hz), 4.72 in (1H, s), 6.75 in-6,85 (3H, m), 6,85-to 6.95 (1H, m), 7,05-7,20 (4H, m).

Comparative example 7

2-(4-ethoxybenzyl)phenol

The Grignard reagent derived from 4-ethoxypropanol (1.5 g), magnesium (0,19 g) and catalytic amount of iodine and tetrahydrofuran (2 ml) in a standard way. To the obtained solution of the Grignard reagent is added dropwise add a solution of 2-benzyloxybenzaldehyde the IDA (1.1 g) in tetrahydrofuran (15 ml) and the mixture is stirred at room temperature for 30 minutes. To the reaction mixture is added saturated aqueous solution of ammonium chloride (10 ml) and water (20 ml) and the mixture extracted with ethyl acetate (100 ml). The extract was washed with water (20 ml) and saturated salt solution (20 ml) and dried over anhydrous sodium sulfate. Then the solvent is removed under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate=5/1) to obtain diphenylmethanone compound (1.7 g). Received diphenylmethane compound (1.7 g) dissolved in ethanol (25 ml). To the solution was added concentrated hydrochloric acid (0,42 ml) and a catalytic amount of 10% palladium on coal and the mixture is stirred in hydrogen atmosphere at room temperature for 18 hours. The catalyst was removed by filtration and the filtrate concentrated under reduced pressure. To the residue is added ethyl acetate (100 ml) and the mixture was washed with saturated aqueous sodium bicarbonate solution (30 ml) and saturated salt solution (30 ml). The organic layer is dried over anhydrous sodium sulfate and the solvent is removed under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate=8/1) to obtain 2-(4-ethoxybenzyl)phenol (0.85 grams).

1H-NMR (CDCl3) δ ppm:

of 1.39 (3H, t, J=7,1 Hz), 3,93 (2H, s), of 4.00 (2H, q, J=7,1 Hz), 4.72 in (1H, s), 6.75 in-6,85 (3H, m), 6,85-to 6.95 (1H, m), 7,05-7,20 (4H, m).

Comparative the example 8

2-[4-(3-benzoyloxymethyl)benzyl]phenol

The Grignard reagent derived from 4-(3-benzyloxyphenyl)bromine benzol (3.2 g), magnesium (0.25 g), a catalytic amount of iodine and tetrahydrofuran (10.5 ml). To the obtained solution of the Grignard reagent add a solution of 2-(methoxyethoxy)benzaldehyde (1.1 g) in tetrahydrofuran (24 ml) and the mixture was stirred at 65°C for 25 minutes. After cooling to room temperature, to the reaction mixture is added saturated aqueous solution of ammonium chloride (10 ml) and water (20 ml) and the mixture extracted with ethyl acetate (100 ml). The extract was washed with water (20 ml) and saturated salt solution (20 ml). After drying the extract over anhydrous sodium sulfate the solvent is removed under reduced pressure and the residue purified column chromatography on silica gel (eluent: hexane/ethyl acetate=5/1) to obtain diphenylmethanone compound (2.5 g). Received diphenylmethane compound (2.5 g) dissolved in ethanol (42 ml)solution was added catalytic amount of 10% palladium on powdered coal and the mixture is stirred in hydrogen atmosphere at room temperature for 7.5 hours. The catalyst was removed by filtration and the filtrate concentrated under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate=5/2) to obtain phenylpropanamine compound (1.6 g) obtained After dissolution phenylpropanamine compound (1.6 g) in dichloromethane (29 ml) to the solution was added 4-(dimethylamino)pyridine (0,069 g), the triethylamine (1.0 ml) and benzoyl chloride (0,79 ml) and the mixture is stirred at room temperature for 3 hours. To the reaction mixture are added ethyl acetate (100 ml) and water (30 ml) and the organic layer separated. The extract is washed with saturated salt solution (30 ml), dried over anhydrous sodium sulfate and the solvent is removed under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate=20/1) to give the ester compound (2.2 g). The mixture obtained ester compound (2.2 g), monohydrate p-toluensulfonate acid (0.21 g) and methanol (28 ml) was stirred at room temperature for 24 hours. The reaction mixture was concentrated under reduced pressure and the residue purified column chromatography on silica gel (eluent: hexane/ethyl acetate=5/1) to obtain

2-[4-(3-benzoyloxymethyl)benzyl]phenol (1.8 g).

1H-NMR (Dl3) δ ppm:

2,00-of 2.15 (2H, m), 2.70 height is 2.80 (2H, m), of 3.96 (2H, s)to 4.33 (2H, t, J=6.5 Hz), 4,74 (1H, Shir. C)6,75-6,85 (1H, m), 6,85-to 6.95 (1H, m), 7,05-7,20 (6N, m), 7,35 is 7.50 (2H, m), 7,50-the 7.65 (1H, m), 8,00-8,10 (2H, m).

Comparative example 9

2-[4-(2-benzoyloxymethyl)benzyl]phenol

Specified in the title compound is obtained by a method described in comparative example 8, using 4-(2-benzyloxyethyl)bromine benzol instead of 4-(3-benzyloxyphenyl)bromine benzol.

1H-NMR (CDCl3) δ ppm:

totaling 3.04 (2H, t, J=7,1 Hz), 3,98 (2H, s), 4,51 (2H, t, J=7,1 Hz), of 4.66 (1H, s), 6.75 in-6,85 (1H, m), 6,85-to 6.95 (1H, m), 7,05-7,25 (6N, m), 7,35 is 7.50 (2H, m), 7,50-of 7.60 (1H, m), 7.95 is-with 8.05 (2H, m).

Comparative example 10

5-acetoxymethyl-2-(4-active compounds)phenol

To a suspension of lithium aluminum hydride (95 mg) in diethyl ether (10 ml) add a solution of methyl-4-(4-active compounds)-3-hydroxybenzoate (0.27 g) in diethyl ether (5 ml) under cooling with ice. After boiling the mixture under reflux for 45 minutes to the reaction mixture under ice cooling successively added water (0.1 ml), 15% aqueous sodium hydroxide solution (0.1 ml) and water (0.3 ml). After stirring the mixture at room temperature for 5 minutes, the reaction mixture was poured into 0.5 mol/l hydrochloric acid and the resulting mixture extracted with ethyl acetate. The extract is dried over anhydrous magnesium sulfate and the solvent is removed under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate=1/1) to obtain the recovered compounds (0,22 g). After dissolving the obtained restored connection (0,22 g) in tetrahydrofuran (2 ml) to the solution add vinyl acetate (2 ml) and bis(dibutylamino)oxide (24 mg) and the mixture was stirred at 30°C for 19 hours. The reaction mixture was directly purified column chromatography on silica gel (eluent: hexane/ethyl acetate=3/1) to obtain acetoxymethyl-2-(4-active compounds)phenol (0.21 g).

1H-NMR (CDCl3) δ ppm:

to 1.21 (3H, t, J=7,6 Hz), is 2.09 (3H, s), 2,61 (2H, q, J=7,6 Hz), of 3.95 (2H, s), 4,74 (1H, s)of 5.03 (2H, s), to 6.80 (1H, d, J=1.3 Hz), 6,80-of 6.90 (1H, m), 7,05-7,20 (5H, m).

Comparative example 11

5-acetoxymethyl-2-(4-propoxyphenyl)phenol

Specified in the title compound is obtained by a method described in comparative example 10 using methyl-3-hydroxy-4-(4-propoxyphenyl)benzoate instead of methyl-4-(4-active compounds)-3-hydroxybenzoate.

1H-NMR (CDCl3) δ ppm:

of 1.02 (3H, t, J=7.4 Hz), 1.70 to of 1.85 (2H, m), is 2.09 (3H, s), 3,88 (2N, 7, J=6.6 Hz), 3,91 (2H, s), 5,02 (2H, s), 5,28 (1H, s)6,70-of 6.90 (4H, m), 7,00-7,20 (3H, m).

Comparative example 12

2-[4-(2-acetoxyethyl)benzyl]-5-acetoxymethyl

Specified in the title compound is obtained by a method described in comparative example 10 using methyl-3-hydroxy-4-[4-(2-hydroxyethyl)benzyl]benzoate instead of methyl-4-(4-active compounds)-3-hydroxybenzoate.

1H-NMR (Dl3) δ ppm:

2,03 (3H, s), is 2.09 (3H, s), 2,90 (2H, t, J=7,1 Hz), of 3.96 (2H, s), 4,25 (2H, t, J=7,1 Hz), 4,82 (1H, s)of 5.03 (2H, s), to 6.80 (1H, d, J=1.5 Hz), 6.87 in (1H, DD, J=1.5 and 7.7 Hz), 7,05-7,20 (5H, m).

Comparative example 13

2-(4-ethylthiomethyl)phenol

The Grignard reagent derived from 1-bromo-4-(ethylthio)benzene (1.1 g), magnesium (0.12 g), a catalytic amount of iodine and tetrahydrofuran (5 ml). To a solution of the Grignard reagent add a solution of 2-(methoxyethoxy)benzaldehyde (0.56 g) in tetrahydrofuran is e (12 ml) and the mixture was stirred at 65° C for 10 minutes. After cooling to room temperature, to the reaction solution was added saturated aqueous solution of ammonium chloride (5 ml) and water (20 ml) and the mixture extracted with ethyl acetate (80 ml). The extract was washed with water (20 ml) and saturated salt solution (20 ml), dried over anhydrous sodium sulfate and the solvent is removed under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate=4/1) to obtain diphenylmethanone connection (0,91 g). Received diphenylmethanone connection (0,90 g) dissolved in dichloromethane (15 ml). To the solution add reagent dess-Martin (1,1,1-three(atomic charges)-1,1-dihydro-1,2-benzodioxol-3(1H)-one) (1.5 g) and the mixture was stirred at 25°C for 26 hours. To the reaction mixture is added diethyl ether (75 ml) and 1 mol/l aqueous solution of sodium hydroxide (30 ml), the mixture is intensively stirred and the organic layer separated. The organic layer was washed with 1 mol/l aqueous solution of sodium hydroxide (30 ml), water (30 ml, 3 times) and saturated salt solution (30 ml), dried over anhydrous sodium sulfate and the solvent is removed under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate=15/1-9/1) to give the ketone compounds (0,82 g). The mixture obtained ketone compounds (0,81 g), monohydrate p-tawassul the new acid (0.10 g) and methanol (14 ml) was stirred at 60° C for 4 hours. After cooling to room temperature the reaction mixture was concentrated under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate=15/1) to obtain the connection with the removed protection (0,69 g). The compound obtained is removed from protection (0.68 g) was dissolved in tetrahydrofuran (11 ml), the solution is added triethylamine (0,41 ml) and methylchloroform (0,22 ml) and the mixture was stirred at 25°C for 1 hour. Then the reaction mixture is added triethylamine (0,11 ml) and methylchloroform (0,061 ml) and the mixture is stirred for 30 minutes. The reaction mixture is filtered and the filtrate concentrated under reduced pressure. The residue is dissolved in tetrahydrofuran (14 ml) and water (7 ml), the solution add borohydride sodium (0.40 g) and the mixture was stirred at 25°C for 7 hours. To the reaction mixture are added dropwise 1 mol/l hydrochloric acid (15 ml) and the mixture extracted with ethyl acetate (75 ml). The extract was washed with water (20 ml), saturated aqueous sodium bicarbonate (20 ml) and saturated salt solution (20 ml), dried over anhydrous sodium sulfate and the solvent is removed under reduced pressure. The residue is purified column chromatography on silica gel (eluent: hexane/ethyl acetate=8/1) to obtain 2-(4-ethylthiomethyl)phenol (0,62 g).

1H-NMR (CDCl3) δ ppm:

of 1.29 (3H, t, J=,3 Hz), 2,90 (2H, kb, J=7,3 Hz), of 3.96 (2H, s), to 4.62 (1H, s), 6.75 in-to 6.80 (1H, m), 6,85-to 6.95 (1H, m), 7,05-7,20 (4H, m), 7,20-7,30 (2H, m).

Comparative example 14

2-(4-methoxyethyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosid

To a solution of 2-(4-methoxybenzyl)phenol (46 mg) and 2,3,4,b-Tetra-O-acetyl-1-O-trichloroacetamido-α-D-glucopyranose made (0.13 g) in dichloromethane (2 ml) is added a complex of boron TRIFLUORIDE - diethyl ether (0,033 ml) and the mixture is stirred at room temperature for 1 hour. The reaction mixture was purified column chromatography on aminopropylsilyl (eluent: dichloromethane) to give 2-(4-methoxybenzyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranoside (0.11 g).

1H-NMR (CDCl3) δ ppm:

at 1.91 (3H, s)2,03 (3H, s), is 2.05 (3H, s), of 2.08 (3H, s), of 3.77 (3H, s), 3,80-of 3.95 (3H, m), 4,17 (1H, DD, J=2,5, and 12.2 Hz), the 4.29 (1H, DD, J=5,5, and 12.2 Hz), 5,11 (1H, d, J=7.5 Hz), 5,10-a 5.25 (1H, m), 5.25-in of 5.40 (2H, m,), 6,75-6,85 (2H, m), 6,95-7,10 (5H, m), 7,10-of 7.25 (1H, m).

Comparative example 15

2-(4-methylbenzyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosid

Specified in the title compound is obtained by a method described in comparative example 14, using 2-(4-methylbenzyl)phenol instead of 2-(4-methoxybenzyl)phenol.

1H-NMR (CDCl3) δ ppm:

1,89 (3H, s)2,03 (3H, s), is 2.05 (3H, s)2,07 (3H, s), is 2.30 (3H, s), 3,80-of 3.95 (3H, m), 4,17 (1H, DD, J=2,5, 12.3 Hz), 4,28 (1H, DD, J=5,5, 12.3 Hz), 5,11 (1H, d, J=7.5 Hz), 5,10-a 5.25 (1H, m), 5.25-in of 5.40 (2H, m,), 6,90-7,20 (8H, m).

Comparative example 16

2-(4-active compounds)phenyl-2,3,4,6-Tetra-O-acetyl-β -D-glucopyranosid

Specified in the title compound is obtained by a method described in comparative example 14, using 2-(4-active compounds)phenol instead of 2-(4-methoxybenzyl)phenol.

1H-NMR (Dl3) δ ppm:

of 1.20 (3H, t, J=7,6 Hz)to 1.87 (3H, s)2,03 (3H, s), is 2.05 (3H, s), of 2.08 (3H, s), 2,60 (2H, kb, J=7,6 Hz), of 3.80-4.00 points (3H, m), 4,18 (1H, DD, J=2,3, and 12.2 Hz), 4,28 (1H, DD, J=5,4, and 12.2 Hz), 5,11 (1H, d, J=7.5 Hz), 5,10-a 5.25 (1H, m), 5.25-in of 5.40 (2H, m), 6.90 to-to 7.25 (8H, m).

Comparative example 17

2-(4-isobutylphenyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosid

Specified in the title compound is obtained by a method described in comparative example 14, using 2-(4-isobutylphenyl)phenol instead of 2-(4-methoxybenzyl)phenol.

1H-NMR (Dl3) δ ppm:

0,88 (6N, d, J=6.6 Hz), 1,75-1,90 (1H, m)to 1.87 (3H, s)2,03 (3H, s), is 2.05 (3H, s), of 2.08 (3H, s), 2,42 (2H, d, J=7,2 Hz), 3,80-of 3.95 (3H, m), 4,18 (1H, DD, J=2,4, 12.3 Hz), the 4.29 (1H, DD, J=5,5, 12.3 Hz), 5,11 (1H, d, J=7,6 Hz), 5,10-a 5.25 (1H, m), 5.25-in of 5.40 (2H, m), 6.90 to-to 7.25 (8H, m).

Comparative example 18

2-(4-ethoxybenzyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosid

Specified in the title compound is obtained by a method described in comparative example 14, using 2-(4-ethoxybenzyl)phenol instead of 2-(4-methoxybenzyl)phenol.

1H-NMR (Dl3) δ ppm:

of 1.39 (3H, t, J=7.0 Hz), at 1.91 (3H, s)2,03 (3H, s), is 2.05 (3H, s)2,07 (3H, s), 3,80-of 3.95 (3H, m)to 3.99 (2H, q, J=7.0 Hz), 4,18 (1H, DD, J=2,5, 12.3 Hz), 4,28 (1H, DD, J=5,6, 12.3 Hz), 5,10 (1 is, d, J=7,7 Hz), 5,15-5,25 (1H, m), 5.25-in of 5.40 (2H, m), 6.75 in-6,85 (2H, m), 6,95-7,10 (5H, m), 7,10-7,20 (1H, m).

Comparative example 19

2-(4-isopropoxyphenyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosid

Specified in the title compound is obtained by a method described in comparative example 14, using 2-(4-isopropoxyphenyl)phenol instead of 2-(4-methoxybenzyl)phenol.

1H-NMR (Dl3) δ ppm:

1,30 (6N, d, J=6.0 Hz), 1,90 (3H, s)2,03 (3H, s), is 2.05 (3H, s), of 2.08 (3H, s), 3,80-are 3.90 (3H, m), 4,18 (1H, DD, J=2,3, 12.3 Hz), 4,28 (1H, DD, J=5,5, 12.3 Hz), 4,48 (1H, septet, J=6.0 Hz), 5,10 (1H, d, J=7,7 Hz), 5,10-a 5.25 (1H, m), 5.25-in of 5.40 (2H, m), 6,70-6,85 (2H, m), 6.90 to-7,10 (5H, m), 7,10-7,20 (1H, m).

Comparative example 20

5-acetoxymethyl-2-(4-active compounds)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosid

Specified in the title compound is obtained by a method described in comparative example 14, using 5-acetoxymethyl-2-(4-active compounds)phenol instead of 2-(4-methoxybenzyl)phenol.

1H-NMR (Dl3) δ ppm:

of 1.20 (3H, t, J=1.6 Hz), a 1.88 (3H, s)2,02 (3H, s), is 2.05 (3H, s)2,07 (3H, s), is 2.09 (3H, s), 2,60 (2H, q, J=7,6 Hz), 3,80-of 3.95 (3H, m), 4,20 (1H, DD, J=2,4, 12.3 Hz), 4,27 (1H, DD, J=5,3, 12.3 Hz), 5,00-5,10 (2H, m)to 5.13 (1H, d, J=7,4 Hz), 5,15-of 5.40 (3H, m), 6,95-to 7.15 (7H, m).

Comparative example 21

Acetoxymethyl-2-(4-propoxyphenyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosid

Specified in the title compound is obtained by a method described in comparative example 14, since used the eat 5-acetoxymethyl-2-(4-propoxyphenyl)phenol instead of 2-(4-methoxybenzyl)-phenol.

1H-NMR (Dl3) δ ppm:

a 1.01 (3H, t, J=7.4 Hz), 1.70 to of 1.85 (2H, m), with 1.92 (3H, s)2,03 (3H, s), is 2.05 (3H, s)2,07 (3H, s), is 2.09 (3H, s), 3,80-of 3.95 (5H, m), 4,20 (1H, DD, J=2,4, 12.3 Hz), 4,27 (1H, DD, J=5,3, 12.3 Hz), 5,00-5,10 (2H, m,), 5,12 (1H, d, J=7,4 Hz), 5,15-of 5.40 (3H, m), 6.75 in-6,85 (2H, m), 6,95-7,10 (5H, m).

Comparative example 22

2-[4-(2-Acetoxyethyl)benzyl]-5-acetoxymethyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranosid

Specified in the title compound is obtained by a method described in comparative example 14, using 2-[4-(2-acetoxyethyl)benzyl]-5-acetoxystyrene instead of 2-(4-methoxybenzyl)phenol.

1H-NMR (Dl3) δ ppm:

1,89 (3H, s)2,03 (3H, s)2,03 (3H, s), is 2.05 (3H, s)2,07 (3H, s), is 2.09 (3H, s), is 2.88 (2H, t, J=7,1 Hz), 3,85-of 3.95 (3H, m), 4,15-of 4.35 (4H, m), 5,00-5,10 (2H, m)to 5.13 (1H, d, J=7.5 Hz), 5,15-of 5.40 (3H, m), 6,95-to 7.15 (7H, m).

Example 1

2-(4-methoxybenzyl)phenyl-β-D-glucopyranosid

The sodium methoxide (28% methanol solution of 0.12 ml) are added to a solution of 2-(4-methoxybenzyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranoside (0.11 g) in methanol (4 ml) and the mixture is stirred at room temperature for 30 minutes. The solvent is removed under reduced pressure. The residue is purified column chromatography on silica gel (eluent: dichloromethane/methanol=10/1) to give 2-(4-methoxybenzyl)phenyl-β-D-glucopyranoside (65 mg).

1H-NMR (Dl3) δ ppm:

3,35-3,55 (4H, m), of 3.69 (1H, DD, J=5,1, 12.1 Hz), to 3.73 (3H, s), of 3.80-4.00 points (2H, m), 4,03 (1 is, d, J=15.1 Hz), 4,91 (1H, d, J=7,4 Hz), 6.75 in-6,85 (2H, m), 6,85-to 6.95 (1H, m), 6,95-7,10 (1H, m), 7,10-7,20 (4H, m).

Example 2

2-(4-methylbenzyl)phenyl-β-D-glucopyranosid

Specified in the header of the compound obtained by the method described in example 1, using 2-(4-methylbenzyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranoside instead of 2-(4-methoxybenzyl)phenyl-2, 3,4, 6-Tetra-O-acetyl-β-D-glucopyranoside.

1H-NMR (CD3OD) δ ppm:

of 2.27 (3H, s), 3,35-3,55 (4H, m), of 3.69 (1H, DD, J=5,2, 12.0 Hz), 3,80-are 3.90 (1H, m), of 3.94 (1H, d, J=15,0 Hz), of 4.05 (1H, d, J to 15.0 Hz), 4,85-of 4.95 (1H, m), 6,85-to 6.95 (1H, m), 6,95-7,20 (7H, m).

Example 3

2-(4-active compounds)phenyl-β-D-glucopyranosid

Specified in the header of the compound obtained by the method described in example 1, using 2-(4-active compounds)phenyl-2,3,4,b-Tetra-0-acetyl-β-D-glucopyranoside instead of 2-(4-methoxybenzyl)phenyl-2, 3,4, 6-Tetra-O-acetyl-β-D-glucopyranoside.

1H-NMR (CD3OD) δ ppm:

1,15-1,25 (3H, m), 2,50-to 2.65 (2H, m), 3,35-3,55 (4H, m), 3,65 of 3.75 (1H, m), of 3.80-4.00 points (2H, m)4,06 (1H, d, J=14,9 Hz), 4,85-5,00 (1H, m), 6,85-7,00 (1H, m), 7,00-7,20 (7H, m).

Example 4

2-(4-isobutylphenyl)phenyl-β-D-glucopyranosid

Specified in the header of the compound obtained by the method described in example 1, using 2-(4-isobutylphenyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranoside instead of 2-(4-methoxybenzyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranoside.

1H-NMR (CD3OD) δ ppm:

Example 5

2-(4-ethoxybenzyl)phenyl-β-D-glucopyranosid

Specified in the header of the compound obtained by the method described in example 1, using 2-(4-ethoxybenzyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranoside instead of 2-(4-methoxybenzyl)phenyl-2, 3,4, 6-Tetra-O-acetyl-β-D-glucopyranoside.

1H-NMR (CD3OD) δ ppm:

of 1.35 (3H, t, J=6.8 Hz), 3,35-3,55 (4H, m), 3,60 of 3.75 (1H, m), 3,80-4,10 (5H, m), the 4.90 (1H, d, J=7,1 Hz), 6,70-6,85 (2H, m), 6,85-to 6.95 (1H, m), 7,00-7,20 (5H, m).

Example 6

2-(4-isopropoxyphenyl)phenyl-β-D-glucopyranosid

Specified in the header of the compound obtained by the method described in example 1, using 2-(4-isopropoxyphenyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranoside instead of 2-(4-methoxybenzyl)phenyl-2, 3,4,6-Tetra-O-acetyl-β-D-glucopyranoside.

1H-NMR (CD3OD) δ ppm:

1.27mm (6N, d, J=6.0 Hz), 3,35-3,55 (4H, m), of 3.69 (1H, DD, J=5,4, 12.1 Hz), 3,88 (1H, DD, J=2,0, 12.1 Hz), 3,91 (1H, d, J=15,0 Hz), was 4.02 (1H, d, J=15,0 Hz), 4,51 (1H, septet, J=6.0 Hz), 4,91 (1H, d, J=7,7 Hz), 6,70-6,85 (2H, m), 6,85-to 6.95 (1H, m), 7,00-7,10 (1H, m), 7,10-7,20 (4H, m).

Example 7

5-hydroxymethyl-2-(4-propoxyphenyl)phenyl-β-D-glucopyranosid

Specified in the header of the compound obtained by the method described in example 1, using 5-acetoxymethyl-2-(4-propoxyphenyl)phenyl-2,3,4,6-those who RA-O-acetyl-β -D-glucopyranoside instead of 2-(4-methoxybenzyl)phenyl-2, 3,4,6-Tetra-O-acetyl-β-D-glucopyranoside.

1H-NMR (CD3OD) δ ppm:

of 1.02 (3H, t, J=7.4 Hz), 1.70 to of 1.85 (2H, m), 3,30-3,55 (4H, m), 3,65 of 3.75 (1H, m), 3,80-of 3.95 (4H, m)4,00 (1H, d, J=15,0 Hz), of 4.54 (2H, s), is 4.93 (1H, d, J=7,4 Hz), 6,70-6,85 (2H, m), 6,85-to 6.95 (1H, m), 7,02 (1H, d, J=7,7 Hz), 7,05-7,20 (3H, m).

Example 8

2-(4-active compounds)-5-hydroxymethylene-β-D-glucopyranosid

Specified in the header of the compound obtained by the method described in example 1, using 5-acetoxymethyl-2-(4-active compounds)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranoside instead of 2-(4-methoxybenzyl)phenyl-2, 3,4,6-Tetra-O-acetyl-β-D-glucopyranoside.

1H-NMR (CD3OD) δ ppm:

to 1.19 (3H, t, J=7,6 Hz), to 2.57 (2H, kb, J=7,6 Hz), 3,30-3,55 (4H, m), 3,65 of 3.75 (1H, m), 3,85-4,00 (2H, m), Android 4.04 (1H, d, J=15,0 Hz), of 4.54 (2H, s), is 4.93 (1H, d, J=7,4 Hz), 6,85-to 6.95 (1H, m), 7,02 (1H, d, J=7,7 Hz), 7,06 (2H, d, J=8.1 Hz), 7,10-7,20 (3H, m).

Example 9

2-[4-(2-hydroxyethyl)benzyl]-5-hydroxymethylene-β-D-glucopyranosid

Specified in the header of the compound obtained by the method described in example 1 using 2-[4-(2-acetoxyethyl)benzyl]-5-acetoxymethyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranoside instead of 2-(4-methoxybenzyl)phenyl-2,3,4,6-Tetra-O-acetyl-β-D-glucopyranoside.

1H-NMR (CD3OD) δ ppm:

was 2.76 (2H, t, J=7,1 Hz), 3,30-3,55 (4H, m), 3,60 of 3.75 (3H, m), 3,85-4,00 (2H, m), of 4.05 (1H, d, J=14.6 Hz), of 4.54 (2H, s)to 4.92 (1H, d, J=7,2 Hz), 6,85-to 6.95 (1H, m), 7,03 (1H, d, J=7.9 for the TS) to 7.09 (2H, d, J=7.8 Hz), 7,10-7,20 (3H, m).

Example 10

2-[4-(2-hydroxyethyl)benzyl]phenyl-β-D-glucopyranosid

To a solution of 2-[4-(2-benzoyloxymethyl)benzyl]phenol (0,49 g) and 1,2,3,4,6-Penta-O-acetyl-β-D-glucopyranose (1/7 g) in toluene (5.2 ml) and dichloromethane (2.2 ml) is added a complex of boron TRIFLUORIDE - dietology ether (0,56 ml) and the mixture was stirred at 25°C for 8 hours. To the reaction mixture are added ethyl acetate (70 ml) and saturated aqueous sodium bicarbonate solution (25 ml) and the organic layer separated. The organic layer was washed with saturated salt solution (25 ml) and dried over anhydrous sodium sulfate and the solvent is removed under reduced pressure. The residue is dissolved in methanol (5 ml) and tetrahydrofuran (2.5 ml)to the resulting solution was added sodium methoxide (28% methanol solution of 0.14 ml) and the resulting mixture was stirred at 25°C for 12.5 hours. To the reaction mixture are added ethyl acetate (75 ml) and water (20 ml) and the organic layer separated. The organic layer was washed with saturated salt solution (20 ml), dried over anhydrous sodium sulfate and the solvent is removed under reduced pressure. The residue is dissolved in methanol (7.5 ml), the resulting solution was added sodium methoxide (28% methanol solution of 0.085 ml) and the resulting mixture was stirred at 25°C for 5 hours. The reaction mixture was purified column chromatography on si is imagele (eluent: dichloromethane/methanol=4/1). The solvent is removed under reduced pressure, to the residue is added diethyl ether and the resulting precipitates are collected by filtration. The obtained solid is washed with diethyl ether and dried under reduced pressure to obtain 2-[4-(2-hydroxyethyl)benzyl]phenyl-β-D-glucopyranoside (0,47 g).

1H-NMR (CD3OD) δ ppm:

was 2.76 (2H, t, J=7,1 Hz), 3,35-3,55 (4H, m), 3,65 of 3.75 (3H, m), 3,88 (1H, DD, J=1,8, AND 11.8 HZ), 3,95 (1H, d, J=15.2 Hz), 4,07 (1H, d, J=15.2 Hz), the 4.90 (1H, d, J=7,4 Hz), 6,85-to 6.95 (1H, m), 7,00-7,20 (7H, m).

Example 11

2- [4- (3-hydroxypropyl) benzyl] phenyl-β-D-glucopyranosid

Specified in the header of the compound obtained by the method described in example 10, using 2-[4-(3-benzoyloxymethyl)benzyl]phenol instead of 2-[4-(3-benzoyloxymethyl)benzyl]phenol.

1H-NMR (CD3OD) δ ppm:

1,70-of 1.85 (2H, m), 2,55-to 2.65 (2H, m), 3,30-3,60 (6N, m), of 3.69 (1H, DD, J=5,2, TO 11.9 HZ), 3,88 (1H, DD, J=2,0, to 11.9 Hz), 3,95 (1H, d, J=15.1 Hz), 4,06 (1H, d, J=15.1 Hz), the 4.90 (1H, d, J=7,3 Hz), 6,85-to 6.95 (1H, m), 7,00-7,20 (7H, m).

Example 12

2-(4-ethylthiomethyl)phenyl-β-D-glucopyranosid

To a solution of 2-(4-ethylthiomethyl)phenol (0.51 g) and 1,2,3,4,6-Penta-O-acetyl-β-D-glucopyranose (2.4 g) in toluene (6.3 ml) and dichloromethane (2.7 ml) is added a complex of boron TRIFLUORIDE - diethyl ether (0,78 ml) and the mixture is stirred at room temperature for 9 hours. To the reaction mixture are added ethyl acetate (70 ml) and saturated aqueous sodium bicarbonate solution (25 ml) and the organic layer separated. The organic layer was washed with saturated salt solution (25 ml), dried over anhydrous sodium sulfate and the solvent is removed under reduced pressure. The residue is dissolved in methanol (10.5 ml), the resulting solution was added sodium methoxide (28% methanol solution of 0.08 ml) and the mixture was stirred at 25°C for 18 hours. To the reaction mixture are added ethyl acetate (75 ml) and water (20 ml) and the organic layer separated. The organic layer was washed with saturated salt solution (20 ml), dried over anhydrous sodium sulfate and the solvent is removed under reduced pressure. The residue is purified column chromatography on silica gel (eluent: dichloromethane/methanol=10/1). The solvent is removed under reduced pressure, to the residue is added diethyl ether and the resulting precipitates are collected by filtration. The obtained colorless solid was washed with diethyl ether and dried under reduced pressure to obtain 2-(4-ethylthiomethyl)phenyl-β-D-glucopyranoside (0.51 g).

1H-NMR (CD3OD) δ ppm:

to 1.24 (3H, t, J=7,3 Hz), is 2.88 (2H, q, J=7,3 Hz), 3,35-3,55 (4H, m), of 3.69 (1H, DD, J=5,0, and 12.2 Hz), 3,88 (1H, DD, J=2.0 a, and 12.2 Hz), 3,95 (1H, d, J=15.1 Hz), 4,08 (1H, d, J=15.1 Hz), 4,91 (1H, d, J=7,3 Hz), 6,85-7,00 (1H, m), 7,00-7,10 (1H, m), 7,10-7,30 (6N, m).

Example test 1

Analysis of the inhibitory action on the activity of SGLT2 person

1) Construction of plasmid vector expressing human SGLT2 the ESA

cDNA library for PCR amplification was obtained by reverse transcription of total RNA obtained from human kidney (gene Ori), using oligo-dT as a primer and system for pre-amplification (SUPERSCRIPT Preamplification System (Gibco-BRL; LIFE TECHNOLOGIES). A DNA fragment encoding SGLT2 man was amplificatoare by PCR reaction using DNA polymerase Pfu (Stratagene), where the above-mentioned cDNA library of the human kidney was used as a template and the following oligonucleotides 0702F and 0712R represented as Sequence No. 1 and 2, respectively, were used as primers. Amplificatory DNA fragment ligated into pCR-Blunt (Invitrogen), a vector for cloning, in accordance with the standard method using the kit. A competent cell of Escherichia coli HB101 (Toyobo)was transformed in accordance with the standard method, and then made the selection of transformants on agar LB medium containing 50 μg/ml kanamycin. After extraction and selection plasmid DNA from one of these transformants was carried out by amplification of the DNA fragment encoding SGLT2 person, by PCR reaction using DNA polymerase Pfu (Stratagene), where the following oligonucleotides 0714F and 0715R represented as Sequence No. 3 and 4, respectively, were used as Prime time is impressive. Amplificatory DNA fragment hydrolyzed by enzymes Xhol and Hindlll, and then purified using a purification system Wizard (Promega). A purified DNA fragment was integrated into the corresponding restriction sites of pcDNA3.1 (-) Myc/His-A (Invitrogen), i.e. the vector for expression of the hybrid protein. A competent cell of Escherichia coli HB101 (Toyobo)was transformed in accordance with the standard method, and then made the selection of transformants on agar LB medium containing 100 μg/ml ampicillin. After extraction and purification of plasmid DNA from one of these transformants analyzed the sequence of the DNA fragment is integrated into the multiple cloning sites of the vector pcDNA3.1 (-) Myc/His-A. This clone compared to human SGLT2, described by Wells et al. (Am. J. Physiol., Vol. 263, pp. 459-465 (1992)) was the replacement of one base (ATS, which encodes isoleucine 433, was replaced by GTC). So was the resulting clone, in which the isoleucine 433 was replaced by valine. This plasmid vector expressing human SGLT2, in which the peptide represented by the Sequence No. 5, was Legerova with carboxyl terminal alanine residue was identified KL29.

Sequence No. 1 ATGGAGGAGCACACAGAGGC

Sequence No. 2 GGCATAGAAGCCCCAGAGGA

Sequence No. 3 AACCTCGAGATGGAGGAGCACACAGAGGC

Sequence No. 4 AACAAGCTTGGCATAGAAGCCCCAGAGGA

Sequence No. 5 KLGPEQKLISEEDLNAVDHHHHHH

2) Obtaining cells, unstable expressing human SGLT2

KL29, a plasmid encoding SGLT2 man was transferrable cells COS-7 (RIKEN CELL BANK RCB0539) by electroporation. Electroporation was performed using a gene pulser GENE PULSER II (Bio-Rad Laboratories) under the following condition: 0,290 kV, 975 μf, 2×106cells COS-7 and 20 µg KL29 in 500 µl medium OPTI-MEM I (Gibco-BRL: LIFE TECHNOLOGIES) in a cell type 0.4 cm After gene transfer, the cells were collected by centrifugation and resuspendable in the medium OPTI-MEM I (1 ml/cell). In each well of 96-hole tablet was added 125 μl of this cell suspension. After culturing overnight at 37°and 5% CO2in each well was added 125 μl of DMEM medium (Gibco-BRL: LIFE TECHNOLOGIES)containing 10% fetal bovine serum (Sanko Jyunyaku), 100 units/ml sodium penicillin G (Gibco-BRL: LIFE TECHNOLOGIES), and 100 μg/ml streptomycin sulfate (Gibco-BRL: LIFE TECHNOLOGIES). After cultivation until the next day, these cells were used to measure inhibitory activity against absorption of methyl-α-D-glucopyranoside.

3) Measurement of inhibitory activity, aimed at the absorption of methyl-α-D-glucopyranoside

After removal of the medium the cells COS-7, temporarily expressing human SGLT2, to each well was added 200 μl of buffer for pre-treatment (buffer, pH 7.4, containing 140 mm x is orida choline, 2 mm potassium chloride, 1 mm calcium chloride, 1 mm magnesium chloride, 10 mm 2-[4-(2-hydroxyethyl)-1-piperazinil]econsultancy acid and 5 mm Tris(hydroxymethyl)aminomethane), and cells were incubated at 37°C for 10 minutes. Buffer for pre-treatment was removed and again was added 200 μl of the same buffer, and then the cells were incubated at 37°C for 10 minutes. Seven μl of methyl-α-D- (U-14C) glucopyranoside (Amersham Pharmacia Biothech) was added to 525 μl of the specified buffer to absorb containing the test sample (buffer, pH 7.4, containing 140 mm sodium chloride, 2 mm potassium chloride, 1 mm calcium chloride, 1 mm magnesium chloride, 5 mm methyl-α-D-glucopyranoside, 10 mm 2-[4-(2-hydroxyethyl)-1-piperazinil]econsultancy acid and 5 mm Tris(hydroxymethyl)aminomethane), and the resulting mixture was stirred, and then received buffer for measuring absorption. As a control received buffer for measurements of absorption without the test compounds. To assess basal uptake in the absence of the test compound and sodium, similarly received buffer for measurement of basal uptake, which instead of sodium chloride contained 140 mm of choline chloride. After removal of the buffer for pre-treatment, each well was added 75 μl of buffer for measurement of absorption and cells were incubated at 37°C for 2 hours. After UD is ing the buffer for measurement of absorbance in each well was added 200 μl of wash buffer (buffer, pH 7.4, containing 140 mm choline chloride, 2 mm potassium chloride, 1 mm calcium chloride, 1 mm magnesium chloride, 10 mm methyl-α-D-glucopyranoside, 10 mm 2-[4-(2-hydroxyethyl)-1-piperazinil]econsultancy acid and 5 mm Tris(hydroxymethyl)aminomethane), and immediately removed. After two additional washes, cells were solubilizers added to each well of 75 μl of 0.2 n sodium hydroxide. After migration, cell lysates in PicoPlate (Packard) and added to each well 150 μl of MicroScint-40 (Packard) was measured radioactivity using a scintillation counter TopCount for microplates (Packard). The difference absorption was obtained as 100% value by subtracting the radioactivity in the basal uptake of radioactivity in the control absorption, and then using the least squares method to calculate the concentration at which inhibited 50% of the absorption value of the IC50), on the basis of the curve "concentration - inhibition". The results are presented in the following table 1.

[Table 1]
Test connectionThe value of the IC50(nm)
Example 1350
Example 2450
Example 3140
Example 4500
Example 5 330
Example 6370
Example 7140
Example 88,1
Example 927
Example 10210
Example 1175
Example 12110

Sample test 2

Analysis on the action, facilitating excretion (allocation) of glucose in urine

As experimental animals used the 3D rats, which were kept in conditions of starvation during the night (SLC., males at the age of 7 weeks, 180-240 g). Ten mg of the test compound suspended or dissolved in 300 μl of ethanol, and then dissolved by adding 1.2 ml of polyethylene glycol 400 and 1.5 ml of physiological solution, and then received a 3.3 mg/ml solution. Three hundred µl of this solution was dissolved in 2.7 ml of diluent (saline:polyethylene glycol 400:ethanol=5:4:1), and then got to 0.33 mg/ml. After measuring the body weight of rats in the tail vein of rats were injected with the test compound at a dose of 3 ml/kg (1 mg/kg). As a control, into the tail vein of rats were injected with intravenous only one saline (saline:polyethylene glycol 400:ethanol=5:4:1) at a dose of 3 ml/kg Immediately after intravenous injection into the tail vein of rats orally enter and 200 g/l glucose solution at a dose of 10 ml/kg (2 g/kg). Intravenous injection into the tail vein was performed with a needle for injection caliber 26 G and 1-ml syringe. Oral administration was performed using a gastric probe for rats and 2.5-ml syringe. The number of rats in one group were 2 or 3. The urine collection was carried out in a metabolic cage after oral administration of glucose. The collection of urine for analysis were performed 24 hours after oral administration of glucose. After urine collection urine volume was recorded and measured the concentration of glucose in the urine. The concentration of glucose in the urine was measured using a set for laboratory test: Glucose B-Test WAKO (Wako Pure Chemical Industries, Ltd.). Then determined the amount of excretion of glucose in urine for 24 hours at 200 g body weight for the total volume of urine, the concentration of glucose in the urine, and body weight. The results are presented in the following table 2.

[Table 2]
Test connectionThe number of allocation glucose in the urine (mg)
Example 127,4
Example 7109,1
Example 8238,9
Example 1069,5

Example test 3

Test for acute toxicity

Five male ICR mice (CLEA JAPAN, INC., 29-34 g, 5 animals which each group) were kept in conditions of starvation for 4 hours, then subcutaneously injected 666 mg/ml suspension, which was obtained by adding 2-[4-(2-hydroxyethyl)benzyl]phenyl-β-D-glucopyranoside a mixture of saline solution:polyethylene glycol 400:ethanol (5:4:1) at a dose of 3 ml/kg (2000 mg/kg). Within 24 hours after the introduction of the death of animals was not observed.

Industrial applicability

Glucoronosyltransferase derivatives of the present invention represented by the above General formula (I)have excellent inhibitory activity against human SGLT2. The present invention allows to obtain an agent for preventing or treating diabetes, diabetic complications, obesity or the like, in Addition, since the compound represented by the above General formula (II), are important as intermediate compounds for producing compounds represented by the above General formula (I), such compounds can be easily obtained compounds of the present invention represented by the above General formula (I).

1. Derived glucoronosyltransferase General formula

where R1represents a hydrogen atom or hydroxy(lower)alkyl, and R2represents a lower alkyl group, lower alkoxygroup and lower allylthiourea, each of which are optional the tion substituted by hydroxy or (lower)alkoxy group, or its pharmaceutically acceptable salt.

2. Derived glucoronosyltransferase according to claim 1 of General formula

where R1represents a hydrogen atom or hydroxy(lower)alkyl, and R3represents a lower alkyl group, lower alkoxygroup or hydroxy(lower)alkyl, or its pharmaceutically acceptable salt.

3. Pharmaceutical composition having hypoglycemic activity and inhibitory activity against human SGLT2, containing as an active ingredient derived glucoronosyltransferase according to claim 1 or 2, or its pharmaceutically acceptable salt.

4. The pharmaceutical composition according to claim 3, representing an inhibitor of human SGLT2.

5. The pharmaceutical composition according to claim 4, which is an instrument for the prevention or treatment of diabetes or complications associated with diabetes.

6. The pharmaceutical composition according to claim 4, which is an instrument for the prevention or treatment of obesity.

7. The method of prevention or treatment of a disease associated with hyperglycemia, including the introduction of a derived glucoronosyltransferase according to claim 1 or 2, or its pharmaceutically acceptable salt.

8. The method of prevention or treatment according to claim 7, where the specified disease associated hiperglucemia, is diabetes or diabetes complications.

9. The method of prevention or treatment according to claim 7, where the specified disease associated with hyperglycemia is obesity.

10. Derived glucoronosyltransferase according to claim 1 or 2, or its pharmaceutically acceptable salt as an active ingredient in pharmaceutical compositions for the prevention or treatment of a disease associated with hyperglycemia.

11. Derived glucoronosyltransferase or its pharmaceutically acceptable salt of claim 10, where the specified disease associated with hyperglycemia is diabetes or diabetes complications.

12. Derived glucoronosyltransferase or its pharmaceutically acceptable salt of claim 10, where the specified disease associated with hyperglycemia is obesity.

13. Benzylaniline derivative of General formula

where R11represents a hydrogen atom or a protected hydroxy(lower)alkyl, a R12represents a lower alkyl group, lower alkoxygroup, lower allylthiourea, protected hydroxy(lower)alkyl, protected hydroxy(lower)alkoxy, protected hydroxy(lower)alkylthio, lower alkoxy-substituted lower alkyl, lower alkoxy-substituted lower alkoxy or lower alkoxy-substituted lower alkylthio; priruslovye, what R12not a methyl group, ethyl group, isopropyl group, tert-butilkoi group or methoxy group, when R11represents a hydrogen atom; or its salt.



 

Same patents:

The invention relates to a group of new compounds katoteshikufu General formula I, where R1- fully stereometric nonpolar side chain of amino acids, presents alkyl radical which has up to 4 carbon atoms; R2- basic side chain amino acids, which the radical of the formula -(CH2)n-R3and R3= NH2,

< / BR>
and n is 1-4, and their salts, stereoisomers and mixtures of stereoisomers; two methods of producing these compounds, and to a medicinal product which is able to inhibit the growth of tumors or slow their growth

The invention relates to new ansicompliant with insulin action formula I, where a denotes N-P(O)(OH)-, H-P(S)(OH)-, HO-P(S)(OH)-, S(O)2(OR1)-, or NH2-C(O)-, where R1denotes a hydrogen atom or (C1-C4)-alkyl, Z represents 2 to 6 sugar residues from the group of: mannose, glucose, gluconic acid, Galaktionova acid, mononova acid, glucosamine, fructose or galactose or 2 to 6 sugar residues of a group specified for Z replaced by one-six independently of each other stands, mannose, glucosamine, dumanoski or mannose-glucosamine, and glycosidic bond both sugars mannose and glucosamine is between C-atoms, 1-3, 1-2 or 1 to 6, both sugars, and R denotes Inositol, inositols, Invitational, insatallation or inositoltrifosfata

-d-cixelsyd" target="_blank">

The invention relates to the synthesis of new biologically active compounds, in particular sulfonyl-D-toxilogical that may find use in therapy as antithrombotic agents, especially venous thrombotic agents

The invention relates to an improved process for the preparation of esters of carboxylic acids of General formula (I) esterification of the corresponding acids or anhydrides with alcohols in a molar ratio acid:ethanol=1: 0.35 to 2.2 in the presence of hydrocarbons as solvent and aromatic sulfonic acids or acidic sulfate as a catalyst at the boiling temperature of the reaction mixture by distillation of the formed water, followed by washing of the reaction mixture and neutralizing it with an alkaline solution, taken from 5-20 wt

The invention relates to the synthesis of biologically active chemical compounds and can be implemented in pharmacology, medicine and agriculture

The invention relates to synthetic organic chemistry, namely to a process for the preparation of esters of carboxylic acids of General formula:

< / BR>
where R is alkyl, aryl, substituted aryl, furyl, substituted furyl

R' is alkyl WITH1-C4

The invention relates to methods of producing optically active cyclobutanone the compounds of formula 1, where R3is a protective group
The invention relates to the synthesis of esters of carboxylic acids, in particular 2-ethoxyethylacetate (or 2-ethoxyethyl ester of acetic acid or ethylpyrazine), which is used as a solvent in the manufacture of varnishes, enamels, photoresists, some dyes, and sulfur dioxide adsorbent and carbon dioxide

The invention relates to the field of organic synthesis, namely the selective acetoxysilane 1,3-cyclopentadiene (CPD) in CIS-3,5-diacetoxyscirpenol (DACP)

The invention relates to the primary organic synthesis, and in particular to catalysts for diacetoxybiphenyl S-CIS-1,3-pen - tadiene in diacetoxybiphenyl
The invention relates to petrochemistry and can be used in the production of phenol and acetone Kukolnik method

The invention relates to analytical chemistry of organic compounds and can be used for concentration of phenol in analytical control of natural water, drinking water and treated wastewater

The invention relates to a process for the production of phenol method Kukolnik

The invention relates to the field of production of phenol, as well as preparation of catalysts for this process

The invention relates to a method of selective oxidation of aromatic compounds (e.g. benzene and its derivatives) in gidroksilirovanii aromatic compounds (for example, into the corresponding phenols)

The invention relates to a method for the synthesis of hydroxylated aromatic compounds by the oxidation of aromatic compounds with hydrogen peroxide in an organic solvent in the presence of synthetic zeolites

The invention relates to a method for production of phenol by direct gas-phase oxidation of benzene with nitrous oxide in the presence of industrial zeolites

-methylstyrene" target="_blank">

The invention relates to an improved method for production of phenol, acetone and-methylstyrene Kukolnik method and relates to the stage of acid decomposition of technical cumene hydroperoxide
Up!