Designation and applying genes encoding pathogenic epitopes for treatment of autoimmune disease

FIELD: medicine, genetic engineering.

SUBSTANCE: invention relates to applying genetic engineering approaches for treatment of autoimmune diseases, in particular, for treatment of cerebrospinal sclerosis. This is achieved by incorporation of one or some recombinant genes encoding autoantigens that represent a target for autoimmune response. In particular, invention claims a method for designation of gene encoding encephalitogenous epitope of proteolipid protein and expression of gene product in vivo by using the recombinant retroviral vector. Expression and secretion of encephalitogenous epitope improves histopathological and clinical indices in experimental autoimmune encephalomyelitis in mice that is used as a model of cerebrospinal sclerosis. The advantage of invention involves the development of a method for recovery the tolerance in treatment of cerebrospinal sclerosis being without suppression of immune system.

EFFECT: improved and valuable method for treatment.

6 cl, 13 dwg, 3 ex

 

The scope of the invention

The present invention relates to the field of immunotherapy, as well as to the preparation and use of genetically transformed cells, which are able to restore tolerance to self-antigen in patients suffering from autoimmune diseases. More specifically, the invention relates to the design and construction of the gene encoding encephalitogenic epitope proteolipid protein (PLP), to methods of expression of epitope PLP in vitro and in vivo, methods secretion of PLP epitope in vivo, as well as the method of transfer of the gene PLP host to suppress the progression of the immune response to its own antigens, formed from proteins of the myelin sheath.

The level of technology

The immune system can respond to antigen in two ways. A positive response leads to the differentiation of T - and b-cells, production of antibodies and the development of immunological memory. A negative response leads to the suppression or inactivation of specific cells and tolerance. Tolerance can be defined as the inability of the body to generate an immune response against a specific antigen. Normally, the body tolerant to its own antigens.

It is believed that autoimmune diseases are the result of uncontrolled immune response directed to its own antigens. For example, have the camping shows what in patients with multiple sclerosis this kind of response is directed towards white matter of the Central nervous system and, in particular, proteins of the white matter. In the end destroys the myelin sheath surrounding axons. This can lead to paralysis, sensory disturbances, and problems with vision. Multiple sclerosis is observed infiltration of marrow T-cells and macrophages. In patients with multiple sclerosis were selected self-reactive myelin-specific T cells, while in normal individuals detected T cells with the indicated specificity. J.M.LaSalle et al., J.Immunol. 147:774-780 (1991), J.M.LaSalle et al., J.Exp.Med. 176:177-186 (1992), J.Correale et al., Neurology. 45:1370-1378 (1995). Currently, among the proteins of myelin, which is the target of the immune response in multiple sclerosis, there are the basic myelin protein (MRI), proteolipid protein (PLP) and myelin-oligodendrocyte glycoprotein (MOG). Those individuals who have not developed an autoimmune response to native proteins, are considered to be “tolerant” to a self-antigen. Thus, evidence that multiple sclerosis is caused pathogenic T-cells, are indirect, however, the close similarity of the characteristics of the disease with those observed in the study of experimental autoimmune encephalomyelitis (EAE) in mice, suggest that multiple sclerosis you ivalsa aberrant immune response, due to T-cells.

Experimental autoimmune encephalomyelitis (EAE), a mouse model of multiple sclerosis man, is the subject of intense and fruitful research for several years and is characterized by histopathological and clinical manifestations similar to those for reflexive forms of multiple sclerosis. The T Lymphocyte in Experimental Allergic Encephalomyelitis. Ann.Rev.Immunol. 8:579-621 (1990). EAE can be called in mice SJL introduction spinal cord homogenate of mouse brain (MSCH), MRR, PLP, the introduction of synthetic peptides whose sequences meet the main encephalitogenic epitopes of the basic protein of myelin, MRI 84-104, proteolipid protein, PLP 139-151, or adoptive transfer of activated CD4' TH1but not TH2cells that are specific to encephalitogenic epitopes. When EAE main encephalitogenic myelin epitopes sequences, such as MRI, can also activate human T cells several different haplotypes, including HLA-DR2. R. Martin, et al., J.Exp.Med. 173:19-24 (1992). Experimental disease is characterized by intermittent for neurological dysfunction, perivascular infiltration by mononuclear cells and demyelination. Damage to the Central nervous system, apparently caused by inflammatory cytokines, which may nonspecific aktivirovat the additional monocytes and macrophages. J.E.Blalock, The Immune System. Our Sixth Sense. The Immunologist, 2:8-15 (1994).

Though the primary attack in EAE can be induced by the introduction of T cells that are specific as to the MDBs, and LPL, a detailed study of reactively T cells in primary and subsequent outbreaks showed the presence of T cells that interact with the specificity that is different from the specificity inducing epitopes. This expansion encephalitogenic epitopes was identified as “the distribution of determinants”. S.D.Miller and W.J.Karpus, Immunology Today 15:356-361 (1994), P.V.Lehman, T.Forsthuber, A.Miller and E.E.Sercarz, Nature 358:155-157 (1992), H.Jiang, S.-I.Zhang and B.Pernis, Sclence 256:1213-1215 (1992). Therefore, antigen-specific treatment would be more effective at his earliest possible appointment prior to the complexity of epitopes and development of possible nonspecific inflammation.

The goal of immunotherapy is to restore tolerance without suppressing the immune system in General, which could lead to complications such as infection, hemorrhage, and cancer. Currently used drugs for the treatment of autoimmune disease are nonspecific immunosuppressive agents such as anti-inflammatory agents or drugs that block cell proliferation or inhibit Pro-inflammatory cytokines. In General, these agents are effective for a limited period and causing the severe complications.

It would be desirable to affect the immune system in a more specific way, in order to monitor the response to its own antigens and theoretically to “cure” the disease without suppressing the entire immune system in General. In recent years, it was proposed and tested several schemes specific immunotherapy, most of which are not found practical application, as it proved ineffective against people. For example, can be synthesized high-affinity peptides that interact with MHC molecules of class II and prevents binding encephalitogenic peptides, and thereby preventing the activation of pathogenic T cells. A.Franco et al., The Immunologist 2:97-102 (1994). The disadvantage of this approach is the difficulty of achieving effective concentrations of inhibitory peptides in vivo. G.Y.Ishioka et al., J Immunol. 152:4310-4319. When alternative strategies peptides which are analogs encephalitogenic sequences antagonizing with receptors on antigen-specific T cells, making them inactive, although the exact mechanism remains unknown. S.C.Jameson et al., J.Exp.Med. 177:1541-1550 (1993), N.Karin et al., J.Exp.Med. 180:2227-2237 (1994), V.K.Kuchroo et al., J.Immunol. 153:3326-3336 (1994). It was also studied the oral introduction of myelin, inducing a state of immunological toleratethe, which is probably due to the induction of suppressor T cells Il what anergy. H.L.Weiner et al., Annu.Rev.Immunol. 12:809-837 (1994), C.C.Whitacre et al., J.Immunol. 147:2155-2163 (1991), SJ.Khoury et al., J.Exp.Med. 176:1355-1364 (1992). It is shown that this treatment is effective for some but not all individuals. H.L.Weiner et al., Science. 259:1321-1324 (1993). Therefore, an obvious need to develop new treatments for multiple sclerosis and other autoimmune diseases using the effective immunospecificity approaches.

Brief description of the invention

The present invention aims at eliminating the drawbacks known from the prior art. In General, the invention is based on the discovery that recombinant DNA technology and migration of cells can be used to restore tolerance to its own tissues. The present invention relates to a method of treating a patient suffering from multiple sclerosis, which is the introduction to the patient getsomething fibroblasts, despite the fact that the data histochemistry fibroblasts were treated in vitro with introducing a DNA fragment encoding amino acids 101-157 proteolipid protein, the DNA fragment was introduced into these histochemistry fibroblasts in vitro using recombinant retroviral vector, the DNA fragment also contains a hydrophobic leader sequence and the hydrophobic leader sequence provides the possibility of the efficiency of synthesis of the amino acid sequence 101-157 proteolipid protein in the endoplasmic reticulum of these getsomething fibroblasts with further constitutive secretion, this DNA fragment also contains one or more sites restriktsii that provides the ability to embed additional gene sequences and gene product or gene products of a given fragment of DNA will be expressed in the body of the patient in therapeutically effective amounts, with the restoration of T-cell tolerance.

The object of the invention is also the fibroblast cultures treated in vitro by introduction of a DNA fragment encoding amino acids 101-157 proteolipid protein, while fibroblasts are histocompatible.

The DNA fragment can be introduced with the recombinant vector, which may be a retrovirus.

In a preferred variant implementation of the invention, the DNA fragment also contains the Boxing Kozak, providing efficient translation of mRNA transcribed on this DNA fragment, the DNA fragment also contains the 3'end of the codon corresponding to the charged amino acid, resulting in the specified protein is not attached to the membrane.

When implementing a preferred variant of the invention, the cells producing line RA transducer retroviral PLP-vector and obtain the supernatant containing the recombinant retrovirus. Producing line RA was received by Dr. A.Dusty Miller, carefully karakt is characterized and its use authorized by the Administration on the control of food and drugs (FDA) for clinical trials of treatments for genetic diseases and cancer. Miller and Baltimore, Mol.Cell.Biol. 6:2895-2902 (1986), W.F.Anderson, Science. 256:808-813.

Brief description of drawings

Figure 1 is a map of part of the PLP gene, showing the restriction sites and sequence of the gene product.

Figure 2 is a map of vector G1XSvNa with restriction enzymes cut sites and functional features. On Fig.2b the complete DNA sequence of the vector G1XSvNa.

Figure 3 shows a diagram of the design vector G1XSvNa PLP containing the inserted gene PLP.

Figure 4 shows the levels of mRNA expressed in transfected and transduced fibroblasts in the analysis of back-transcriptase polymerase chain reaction. Line 1 corresponds to the molecular weight standards, line 2 - negative control of the imaginary transfected fibroblasts, line 3 - positive control with plasmid containing the gene PLP, line 4 - cDNA from PLP - transfected fibroblasts SJL, line 5 - cDNA from PLP - transduced fibroblasts SJL.

Figure 5 presents the level of protein PLP in supernatant transduced fibroblasts when determining ELISA.

Figure 6 shows the level of expression of B-Gal in transduced fibroblasts.

Figure 7 shows the system of clinical accounting chronic EAE.

On Fig the system histological accounting chronic EAE.

Fig.9 illustrates the clinical assessment of EAE in mice, the treatment is developed retrovirus-translotsirovannoi fibroblasts.

Figa reflects pathological evaluation of brain and spinal cord of SJL mice treated with retrovirus-translotsirovannoi fibroblasts. On Fig.10b summarized pathological evaluation of the spinal cord and brain from day to 55-60 90-95 days.

11 shows the histology of SJL mice treated with retrovirus-translotsirovannoi fibroblasts.

On Fig results proliferative tests on mice with EAE treated with PLP - expressing fibroblasts.

On Fig results proliferative assays with IL-2 and no IL-2 in mice with EAE treated with PLP - expressing fibroblasts.

Detailed description of the invention

As mentioned above, the present invention relates to the use of genetically transformed cells to restore toleratethe to a self-antigen in patients suffering from autoimmune disease. Genetically transformed cells can be any mammalian cells. The term “genetically transformed” refers to the cell in which you entered one or more recombinant genes such as the gene encoding the epitope own antigen.

A gene is a deoxyribonucleotide sequence encoding the amino acid sequence. Genes inserted recombinant methods may be in the form of synthetic is oligonucleotide, cDNA (i.e. they will not contain introns), in the form of copies of genomic sequence or a hybrid gene, merged from two or more gene sequences. Additionally, a gene may be associated with one or more nucleotide sequence capable of directing expression of the gene product. The elements of the sequences that can influence gene expression include, but are not limited to the mentioned above, promoters, enhancer elements, signals termination of transcription and polyadenylation sites, sequence Boxing Kozak to improve the efficiency of broadcast and leader sequence. Additionally, the sequence of a gene may contain restriction sites that allow insertion of additional sequences. Preferably, the gene must contain a leader sequence so that the gene product was synthesized in the cytoplasmic reticulum with subsequent constitutive secretion.

Recombinant genes intended for insertion into cells with a view to their genetic transformation, can encode one or more epitopes, parts, domains or mini-proteins protein antigen. Examples of proteins which can be derived epitopes, parts, domains or mini-proteins, can serve as (without limitation listed) proteins of myelin, Retz who ptor acetylcholine, the TSH receptor and collagen.

It is believed that the protein autoantigens that serve as the target of an autoimmune response are highly conserved within a species and between species. Therefore, although the present invention primarily is directed to a method of treatment of people, this method can be applied for treatment of animals. Examples of autoimmune diseases mediated by T-cells, for which treatment can be applied to the present invention, are (without limitation listed) multiple sclerosis, myasthenia gravis, systemic lupus erythematosus, psoriasis, juvenile diabetes, rheumatoid arthritis, thyroid disease and chronic inflammatory demyelinizing polyneuropathy (CDIP).

The expression vectors are typically deoxyribonucleotide molecules designed for controlled expression of one or more genes of interest. The vectors may contain one or more operatively associated with the gene nucleotide sequences that control expression of the desired gene or genes. There is a large variety of available expression vectors and a qualified technician can easily select the appropriate vector. In addition, in standard laboratory manuals described methods of recombinant DNA and ways to receive the Deposit and use of expression vectors. Optionally, the vector may contain a selective marker, e.g. a gene of resistance to the antibiotic.

The gene can be introduced into the mammalian cell using any method of gene transfer. Examples of such techniques, without limiting the above, serve as gene transfer by viral RNA, i.e. retroviral transduction, gene transfer by viral DNA, electroporation, calcium phosphate transfection, microinjection or gene transfer via liposomes. The choice of procedures necessary to obtain genetically transformed cells secreting the desired product of the gene will depend on the nature and properties of the selected cells. Specific technologies introduce genes into cells are well-known specialists in this field of research.

The following examples reveal the design part of the PLP gene, show the expression of the PLP gene product in vitro and in vivo and the effects of PLP gene product in vivo. They are given to illustrate the invention and do not limit its scope.

EXAMPLE 1

CONSTRUCTING GENE PLP

In mice SJL/J encephalitogenic the PLP epitope represented by the amino acids 139-151. N.Takahashi et al., Cell 42:139-148 (1985), K.Sakai et al., J.Neuroimmunol. 19:21-32 (1988), D.H.Kono et al., J.Exp.Med. 168:213-227. Described in the present invention the vector is constructed so that encoded them gene product constitutive secretarials of the fibroblast the century Since complete protein PLP is a hydrophobic transmembrane protein (H.-J.Diehl, M.Schaich, R.-M.Buzinski and W.Stoffel, PNAS USA 83:9807-9811 (1986)), and encephalitogenic epitope is extracellular, was constructed a plasmid encoding amino acids 101-157 and additional amino acids that are required for secretion. This sequence has a hydrophilic character.

1. The synthesis of oligonucleotides and construction of vector PLP pRc/CMV

Oligonucleotides can be synthesized manually, say, phosphocreatine method, as described, for example, R.L.Letsinger et al., J.Am. Chem. Soc. 98:3655 (1967) (work cited as references). The prior art is well known and other methods. Cm. also Maneucci and Caruthers, J.Am. Chem. Soc. 103:3185 (1981) (work cited as a reference).

However, preferably the receiving sequence of the desired gene automatic synthesis of individual oligonucleotides at concentrations of 2 μm. To obtain amino acid sequence PLP 101-157 DNA synthesis was performed on a DNA synthesizer such as Perkin Elmer/Applied Biosystems Division Model 394 using lataitis-protected phosphoramidites. Dimethoxytrityl group (DMT) is not removed from the 5'-hydroxyl group to facilitate cleaning. After the usual removal of the oligonucleotides from the resin with concentrated ammonium hydroxide and deprotection at 55°C for 16 hours, the oligonucleotides were purified with the use the of cartridges for purification of oligonucleotides (ORS) according to the manufacturer's instructions (Applied Biosystems Inc.). Were synthesized five oligonucleotides with the following sequences:

O L G 1 5 ' -

CGGCGACTACAAGACCACCATCTGCGGCAAGGGCCTGAGCGCAACGGTA

ASA

GGGGGCCAGAAGGGGAGGGGTTCCAGAGGCCAACATCAAGCTCATTCTC

TCGAGC-3'

O L G 2 5 ' -

GAGCTTGATGTTGGCCTCTGGAACCCCTCCCCTTCCTGGCCCCCTGTTAC

CGTTGCG

CTCAGGCCCTTGCCGCAGATGGTGGTCTTGTAGTCGCCGGGCC-3'

O L G 3 5 ' -

GGGTGTGTCATTGTTTGGGAAAATGGCTAGGACATCCCGACAAGTTTGTG

GGCATCACCTATGCTAGCCTTAAGTAGGATCCTTGAATAGGTA-3'

O L G 4 5 ' -

AGCTTACCTATTCAAGGATCCTACTTAAGGCTAGCATAGGTGATGCCCA-3'

O L G 5 5 ' -

CAAACTTGTCGGGATGTCCTAGCCATTTTCCCAAACAATGACACACCCGCTCG

AGAGAAT-3'

Each purified oligonucleotide was dried under vacuum, washed with 1 ml of sterile double-distilled water and then again evaporated to dryness in vacuum (privately Speed vac, Savant Inc.). 80 gr of each oligomer was subjected to generowania at 37°C for 1 hour, resuspended in 56,6 μl of 1X kinase buffer (polynucleotides buffer, Boehringer Mannheim, Indianapolis, IN)containing 10 units of polynucleotide kinase (Boehringer Mannheim, Indianapolis, IN) and 100 μm ATP. For hybridization of each individual oligonucleotide were mixed in 2xSSC (0.03 M sodium citrate, pH 7.0, 0.3 M NaCl) in a test tube for PCR with the corresponding complementary oligomer. The volume of each hybridization mixture was brought up to 200 μl. Oligomer OLG1 hybridized with the oligomer OLG2 and oligomers OLG4 and OLG5 hybridized with the oligomer OLG3. Hybridization was performed in thermocycler Perkin Elmer 9600 according to the following program: 1) 99,9°, 2 minutes and 2) of 99.9° to 4° 15 minutes. When PON is hereto temperature up to 4° When the temperature in thermocycler fell to 37°C, a solution containing oligomeric duplex OLG1 and OLG2, was mixed with a solution containing oligomers OLG3, OLG4 and OLG5. Then reduce the temperature continued to 22°C. Then was added 5 units (5 μl) of T4 ligase (Boehringer Mannheim, Indianapolis, IN) and 45 μl of branded 10X T4 DNA ligase buffer (Boehringer Mannheim, Indianapolis, IN) and ligation was continued throughout the night with a 10°C.

Legirovannoi DNA was besieged by the two volumes of 100%ethanol and incubated at -70°With 1 hour. The precipitate was centrifuged for 30 min at 17 000 × g and 4°C. the Supernatant was discarded, and the precipitate washed with 1 ml of 70%legs ethanol and centrifuged 10 min at 17 000 × g and 4°C. the precipitated DNA was dried under vacuum (privately Speed vac, Savant Inc.) and resuspendable in 45 μl of sterile double-distilled water.

DNA of the appropriate molecular weight was isolated by electrophoresis. To the sample was added to 5 ál of 10X buffer for drawing (6.25 g Ficoll and 0.93 g of disodium salt of EDTA/ 25 ml 10% SDS, orange G, Xilin cyanol and bromophenol blue) and applied to acrylamide gel with urea size 14.5 cm × 16 cm × 0.15 mm (7M urea/8% acrylamide with 1.1% bisacrylamide). As a buffer for gel and electrophoresis was used TBE (89 mm Tris, 89 mm boric acid and 2 mm EDTA, pH 8.0). The sample was subjected to electrophoresis at 35 mA until the eye stripe dye orange G has not reached the edge of the gel on 1 see Acrylamide gel twice washed with water for 5 minutes. After the last washing, the gel was incubated for 3 minutes in 500 ml of a solution containing 10 ál of ethidium bromide solution (10 mg/ml) and viewed under UV light. The band corresponding to legirovannoi DNA are cut out of the gel and fragmentable into small pieces for electroelution apparatus IBI (model UEA: International Biotechnologies Inc., New Haven, CT).

For electrolyze salt trap apparatus was filled with 125 μl of 7M solution of sodium acetate with bromophenol blue. The camera buffer fills 1/2X TBE. The sample was subjected electroelution at 85 for 1 hour. After removal elyuirovaniya DNA cell for the sample was washed for 1/2X TBE and the wash was combined with the initial eluate. Then elyuirovaniya DNA was besieged during the night at -70°With two volumes of 100%ethanol. The precipitate was besieged, washed as previously described, and resuspendable in 15 μl of sterile double-distilled water.

Before legirovaniem elyuirovaniya part of the PLP gene in the vector pRc/CMV (Invitrogen, San Diego, CA), the vector pRc/CMV was restrictively endonucleases Ara I and Hind III according to the manufacturer's recommendations (Boehringer Mannheim, Indianapolis, IN). Then resuspending construct gene PLP was added to 5 μl of a mixture containing 0.3 μg of the cut vector pRc/CMV (2 μl), 1 unit of T4 ligase (1 μl) (Boehringer Mannheim, Indianapolis, IN) and 2 ál of 10X T4 DNA ligase buffer (Boehringer Mannheim, Indianapois, IN). Then legirovannym vector of transformed competent cells lines AG1.

The transformation was carried out by mixing the mixture for ligation with AG1 cells and inquira on ice for 20 minutes. The mixture is then cells/vector were incubated at 42°With 2 minutes and were sown on the night of the agar Luria broth (LB; Bio 101, Vista, CA), which included ampicillin (80 mg/ml) (Sigma, St.Louis, MO). The colony was skanirovali regarding the correct sequence of the vector, allocating plasmid DNA, with subsequent sequencing.

For selection of plasmids used commercial kits Wizard Minipreps (Promega, Madison, WI). Colonies were wounded her with cups with LB/Amp agar and pokasivali 3.5 hours in 5 ml of LB medium (Bio 101, Vista, CA) supplemented with 80 mg/ml ampicillin (Sigma, St. Louis, MO). For the deposition of cells in 3 ml of medium was centrifuged at 17 000 × g at room temperature for 1 minute. The selection of plasmids were performed according to the manufacturer's recommendations. For sequencing used 1 µg plasmid.

Sequences of oligonucleotides can be verified is well known from the prior art methods, such as described by Sanger et al., PNAS U.S.A. 70:1209 (1973) or by the method of Maxima-Gilbert, Meth.Enzymology. 65:499 (1977) (both methods are mentioned in the present description as references). It is preferable to sequence plasmid using automatic sequencing machine. In the case of construct pRc/CMVPLP plasmid was sequenced automatic fluorescent method of DNA sequencing (Perkin Elmer/Applied Biosystems Inc., Foster City, CA) using the following primers: GATTTAGGTGACACTATAG and TAATACGACTCACTATAGGG. These primers were used as the seed vector, flanked by Boxing Kozak and “stop”website of the entire construct. Figure 1 shows a map of part of the PLP gene, indicating the restriction sites and sequence of the gene product. At the 5'end of the construct, the authors have previously built a hydrophobic leader sequence of the gene MHC class IIdso that the gene product was synthesized in the endoplasmic reticulum (ER) for further constitutive secretion. Linsk et al., J.Exp.Med. 164:794-813 (1996). In addition, at the 3'-end was added lysine codon to eliminate the attachment of the protein to the membrane. In the construct was included Boxing Kozak, to ensure effective translation. In the construct were also inserted restriction sites Afl II and Barn HI, in order to make possible the insertion of other epitopes.

EXAMPLE 2

The PROTEIN EXPRESSION of PLP IN VITRO

In order to demonstrate that PLP-vector encodes a constitutive secretory protein, were conducted the following experiments. In particular, the levels of PLP mRNA was evaluated in fibroblasts SJL, transfected with the vector pRc/CMV PLP, and the levels of mRNA and protein PLP was evaluated in fibroblasts SJL, transfected with the vector pG1PLPSvNa.

1. Obtaining cultures of fibroblasts

Syngeneic fibroblasts (obtained from mice SJL), PR is delivered by Dr. G.Dveskler (Uniformed Services University, Bethesda, MD), were grown at 37°in DMEM with 5% glutamine and 10% fetal calf serum. The cells were collected and frozen at a concentration of 1×107cells / ampoule. Aliquots of frozen cells were tested for the presence of Mycoplasma, sterility and viability.

2. Retroviral constructs

Was constructed recombinant retroviral vector, in which were built exogenous genes. The cloning strategy was aimed at obtaining vector pG1XSvNa (W.French Anderson, University of Southern California), containing an insert of the PLP from the vector pRc/CMV-PLP. Vector pG1XSvNa, like most used in preclinical and clinical testing of retroviral vectors was derived from retrovirus leukemia mice, Malone (Mo-MuLV). Rosenberg et al., N.Eng.J.Med. 323:570-578 (1990), Culver et al., Science. 256:1550-1552 (1992). Vector pGlXSvNa has dimensions 5865 base pairs. His card, functional features and the complete DNA sequence shown in Figa and 2b. Figure 3 shows a diagram of the design vector pG1PLPSvNa. Typically, the vector pRc/CMV-PLP were digested BstEII/HindIII and encoding PLP fragment was isolated by electrophoresis in a gel. After electroelution adapters HindIII/NotI (Stratagene, La Jolla, CA) and ligated into the HindIII site lirovannomu fragment. To obtain Notl-all were Notl restriction. Vector pGlXSvNa was restrictively Notl and Electrosila were isolated fragment 565 base pairs, ends of which are treated with alkaline phosphatase from calf intestine (ClAP). Insert ligated into the Notl site of the vector. BstEII-the ends of the insert and Notl site of the vector was constructed using the fragment maple. For circuit vector ligation was performed for blunt ends. Cells NV transformed ligase mixture, and then spent restriction analysis for confirming the presence of the insert and its orientation. Recombinant retrovirus replication defective and unable to produce infectious virus.

3. The supernatant retroviral vector

To obtain recombinant PLP-virus supernatant PLP-transduced packaging cell line RAT were grown in 4 ml of appropriate culture medium in vials KZT25 (Corning, Cambridge, MA). Containing retroviral vector supernatant was obtained by collecting the culture medium when the cells are 80-90% of the monolayer, and stored in 1-ml aliquot at -70°C.

Cell line-producer and/or viral supernatant following studies were conducted:

1. The titer of virus was determined on cells ZTZ. Use viral preparations with a titer higher than 5×104colony-forming units per ml

2. Sterility cell line producer and supernatant confirmed tests for aerobic and anaerobic bacteria, fungi and Mycoplasma.

Drugs LP-vector, obtained from cells RA, should be carefully examined to confirm the absence of replication competent virus. This aspect is especially important when the embodiment of the invention, when it is used to treat people. To confirm the absence of replication competent virus should be tested as viral supernatant and transduced fibroblasts. Cell line-producer and/or viral supernatant can be conducted the following research:

1. The titer of virus was determined on cells ZTZ. Use viral preparations with a titer higher than 5×104colony-forming units per ml

2. The cell line producing checked by means of southern blotting for the presence of the gene PLP.

3. Define the products PLP cell line-producer, and these products should be considerably larger than the initial reference value (ELISA).

4. Sterility cell line producer and supernatant confirmed tests for aerobic and anaerobic bacteria, fungi and Mycoplasma.

5. Ongoing virological tests are: MAR-test, test for the virus, LCM, test thymic agent, S-L-test ecotropic virus, S+L-test xenotropic virus, S+L-test amphotropic virus and ZTZ amplification.

6. In order to ensure that no ADV is nizinny agents, spend electron microscopy.

After the introduction of a gene into fibroblasts and prior to the introduction of fibroblasts of patients, conduct the following studies:

1. Cell viability should be greater than 70%, which is judged by the staining Trifanova blue.

2. Before the introduction of a cytological analysis of 200 cells to exclude the presence of tumor cells.

3. Confirm sterility tests for the presence of aerobic and anaerobic bacteria, fungi and Mycoplasma.

4. S+L test should be negative, including amplification ZTZ.

5. PCR analysis for the presence of the gene of surface protein A should be negative.

6. Back-transcriptase test should be negative.

7. To confirm the presence of intact provirus transduced fibroblasts was studied by southern blot testing.

8. Products of protein PLP podvergali test protein PLP.

4. Transfection of fibroblasts

Prior to transfection of fibroblasts from SJL transformed cells AG1 produce highly purified vector PLP-pRc/CMV. Large-scale purification of DNA is performed using commercially available kits and gradient centrifugation in CsCl. Initial cleaning is performed using the set Wizard Megaprep Kit (Promega, Madison, WI). Transformed cells AG1 grown in 1000 ml overnight culture in LB medium/Amp at 37°, osaid the Ute and release of plasmid DNA according to the manufacturer's instructions. Then the selected DNA resuspending in 3 ml of buffer TE (10 mm Tris-HCl, pH 7.4, and 1 mm disodium salt of EDTA, pH 8.0) and subjected to gradient centrifugation in CsCl. The modified DNA purification gradient centrifugation in CsCl conducted according to the technique, published in “Current Protocols in Molecular Biology, Vol.1” (Greene Publishing Associates and Wiley-Interscience).

After the strip of DNA extracted from the centrifuge tubes from the sample to remove the ethidium bromide, purifying three volumes SSC-saturated isopropanol. Washing continued until until the aqueous phase becomes pure. CsCl is removed presidenial. Then to the sample add 2 volume M NaCl/TE and 2 volumes of 100%ethanol (with respect to the total volume of DNA solution and M NaCl/TE), are mixed and placed for 10 minutes on ice. Precipitiously DNA precipitated by centrifugation at 10 000 × g for 10 minutes at 4°C. the Precipitate was washed with cold 70%ethanol, re-centrifuged at 10 000 × g for 10 minutes at 4°and dried in vacuum (privately Speed vac, Savant Inc.). Purified DNA resuspended in double-distilled sterile water and used in transfection experiments.

Experienced fibroblasts SJL transferout using LipofectAMINE (Life Technologies Inc./Gibco BRL) according to manufacturer's instructions. Control fibroblasts SJL subjected to the same procedures, but without DNA construct. For transfection using 3 μl of the shelled in CsCl plasmid PLP-pRc/CMV and 25 μl of Lipofectamine. On the eve of the experiment approximately 3×105cells seeded in 25 cm2culture flasks (Corning Costar Corp., Cambridge, MA) and grown at 37°C in an atmosphere of 5% CO2in 5 ml of culture medium DMEM (Wednesday Needle in the modification Dulbecco) (Irvine Scientific, Santa Ana, CA) supplemented with 5% glutamine, 10% fetal calf serum, 25 U/ml of sodium salt of penicillin G and 25 mg/ml streptomycin sulfate. The cells are then washed with 3 ml of serum-free medium HL-1 (Hycor Biomedical Inc., Irvine, CA). After cells were preincubator with complex DNA/Lipofectamine 6 hours at 37°C in an atmosphere of 5% CO2in bottles add 1 ml of DMEM medium. 36 hours after the completion of the transfection medium is replaced by 5 ml of DMEM medium containing 900 μg G418 (Life Technologies Inc./Gibco BRL) per ml of medium. Experienced cells grown in the presence of 900 μg G418 (ml environment until such time as the control cells were not killed, and some experimental bottle more was not observed cell death). Then the concentration of G418 was lowered to 600 mg/ml of culture medium for further cultivation of the cells.

5. Transduction of fibroblasts

For transduction of fibroblasts using retroviral constructs containing a selective marker neo and PLP gene or gene Lac-z. Transduction with retrovirus performed on viable cells (90%viability by staining of the trip is new in blue). In each well of a 24-hole tablet (Falcon, Franklin Lakes, NJ) sowing 2×106cells in 0.5 ml medium DMEM-10 (DMEM with addition of 10% fetal calf serum, 2 mm L-glutamine, 50 IU/ml penicillin G, 50 mg/ml streptomycin). Cells transferred to the incubator for attaching (37°, 5% CO2). After the cells attached to the substrate, each cell make 1 ml of retroviral supernatant and polybrene (Sigma, St.Louis, MO) (final concentration 10 μg/ml). Cells incubated as described above for 2.5 hours without shaking. After 2.5 hours, the cells are transferred into vials KZT25, and add DMEM-10 to a final volume of 8 ml On the third day after transduction, the medium is replaced by selective (DMEM-10 with the addition of 900 μg/ml G418 (Gibco, Grand Island, NY). Then the concentration of G418 was lowered to 600 mg/ml of culture medium for further cultivation of the cells.

6. Analysis of mRNA expression

Isolation of RNA was performed in aseptic conditions using Mcasa-free materials and DEPC (diethylpyrocarbonate)-treated solutions. 4×106experimental and control cells were twice washed in ice-cold phosphate buffered solution, resuspendable 200 μl of the mixture for lysis of the cells (10 mm Tris, pH 7.5, 0.15 mm NaCl, 1.5 mm MgCl2, 0.65% NP 40), mixed and centrifuged at 17 000 × g and 4°5 minutes. The supernatant pen is carried in the tube, containing 200 ál of urea mixture (7M urea, 1% SDS, 0.35 M NaCl, 10 mm EDTA and 10 mm Tris-HCl, pH 7.5) and 400 μl of a mixture of phenol:chloroform:isoamyl alcohol (25:24:1). The solution was mixed and centrifuged 1 min at 17 000 × g. This procedure with the aqueous phase was repeated twice, then it was transferred into a tube with 400 ál of phenol and washed as described previously. The aqueous phase is again transferred to a new tube and precipitated RNA and 1 ml 100%ethanol at -20°With during the night. Precipitated RNA once washed with 70%ethanol. After removal of the ethanol precipitate was dried in vacuum. 1 µg RNA was used for analysis back-transcriptase PCR (RT-PCR).

RT-PCR was performed using a commercial kit GenAmp RNA PCR Kit (Perkin Elmer/ABI) according to the manufacturer's instructions. For amplification of cDNA used the following primers: 5'-GCGACTACAAGACCACCATCT-3' and 5'-TAAGGCTAGCATAGGTGATG-3'. PCR products were separated by electrophoresis in 1.5%agarose gel (SeaKem GTG; FMC)/TAE with 1 ál of ethidium bromide (10 mg/ml) in 1 ml of agarose. Electrophoresis was performed in TAE buffer at a constant current of 40 mA. The electrophoresis was carried out in the course of such time, which was enough for a clear separation of the molecular weight markers, which allowed to verify the approximate molecular weight of PCR products. The band of interest DNA was cut from the gel and DNA was purified using kommercheskoj is set MERmaid (Bio 101, Vista, CA) according to manufacturer's instructions. Then the purified DNA sequenced automatic method with fluorescent DNA (Perkin Elmer/ABI, Foster City, CA).

Figure 4 shows a photograph of an agarose gel with PLP-specific products FROM RT-PCR. The results svidetelstvujut that mRNA is present in PLP-transduced and PLP-transfected cells. Yet to establish the correlation between mRNA and secretively protein, since the concentration of the peptide does not necessarily correspond to the level of mRNA.

7. Analysis of protein expression

Quantitative expression in vitro genome encoded PLP proteins was assessed immunologically, using ELISA. Tested undiluted supernatant from cultures of fibroblasts transduced gene PLP. Supernatant contributed to the wells of the 96-well plate to micrometrology. Primary anti-PLP 139-151 antibodies E 139-151, obtained from Dr. M.Lees (Harvard), specific for PLP 139-151. They were added to the cells in the form of undiluted hybridoma supernatant, and then made the second conjugate antibodies (antibodies goat to mouse IgG) horseradish peroxidase at a dilution of 1:500. The tablet showed and analyzed the absorption at 490 nm on an ELISA reader. Figure 5 shows the results of ELISA supernatants transduced fibroblasts. Samples 1 and 2 represent PLP (amino acids 139-151) and peptides gp120 HIV, use the data in a concentration of 5 µg/ml This experiment proves that PLP-transduced fibroblasts really produce and secrete partial protein PLP.

EXAMPLE 3

EFFECTS of PROTEIN PLP IN VIVO

Critical set forth in this example embodiment of the invention is the ability to deliver genetically transformed fibroblasts of the patient so that the cells survived in sufficient quantity and for a sufficient length of time, providing the patient constantly secretively antigen.

In order to follow the fate of transplanted fibroblasts, fibroblasts SJL transduced bearing In the-galactosidase a retrovirus was injected subcutaneously between the shoulder blades SJL mice. All animals were females line SJL aged 6-8 weeks were obtained from Jackson Labs. Animals were kept according to the recommendations of the NIH (National Research Council, 1986). Subcutaneously introduced fibroblasts were found in large numbers after 60 days after injection. Fibroblasts injected in the foot pad or intramuscularly, could not be found on the eighth day.

1. Fate In Vivo B-gal-transduced cells

Activity marker-galactosidase activity was assessed in two groups of normal mice (each of 8 animals). The two mice injections of Lac-Z-transduced cells did subcutaneously in the back, two mice intramuscularly and two who Isham - in the foot pad. One animal was injected fibroblasts transduced only marker neo, and the last mouse was injected non-transduced fibroblasts. After collecting and washing the cells of various lines suspended at a concentration of 107in 2 ml of Hanks and slowly injected through the needle 25 gauge at various points. Animals were scored at the 10th and 15th days after treatment and the injection sites were subjected to histochemical study. Pieces of tissue were fixed in 4%paraformaldehyde for 1 hour, washed three times in PBS, and then kept overnight in an 8.4%solution of acrylamide. The next morning, the samples were placed in acrylamide, which after curing, cut up and frozen. Frozen sections with a thickness of 10 μm, obtained using a cryostat, stained with 1 ml of 5-bromo-4-chloro-3-indolyl-B-d galactopyranoside (X-Gal) in PBS. X-Gal was dissolved in DMSO at a concentration of 40 mg/ml and then added to the reaction mixture. Incubation was performed 14-18 hours at 37°C. figure 6 shows the expression of B-gal in transduced fibroblasts after 60 days in vivo. He had indications inflammatory response that gives the basis to consider that used for transduction of syngeneic fibroblasts retrovirus does not provoke an immune response or rejection process.

2. The effect of PLP on normal mice SJL

Another important aspect of the present invention, the glass lens is authorized in this example, is the answer to the question whether the transduced fibroblasts secreting PLP, to cause EAE in normal animals. To test this assumption 12 normal SJL mice were injected 107PLP-secreting fibroblasts SJL. Six animals fibroblasts were injected subcutaneously and the other six - IPR. On the 16th day the animals were killed and examined for the presence of inflammation or EAE. Figure 7 presents the system of clinical accounting of chronic EAE. Lu et al., Mol.Immunol. 28:623-630 (1991), J.Williamson et al., J.Neuroimmunol. 32:199-207 (1991). In the mouse model of EAE for playback of multiple sclerosis using homogenates of spinal cord adjuvant, inflammation in the CNS can be found on the 14th day. In this experience from normal animals that received an injection of PLP-secreting fibroblasts do not detect any clinical signs of disease even at the 60th day of the survey. In addition, the animals on the 60th day is not detected histological signs of inflammation in the CNS. On Fig system presents histological accounting chronic EAE. J.Goverman et al., Cell. 72:551-560 (1993).

3. Clinical and histological evaluation of mice with acute EAE after the introduction of the retrovirus-transduced fibroblasts

A six-week SJL mice were injected spinal cord homogenate of mice (MSCH) in complete Freund's adjuvant (CFA) and after 7 days - MSCH in incomplete Freund F. Anda (IFA). J.Immunol. 144:909-915 (1990). The first signs of EAE were observed for 14 to 18-day with full recovery to the 21st day. 95% of the animals were observed for clinical signs of acute EAE. These animals on day 21 was introduced 107PLP-secreting fibroblasts SJL or control fibroblasts. Animals which did not develop clinical signs of disease, were excluded from the experiment. Figure 9 presents the clinical score of mice with EAE after the introduction of the retrovirus-transduced fibroblasts. In animals that were injected PLP-secreting fibroblasts showed a significant reduction of clinical signs and a sharp decrease in the number of cells of inflammation, especially in the brain. On Figa presents pathological evaluation of the brain and spinal cord of SJL mice after administration of PLP-secreting fibroblasts. On Fig.10b summarized pathological evaluation of the brain and spinal cord of mice on the terms and 90-95 55-60 days. Histological assessment of EAE was performed on hematoxylin-eosin stained sections of brain and spinal cord.

4. Clinical and histological evaluation of mice with chronic EAE after the introduction of the retrovirus-transduced fibroblasts

150 mice were administered MSCH in CFA. The second immunization was carried out after 7 days. A.M.Brown and D.E.McFarlin, Laboratory Invest. 45:278-284 (1981). Day +14-16 at 113 participants of the animals developed clinical signs of disease, prodoljalas is 3-4 days. These positive animals were separated for subsequent experiments to day +55-60 100 mice was observed first relapse. 67 mice was observed for the second relapse by day +137. 8 days after relapse animals were injected with 107fibroblasts and another 18-23 days, animals were scored. Used four different types of fibroblasts: transduced with retrovirus encoding the PLP retrovirus,-galactosidase and peo-selective marker, and retranslation cells. Figure 11 presents the histology of mice with chronic EAE treated with retrovirus-translotsirovannoi fibroblasts. Among the animals, which were injected PLP-secreting fibroblasts were observed in animals with inflammation degree 2+ and 3+.

1. Peripheral immune status of the treated mice compared to control EAE mice

Cells spleens four control EAE mice and four EAE mice, which were injected fibroblasts expressing the protein PLP, were used in coagulation tests, during which cells spleens were incubated with 40 μm of peptide PLP 140-151 or 40 μm peptide 308-322 HIV gp120 for 4 days, and then marked3H-thymidine for 24 hours.

Animals were killed by asphyxiation WITH2. Cells spleens were dispersively to the state of unicellular suspension in medium RPMI1640, passing the suspension through a sieve #60. Cells ADNOC atno washed before how to sow into the wells of 96-well plates (8×105per cell) in 0.2 ml of medium HL-1 (Nusag Biomedical, Irvine, CA) supplemented with 2 mm glutamine, 100 U/ml penicillin, 100 µg streptomycin. Cells were cultured with or without adding 40 μm peptide for 4 days at 37°C in an atmosphere of 5% CO2. For antigen-specific proliferation used the PLP peptide 140-151 and peptide ICBMs 89-101, and as a negative control was used peptide 308-322 HIV gp120. Individual cells also contained 100 U/ml recombinant mouse IL2 (Boehringer Mannheim, Indianapolis, IN). In the last 18-24 hours of cultivation in each cell was added 1 µci3H-thymidine (ICN, Irvine, CA), cells were collected on glass fiber filters Xtal Scint” (Beckman, Fullerton, CA) and counted on a scintillation counter Beckman LS6000. Expected values include thymidine (number of emulsol in the experiment per minute minus the background counts per minute), and display the average values for the three crops plus or minus the standard deviation.

The results shown Fig, suggest that PLP-specific proliferative response is significantly reduced in mice with EAE, which were introduced PLP-expressing fibroblasts.

Fig illustrates an experiment similar to that shown in Fig, with the difference that during the 5 days additionally injected murine IL-2 (10 U/ml). These results p the show, the mechanism by which significantly reduced PLP-specific proliferative response may include a deletion of T cells, rather than anergy, because these lymphocytes do not respond to 11-2.

Though the mechanism by which the declared according to the present invention, the method restores tolerantly individuals suffering from due to T-cell autoimmune disease, is not yet fully understood, the obvious advantages of the claimed method of treatment in comparison with alternative approaches. The proposed method based on the genetic approach to immunospecificity “off” pathogenic T-cell response, and suppresses the immune system in General. In the case when due to T-cell autoimmune disease in a particular individual due to T-cells with multiple specificity, notified in accordance with the present invention the method can be easily adapted in relation to these specificlaly.

Scope of the present invention is not limited to the described variants of its implementation, which illustrate aspects of the invention. Clones, DNA or amino acid sequences that are functionally equivalent are described, also included in the scope of the present invention. Various modifications from the retene, in addition to the above, will be apparent to a skilled specialist from the preceding description. Such modifications are also included in the scope of claims of this application.

Various publications cited in the present description, is included only as a reference.

1. A method of treating a patient suffering from multiple sclerosis, including the introduction getsomething fibroblasts of this patient despite the fact that the data histochemistry fibroblasts were treated in vitro with introducing a DNA fragment encoding amino acids 101-157 proteolipid protein, the DNA fragment was introduced into these histochemistry fibroblasts in vitro using recombinant retroviral vector, the DNA fragment also contains a hydrophobic leader sequence and the hydrophobic leader sequence allows the synthesis of the amino acid sequence 101-157 proteolipid protein in the endoplasmic reticulum of these getsomething fibroblasts with further constitutive secretion and gene product or gene products of a given fragment of DNA will be expressed in the body of this the patient in those who piticescu effective amounts with the restoration of T-cell tolerance.

2. The fibroblast cultures treated in vitro by introduction of a DNA fragment encoding amino acids 101-157 proteolipid protein.

3. Culture of fibroblasts according to claim 2, wherein the fibroblasts are histocompatible.

4. Culture of fibroblasts under item 2 or 3, characterized in that the DNA fragment is introduced with the recombinant vector.

5. Culture of fibroblasts according to claim 4, characterized in that the vector is a retrovirus.

6. A method of treating a patient suffering from multiple sclerosis, including the introduction getsomething fibroblasts of this patient despite the fact that the data histochemistry fibroblasts were treated in vitro with introducing a DNA fragment encoding amino acids 101-157 proteolipid protein, the DNA fragment was introduced into these histochemistry fibroblasts in vitro using recombinant retroviral vector, the DNA fragment also contains a hydrophobic leader sequence and the hydrophobic leader sequence allows the synthesis of the amino acid sequence 101-157 proteolipid protein in the endoplasmic reticulum of these getsomething fibroblasts with further constitutive secretion, this DNA fragment also contains the Boxing Kozak, providing efficient translation of mRNA are Tran scribed as components which has been created on this DNA fragment, this DNA fragment contains the 3′-the end of the codon corresponding to the charged amino acid, resulting in the specified protein is not attached to the membrane, the DNA fragment also contains one or more restriction sites, allowing for the embedding of additional gene sequences, and the gene product or gene products of a given fragment of DNA will be expressed in the body of the patient in therapeutically effective amounts, with the restoration of T-cell tolerance.



 

Same patents:

FIELD: medicine, surgery, transplantology.

SUBSTANCE: embryonic spleen should be sampled, washed in nutritive medium № 199 to be placed into fresh medium № 199 to obtain homogenate in teflon homogenizer followed by centrifuging; then one should isolate the upper, medium and inferior layers, suck off medium layer and the upper part of inferior layer; the cell mixture obtained should be diluted in nutritive medium № 199 to be then introduced by injections into mesentery of small intestine or rectus muscle of abdomen. The present innovation favors the activation of immune system in patients undergone splenectomic operation and in those in case of surgical immunodefficient state due to high functional and regenerating activity of transferred embryonic splenic cells.

EFFECT: higher efficiency of prophylaxis.

6 dwg, 2 tbl

FIELD: cellular biology, medicine.

SUBSTANCE: invention relates to isolating and cryopreserving precursor-cells. Methods involve treatment of human liver tissue for preparing the essentially monocellular suspension containing precursor-cells and cells that are not precursor-cells, a single or more lines of cellular differentiation presenting in the human liver. Invention describes methods involving stage for separating cellular population resulting to reducing amount of cells that are not precursor-cells and providing preparing the separated suspension enriched with precursor-cells expressing one or more markers and associated with a single or more lines of the cellular differentiation. Also, invention describes a method for selection cells from the separated suspension wherein these cells or their progeny, or their more matured forms express one or more markers associated with lines of the cellular differentiation. These markers involve: CD14, CD34, CD38, CD45 and ICAM. Hepatic precursor-cells have diameter size 6-16 mc, they are diploid and show indices: glycoforin A-, CD45-, AFP+++, ALB+, ICAM+ and they comprise subpopulations varying with respect to expression of CD14+, CD34++, CD38++ and CD117++. These cells are useful for carrying out cellular and genetic therapy in liver treatment and for preparing artificial organs also.

EFFECT: valuable biological and medicinal properties of cells.

41 cl, 7 tbl, 13 dwg, 15 ex

FIELD: biotechnology, molecular biology, medicine, genetic engineering, pharmacy.

SUBSTANCE: the hemopoietic protein comprises the amino acid sequence of the formula: R1-L1-R1, R2-L1-R1, R1-R2 or R2-R1 wherein R1 represents the modified ligand flt-3; R2 represents the modified human IL-3, the modified or unmodified colony-stimulating factor. Modification of R1 is carried out by addition of N-end with C-end directly or through linker (L2) that is able to join N-end with C-end to form new C- and N-ends. The modified human IL-3 is prepared by replacing amino acids at positions 17-123. The human G-CSF is modified by exchange of amino acids. The hemopoietic protein is prepared by culturing cells transformed with vector comprising DNA that encodes the hemopoietic protein. The hemopoietic protein stimulates producing hemopoietic cells and this protein is used as a component of pharmaceutical composition used in treatment of humans suffering with tumor, infectious or autoimmune disease. Invention provides preparing multifunctional hemopoietic proteins eliciting the enhanced activity with respect to stimulation of hemopoietic cells and eliciting the improved physical indices. Invention can be used for preparing chimeric multifunctional hemopoietic proteins.

EFFECT: improved preparing and producing method, valuable medicinal properties of protein.

22 cl, 19 dwg, 18 tbl, 117 ex

FIELD: genetic engineering, immunology, medicine.

SUBSTANCE: invention relates to new antibodies directed against antigenic complex CD3 and can be used in therapeutic aims. Antibody IgG elicits the affinity binding with respect to antigenic complex CD3 wherein heavy chain comprises skeleton of the human variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 2, 4 and 6 and their corresponding conservatively modified variants. Light chain comprises skeleton of the rodent variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 8, 10 and 12 and their corresponding conservatively modified variants. Antibody is prepared by culturing procaryotic or eucaryotic cell co-transformed with vector comprising recombinant nucleic acid that encodes antibody light chain and vector comprising recombinant nucleic acid that encodes antibody heavy chain. Antibody is administrated in the patient suffering with malignant tumor or needing in immunosuppression in the effective dose. Invention provides preparing chimeric antibodies against CD3 that are produced by expression systems of procaryotic and eucaryotic cells with the enhanced yield.

EFFECT: improved preparing methods, valuable medicinal properties of antibody.

33 cl, 5 dwg, 1 ex

FIELD: organic chemistry, natural compounds, medicine, oncology.

SUBSTANCE: invention represents new saponin mixtures used for inhibition of initiation and activation of mammalian epithelial cell in pre-malignant or malignant state, for stimulation of apoptosis of mammalian malignant cell, prophylaxis of anomalous proliferation of mammalian epithelial cell, for treatment of inflammatory and regulation of angiogenesis in mammal. These mixtures are isolated form plants of species Acacia victoriae. Also, invention relates to methods for their applying. These compounds can comprise triterpene component, such as acacic or oleanolic acid to which oligosaccharides and monoterpenoid components are joined. Mixtures and compounds elicit properties associated with regulation of apoptosis and cytotoxicity of cells and strong anti-tumor effect with respect to different tumor cells.

EFFECT: valuable medicinal properties of compositions.

43 cl, 53 tbl, 50 dwg, 44 ex

FIELD: biology, genetic engineering.

SUBSTANCE: invention relates to preparing immortalized cellular lines from health human skin tissues and can be used in immunological, pharmacological, photo- and chemical-toxicological analysis of cutaneous response, for expression of heterologous genes and for construction of artificial skin. Keratinocytes are immortalized by infection of keratinocytes of health human. The human skin sample is isolated and prepared its for culturing in vitro. Keratinocytes are prepared from this prepared human skin sample and plated in serum-free medium for growing keratinocytes in cultural plates with cover alleviating attachment and growth of cells. In the process for culturing keratinocytes the serum-free medium is replaced to provide preparing the optimal confluent growth of cells in culture with continuous maintenance of cup cover. Keratinocytes are transferred in selective serum-free medium in cultural cups with cover and infected with vectors pLXSHD + SV40(#328) and pLXSHD + E6/E7. Then prepared immortalized keratinocytes are transferred in cultural cups with cover to useful medium for proliferation. Then prepared proliferated keratinocytes are transferred in medium with high calcium content for differentiation in cultural chambers with cover. Invention provides preparing the human keratinocyte cellular line that has no oncogenic property and retains capacity for differentiation and expression of proteins and enzymes expressing by normal differentiated keratinocytes being even after increased number of passages in culture. Also, this cellular line forms lamellar and polarized epithelium with keratinized layer (stratum corneum) consisting of ortho-keratinocytes in the process for culturing in organotypical culture in serum-free medium and without layer of feeding cells.

EFFECT: improved immortalizing method, valuable biological properties of cellular line.

7 cl, 2 dwg, 4 ex

The invention relates to biotechnology and Cryobiology

The invention relates to medicine, namely to cell therapy, and for the culture of cells containing precursor cells osteogenesis of the implant based on it and use it to restore the integrity of the bone

FIELD: biotechnology, genetic engineering, molecular biology.

SUBSTANCE: invention proposes recombinant DNA pcDNA-TCI that has molecular mass 4.3 x 103 kDa and size 6 657 nucleotide pairs. The proposed recombinant plasmid DNA provides expression of artificial gene TCI comprising cytotoxic T-cellular epitopes of HIV-1 in eucaryotic cells. Also, invention proposes recombinant attenuated strain of bacterium Salmonella enteritidis E-23 pcDNA-TCI. The proposed strain is obtained by genetic transformation of the strain Salmonella enteritidis E-23 with plasmid pcDNA-TCI. The strain provides delivery DNA-vaccine in eucaryotic cells as the recombinant plasmid DNA pcDNA-TCI. Proposed groups of inventions provide inducing the expressed specific humoral and cellular immune response to HIV-1 in body. Proposed group of inventions can be used in medicine and virology for construction of live DNA-vaccine against HIV-1.

EFFECT: valuable biological and medicinal properties of strain and vaccine.

2 cl, 3 dwg, 3 tbl, 5 ex

FIELD: genetic engineering, biotechnology, molecular biology, medical-biological and pharmaceutical industry.

SUBSTANCE: invention relates to isolating gene from cells of the strain P. altcromonas producing enzyme that cleaves polysaccharide comprising sulfated fucose and this gene encodes above indicated enzyme, Invention proved the presence of two opened reading frames (ORF-1 and ORF-2) and their nucleotide sequences are determined. Active recombinant forms of enzyme able to hydrolyze sulfated fucose-comprising polysaccharide are obtained by expression of these sequences in E. coli being this polysaccharide is not cleaved by fucoidanase produced by Flavobacterium sp. SA-0082 (FERM BP-5402). Applying the invention provides the possibility for preparing large amounts of qualitative raw for pharmaceutical preparations.

EFFECT: improved preparing method, valuable properties of polypeptide.

5 cl, 5 dwg, 2 tbl, 7 ex

Thrombopoietin // 2245365

FIELD: medicine, molecular biology, polypeptides.

SUBSTANCE: invention describes homogenous polypeptide ligand mpI representing polypeptide fragment of the formula: X-hTPO-Y wherein hTPO has amino acid sequence of human fragments TPO (hML); X means a amino-terminal amino-group or amino acid(s) residue(s); Y means carboxy-terminal carboxy-group or amino acid(s) residue(s), or chimeric polypeptide, or polypeptide fragment comprising N-terminal residues of amino acid sequence hML. Also, invention relates to nucleic acid encoding polypeptide and expressing vector comprising nucleic acid. Invention describes methods for preparing the polypeptide using cell-host transformed with vector, and antibodies raised against to polypeptide. Invention describes methods and agents using active agents of this invention. The polypeptide ligand mpI effects on replication, differentiation or maturation of blood cells being especially on megacaryocytes and progenitor megacaryocyte cells that allows using polypeptides for treatment of thrombocytopenia.

EFFECT: valuable medicinal properties of polypeptide.

21 cl, 92 dwg, 14 tbl, 24 ex

The invention relates to the field of biotechnology and medicine, in particular to genetic engineering and immunology

The invention relates to genetic engineering and can be used for therapeutic purposes, in particular in the treatment of neoplastic processes

The invention relates to the field of biotechnology and medicine, in particular to genetic engineering and immunology

FIELD: medicine.

SUBSTANCE: a patient with systemic lupus erythematosus (SLE) should be prescribed to apply efficient quantity of pharmaceutically active form of dehydroepiandrosterone (DHEA) and then, after prescription it is necessary to detect the values for disease activity and total symptoms of the process that characterizes SLE-patient's state, such as: index of SLE activity (IASLE), degree of SLE activity (DSLE), patient's visual analog scale (VAS) and coefficient of Krupp's severity degree (CSDK) to determine the difference between these above-mentioned values obtained before treatment and those taken during therapy, moreover, the decrease of three out of these four values or either the decrease of stabilization or the increase being not higher than by 5% in the fourth value shows that patients reacts to the intake of DHEA.

EFFECT: higher efficiency of therapy.

13 cl, 1 dwg, 8 tbl

Up!