Peptide vector, method for its preparing, nucleotide sequence, recombinant plasmid dna and strain escherichia coli b-8389 vkpm for its preparing, method for genetic modification of mammalian and human cells

FIELD: genetic and tissue engineering, biotechnology, medicine, agriculture.

SUBSTANCE: invention relates to the development of simple with constructive relation peptide vector (PGE-κ) consisting of polypeptide sequence of epidermal growth factor (EGF) and modified sequence of signal peptide T-antigen SV-40. New vector PGE-κ is able to provide the selective delivery of genetic material in target-cell cytoplasm carrying external receptors to EGF and the following its transport across nuclear membrane. Also, invention proposes a method for preparing peptide vector PGE-κ involving its expression as a fused protein "mutant thioredoxine-linker-vector" and cleavage of product expressed in E. coli in the linker region with specific protease. Invention provides preparing the recombinant strain E. coli B-8389 VKPM as a producer of the fused protein comprising PGE-κ. Proposed vector shows simple structure, absence of toxicity and immunogenicity and these properties provide its usefulness for the directed genetic modification of epithelial, embryonic and tumor cells in vivo.

EFFECT: improved preparing method, valuable medicinal properties of vector, improved genetic modification.

7 cl, 12 dwg, 4 tbl, 16 ex

 

Group of inventions relates to genetic and tissue engineering and can be used in biotechnology, medicine and agriculture.

Currently, many practical problems associated with changing the properties of a living organism, can be solved by the method of genetic modification. Such modification of target cells can be accomplished by providing transport of exogenous genetic material through the cell membrane into the cytoplasm of cells with subsequent expression encoded in genetic material, proteins, or with the subsequent interaction of genetic material with intracellular biopolymers order directional changes of the metabolism of modified cells.

A common concern is the delivery of genetic material to specific tissues, organs, overcoming the plasma membrane of target cells and transport to a specific target within the cell. It should be noted that since any genetic material is a potential mutagen, it is very important to prevent it from entering into other, not in need of transformation, the cells of the body.

Therefore, there still remains the task of finding a peptide vectors that are capable of selective transport of genetic material into the cytoplasm of target cells, and its subsequent transport DNAs what R their nuclei, defended on the possibilities of genetic material from intracellular degradation. Of particular practical interest are growing mammalian cells - epithelial, embryonic and tumor. Most of them bear on the surface of the receptor to a specific protein, epidermal growth factor (EGF). So promising in terms of transformation of these cells can be vectors carriers of genetic material, created on the basis of peptide sequences that interact with the receptor for EGF.

The level of technical condition.

The most simple in construction example of a peptide vector for genetic transformation of cells bearing receptors for EGF, is a complex in which the sequence of epidermal growth factor, providing specific interaction with target cells, covalently linked to the role of binding site nucleic acid polylysine [1]. Using this vector carry out targeted delivery of genetic material into the cell of a mammal expressing at their surface receptors for EGF. However, the described vectors and, respectively, the method of genetic modification of cells with its use does not involve active transport of oligonucleotides in the cell nucleus, which may tales of Atsa on security of exogenous genetic material within the cell.

Known peptide vector comprising the sequence of TGF-alpha, specifically interacts with the receptor for EGF; the domain of the yeast transcription factor GAL4 as a DNA-binding region and the translocation domain of exotoxin A of Pseudomonas to protect you enter in the cell genetic material from destruction in the endosomes [2]. Partially solving the problem of safety in the cytoplasm of exogenous material, offer the peptide vector is large and includes two alien for a cell protein that when used in vivo will result in the emergence of the immune response. In addition, this vector, as discussed above, is used for genetic modification of target cells only in the form of a complex with poly-L-lysine, which has a non-specific toxicity. Thus, the use of this vector in vivo appears to be unpromising.

Given these shortcomings, it looks natural tendency of improvement of peptide vectors of the desired target cells, which involves the use of specific peptide sequences that combine the ability to bind oligonucleotides and to ensure their specific transport through the nuclear membrane, the so-called “nuclear localization signals” (NLS). An example of such a peptide is the signal sequence of the T antigen of SV-40. The possibility of genetic modification of vertebrate cells by directed transport in the core of exogenous genetic material previously introduced into the cytoplasm of a cell by microinjection [3]. However, numerous studies in this area showed that the transport efficiency of the vector using NLS for binding and holding oligonucleotides into the nucleus, is questionable or, at least, not obvious a priori, since it is known that the “conductive properties of the NLS sharply weaken the structure of the complex with the genetic material. For such a vector system had an acceptable efficiency, the ratio of the vector to the oligonucleotide should, estimated to be above 100:1 [4]that is a consequence not only undesirable “load” cells of a foreign protein, but also the emergence of peptide-peptide interactions, which reduce the transport activity of the vector.

Morris et al. ([5] - the closest analogue) method of genetic modification of human fibroblasts requires the use of a two-component peptide vector MPG, providing directional transport genetic material into the target cell and then to the core and consisting of a nuclear localization signal large T-anti-Christ. s SV-40 peptide gp41 of HIV-1. The main disadvantage of this vector and method of application should include low selectivity towards the target cells and the lack of efficiency of transport genetic material into the nucleus, an acceptable level of which (for the reasons mentioned above) can only be achieved if the ratio of MPG-peptide: the oligonucleotide of at least 20:1.

In this regard, the main task of the present invention was to create a simple in their design, an effective peptide vector, suitable (non-toxic and does not cause an immune response) for directed genetic modification in vivo of cells that carry on their surface receptors for EGF. In addition, given that the chemical synthesis of polypeptides are not always justified in economic terms, as well as the fact that this remains an unresolved problem postsinteticescuu folding, the aim of this work was the development of genetically engineered method of obtaining significant quantities of such a vector with properly shaped conformation. If this was based on a well-known technique of expression of a foreign protein in E. coli in the form of a hybrid product, which he merged with the remainder of the modified thioredoxin (Glu30His, Gln62His) [6]. Additional remains of His highlight protein metal chelate-affinity chromatography.

R is the hiding of the invention.

Based on known results and developments in this research it was possible to assume that the solution of the problem of creating an effective two-component peptide vector, suitable for genetic modification in vivo cells actively expressing the receptors for EGF, can be found on the search path for optimal combining (in terms of nature amino acid sequence and its size) sequences based on the NLS sequences and providing specific interactions with receptors on target cells, the combination of which would have a minimal level of non-specific interactions.

This combination of components peptide vector was found and was consistently linked modified signal sequence of the T antigen of SV-40, consisting of 11 amino acid residues, and the amino acid sequence of epidermal growth factor (human) out of 53 amino acid residues. The result is a new peptide vector (64 amino acids) with SEQ ID No. 1, called PGE-k, which when performing genetic transformation provides targeted delivery of genetic material to cells bearing receptors for EGF, and transport it through cellular and nuclear membranes in a molar ratio with oligonucleotide is 3-10:1. Thus, the present invention provides improved selectivity and efficiency of the method of genetic modification of the considered target cells (the technical result).

To obtain a new peptide vector, a method of providing for the expression in E. coli recombinant nucleotide sequence (SEQ ID No. 5)that encodes a protein (SEQ ID No. 4), consisting of modified thioredoxin, PGE-k and combining them linker sequence, specifically cleaved by enterokinase and necessary for its implementation recombinant plasmid (pGEK) and recombinant E. coli strain (BL21(DE3)/pLysS/pGEK deposited in PMBC number In-8389).

Thus, the present invention includes the following objects.

The first object of the invention is a peptide vector PGE-k, providing preferential transport of exogenous genetic material into the cell of a mammal that lays outside the receptors for epidermal growth factor, and subsequent uptake into the nucleus of the specified cells, with the amino acid sequence SEQ ID No. 1, consisting of the derived amino acid sequence of epidermal growth factor (human) (SEQ ID No. 2), which is a binding site with external receptors called cells, and the sequence of the signal peptide of the T-antigen of SV40 (SEQ ID No. 3), which is responsible for binding of exogenous genetic material and overcoming them the nuclear envelope.

The second object of the invention relates to a nucleotide sequence that encodes a protein, which consists of a mutant form of thioredoxin (Glu30His, Gln62His), the linker sequence(Gly-Ser)2-Gly-(Asp)4-Lys-specifically cleaved by enterokinase, and the sequence of the peptide vector PGE-k and characterized by amino acid sequence SEQ ID No. 4. Preferably this nucleotide sequence represented by SEQ ID No. 5.

A third object of the invention is a recombinant plasmid pGEK for the expression of fused protein comprising a peptide vector PGE-k, which is characterized in that it has the size 3691 BP and consists of

- NdeI/AatII fragment of plasmid pGEMEX-1 having a size 2347 BP and contains the site of initiation of replication (Ori) and the gene for resistance to ampicillin (Bla);

- AatII/HindIII fragment of plasmid pGEMEX-1 having a size 755 BP and containing the second site of replication initiation (f1Ori), and

- the nucleotide sequence of SEQ ID No. 5.

The fourth object of the claimed group is a strain of Escherichia coli VKPM B-8389 containing plasmid pGEK and which is the producer of fused protein comprising a peptide vector PGE-k.

The fifth object of the invention relates to a method for obtaining a peptide vector is, providing:

- cultivation of recombinant E. coli strain VKPM B-8389 in conditions that ensure the expression of a peptide comprising the vector of the fused protein,

the hydrolysis of the obtained fused protein enterokinase or another protease that recognizes included in the linker sequence and specifically cleave the peptide bond following the specified linker, and

- selection of the target product.

The sixth object of the claimed group is a method of genetic modification of mammalian cells, outer bearing receptors for epidermal growth factor involving contacting these cells with exogenous genetic material in the presence of peptide vector PGE-k.

Description of the drawings.

Figure 1 shows the physical and genetic map of the new recombinant plasmid pGEK.

Legend: Bla - gene resistance to ampicillin, f1ori - site start replication, phage f1, T7p, T7t - promoter and terminator T7 polymerase, SP6p - promoter, an SP6 polymerase.

Figure 2 presents the nucleotide sequence of the gene thioredoxin (Glu30His, Gln62His), linker and epidermal growth factor, protonirovannykh in plasmid pGEMEX-1 restriction sites Ndel (905)* and BamHI (42)*, where

- fragments of the sequence pGEMEX-1 (Promega);

sequence of the gene of thioredoxin (Glu30His. Gln62His);

the gene sequence of the linker composition -(Gly-Ser)2-Gly-(Asp)4-Lys-

sequence of the gene for human epidermal growth factor.

* location restriction site Promega catalog.

Figure 3 shows a diagram of the construction of plasmid pGEMEX-1/Thio-hEGF.

4 shows the circuit construction of plasmid pGEK.

Figure 5 presents the scheme of inclusion in the gene sequence of the hybrid protein of the formula SEQ ID No. 4 gene binding site separation of exogenous genetic material of the formula SEQ ID No. 2.

Figure 6 shows a scheme for introduction of point mutations using polymerase chain reaction.

Figure 7 presents the results of electrophoretic fractionation at 15% of Tricin-SDS page of purified a new peptide vector PGE-k formula SEQ ID No. 1 in comparison with the recombinant peptide, human epidermal growth factor, where

1 - cleaned new peptide vector formula SEQ ID No. 1,

2 - control: recombinant peptide, human epidermal growth factor.

On Fig presents HPLC analysis of purified a new peptide vector formula SEQ ID No. 1. Column diasorb ST, h mm (Alsike, Russia), linear gradient of MeCN (5% to 95%, 45 min) in 0.01% aqueous CF3COOH.

Figure 9 presents the mass spectrum (MALDI) is a new peptide vector formula SEQ ID No. 1.

Figure 10 presents the micrograph (1 - fluorescent, 2 - inversion) tumor cell line a-431 after 18 hours incubation with 5'-FITC-labeled phosphothioate the oligonucleotide 2009F and with a mixture of his and a new peptide vector formula SEQ ID No. 1 in a molar ratio of 1:10.

Figure 11 presents a fluorescent micrograph of tumor cells a-431 on the fifth day of incubation with the plasmid pEGFP-N1 and with a mixture of her and a new peptide vector formula SEQ ID No. 1 in a molar ratio of 1:25.

On Fig shows the effect of mixtures of a new peptide vector formula SEQ ID No. 1 with oligonucleotides AS-TMO-PO and AS-TMO-PS on the cell survival of breast carcinoma human line MCF-7 (molar ratio of protein-oligonucleotide 5:1).

In Mgr. 1. lists the claimed oligodeoxyribonucleotide and amino acid sequences.

In Table. 1 provides a list of the synthesized oligonucleotides.

In Table. 2 shows the effect of the vector PGE-k on delivery fluorescein-labeled antisense-teoalivanoglou in tumor cells.

In Table. 3. shows the impact of vector PGE-k for the delivery of reporter plasmids in various tumor cells.

In Table. 4. shows the change of the cytotoxic activity of antisense AS-TMO and its thio-analogue in relation to the culture of tumor cells under the action of lipofectin and vector PGE-k.

Below are examples what s the embodiment of the invention.

Example 1 describes the chemical synthesis of primers and antisense-oligonucleotides, including modified and method enzymatic 5'-phosphorylation of DNA fragments.

Examples 2-5 describe the cloning of the gene of thioredoxin and obtaining the plasmid pBluescript II/Thio containing this gene. The source of chromosomal DNA served as the Escherichia coli strain TG1.

Cloning was performed using a PCR method based on the known nucleotide sequence. For amplification of the gene used a pair of primers Thio5 and hi3 (note: we used synthetic oligodeoxyribonucleotide, hereinafter referred to as "oligonucleotides"; see Tab. 1)flanking the coding part of the gene of thioredoxin with 5'- and 3 ' -ends, respectively. The nucleotide sequence of the primers included restriction sites required for subsequent cloning in the expression vector. Thio5 contained a Ndel restriction site, and hio3 website Nael.

The DNA fragments obtained by PCR were fractionally agarose gel, isolated from the agarose was fosforilirovanii using polynucleotide-kinase phage T4, was subcloned into the composition of the vector pBluescript II SK (-) and received the plasmid pBluescript II/Thio.

In this and other examples were isolated from clones plasmids were sequentiality within the insert method Singer.

Example 6 describes, according to Figure 3, the receiving PLA the foreign ministries pGEMEX-1/hEGF, containing the gene for epidermal growth factor by sublimemovies this gene in commercial plasmid pGEMEX-1, the restriction sites EcoRI and BamHI.

Example 7 describes, according to Figure 3, the construction of the plasmid pGEMEX-1 /Thio containing gene thioredoxin, perchlorovinyl gene thioredoxin from the plasmid pBluescript II/Thio in plasmid pGEMEX-1 restriction sites Ndel and BamHI.

Example 8 describes, according to Figure 3, obtaining and cloning plasmid pGEMEX-1/Thio-hEGF containing gene fused protein of the formula SEQ ID No. 4. The introduction of the linker was necessary for directional hydrolysis enterokinase fused protein of the formula SEQ ID No. 4 site (Asp)4-Lys-Lys.

Example 9 describes the introduction of point mutations, Glu30His and Gln62His, gene thioredoxin.

It is known that substitution of two residues in thioredoxine E. coli (Giu30→and His Gln62→His) allows you to select it and its derivatives metallogenetic affinity chromatography by binding histidine residues with immobilized ions Ni2+or Cu2+. Introduction each of the mutations consisted of three PCR according to the General scheme (6). The resulting plasmid pHis-EGF containing specified gene fused protein.

Example 10 describes the introduction of the plasmid pHis-EGF fragment encoding the binding site of the genetic material of the formula SEQ ID No. 2 according to Figure 4, 5. The fragment was introduced using two PCR involving oligonucleic the species WITH the LINKER and N-EGF. The resulting recombinant plasmid pGEK.

Examples 11 and 12 describe the acquisition and cultivation of Escherichia coli In-8389 PMBC and the allocation of fused protein of the formula SEQ ID No. 4 using a metal-chelating and ion exchange chromatography. Fractions were analyzed by gel-electrophoresis.

Example 13 describes the isolation and purification of peptide vector formula SEQ ID No. 1. Protein formula SEQ ID No. 4 was subjected to cleavage by the catalytic subunit of enterokinase site (Asp)4-Lys-Lys. The resulting peptide vector PGE-k formula SEQ ID No. 1 was purified by ion exchange chromatography. The product is characterized by UV and mass spectra (Figure 9), electrophoresis in SDS page and HPLC (Fig.7, 8). Amino acid analysis confirmed the sequence of the ten N-terminal amino acids (NH2-Lys-Lys-Lys-Lys-Arg-Lys-Val-Glu-Asp-Pro-).

In Examples 14-16 describes experiments to determine effect of peptide vector PGE-k for delivery in the tumor cell culture plasmid DNA (Example 15) and oligonucleotides-antisense (Examples 14 and 16).

In our experiments we used cell culture, characterized by different number of surface EGF receptors: HeLa (cell carcinoma of the cervix person), MCF-7 (cell adenocarcinoma of the breast man), A431 (epidermoid carcinoma cells of the vulva person), KB (human cells carcinoma of the oral Palast is), C (cells myeloid leukemia person).

As negative control we used cells C, the surface of which almost does not bear EGF-receptors, like the surface of somatic cells in normal. As a positive control was considered the delivery of the same genetic constructs into cells by lipofectin.

The versatility of the peptide vector formula SEQ ID No. 1 with respect to the structure of the delivered DNA molecules was confirmed in experiments with different oligonucleotides, including modified, and with plasmid DNA.

Examples 14 and 16 describe experiments on effective delivery to target cells oligomers F2009 (antisense to gene Vs inhibitor of apoptosis), AS-TMO-RO (antisense to the RNA component of telomerase) and his phosphorothioate analogue AS-TMO-PS containing links instead O-P(O)-O bonds O-P(S)-O-.

Similar data were also obtained for oligonucleotides another structure, such as antisense to genes With the ICC, mdr1 and other

In Example 14 shows experimental data for determination of the effect of peptide vector formula SEQ ID No. 1 on the efficiency of delivery into tumor cells A431 and C phosphorothioate antisense-oligonucleotide 2009F carrying a 5'-fluorescein label (FITC) (see Figure 10 and Table. 2). Properties phosphorothioate oligonucleotides, in particular high intracellular stability, allows the t to reliably correlate the recorded fluorescence from intracellular location exactly oligomer, and not the products of its hydrolysis. From the data Table. 2 it follows that the use of peptide vector PGE-k led to a drastic, more than 5 times, increasing the efficiency of delivery 2009F in A431 cells, enriched EGF-receptors. At the same time, this peptide vector is not only not helped, and even prevented the ingress 2009F wrong receptordependent cells C, protecting them from the action 2009F, which confirms the selectivity of PGE-k.

Example 15 describes the experiment for delivery to cells HeLa and A431 plasmid pEGFP-N1(Clontech, USA)containing nuclear promoter gene green fluorescing protein (see 11, PL. 3). Gene expression in the composition of this design reliably confirms the penetration of plasmids in the cell nucleus.

Shipping preparation of plasmid DNA pEGFP-N1 in cell cultures HeLa, A431 and C lipofectin in all cases led to the transformation of more than 90% of the treated cells, which is the number of cells expressed reporter protein. Incubation of the cells of these cultures with a free plasmid did not lead to the formation of transformants. Cultivation of cell cultures under the same conditions, but with the addition of mixtures of plasmids pEGFP-N1 with a peptide vector formula SEQ ID No. 1, resulted in fluorescence of only those cells that bore surface EGF receptors (HeLa and A431). The Data Table. 3 shows that the number of transformants for iSilo from nature to culture cells and the molar ratio of the components of the mixture and was maximum for enriched EGF-receptor cell culture A431 and zero for receptortargeted C.

Overall, the results reliably indicate selective delivery of plasmid DNA into the nuclei of cells, outer bearing receptors for epidermal growth factor.

Example 16 describes the determination of the effect of peptide vector formula SEQ ID No. 1 on cytotoxic activity of oligonucleotides AS-TMO-PO and AS-TMO-PS in relation to culture tumor cell line MCF-7. In the limits of concentrations (up to 1000 nm) oligonucleotides showed no cytotoxic activity. The fundamental difference in the effect on cell survival was observed upon delivery of oligomers into cells by lipofectin. Phosphorothioate antisense AS-TMO-PS had a high toxicity (IC50=109 nm), and fosfodiesterzy AS-TMO-PO was non-toxic.

Incubation of cells with mixtures of these oligomers with protein PGE-k in a molar ratio of oligonucleotide - PGE-k 1:5 resulted in the same values IC50equal for both antisense 470 nm (see Fig and Table. 4).

These data illustrate the ability of the new peptide vector is not only to deliver oligonucleotides into target cells, but also to protect them from intracellular degradation. The peptide vector formula SEQ ID No. 1 allows with the same efficiency to use and phosphorothioate oligonucleotides-antisense, and their natural counterparts.

From the data of Examples 14-16 follows that the peptide vector PGE-k ledge is t activity known transfairusa means, lipofectin, about 4 times. However lipofectin acts selectivity, regardless of the type of cells, and is able by itself to be non-selective cytotoxic effect, breaking the barrier properties of the outer cell membrane. Therefore, a new peptide vector formula SEQ ID No. 1 has a distinct advantage over lipofection due to the specificity of their action. In addition, the use of a new peptide vector formula SEQ ID No. 1 for the first time allows the use in the practice of gene therapy phosphodieterase antisense-oligonucleotides instead of toxic and much more expensive thio-analogues.

Example 1. Synthesis and phosphorylation of primers.

Oligodeoxyribonucleotide, including primers (see Table. 1), were synthesized by solid-phase method was used on an automatic DNA synthesizer AFM 2U (Biosset", Russia) using commercial was used for protected derivatives of nucleosides and fluorescein (FITC), nucleoside polymers and other reagents (Glen Research, USA). In the synthesis phosphorothioates of the oligonucleotide, AS-TMO-PS, instead of the standard oxidant containing iodine and water, used a 0.05 M solution of 3H-1,2-benzodithiol-3-one-1,1-dioxide (Glen Research, USA) in acetonitrile. The release and breakdown of communication synthesized oligomer with a carrier carried by ammonolysis (28% ammonia, 5 hours,50° C). 5'-Dimethoxytrityl-derivatives of all oligonucleotides were purified ion-steam reversed-phase HPLC on a column of diasorb ST, 4×250 mm (Alsike, Russia) in a linear gradient of MeCN (from 12.5% to 45%, 30 min) in 0.1 m aqueous NEt3-AcOH at 50°, released 80% water Asón and allocated in the form of lithium salts. The synthesized oligonucleotides were characterized by UV-spectrophotometry, mass spectroscopy, laser desorption, were analyzed by HPLC and electrophoresis in SDS page.

5'-Phosphorylation of oligonucleotides was performed using phage polynucleotide kinase T4 in standard conditions. A 10 µl reaction mixture contained 20-40 pmoles of the oligonucleotide, 1 μl of 10×PNK buffer ("NEB, USA): 500 mm Tris-HCI, 100 mm gl2, 50 mm dithiothreitol, 1 mm spermidine, 1 mm EDTA, 2 μl of 5 mm gatr and 10 units of polynucleotide kinase. The reaction mixture was stirred for 1 h at 37°With, then iactiveaware the enzyme for 30 min at 70°C.

Example 2. Isolation of plasmid DNA from cells of strains of E. Li.

Isolation of plasmid DNA from all strains of E. Li was performed according to the modified method Birinboim & Doly. Cells from 15 ml of overnight culture was besieged by centrifugation and the precipitate resuspendable in 1 ml buffer (25 mm Tris-HCI, pH 8.0, glucose 50 mm, EDTA 10 mm, lysozyme up to 4 mg/ml). Cell suspension was incubated for 30 min at room temperature was added 2 ml of 0.2 M NaOH, with the holding of 1% SDS. The mixture was stirred in an ice bath for 5 minutes Then at 0°C was added 1.5 ml of 3 M COAs, pH of 4.8, kept for 30 min, the precipitate was separated by centrifugation (30 min, 12000 g). To the supernatant was added 1/3 volume of 40% PEG 6000, kept at 4°30 minutes the Mixture was centrifuged (10 min, 12000 g), the precipitate was dissolved in 2 ml of buffer solution (20 mm Tris-HCl, 1 mm EDTA, pH 8.0), was added 4 ml of a saturated solution of NH4OAc, kept for 15 min at 4°C. the Precipitate ottagonale (15 min, 12000 g), the supernatant was added to 4 ml of isopropanol, was kept for 15 min at 4°and repeating the centrifugation. The precipitate was washed with 70% ethanol and dried in vacuum.

Example 3. The selection of chromosomal DNA from cells of strains of E. Li.

1.5 ml of overnight culture of cells of Escherichia coli TG1 was centrifuged (12000 g, 3 min). Cells resuspendable in 600 μl of buffer (20 mm Tris-HCl, pH 8.0, 1 mm EDTA, 0.5% BPS, 100 µg/ml proteinase K), kept for 1 hour at 37°C. To the suspension dabwali 100 ál of 5 M NaCl were mixed and then added to 80 μl of 0.7 M NaCl containing 10% cetyltrimethylammonium bromide. The suspension was stirred and kept for 1 hour at 65°C. were extracted Sequentially with equal volumes of chloroform and a mixture of phenol/chloroform, equilibrated in 0.2 M Tris. The aqueous phase was mixed with 0.6 volume of iPrOH. DNA was besieged by centrifugation (10, 12000g), washed with 70% tO and dried in a desiccator.

Example 4. Conditions Prov is Denia polymerase chain reactions (PCR).

4.1. Amplification of the gene encoding thioredoxin.

The reaction mixture contained 10 ng of chromosomal DNA of E. coli strain TG1 (see Example 3), 0.2 mm of each dNTP, 1 μm each of primers, Thio5 and Thio3 and 1 unit of activity is thermostable Vent polymerase in 50 μl of buffer (20 mm Tris-HCl, pH 8.8, 2 mm MgS04, 10 mm KCl, 10 mm (NH4)2SO4, 0.1% Triton X-100). On top of the reaction mixture was layered 25 ál of mineral oil (USB, USA). The cycle of amplification consisted of denaturation of DNA (96°C, 1 min), annealing (60°C, 1 min) and elongation (74°sec, 30 sec). Just carried out 35 cycles of reaction at the amplifier firm "Techne" (Germany). The PCR products were separated in electrophoretic 1.7% agarose when the strength of the electric field of 12 V/cm and was isolated fragment length 333 base pairs.

4.2. The remaining PCR.

The reaction mixture contained 100 ng of plasmid DNA, 0.2 mm of each dNTP, 1 μm of each primer and 1 unit of activity is thermostable Vent polymerase in 50 μl of buffer (20 mm Tris-HCl, pH 8.8, 2 mm MgSO4, 10 mm KCl, 10 mm (NH4)2SO4, 0.1% Triton X-100).

Example 5. Cloning of the gene of thioredoxin and obtaining the plasmid pBluescript ll/Thio.

Plasmid pBluescript II SK-("Stratogene, USA), hydrolyzed in the endonuclease Smal. The hydrolysate was treated with an equal volume of phenol/chloroform (1:1), the aqueous phase was added 1/10 volume of 3 M solution of AcONa, pH 6.0, and 3 volumes of ethanol, remove ivali 30 min at 4° C, centrifuged at 12000 g for 15 minutes the Precipitate was washed with 70% ethanol, dried, dissolved in 40 μl of 10 mm Tris-HCI, pH 8.0. To the solution was added 5 μl of 10x CIAP buffer (0.5 M Tris-HCI, 10 mm MgCl2, 1 mm ZnCl2, 10 mm spermidine, pH 9.3), 5 ál phosphatase (0.1 unit/ál) and incubated at 37°C for 30 minutes To the reaction mixture was added 300 μl of stop buffer (10 mm Tris-HCI, pH 7.5, 1 mm EDTA, 200 mm NaCl, 0.5% LTOs), then was treated with a solution of, besieged and dried precipitate, as described above for hydrolysate in this Example. 50 ng of the obtained product was mixed with 5 ng of PCR product length 333 base pairs, obtained in Example 4.1, and 5 units of T4 DNA ligase in 10 μl of 1x buffer (40 mm Tris-HCI, 10 mm MgCl2, 10 mm dithiothreitol, 0.5 mm ATP, pH 7.8). After incubation ligase mixture (16°during the night) it was pretransformation cells of the strain E. Li XL-1 Blue (Stratogene, USA) at a rate of 10 ng of plasmid DNA on a 1.5×107cells (100 μl) and were sown on Petri dishes with apparitional medium containing 100 μg/ml ampicillin, and incubated overnight at 37°C. has Inoculable single colonies in 3 ml of medium YT (8 g/l of tryptone, 5 g/l yeast extract, 5 g/l NaCl)containing 100 μg/ml ampicillin, and incubated overnight at 37°and 260.min on a rocking chair "Certomat" N " ("Sugaip Melsungen, Germany). Isolated from transformed cells (as in Example 2) plasmid DNA sequenced in PR the Affairs of the insertion method Senger, using T7 and reverse primers. The constructed plasmid was named pBluescript ll/Thio.

Example 6. Subclavian hEGF gene in the vector pGEMEX-1.

Plasmid pGEMEX-1 sequentially hydrolyzed in restrictase EcoRI and Hl, processing hydrolyzed as in Example 5. The product was dephosphorylated and processed as in Example 5. 50 ng of the obtained product was mixed with 5 ng hEGF gene [7] and ligated into the conditions of Example 5. Ligase mixture was pretransformation cells of the strain E. Li XL-1 Blue in the conditions of Example 5. Growing cells, highlighting the resulting plasmid pGEMEX-1/hEGF and confirmation of its structure also were conducted by the method of Example 5.

Example 7. Obtaining the plasmid pGEMEX-1/Thio.

Plasmid pGEMEX-1 sequentially hydrolyzed in restrictase Aatll and BamHI, processing hydrolyzed as in Example 5 and allocating fragment Aatll/ BamHI (pGEMEX-1).

Similarly, from the same plasmid sequential action of restricts NdeI and AatII has been received and the selection NdeI/AatII (pGEMEX-1).

From the plasmid pBluescript II/Thio (Example 5) by the action of restricts NdeI and BamHI was similarly obtained fragment NdeII/BamHI (pBluescript II/Thio).

Dephosphorylation of the obtained fragments and their joint ligation to form plasmid pGEMEX-1/Thio carried out as in Example 5.

Example 8. Obtaining the plasmid pGEMEX-1/Thio-hEGF

Plasmid pGEMEX-1/hEGF (Example 7) was digested with restrictase AatII and EcoRI, the plasmid pGEMEX-1/Thio - restrictase AatII and TurboNael. Fragments AatIIEcoRI (pGEMEX-1/hEGF) and AatII/TurboNael (pGEMEX-1/Thio) was combined with linker duplex of oligonucleotides SpE1 and S2, and ligated as in Example 5. In the conditions of Example 5, the reaction mixture was used to transform the E. coli strain XL1 Blue and allocated plasminogen from the transformants. The resulting plasmids were analyzed by hydrolysis of restrictase TurboNael and EcoRI, and then DNA of selected clones sequenced by the method of Sanger. The resulting vector was named pGEMEX-1/Thio-hEGF.

Example 9. Obtaining the plasmid pHis-hEGF.

9.1.

In the conditions of Example 4.2 (the annealing temperature of the primers 36° (C) spent 20 cycles of PCR on plasmid pGEMEX-1/Thio-hEGF (Example 8) with primers E30R and SP6. The PCR products by electrophoresis were separated as in Example 4.1, and highlighted fragment length 487 base pairs.

9.2.

PCR on plasmid pGEMEX-1/Thio-hEGF with primers E30L and T7 and separation of PCR products were performed in the conditions of Example 9.1. Allocated fragment length 178 base pairs.

PCR 9.3.

The reaction mixture contained 40 ng of PCR product 9.2 and 20 ng of PCR product 9.1. Annealing of primers was carried out at 28°C for 1 min Just spent 30 cycles of PCR. Other PCR conditions as in Example 9.1. Processing of the reaction mixture and manipulation of the PCR product were performed as in Example 5.

9.4. Introduction of mutations Glu30His and Gln62His in gene thioredoxin E. Li.

According to the scheme (6) the settlement of adavale spent 2 mutations. In the conditions of Example 9.1 PCR was performed on DNA from Example 9.3 with mutagenic primers Q62R and Q62L and flanking primers T7 and SP6. Product mutations, processed and separated as in Example 9.1, was subjected to mutation Glu30His with other mutagenic primers, E30L and E30R the PCR conditions and product selection mutation of Example 9.1. The product of the last PCR hydrolyzed in restrictase Ndel and Hindlll, provided the resulting DNA fragment length 557 base pairs and cloned it into the vector pGEMEX-1, as described in Example 5. The obtained plasmid was named pHis-hEGF.

Example 10. The preparation of recombinant plasmids pGEK.

10.1.

Spent 24 cycle PCR with a mixture of plasmid pHis-hEGF (Example 9.4), primers T7 and phosphorylated C-LINKER'a in the conditions of Example 4.2. Temperature range: DNA denaturation 1 min at 96°s, primer annealing -1 min at 49°S, DNA synthesis -1 min at 74°C.

10.2.

Under the same conditions was carried out PCR with a mixture of plasmid pHis-hEGF, primers SP6 and phosphorylated N-EGF.

10.3.

The PCR products 10.1 and 10.2 length 460 and 238 were isolated by electrophoresis as in Example 4.1, and hydrolyzed respectively endonucleases l and Hindlll. The products of hydrolysis length 278 and 210 BP, respectively, were again isolated by electrophoresis. Plasmid pHis-hEGF sequentially hydrolyzed by endonucleases CpoI and HindIII and was allocated CpoI/HindIII (pHis-hEGF), as in Example 5. CpoI/HindIII (pHis-hEGF) was dephosphorylated in the conditions is x Example 5. Dephosphorylating CpoI/HindIII (pHis-hEGF) was mixed with gidrolizovannykh PCR products 10.1 and 10.2, ligated, provided the product of ligation, cloned it into E. Li XL-1 Blue, transformants were grown and isolated them from the plasmid DNA, as in Example 5. The selected clones were sequentiality within the insert method Singer. The obtained expression design is called “recombinant plasmids pGEK”.

Example 11. Transformation of Escherichia coli strain BL21 (DE3)pLysS and growing a new strain of Escherichia Li-8389 PMBC.

Cells of the strain E. Li BL21(DE3)pLysS (firm Novagen, Inc.", Cat#69388-3, Madison, new Jersey, 53711, USA) was transformed with plasmid pGEK 10 ng pGEK 1 - 5×107cells according to the method of Example 5 to obtain the target of a new strain of Escherichia coli BL2l(DE3)/pLysS/pGEK (no In-8389 PMBC). Then the culture were sown on Petri dishes with apparitional medium containing 100 μg/ml ampicillin and 34 μg/ml chloramphenicol and incubated overnight at 37°C. Individual colonies (about 100 pieces) was collected with a glass rod and suspended in 100 ml of medium TV (12 g/l of tryptone, 24 g/l yeast extract, 0.04% of glycerol, 1/10 volume of phosphate buffer (0.17 M KN2RHO4, 0,72 M2NRA4)). The culture was grown in the presence of 100 μg/ml ampicillin and 34 mg/ml chloramphenicol at 30°and 260.minutes on a rocking chair "Certomat" N " ("Sugaip Melsungen, Germany) to doctrine.culture optical density OD 550=2.0 PU Further added isopropyl-β-D-thiogalactoside to final concentration of 0.05 mm and continued incubation at 13°and 260.min 24 hours.

The new strain contains 300-400 copies of the recombinant plasmid pGEK, this number is maintained stable for at least 8 generations.

The strain E. Li BL2l(DE3)/pLysS/pGEK synthesizes protein TrxA-EGF-NLS formula SEQ ID No. 4 in the amount of 300 mg per 1 l of culture liquid when its density, the corresponding 4×109cells/ml

Resistance: F-, ompT, hsdSB(rB-, mB-), dcm, gal, λ (DE3), plysED, CmRAmpR. Concentration of ampicillin to 100 μg/ml, chloramphenicol 25 mg/ml

The strain is not animal - and plant-pathogenic.

Example 12. The allocation of the fused protein TrxA-EGF-NLS formula SEQ ID No. 4.

The resulting cell culture of Escherichia coli B-8389 PMBC were centrifuged (2500 g, 1 hour). Cells resuspendable in 50 ml buffer: 100 mm Tris-HCl+phenylmethylsulfonyl to 0.1 mm, pH 8.0 and treated with ultrasound on the cage of UZDN-2T (7-10 times for 30 s at t° no more than 10°). Added an equal volume of 0.3 M NaCl and mixed, centrifuged at 9000 g 1 h the Supernatant was applied to a column (25×100 mm, Chelatlng-Sepharose (Ni2+) (Pharmacia, Sweden)). The column was washed with buffer: 50 mm Tris-HCl, pH 8.0, 0.15 M NaCl, then buffer: 50 mm Tris-HCl, pH 8.0,1 M NaCl, and again the previous buffer, each time achieving zero absorption of the eluate atλ =280 nm. The obtained target product - protein formula SEQ ID No. 4 was washed with buffer: 50 mm Tris-HCI, pH 8.0, 0.25 M NaCI, 0.1 M imidazole. The eluate were dialyzed (4°C, membrane Spectra/Por 10000): twice against 50 mm Tris-HCl, pH 8.0, 8-12 h, 1 time against buffer: 50 mm Tris-HCl, 1 mm CuSO4, pH 8.0, 24-36 h and twice against 20 mm Tris-HCl, pH 7.6, 8-12 hours Dialysate was applied on the column MonoQ HR10/10 (Pharmacia, Sweden), equilibrated last buffer. Protein formula SEQ ID No. 4 was washed with a linear NaCI gradient (0.1 M-0.5 M) in the same buffer. Fractions were analyzed by gel-electrophoresis and combined those which contained the greatest number of target fused protein (molecular weight 20 kDa).

Example 13. Isolation and purification of peptide vector PGE-k formula SEQ ID No. 1.

To the resulting drug fused protein of the formula SEQ ID No. 4, desalted using a device Ultrafree-15 (Biomax-5K) (Millipore), was added 1/10 volume enterokinase buffer: 0.5 M Tris-HCI, 0.01 M CaCl2,1% tween-20, pH 8.0, and enterokinase EKmax ("Invitrogen, USA) at a rate of 1 unit of the enzyme on 3 mg of the hybrid protein, incubated for 20 hours (37°). The products of hydrolysis were fractionally on column MonoQ HR10/10 and analyzed (as described in Example 10). The yield of pure peptide vector PGE-k formula SEQ ID No. 1 was 1.8 to 2.2 mg m/e [MV-N] 7620,8 (Fig. 9).

Example 14. Determination of the influence of the peptide vector PGE-k for delivery in the tumor cell culture 5'-fluorescein sword is spent thio-oligonucleotide 2009F.

Tumor cells HeLa, MCF-7, A431 and KB were cultured in plastic culture flasks (Costar, UK) in DMEM (Gibco, USA)containing 10% fetal bovine serum (Gibco) and 50 μg/ml gentamicin (Sigma, USA) at 37°C in humidified atmosphere containing 5% CO2. Cells of K 562 line cells were cultured in the same conditions, but using medium RPMI 1640 (Gibco, USA). Cell cultures subcultured 2 times a week and were sown in 12-well plates at top of glass or directly in the wells the day before the experiment.

Transfection of cells A431 and C implemented solutions thio-5'-FI-oligonucleotide 2009 F in the presence of various PGE-k. To prepare transfairusa mixtures in the ratios shown in the Table. 2, used a solution of PGE-k (40 mm, 50 mm Tris-HCl, M NaCl, pH 8) and 50 mm solution 2009 F in water. In all experiments, the concentration of the oligonucleotide when the incubation was 200 nm. After 18 hours the culture medium was removed, the glass cells were twice washed in phosphate-saline buffer (PBS), the cells were fixed in 4% paraformaldehyde in PBS, was concluded in the moviola and explored the fluorescence using a fluorescent microscope. For flow cytofluorimetry (cytometer EPICS, Coulter, Germany) cells after incubation was removed from the plastic with a solution of 0.05% trypsin in solution of Versene (Sigma, the SHA), were washed in PBS and fixed with 2% paraformaldehyde. For fluorescence excitation used argon laser (Coherent, USA) with a wavelength of 488 nm. For micrographs of cells here and then used an inverted Nikon microscope (Japan) and fluorescent microscope Opton (Germany) (Figure 10). The results of the experiments are given in Table. 2. They show that the addition of peptide vector PGE-k for fluorescein-labeled thio-antisense several times increases the intensity of fluorescence of receptor-enriched cells and, therefore, increases the amount delivered into cells thio-antisense. In the receptor-deficient cells C, on the contrary, adding PGE-k the intensity of the fluorescence decreases.

Example 15. Determination of the influence of the peptide vector PGE-k for delivery in the tumor cell culture plasmid DNA.

Transfection of cell cultures HeLa, AI C, prepared as described in Example 14 were carried out with solutions of the preparation of plasmid pEGFP-N1 (Clontech) in water in the presence of different amounts of PGE-k (PL. 3). Before transfection the cells were washed with DMEM containing no serum, was added 2 ml of fresh DMEM, and incubated for 2 hours. 15 min prior to transfection the medium was changed for fresh and added chloroquin (Sigma) at a concentration of 25 ám.

To prepare transfection mixtures with a ratio of components shown in Table. 3, and the used solutions plasmid pEGFP-N1 (78 nm, ~ 220 µg/ml) in water and a solution of the peptide vector PGE-k (40 mm, 50 mm Tris-HCl 0.17M NaCl, pH8). The mixture did not lose transfairusa properties, at least during the week. The solutions were added to the cells at a rate of 1 µg plasmid/ml of culture for 24 hours, after which the medium was changed to a standard DMEM and incubated for another 24-96 hours. Then explored the fluorescence of transfected cells, as in Example 14. Transfection of HeLa cells, A431 and C the plasmid using lipofectin (InvitroGen, USA) was performed according to the manufacturer's Protocol. Experimental data are given in Table. 3, show that the free plasmid pEGFP-N1 not transferium tumor cells. In the presence of peptide vector formula SEQ ID No. 1 is the transfection of only the receptor-enriched cells HeLa and A431.

Example 16. Determination of the influence of the peptide vector PGE-k on cytotoxic activity of oligonucleotides AS-TMO-PO and AS-TMO-PS against tumor cells.

Cell adenocarcinoma human breast line MCF-7, prepared as described in Example 14, were treated with aqueous solutions: oligonucleotide AS-TMO-PO, the oligonucleotide AS-TMO-PS (thio-analogue AS-TMO-PO) or mixtures of these oligonucleotides with a new peptide vector PGE-k in molar ratios of 1:5 in the concentration range 1×10-9-1×10-6M in the oligonucleotide. Cells were incubated for 120 hours under the conditions of Approx the RA 14. Their survival was determined using the MTT-test and was evaluated in percentage from the corresponding idle control. Transfection with oligonucleotides using lipofectin (InvitroGen, USA) was performed according to the manufacturer's Protocol. Metric values cytotoxic activity IC50for these oligonucleotides and their mixtures with a peptide vector PGE-k against tumor cells MCF-7 are given in Table. 4. The results show that AS-TMO-PO does not show such activity either in free form or in the presence of lipofectin. In the presence of peptide vector formula SEQ ID No. 1 both antisense show approximately the same cytotoxic activity.

Literature

1. Cristano R.J., Roth J.A. EGF-targeted nucleic acid delivery// Pat. U.S. No. WO 96/30536 issued 03.10.1996.

2. Fominaya J., C. Uherek, Wels W. A chimeric fusion protein containing transforming growth factor-alpha mediates gene transfer via binding to the EGF receptor// Gene Ther. 1998. V.5. No. 4. R-30.

3. Collas, P., Alestrom P. Nuclear localization signals: a driving force for nuclear transport of plasmid DNA in zebrafish// Biochem. Cell. Biol. 1997. V.75. P.633-640.

4. Siebenkotten G., Christine R. Cellular transport system for the transfer of a nucleic acid through the nuclear envelope and methods thereof// Pat. U.S. No. WO 00/40742. Issued 18.02.2003.

5. Morris M.C., Vidal P., Chaloin L, Heitz f, Divita G. A new peptide vector for efficient delivery of oligonucleotides into mammalian cells// Nucleic Acids Res. 1997. V.25. No. 14. R-2736.

6. Lu Zh., DiBlasio-Smith, A., Grant, K.L., Warne N.W., E.R. LaVallie, Collins-Racie LA, M.T. Follettie, M.J. Williamson, J.M. McCoy Histidine Patch Thioredoxins. Mutant forms of thioredoxin with metal chelating affinity that provide for convenien purifications of thioredoxin fusion proteins//J. Biol. Chem. 1996. V.271. No. 9. P.5059-5065.

7. The Eldar M.A., Cagents S.M., Pozmogova G., Lutsenko S., Severin, Y.S., Kirpichnikov M.P., Scriabin KG Strain of yeast S. cerevisiae BKM CR-349D - producer of epidermal growth factor (human).// Patent of the Russian Federation 1999. No. 21505001 issued 10.06.2000.

Appendix 1. List oligodeoxyribonucleotide and amino acid sequences.

SEQ ID No. 1 is the amino acid sequence of the inventive peptide vector PGE-k:

NH2-Lys-Lys-Lys-Lys-Arg-Lys-Val-Glu-Asp-Pro-Tyr-Asn-Ser-Asp-Ser-Glu-Cys-Pro-Leu-Ser-His-Asp-Gly-Tyr-Cys-Leu-His-Asp-Gly-Val-Cys-Met-Tyr-lle-Glu-Ala-Leu-Asp-Lys-Tyr-Ala-Cys-Asn-Cys-Val-Val-Gly-Tyr-lle-Gly-Glu-Arg-Cys-Gln-Tyr-Arg-Asp-Leu-Lys-Trp-Trp-Glu-Leu-Arg-COOH

SEQ ID No. 2 is the amino acid sequence of residue peptide of human epidermal growth factor:

-Asn-Ser-Asp-Ser-Glu-Cys-Pro-Leu-Ser-His-Asp-Gly-Tyr-Cys-Leu-His-Asp-Gly-Val-Cys-Met-Tyr-lle-Glu-Ala-Leu-Asp-Lys-Tyr-Ala-Cys-Asn-Cys-Val-Val-Gly-Tyr-lle-Gly-Glu-Arg-Cys-Gln-Tyr-Arg-Asp-Leu-Lys-Trp-Trp-Glu-Leu-Arg-COOH

SEQ ID No. 3 is the amino acid sequence of the binding site with the transported exogenous genetic material:

NH2-Lys-Lys-Lys-Lys-Arg-Lys-Val-Glu-Asp-Pro-Tyr-

SEQ ID No. 4 is the amino acid sequence of the fused protein:

NH2-X-Y-Lys-Lys-Lys-Lys-Arg-Lys-Val-Glu-Asp-Pro-Tyr-Asn-Ser-Asp-Ser-Glu-Cys-Pro-Leu-Ser-His-Asp-Gly-Tyr-Cys-Leu-His-Asp-Gly-Val-Cys-Met-Tyr-lle-Glu-Ala-Leu-Asp-Lys-Tyr-Ala-Cys-Asn-Cys-Val-Val-Gly-Tyr-lle-Gly-Glu-Arg-Cys-Gln-Tyr-Arg-Asp-Leu-Lys-Trp-Trp-Glu-Leu-Arg-COOH, where "X" is the residue of thioredoxin with mutations Glu30His, Gln62His Y - linker -(Gly-Ser)2-Gly-(Asp)4-Lys-

SEQ ID No. 5 is the nucleotide is the first sequence, encoding a protein of the formula SEQ ID No. 4:

5'-ATGAGCGATAAAATTATTCACCTGACTGACGACAGTTTTGACACGGATGTACTCAAAGCGGACGGGGCGATCCTCGTCGATTTCTGGGCACACTGGTGCGGTCCGTGCAAAATGATCGCCCCGATTCTGGATGAAATCGCTGACGAATATCAGGGCAAACTGACCGTTGCAAAACTGAACATCGATCATAACCCTGGCACTGCGCCGAAATATGGCATCCGTGGTATCCCGACTCTGCTGCTGTTCAAAAACGGTGAAGTGGCGGCAACCAAAGTGGGTGCACTGTCTAAAGGTCAGTTGAAAGAGTTCCTCGACGCTAACCTGGCCGGCTCTGGTTCTGGTGATGACGATGACAAGAAAAAAAAGAAACGTAAAGTTGAGGATCCGTACAATTCTGACTCTGAATGCCCATTGTCTCACGACGGTTACTGCTTGCACGACGGTGTTTGCATGTACATCGAAGCTCTGGACAAATACGCTTGCAACTGCGTTGTTGGTTACATCGGTGAACGTTGCCAATACCGAGATCTGAAATGGTGGGAACTGCGTTGA-3'

99,8
Table 1
List of used oligodeoxyribonucleotides.
The name of the oligonucleotideThe nucleotide sequence
C-linker5’-CTCAACTTTACGTTTCTTTTTTTTCTTGTCATCGTCATCACC-3'
E30L5'-CACCAGTGTGCCCAGAAATCGAC-3'
E30R5'-GGGCACACTGGTGCGGTCCGTG-3'
N-EGF5'-GATCCGTACAATTCTGACTCTGAATGC-3'
Q62L5’-CAGGGTTATGATCGATGTTCAG-3'
Q62R5'-CGATCATAACCCTGGCACTG-3'
SP65’-TATTTAGGTGACACTATAG-3'
SpE15'-GGCTCTGGTTCTGGTGATGACGATGACAAG-3'
SpE25’-AATTCTTGTCATCGTCATCACCAGAACCAGAGCC-3'
T75’-TAATACGACTCACTATAGGG-3'
Thio35’-GCCGGCCAGGTTAGCGTCGAGG-3'
Thio55'-CATATGAGCGATAAAATTATTCACC-3'
AS-TMO-PO5'-TTAGGGTTAGGGTTAGGGTTAGGG-3'
AS-TMO-PSThio-5'-TTAGGGTTAGGGTTAGGGTTAGGG-3'
2009FThio-5'-Fitc-AATCCTCCCCCAGTTCACCC-3'
Table 2
The impact of vector PGE-k formula SEQ ID No. 1 for delivery thio-5'-fluorescein-labeled antisense-oligonucleotide 2009F in cell lines A431 and C.
Cell lineAddedRatioThe intensity of fluorescence, $average% of cellsRelation to the intensity of fluorescence. 2009F
A4310 3,830,6 
 2009F 17,2to 97.1 
 PGEk:2009F3:147,13,2
 PGEk:2009F5:164,499,94,5
 PGEk:2009F10:173,61005,2
C0 5,070,25 
 2009F 54,496,8 
 PGEk:2009F10:147,995,70,87

Table 3
The impact of vector PGE-k formula SEQ ID No. 1 on the delivery of reporter plasmid pEGFP-N1 in tumor cells HeLa.
AddedRatio% fluorescent cells
 mol/molCell culture
  HeLaA431C
PEGFP-N1 lipofectin 85-908-95 85-90
PEGFP-N1 000
PEGFP-N1:PGE-k1:1000
PEGFP-N1:PGE-k1:820-3025-350
PEGFP-N1:PGE-k1:1620-3040-450
PEGFP-N1:PGE-k1:2540-4650-560
PEGFP-N1:PGE-k1:3220-3040-450
PEGFP-N1:PGE-k1:64 - 5000000
Table 4
Determination of cytotoxic activity of oligonucleotides AS-TMO-RO and AS-TMO-PS in relation to culture tumor cell line MCF-7.
AddedIC50AS-TMO-PO, nmIC50AS-TMO-PS, nm
0not found (>1000)not found (>1000)
Lipofectinnot found (>1000)109
PGE-k, in a molar ratio of oligonucleotide-protein 1:5~470~470

1. The peptide vector PGE-k, providing preferential transport of exogenous genetic material in a living cell, mammals and humans, outer bearing receptors for epidermal growth factor, and the subsequent flow of material in the core of the specified cells, with the amino acid sequence SEQ ID No. 1 consisting of the amino acid sequence of the human epidermal growth factor (SEQ ID No. 2), which is a binding site with external receptors called cells, and the modified sequence of the signal peptide of the T antigen of SV-40 (SEQ ID No. 3), which is responsible for binding of exogenous genetic material and overcoming them nuclear envelope the specified cell.

2. The nucleotide sequence encoding a protein, which consists of a mutant thioredoxin (Glu30His, Gln62His), the linker sequence(Gly-Ser)2-Gly-(Asp)4-Lys-specifically cleaved by enterokinase, and the peptide vector according to claim 1, and characterized by amino acid sequence SEQ ID No. 4.

3. The nucleotide sequence according to claim 2, characterized in, what it represents SEQ ID No. 5.

4. Recombinant plasmid pGEK for the expression of fused protein comprising a peptide vector according to claim 1, characterized in that it has the size 3691 BP and consists of:

- NdeI/AatII fragment of plasmid pGEMEX-1 having a size 2347 BP and contains the site of initiation of replication Ori and the gene for resistance to ampicillin l;

- AatII/HindIII fragment of plasmid pGEMEX-1 having a size 755 BP and containing flOri,

- nucleotide sequence according to claim 3.

5. The strain of Escherichia coli In-8389 PMBC containing recombinant plasmid pGEK,producing fused protein comprising a peptide vector, which provides selective transport of exogenous genetic material into the cell of a mammal and human.

6. A method of obtaining a peptide vector, including:

- cultivation of transgenic strain according to claim 5 under conditions that ensure the expression of a peptide comprising the vector of the fused protein;

- selection and subsequent hydrolysis of the fused protein enterokinase or another protease that recognizes included in the linker sequence and specifically cleave the peptide bond following the specified linker, and

- selection of the target product.

7. The method of genetic modification of living mammalian cells and human outer bearing receptors for epidermal factor grew the and, providing the contacting these cells with exogenous genetic material in the presence of peptide vector comprising sequences that allow the selective transport of exogenous genetic material to the target cell through its cell membrane, and the derived sequences of the nuclear localization signal, characterized in that the use of the peptide vector according to claim 1.



 

Same patents:

The invention relates to genetic engineering, in particular the production of proinsulin Lyspro person, and can be used to create drugs of new generation for the treatment of insulin-dependent diabetes mellitus

The invention relates to medicine and biotechnology and concerns of soluble mutant CTLA4 molecules that bind to the antigen CD86 with higher avidity than wild type CTLA4

The invention relates to medicine and relates to peptides that can be used for cell adhesion and wound healing

The invention relates to biotechnology, in particular genetic engineering

The invention relates to biotechnology, in particular genetic engineering, and can be used to produce secreted modified colony-stimulating factor granulocyte person (hG-CSF)

The invention relates to the field of genetic engineering and biotechnology

FIELD: medicine, genetic engineering.

SUBSTANCE: invention relates to applying genetic engineering approaches for treatment of autoimmune diseases, in particular, for treatment of cerebrospinal sclerosis. This is achieved by incorporation of one or some recombinant genes encoding autoantigens that represent a target for autoimmune response. In particular, invention claims a method for designation of gene encoding encephalitogenous epitope of proteolipid protein and expression of gene product in vivo by using the recombinant retroviral vector. Expression and secretion of encephalitogenous epitope improves histopathological and clinical indices in experimental autoimmune encephalomyelitis in mice that is used as a model of cerebrospinal sclerosis. The advantage of invention involves the development of a method for recovery the tolerance in treatment of cerebrospinal sclerosis being without suppression of immune system.

EFFECT: improved and valuable method for treatment.

6 cl, 13 dwg, 3 ex

FIELD: biotechnology, genetic engineering, molecular biology.

SUBSTANCE: invention proposes recombinant DNA pcDNA-TCI that has molecular mass 4.3 x 103 kDa and size 6 657 nucleotide pairs. The proposed recombinant plasmid DNA provides expression of artificial gene TCI comprising cytotoxic T-cellular epitopes of HIV-1 in eucaryotic cells. Also, invention proposes recombinant attenuated strain of bacterium Salmonella enteritidis E-23 pcDNA-TCI. The proposed strain is obtained by genetic transformation of the strain Salmonella enteritidis E-23 with plasmid pcDNA-TCI. The strain provides delivery DNA-vaccine in eucaryotic cells as the recombinant plasmid DNA pcDNA-TCI. Proposed groups of inventions provide inducing the expressed specific humoral and cellular immune response to HIV-1 in body. Proposed group of inventions can be used in medicine and virology for construction of live DNA-vaccine against HIV-1.

EFFECT: valuable biological and medicinal properties of strain and vaccine.

2 cl, 3 dwg, 3 tbl, 5 ex

FIELD: genetic engineering, biotechnology, molecular biology, medical-biological and pharmaceutical industry.

SUBSTANCE: invention relates to isolating gene from cells of the strain P. altcromonas producing enzyme that cleaves polysaccharide comprising sulfated fucose and this gene encodes above indicated enzyme, Invention proved the presence of two opened reading frames (ORF-1 and ORF-2) and their nucleotide sequences are determined. Active recombinant forms of enzyme able to hydrolyze sulfated fucose-comprising polysaccharide are obtained by expression of these sequences in E. coli being this polysaccharide is not cleaved by fucoidanase produced by Flavobacterium sp. SA-0082 (FERM BP-5402). Applying the invention provides the possibility for preparing large amounts of qualitative raw for pharmaceutical preparations.

EFFECT: improved preparing method, valuable properties of polypeptide.

5 cl, 5 dwg, 2 tbl, 7 ex

Thrombopoietin // 2245365

FIELD: medicine, molecular biology, polypeptides.

SUBSTANCE: invention describes homogenous polypeptide ligand mpI representing polypeptide fragment of the formula: X-hTPO-Y wherein hTPO has amino acid sequence of human fragments TPO (hML); X means a amino-terminal amino-group or amino acid(s) residue(s); Y means carboxy-terminal carboxy-group or amino acid(s) residue(s), or chimeric polypeptide, or polypeptide fragment comprising N-terminal residues of amino acid sequence hML. Also, invention relates to nucleic acid encoding polypeptide and expressing vector comprising nucleic acid. Invention describes methods for preparing the polypeptide using cell-host transformed with vector, and antibodies raised against to polypeptide. Invention describes methods and agents using active agents of this invention. The polypeptide ligand mpI effects on replication, differentiation or maturation of blood cells being especially on megacaryocytes and progenitor megacaryocyte cells that allows using polypeptides for treatment of thrombocytopenia.

EFFECT: valuable medicinal properties of polypeptide.

21 cl, 92 dwg, 14 tbl, 24 ex

The invention relates to the field of biotechnology and medicine, in particular to genetic engineering and immunology

The invention relates to genetic engineering and can be used for therapeutic purposes, in particular in the treatment of neoplastic processes

The invention relates to the field of biotechnology and medicine, in particular to genetic engineering and immunology

FIELD: genetic engineering, molecular biology.

SUBSTANCE: invention proposes a method for detecting genes encoding membrane-bound transmembrane proteins. Method involves expression of the nucleic acid chimeric sequence in the cell-host consisting of DNA fragment encoding secreting protein that is able to bind antigen and DNA fragment to be tested; interaction of cells expressing the fused protein with antigen; selection of cells on surface of that indicated antigen is bound; isolation of recombinant vector containing in selected cells of DNA fragment to be tested and, if necessary, determination of its sequence. Also, invention proposes the developed vector constructions and comprising their sets designated for realization of the proposed method. Invention provides significant simplifying the screening process of libraries and cloning genes encoding transmembrane proteins. Invention can be used for detecting and preparing genes encoding any membrane-bound proteins used in different branches of science and practice.

EFFECT: improved isolating method, valuable biological properties of protein.

27 cl, 7 dwg, 1 tbl, 8 ex

Up!