New growth/differentiation factor of tgf-β-family and pharmaceutical composition

FIELD: medicine, pharmacology, pharmacy.

SUBSTANCE: invention relates to a new growth/differentiation factor of TGF-β-family representing the amino acid sequence SEQ ID NO.2 or, if necessary, its functionally active moieties and to pharmaceutical composition based on thereof that can be used for inducing angiogenesis. Invention provides the enhancement of biological activity of preparation.

EFFECT: valuable biological properties of factor.

4 cl, 3 tbl, 4 dwg, 3 ex

 

The present invention relates to a new factor in the growth/differentiation TGF-βfamily and to pharmaceutical compositions based on it.

TGF-β-family of growth factors, which are related BMP, TGF and inhibin proteins (Roberts and Spon, Handbook of Experimental Pharmacology,(1990), 419-472), especially suitable for medical treatments and applications. These factors are suitable for wound healing and tissue regeneration. Further, some members of the TGF-β-family induce tissue growth and therefore play a Central role in inducing the development of cartilage and bone.

Wozney (Progress in Growth Fact or Research,, (1989), 267-280 and Vale and others (Handbook of Experimental Pharmacology,(1990), 211-248)) describe the different growth factors, such as, for example, which are the sister group of BMP (bone morphogenetic proteins) and group inhibin. Representatives of these groups have significant structural similarity. The precursor protein consists of an amino-terminal signal sequence, propeptide - and carboxy-terminal sequence of about 110 amino acids, which is cleaved from its predecessor and represents the Mature protein. Further, its members are determined by the homology of amino acid sequences. The Mature protein contains vysokomerna the positive sequence, in particular, seven cysteine residues, which are conserved in members of the family. TGF-β-shaped proteins are multi-functional, hormonal active growth factors. They also have related biological activities, such as chemotactic attraction of cells, promoting cell differentiation and inducing activity against tissue, such as cartilage and bone. Many types of cells are able to synthesize TGF-β-shaped proteins, and almost all cells contain TGF-β-receptors.

In General, these proteins differ in their structure, which leads to significant variations in their precise biological function. Further, they are in a wide range of different types of tissues and stages of development. Therefore, they may have differences in terms of their precise functions, such as the required cellular physiological environment, their life expectancy, their location, their needs in the supporting factors and their resistance to degradation. Describes numerous proteins that have inductive capacity of the tissues, their natural functions in the body and, more importantly, their medical applicability still need to investigate. With high probability it is assumed the existence of yet unknown members of the TGF-β-collection, which is must for osteogenesis or for differentiation/induction of other types of fabrics. One of the biggest challenges in the allocation of these new TGF-β-shaped proteins is that their functions are still not accurately can be described for the development of biological analysis in order to recognize them. On the other hand, the expected homology of nucleotide sequences to known family members is too small to make possible screening using classical methods of hybridization of nucleic acids. However, further isolation and characterization of new TGF-β-shaped proteins necessary to get other proteins differentiation and induction, which satisfy all the desirable medical requirements. These factors can be used in medicine for treatment (healing) injuries and in the treatment of degenerative bone disease and/or other types of tissues, such as kidney or liver.

In the patent application PCT/EP 93/00350 specified nucleotide and amino acid sequence for TGF-βprotein MP-52, and mentioned the Mature peptide sequence and a large portion corresponding to propeptide MP-52 sequence. The full sequence of propeptide MP-52 not disclosed.

The present invention is the protein TGF-β-collection containing the specified amino acid sequence SEQ ID NO.2, or if not what bademosi its functionally active portion and having biological properties, such as inductive in angiogenesis and in relation to tissue, particularly osteoinductive and/or mitogenic activity, which may be suitable for therapeutic applications. The above characteristics of the protein can vary depending on the education of homodimers or heterodimers. Such structures may also be suitable for clinical applications, particularly when the evidence of angiogenesis, both inducing and/or enhancing the formation of blood vessels.

Biological properties proposed according to the invention proteins, particularly mitogenic and osteoinductive potential, it is possible to determine, for example, by testing according Seyedin and others, PNAS,(1985), 2267-2271; or (Sampath and Reddi, PNAS,(1981), 7599-7603.

Proposed according to the invention the protein TGF-βfamily is encoded by a DNA sequence, including

(a) a portion encoding a Mature protein and, if necessary, other functional parts of the specified nucleotide sequence of SEQ ID NO.1;

(b) the nucleotide sequence corresponding to the sequence of p. (a) due to the degeneracy of the genetic code;

(b) allelic derived nucleotide sequences corresponding to the sequences of PP.(a) and (b);

or

(g) placentas is required, hybridizers with one of the sequences (a), (b) or (C);

provided that the DNA molecule according to p. (g) encodes at least all of the Mature protein TGF-βfamily. The following information briefly describes the protocols sequences, and drawings.

In SEQ ID NO.1 (see end of description) complete nucleotide sequence of the DNA encoding TGF-βprotein MP-52. ATG - start codon begins with nucleotide 640. The start of the Mature protein begins after nucleotide 1782.

In SEQ ID NO.2 (see end of description) complete amino acid sequence of TGF-βprotein MP-52, which is made from a specified nucleotide sequence of SEQ ID NO.1.

Figure 1 presents a comparison of the amino acid sequence of MP-52 with some members of the family GIR-protein beginning at the first of the seven surviving cysteine residues. The sign* indicates that the amino acid is the same in all the compared proteins; the + sign indicates that the amino acid matches at least one of the proteins compared to the MP-52.

Figure 2 presents the nucleotide sequence of oligonucleotide primers used in the present invention, and the comparison of these sequences with known members of the TGF-βfamily. M represents a or C; S is C or G; And R stands for the algebra G; and K denotes G or T. "2A" refers to a sequence of primer OD; "2b" refers to a sequence of primer OID.

Figure 3 presents a Western blot showing that only in the case of recombinant viruses, but not in the case of viruses, wild-type (without integrated foreign DNA), have specific Mr-52 band. M denotes pre-painted marker on the molecular mass of the protein with these seemingly molecular masses (Gibco BRL # 26041-020), 1 denotes the supernatant of cell culture (100 ál) after infection with recombinant viruses (with inserted MR-cDNA) under reducing (1% β-mercaptoethanol) conditions, 2 denotes the supernatant of cell culture (100 ál) after infection with wild-type viruses (without inserted foreign DNA) under reducing (1% β-mercaptoethanol) conditions, 3 denotes the supernatant of cell culture (500 μl) after infection with recombinant viruses (with inserted MR-cDNA) in non conditions, 4 denotes the supernatant of cell culture (500 μl) after infection with wild-type viruses (without inserted foreign DNA) when non conditions.

4 shows plasmid pABWN.

The concept of "functional part" of the present invention refers to the part p is of otein, which is able to act as part of the signal peptide, propeptide, or the Mature protein, i.e., to perform at least one of the biological functions of the natural parts of the protein MP-52.

The region encoding the Mature part of the protein extends from nucleotide 1783 to 2142 specified in SEQ ID NO.1 in the sequence. If necessary, the DNA molecule may contain a functional part of the specified SEQ ID NO.1 in the sequence, namely the encoding of the signal and/or propeptide a part of the nucleotide sequence. Particularly preferably, the DNA molecule contains a sequence signal and propeptide part and part of the Mature protein, i.e. nucleotides 640-2142 specified in SEQ ID NO.1 in the sequence. On the other hand, the DNA molecule, along with the part that encodes a Mature protein may also contain another functional signal and/or propeptide of other proteins, particularly other proteins of TGF-β-collection.

The DNA molecule may optionally contain between nucleotides 1270 and 1271 specified in SEQ ID NO.1 in the sequence of non-coding intraperitoneally. This intron sequence contained in the deposited plasmid DSM SKL 52 (N-3) MN 12, which has a genomic sequence of nucleic acids MP-52.

The sequence of MP-52, a protein encoded by phage #x003BB; 15.1 cDNA begins with nucleotide specified 321 SEQ ID NO.1 in the sequence.

Although allelic, degenerate and hybridizers sequences have structural differences due to minor changes in the nucleotide and/or amino acid sequences, proteins encoded such sequences have essentially the same useful properties, which makes possible their use for such appointments in medicine.

According to the present invention, the designation of "hybridization" represents a conventional hybridization conditions, preferably conditions with a salt concentration of 5×SSC at 62-66°with further carried out for 1 hour and washing with 0,6×SSC, 0,1% SDS, at 62-66°C. Particularly preferably, the designation of "hybridization" refers to the stringent hybridization conditions with a salt concentration of 4×SSC at 62-66°with further carried out for 1 hour and washing with 0,1×SSC, 0,1% SDS, at 62-66°C.

DNA sequences mentioned above, receive from vertebrates, preferably mammals, such as pigs, cows, and rodents, such as rats or mice, and particularly primates, such as humans.

Especially preferred is specified in SEQ ID NO.1 and denoted as MP-52 sequence. Transcripts MP-52 get from AMB the optional fabric and encode a protein, which shows significant homology of amino acids relative to the Mature part of the GIR-shaped proteins (see figure 1). Protein sequence BMP2 (=BMP-2A and BMP 4 (=BMP 2B) described Wozney and others, Sience,(1988), 1528-1534. The corresponding sequences BMP 5, BMP 6, BMP 7 describes Celeste and others, Proc.Natl.Acad.Sci. USA, 87, (1990), 9843-9847.

Another object of the present invention is a pharmaceutical composition that contains a pharmaceutically effective amount proposed according to the invention TGF-β-protein as biologically active substances. If necessary, the composition includes a pharmaceutically acceptable carrier, excipient, diluent or filler. Such pharmaceutical composition can be used when evidence of angiogenesis to improve and/or induce the formation of blood vessels, either individually or in combination with other biologically active substances, for example with other proteins of TGF-βfamily or growth factors such as EGF (epidermal growth factor) or PDGF (derived from platelet growth factor). In addition, such a pharmaceutical composition can be used for prevention of diseases associated with angiogenesis. Proposed according to the invention the pharmaceutical composition monotachi be used for prophylaxis or cosmetic surgery. Furthermore, application of the composition is not limited to people, and it can be applied also in the case of animals, especially domestic animals.

Further, the invention is illustrated in the following examples.

EXAMPLE 1

The allocation of MP-52

1.1. Total RNA extracted from human embryonic tissue (aged 8-9 weeks) by the method of Chirgwin and others, Biochemistry,and(1979), 5294-5299. Poly(A+)-RNA was separated from total RNA by oligo(dT)chromatography according to the manufacturer's instructions (Stratagene Poly (A) Quick-columns).

1.2. For the reverse transcription reaction 1-2,5 μg poly (A+)-RNA for 5 minutes, heated at 65°C and quickly cooled with ice. The reaction mixture contains 27 units PHK-Guarol (Pharmacia), 2.5 µg oligo(dT)12-18 (Pharmacia) buffer (250 mmol/l TRIS/Hcl, pH=8,5; 50 mmol/l MgCl2; 50 mmol/l DTT (dithiothreitol); 5 mmol/l any dNTP (deoxynucleotide); 600 mmol/l KCl) and 20 units AM reverse transcriptase (Boehringer Mannheim) at 1 µg of poly(A+)-RNA. The reaction mixture (25 µl) was incubated for 2 hours at 42°C.

1.3. Indicated in figure 2 deoxynucleotide primers OD and OID get on an automatic DNA synthesizer (Biosearch). Purification is carried out by denaturing electrophoresis on polyacrylamide gel and highlight the major bands from the gel by isotachophoresis. By comparing the sequences of nucleic acids of known members of the TGFβ -collection and selection of areas with high conservation design oligonucleotides. The comparison of these regions is shown in figure 2. To facilitate cloning both nucleotides containing restriction sites EcoRI and OD contains an additional restriction site NcoI at its 5’-end.

1.4. In the case of polymerase chain reaction (PCR reaction) using 20 ng of the corresponding poly(A+)-RNA cDNA from the source material. The reaction is carried out in a volume of 50 ál, and it contains 1xPCR buffer (of 16.6 mmol/l (NH4)2SO4; 67 mmol/l TRIS/Hcl, pH 8,8; 2 mmol/l MgCl2; 6.7 mmol/l EDD, 10 mmol/l β-mercapto-ethanol; 170 µg/ml albumin bovine serum (Gibco); 200 µmol/l of any dNTP (Pharmacia); 30 mcmol each of the oligonucleotide (OD and OID) and 1.5 units of Taq polymerase (Ampli Taq, Perkin Elmer Cetus). The reaction mixture was covered with paraffin and perform 40 cycles of polymerase chain reaction. The products of polymerase chain (PCR)reaction purified by extraction with phenol and chloroform and concentrated by ethanol precipitation.

1.5. The product of polymerase chain reaction were cleaved with restriction enzymes SphI (Pharmacia) and AIWNI (Biolabs) accordingly to the manufacturer's instructions.

1.6. The products of restriction cleavage fractionary by electrophoresis on agarose gel. After staining with ethidiumbromid unsplit etc the products of the amplification are cut out from the gel and was isolated by extraction with phenol. The resulting DNA is then purified by a double extraction with phenol and chloroform.

1.7. After precipitation with ethanol one-fourth or one-fifth of the selected DNA reamplification, and use the same conditions as for the primary amplification, except that the number of cycles is reduced to 13. Products reamplification (re-amplification) purified, cut with the same enzymes, as mentioned above, and uncut products, as explained above for the amplification products, extracted from agarose gels. Stage reamplification (re-amplification) is repeated twice.

1.8. After the last discharge from the gel amplification products digested with 4 units of EcoRI (Pharmacia) at the manufacturer's recommended conditions. One-fourth of the mixture after the restrictions are ligated with the cleaved with EcoRI vector pBluescript II SK+(Stratagene). After ligating 24 clone analyze further by sequencing. Split with ALWNI and SphI sample gives a new sequence, which is denoted as MP-52. Other clones contain the prevailing BMP 6-sequences and one clone contains BMP 7-sequence.

Clone the 3’-end complementary to cDNA according to the described Frohmann method (amplification, published by Perkin-Elmer Corp., Issue 5 (1990), S.11-15). The same embryonic mRNA, which was used for ejecta is the first fragment of a MP-52, subjected to reverse transcription as described above. Amplification is carried out with the use of adapter primer (AGAATTCGCATGCCATGGTCGACG) and an internal primer (CTTGAGTACGAGGCTTTCCACTG) MP-52 sequence. Amplification products reamplification (re-amplified) when using overlapping adapter primer (ATTCGCATGCCATGGTCGACGAAG) and overlying the inner primer (GGAGCCCACGAATCATGCAGTCA) MP-52 sequence. Products reamplification, after restriction cleavage with NcoI, clone split in the same way the vector [Fig 19 (Pharmacia No. 27-4951-01) with one modified composite (multiplen) plot clone, which contains a single restriction site NcoI], and is sequenced. Clones characterized by lap joints, their sequence with the 3’-end of the known MP-52 sequence. One of them is used as a probe for screening a human genomic gene Bank (Stratagene No. 946203) as described in detail Ausubel and other method (Current Protocols in Molecular Biology, published by Greene Publishing Associates and Wiley-Intersience /1989/). 8·105λ-phages isolated phage (λ 2.7.4), which contains an insert of approximately 20 KB and deposited at the DSM under the number 7387. This clone, along with mRNA isolated from by the described methods of amplification sequence, contains other carrying the information sequence (Sequenzinformationen) n the 5’-end.

For analysis by sequencing HindIII-a fragment length of approximately 7.5 KB subcloning cut in the same way the vector (Bluescript SK, Stratagene No. 212206). This is denoted as SKL 52 (N 3) Mr 12, the plasmid is also stored in the DSM under the number 7353. Presented in SEQ ID NO.1 bearing information sequence is derived from phage λ 2.7.4. ATG at position 640 represents the first ATG in frame read (in position 403 receive the stop codon). On the basis of a specified sequence, you should assume that we are talking about the start codon for translation.

Genomic DNA contains introns with a length of approximately 2 KB between base pairs 1270 and 1271 SEQ ID NO.1. The sequence of the intron is not shown. The correct location of the splicing confirmed by sequencing of the amplification product, which is derived from the cDNA containing this region. These carry information sequence obtained using a slightly modified method, which is described Frohman (amplification, published by Perkin-Elmer-Corporation, Issue 5, (1990), S.11-15). The same embryonic RNA, which was used to isolate the 3’-end of MP-52, is subjected to reverse transcription with the use of internal, oriented in the 5’direction, primer MP-52 sequence (ACAGCAGGTGGGTGGTCTGGACT). Poly-a-end (tail) attached to the 5’-end of the first cDNA strands when applying the limit is th transferase. Carry out two-stage amplification, first by applying consisting of oligo-dT and the adapter sequence of the primer (AGAATTCGCATGCCATGGTCGACGAAGC) T16 and, secondly, when using the adapter primer (AGAATTCGCATGCCATGGTCGACG) and an internal primer (CCAGCAGCCCAT) Mr-52 - consistently. Amplification products reamplification (re-amplified) when using the same adapter primer and blocking (connecting overlapping internal primers (TCCAGGGCACTAATGTCAAACACG) MP-52 sequence. Then the products reamplification re-amplified with the use of overlapping adapter primer (ATTCGCATGCCATGGTCGACGAAG) and overlying the inner primer (ACTAATGTCAAACACGTACCTCTG) Mr-52-consistently. Products re-amplification using the smooth ends of the clone in the vector (Bluescript SK, Stratagene No. 212206), which is cleaved with EcoRV. Clones characterized by their overlapping sequences using DNA phage λ 2.7.4.

Next, cDNA Bank, derived from the RNA of human fibroblasts and cloned in the phage λ gt 10, is subjected to screening. At the same time explore 2×106 phages, and as a radioactive probe is approximately 1 KB fragment of genomic Mr-52-DNA (2nd exon until the restriction site Hind III in Naturhotel broadcast 3’-region). Allocate 17 spots (zones of hemolysis) of the mixture, which will complement the flax examined using PCR with use of primers from the 5’-3’-region of the MP-52 sequence. After that choose and sever 8 sterelny spots, cDNA isolated from the phage by partial cleavage with EcoRI and clone also cleaved with EcoRI Bluescript-vector.

Sequencing of one of the resulting plasmids SK 52 L 15. IMP25 shows that the longest phage (15.1) starts at nucleotide No. 321 TO SEQ ID NO.1. Further, by sequencing confirmed the place of splicing (nucleotide 1270).

Plasmid SKL 52 (N 3) Mr 12 is stored under the number 7353 in the DSM (German collection of microorganisms and cell cultures, Mascheroder Weg Ib, 38124, Brounschweig) on December 10, 1992

Phage λ 2.7.4 is stored under the number 7387 in the DSM as of January 13, 1993

Plasmid SK52L15. IMP25 stored under room 8421 in DSM July 16, 1993

EXAMPLE 2

The expression of MP-52

For the expression of MP-52 have different systems. The use of viruses ospowiki as expression systems in detail and as guidance for professionals described in Current Protocols in Molecular Biology (Ausubel and others, Greene Publishing Associates and Wilay-Interscience, Wiley and Sans), hereinafter referred to as CF, Chapter 16, part 16.15-16.18. The system is based on the fact that the foreign DNA in the application of certain vectors by homologous recombination can be integrated into the genome of vaccinia virus. For this purpose used a vector containing the TK (thymidine kinase) gene from the genome ospowiki. In order to make possible the selection of the wearing of recombinant viruses the vector further contains E. coli - xanthine-guanine-phosphoribosyl-transferase gene (gpt)/Falkner and others, J.Virol 62 (1988), 1849-1854/. In this vector cDNA clone with the entire coding region of the MP-52. cDNA derived from plasmids SK52L15. IMP25 (DSM, room 8421), which is to remove a large part not subjected broadcast 5’-region, however, is first subjected to deletions and intermediate clone. This plasmid SK52L15. IMP25 linearizer using SaLI and the 5’-end sequentially subjected to deletions using a set of Exo III/Mung Bean (Stratagene # 200 330) according to the manufacturer's instructions. After restriction with BamHI to varying degrees affected by deletions Mr-52-cDNA on agarosegel is separated from the residual vector, isolated and according to standard methods (Sambrook and other, Molecular Cloning, 2nd edition, Cold Spring Harbor Laboratory Press, 1989) intermediate clone subjected to restriction with EcoRV and BamHI pBluescript II SK-vector (Stratagene # 212206/p.SK52S/. All restriction is carried out according to the manufacturer's instructions. Additional sequencing using sequenase (USB/Amersham #70770) provides, among other things, the clone, which begins with nucleotide 576 in SEQ ID NO.1 (64 base pairs are deleted from the start codon). From it by restriction with SalI and SacI isolate cDNA insert and clone in the same way the split vector for recombination in opulencia. The resulting plasmid (pBPIMP52S) stored in the DSM (number 9217) the may 24, 1994 and used to produce recombinant viruses ospowiki. For this purpose, up to 80% confluent 14 3B cells (HuTk, ATCC CRL 8303) in the cups for crops with a diameter of 35 mm infect with vaccinia virus wild type in 2 ml of PBS (phosphate buffer solution for 30 minutes at room temperature with shaking on the occasion of (1 virus on 10 cells). After aspiration of the supernatant liquid and the additive 2 ml of culture medium (MEM, Gibco BRL #041-01095) incubated for 2 hours at 37°C. the Medium is then removed, and the transformation of these cells reach using 100 ng pBPIMP52S, 2 μg of carrier DNA (calf thymus, Boehringer Mannheim # 104175) and 10 μl lipofectin (Gibco BRL # 18292-011) in 1 ml MEM for 15 hours at 37°C. After the addition of 1 ml of MEM with 20% FCS (Gibco BRL # 011-06290) incubated over the next 24 hours at 37°and lysed cells are then frozen.

gpt-selection for xanthine-guanine-phosphoribosyl-transferase and isolation and amplification of individual recombinant viruses carried out essentially as described in part 16.17 CF, with the difference that the use of RK-13 cells (ATCC CCL 37).

The integration of the MP-52-cDNA in the viral genome is confirmed by the analysis using the blotting method for Southern and dot-blot (CF, part 16.18). The recombinant virus used for gene-expression analysis in cell line 143 In (HuTk, ATCC CRL 8303). Confluent cells to inficere the t using the appropriate number of cells number of viruses for 45 minutes at 37° And then add the appropriate culture medium (MEM, Gibco BRL # 041-01095) with 10% FCS and penicillin/streptomycin (1:500, Gibco BRL # 043-0514 IT). After 6 hours at 37°remove the medium, the cells are washed twice with, for example, HBSS (Gibco BRL #042-0418 Ω) and add nutrient medium (e.g., MEM) without FCS. After producing for 20-22 hours collecting the supernatant of the cell culture. Analysis of the expression is carried out by Western blotting according to standard methods (CF, part 10.8). For this purpose, the proteins precipitated from 100-500 µl of the supernatant of the cell culture by adding an equivalent volume of acetone and incubation for at least for 1 hour on ice and separated by centrifugation. After re-suspension of sediment in the specified buffer (7 M urea, 1% SDS, 7 mmol of sodium dihydrophosphate, of 0.01% bromophenol blue and, if necessary, 1% β-mercaptoethanol) carry out the separation on a 15%polyacrylamide gel. As marker proteins using pre-painted standard molecular weight protein (Gibco BRL # 26041-020). Transfer to PVDF-membrane (Immobilon # IPVHOOO10) and blocking of the membrane is carried out by standard methods.

For the detection of MP-52 on the membrane get polyclonal antibodies against Mr-52 as in the case of chickens, and also in the case of rabbits. For this more Mature part of the MP-52 with 6 histidine the N-end Express in E.coli and purified, as described for example Hochuli and other (10/Technology,, 1321-1325, 1988/). Using both antibodies can specifically detect expression of MP-52, and dimeric MP-52 less efficiently detected than Monomeric. For Western blotting, according to figure 3, the use of chicken antibodies that specifically purified by PEG-precipitation /Thalley and others, 10/Technology,, 934-938 (1990)/ and through associated with membrane antigen (Mature MP-52 with 6 histidine) (18, 17; Sambrook and other, Molecular Cloning, 2nd edition, Cold Spring Harbor Laboratory Press, 1989). As the second antibodies used antiquary with IgG attached to alkaline phosphatase (Sigma A 9171). Detection is performed using the kit for determination of protein Tropix Western-Light (Serva # WL 10 RC)according to the manufacturer's instructions.

Western blotting figure 3 shows that only in the case of recombinant viruses, but not in the case of viruses, wild-type (without integrated foreign DNA), have specific Mr-52 band. The expression of MP-52 leads to the secreted protein expressed in the gel under non conditions molecular weight of approximately 25 kDa. Under reducing conditions, the protein of 14-15 kDa penetrates into the gel. These results show that the Mr-52 exprimarea as dimeric Mature protein. In case you receive when Western-blot-analysis the e weak bands in the region above 60 kDa talking, probably about the remains uncut protein precursor. Behaviour penetration besides confirms derived from SEQ ID NO.2 theoretical molecular weight, consistent with Mature than Monomeric Mr-52 has a value of 13.6 kDa.

The expression of MP-52 and cleavage of the protein precursor to Mature MP-52 can be detected in various cell lines. Experienced cell With 127 (ATSS CRL 1616, mouse), KSS 21 (ATSS CCL 10, hamster), MRC-5 (ATSS CCL 171) and T Swiss albino (ATSS CCL 96, mouse).

Expression and cleavage to Mature MP-52 is also shown in the other the eukaryotic expression system. This cDNA Mr-52 (beginning with nucleotide 576) clone in the expression plasmids pSG5 (Stratagene # 216201). Plasmid pSK52S subjected to restriction analysis using SIA and I ba I, and by treatment with T4 polymerase doing stupid protruding ends of the MP-5 2-insert. Cloning subjected to restriction and also with blunt ends by treatment with T4 polymerase vector pSG5 carried out by standard methods. All enzymatic reactions are carried out according to the manufacturer's instructions. The correct orientation of the Mr-52-inserts provide due to restriction analysis and additional sequencing using T7-primer (Stratagene # 300 302). The resulting plasmid pSG52S (stored with 17.05.1994, under the number DSM 9204) can be cotransformation using vector that code is any selectable marker, such as G418 resistance gene, to obtain stable cell lines. For this purpose pSG52S cotransformation together with plasmid R (stored in the DSM under the number 9203 with 17.05.1994 g) in L 929 cells (ATSC CCL, I, mouse) using lipofectin (Gibco BRL # 18292-011)according to the manufacturer's instructions. Selection with G418 carried out according to well-known specialist methods (CF, part 9.5) and come to the line of cells that Western-blotting produces detectable Mature MP-52.

Another expression vector for Mr-52 get when using plasmids pABWN (Niwa and others, Gene, 108, (1991), 193-200; and 4)that is made available Dr.Miyazaki.

This Hind III fragment of plasmid pSK52S that begins with nucleotide 576 in SEQ ID NO.1, isolated and protruding ends dull by processing using fragment maple. By ligating the adapter at both ends of the fragment impose a restriction site Not I. Adapter: AGCGGCCGCT

TCGCCGGCGA

Vector pABWN subjected to restriction analysis using Xho I also handle fragment maple and dephosphorylated with intestinal alkaline phosphatase calf (Boehringer Mannheim). This phosphorylated adaptor are ligated additionally so that it is now possible to insert Mr-52-fragment after restriction with Not I generated the Not I site of the cut vector. The resulting expression vector indicated below as a Hind III-MP-52/pABWN. All implementation through the haunted reaction cloning performed by standard methods (for example, CF, part 3.16). The structure of the Hind III-Mr-52/pABWN-vector expression confirmed by sequencing and obtain a card restriction. Hind III-MP-52/pABWN contains the MP-52 sequence starting from the nucleotide 576 and ending with the nucleotide 2278 in SEQ ID NO.1.

Hind III-MP-52/pABWN transferout in L cells (mouse fibroblasts) and from there get a stable transformants. To do this, depending on the circumstances, 4 μg plasmid (Hind III-MP-52/pABWN or pABWN) transferout 5×105L-cells present in the cups for crops with a diameter of 6 cm, when using 20 ál of reagent Lipofect AMINE (Gibco BRL # 18324-012). For this purpose, a solution (4 μg of the appropriate plasmid DNA in 200 µl OPTI-MEM I/Gibco BRL # 31985/) gently mixed with solution B (20 µl reagent Lipofect AMINE in 200 μl OPTI-MEM I) and at room temperature for 45 minutes and incubated for formation of complex DNA-liposomes. During this procedure, the cells are washed once with 2 ml of OPTI-MEM I. For each transfection in a vessel with DNA-liposomal complex is injected 1.6 ml of OPTI-MEM I. the Solution is gently mixed and thus pereslaivayut washed cells. Cells incubated with the diluted complex for 5 hours at 37°in CO2-containing incubator. After incubation, add 2 ml of DMEM (Gibco BRL, modified Dulbecco Eagle-Wednesday) with 20% FCS. 24 hours after transfection the medium replaced with fresh DMEM with 10% FCS. After 48 hours of th the start of transfection, the cells are transferred into cups for crops with a diameter of 10 cm After 72 hours after the start of transfection with a concentration of 800 μg/ml starts G418 selection. Stable clones appear after 1-2 weeks.

5 ml air-conditioned DMEM with or without FCS receive from confluent of transformants, which were grown for 3 days in a Cup for a culture with a diameter of 10 cm Transfetsirovannyh two different supernatant fluids of cell cultures (Hind III-MP52/pABWN and pABWN) cells, and lysates of cells examined by Western blotting. This air-conditioned environment, as well as in the lysates of transfected using Hind III-MP52/pABWN cells found in Mature MP-52. The clones clone and then producing the MP-52 cells, depending on the circumstances, choose according to the Western blotting analysis. Evaluation of Western blot analyses show Mr-52-producing up to 1 mg/L.

EXAMPLE 3

The biological activity of MP-52

To detect the biological activity of the MP-52 and to prove the usefulness of the present invention for applications in medicine for the prevention and/or treatment of bone diseases, carry out various experiments in vitro and in vivo.

1. Test in vitro

1.1.

As increased synthesis of glycosaminoglycans and collagen (GAG) in chondrocytes after TGF-β-stimulation described (Hiraki and others, Biochimica et Biophysica Acta,(1988), 91-99), investigate, is also the MP-52 this effect. When application of the supernatant fluids of cell cultures (DMEM with 10% FCS, producing Mr 52 transformed L-cells (transfection using Hind III-MP52/pABWN), study chondrogen activity of MP-52 in primary cultures of embryonic limb of rats.

For this purpose use 4 limbs rat fetuses at the age of 16 days. After triplinerve derived cells in F-12 medium (nutrient mixture Ham's F-12, Gibco BRL # 21700) with 10% FCS was placed on the coated collagen type 1 plate with recesses 24 in the amount of 3×105cells and cultured for about 2 days until confluence. To 500 ál of culture medium (F-12 medium with 10% FCS), depending on the circumstances, add 56 μl of conditioned medium (KM) transfectants due to Hind III-MP 52/pABWN L-cells, transfectants due pABWN-L-cells or only medium (DMEM with 10% FCS). In a time interval 0, 3, 6 and 9 days, apply F-12-medium with 10% FCS, and appropriate additives. All three days are change of environment, with appropriate additives. Then the following 2 days of culture were cultured in F-12 medium without FCS in the presence of appropriate additives (air-conditioned environment, respectively, control environment) and then add35S-sulfate for 6 hours. Incorporated into polysaccharides35S determine after pronase-E-digestion and precipitation, as described Hiraki and others (Biochimica et Biophisica Acta,, (1988), 91-99).

Table 1
 Radioactivity (cpm/dredging)
The number of stagesDMEM (10% FCS) control L-cellsKM of transfectants L-cells by pABWNKM of transfectants L-cells by Hind III-MP 52/pABWN
23720±1143865±1204879±422
54188±1354154±298223±275*
83546±1603310±1159890±1260*
113679±2183633±1677520±160*
Value refers to ±S.E.M. for 3 or 4 cultural mixtures.

*) p<0,01 vs DMEM and MILES of transfectants L-cells, obtained using pABWN (multiple t-test, Scheffe).

As can be seen from table 1, supernatant of cell cultures, producing Mr 52 transfectants significantly stimulate the synthesis of GAG compared to a net nutrient medium (DMEM with 10% FCS) or the supernatant liquid of the culture, L-cells, transfitsirovannykh using pABWN. This shows that Mr-52 can stimulate the differentiation of chondrocytes.

1.2.

The effect described by some members of the BMP family is an increased activity of alkaline phosphatase (ALP activity in osteoblasts. Clone the global cell line of rat ROB-C 26 (C-26) is referred to osteoblasts relatively early stage of maturation (Yamaguchi and others, Calcif. Tissue Int. 49 (1991), 221-225).

For osteoinductive proteins, such as BMP-2, describes the ability to enhance ALP activity: Yamaguchi and others, J.Cell. Biol. 113 (1991), 681-687.

The influence of Mr 52 s cells are examined as follows. With 26 cells in the amount of 3×104cells to deepen plated on plate with 24 holes and cultured in medium α-MEM (Gibco BRL) with 10% FCS until confluency. To deepen add 56 μl of the supernatant of the culture producing Mr 52 transfectants L-cells (Hind III-MP52/pABWN), respectively, the supernatant of transfectants L-cells, obtained using pABWN, or only the supernatant of the culture (DMEM with 10% FCS) and L-cells to 500 ál of medium cell culture C-26. Replace medium with appropriate supplements carry out all three days. ALP activity in extracts of cells determined after 0, 3, 6, 9 and 12 days using standard methods based on p-nitrophenylphosphate as a substrate, as for example described Takuwa and others (Am.J.Physiol., 257 /1989/, E-E).

Table 2
 ALP activity (nmol/min) to deepen
The number of stages of incubationDMEM (10% FCS) control L-cellsKM of transfectants L-cells by pABWNKM of transfectants L-cells for Hind III-MP-52/pABWN
041,8±2,841,8±2,841,8±2,8
3136,3±3,7for 125.8±2,3181,3±14,2*
6129,0±7,8119,3±6,4258,0±8,3*
9118,4±3,7110,1±2,8258,4±10,6*
12121,2±3,2to 125.3±6,0237,8±11,0*
The values are±S.D. for 4 cultural mixtures.

* p<0,01 vs DMEM and MILES of transfectants L-cells derived from pABWN (multiple t-test, Scheffe).

As follows from table 2, ALP activity significantly enhanced by additives Mr 52 compared with pure DMEM with 10% FCS and environment infected with pABWN L-cells.

This result shows that Mr 52 can contribute not only to the differentiation of chondrocytes, but also differentiation and maturation of osteoblasts.

Another line of cells of the osteoblast (MC3T3-EI, mouse), which, as described Takuwa and others (Biochem. Hiophys. Res. Com.,(1991), 96-101), by treatment with BMP-2 shows the increase in ALP activity, after incubation with conditioned medium producing Mr 52-L transfectants cells (Hind III-MP52/pABWN) or with the environment after producing Mr 52 due to infection with recombinant viruses ospowiki not show the characteristic no changes in ALP activity. This indicates that Mr 52 has partly specificity cells deviating from BMP-2. Various functions due to different target areas of individual members of the TGF-βfamily, can be of great usefulness in medicine.

2. Experiments in vivo

2.1.

The most clearly expressed the possibility to study bone development is based on ectopic osteogenesis in vivo. It can be induced, for example, by implantation of demineralized bone matrix (Urist, Science 150 (1965), 893-899). By combining the inactive matrix with inducing bone proteins can induce the same process as described, for example, Sampath and others (PNAS denotes Proc.Natl.Acad.Sci., USA), 78 (1981, 7599-7603). This process of bone formation similar to that of embryonic enchondral bone formation and treatment of the bones in adulthood. Thus, this method makes it possible to study proteins in their ability to induktiven bone in vivo.

For this experiment Mr 52 protein, which is produced by the expression system opulation (see example 2), partially purified and implanted.

For this purpose B cells (HuTk-, ATCC CRL 8303) grown in cups for cultivation and small passenger vessels up to Confluencia and, as described in example 2 for analyses by the expression, infect using recombinant VI the moustache, washed and left to accumulate about 20 hours Mr 52 in MEM (Gibco BRL, about 1 ml to 106cells). As the control is carried out by the same preparation by infection with wild-type viruses. The supernatant of the culture cells (conditioned medium) of each preparation (mixture) is collected and centrifuged (40000×g for 30 minutes at 4°). To remove virus supernatant filtered through inorganic filters (size of pores of 0.1 μm, Whatman, Anotop 25). During okharakterizovanie MP-52 was able to find that this protein binds to the heparin-separate. This behavior is used for partial purification. For this purpose, filtered and centrifuged, air-conditioned environment is brought to a final concentration of 50 mmol TRIS, pH=7,0; 100 mmol NaCl and 6 mol of urea and loaded into a column of heparin (HiTropTM, Pharmacia # 17-0407-01), which is equilibrated with buffer A (50 mmol TRIS, pH=7,0, 100 mmol NaCl and 6 mol of urea). The loaded column was washed with buffer a and using a linear gradient to 100% buffer B (50 mmol TRIS, pH=7,0 600 mmol NaCl and 6 mol of urea) at a speed of expiration of 0.5 ml/min elute in 50 minutes (2.5 ml per fraction). Urea is optional. By Western blot analysis (see example 2) can also be checked that Mr 52 reproducibly eluted in the basis of the nom in 2 fractions at a concentration of NaCl of about 250-400 µm. Aliquots of these fractions also, according to the manufacturer's instructions, check with painted silver 15-percentage polyacrylamide gels (Silver Stain II, Daiichi # SE 140000) and unite. Comparable fractions after purification from conditioned medium after infection with wild-type viruses also be combined after analysis in painted silver gels.

From further research in relation to Mr 52 it follows that Mr 52 also binds to hydroxyapatite. Therefore, in principle, it is possible to achieve further purification using column hydroxyapatite, respectively, to replace a column of heparin (e.g., BIO-RAD Econo-RAS STD). For further cleaning can be another, well-known specialist methods, such as column with gel sieves (), columns with ion exchangers, affinity columns, column chelates metals or columns based on hydrophobic interactions.

Pre-purified by chromatography on heparin-sepharose Mr 52 protein, respectively even, respectively contaminating proteins that are also found in infected wild-type supernatant fluids cell culture, purified further using reversed phase HPLC (high performance liquid chromatography). For this purpose, a C8-column (Aquapore RP 300, Applied Biosystems, particle size: 7 μm; the amount by which: 300 ) balance with 10% buffer B (buffer A: 0.1% of triperoxonane acid; buffer B: 90% acetonitrile, 0.1% of triperoxonane acid). After loading the column joint, containing Mr 52 factions heparin column was washed in a large amount of 10% buffer C. Bound protein elute using the following gradient: 10 to 50% buffer b for 20 minutes and 50 to 100% buffer b for 50 minutes. Fractions of 500 µl gather and analyze by Western blot analysis, and also painted silver gels. Mr 52 protein under conditions selected eluted approximately in the region of 55-65% acetonitrile. Fractions from MP 52 unite. The same exercise with the relevant fractions from control and purification of the supernatant of virus-infected wild-type cells.

Partially purified MP 52 protein in particular by Western blotting analysis concentration of 50 ng/ml shows a clear increase in ALP activity in the R-s-cells after three stages of incubation.

Partially purified MP 52-protein, respectively, control the protein from, respectively, partially purified supernatant fluids of cell cultures after infection with wild-type viruses reconstructed matrix and implanted in rats to prove the ability of the cartilage - and osteogenesis.

In principle should be applicable different, know the local specialist matrix materials, i.e. natural (also modified) and synthetically derived matrix, preferably, however, biocompatible, biologically erodible in vivo porous materials. In these experiments apply bone matrix rats, which is essentially prepared just as described Sampath and others (PNAS,(1983), 6591-6595). Rat bones (femur and tibia) demineralized in 24 hours in 0.6 M Hcl and then remove the remaining bone marrow. After washing with water and degreaser for 3 hours in a mixture of chloroform with methanol (1:1) bones are dried in the air, frozen at a low temperature pulverized (sprayed) in the mill and separated by sieving particle size 400-1000 μm. Then the matrix within 7 days at room temperature, extracted with 4 M of guanidine-Hcl in the presence of protease inhibitors. After extensive (rich) leaching water matrix lyophilizer and stored at 4°C. Thus processed matrix is not shown, none of them, no inductively bone activity.

Protein, using different, well-known specialist methods can be combined with proektirovanii bone matrix.

Mr 52-protein, respectively, a control protein, which is cleared when using heparin-sepharose, and also converts the phase HPLC, in a solution of acetonitrile with triperoxonane acid, after elution, unite in the amount of 25 mg matrix on the implant, well-mixed, frozen at low temperatures and lyophilizers.

For implantation associated with the matrix Mr 52 using rats (Wistar) at the age of about 3 months, which lead to a state of General anesthesia by intramuscular injection of anesthesia means (0.2 ml Rompun (Bayer), mixed with 0.5 ml Ketanest 50 (Parke Davis)) in an amount of 0.14 ml per 100 g body weight. For implants prepared from two sides of the pockets in the abdominal muscles (below the ribcage, starting approximately 0.5 cm below the lower costal arch). Associated with the matrix Mr 52 (approximately 2-4 µg according to the definition by Western blotting analysis), and respectively associated with the matrix control proteins moisturize with a 0.9%solution of sodium chloride (Delta Pharma) and transferred into muscle pockets. Muscle pockets, and the skin incisions are then closed with stitches. Rats immunomodulate using cyclosporine A (Sandimmun).

After 18, respectively 26, the day the implant is removed from rats and fixed for histological studies. Since the implant with Mr 52 after 26 days already suggests macroscopically bone formation, then it is put (close up) in methyl methacrylate for the preparation of thin films; other implants in elewaut in paraffin. Mineralized cartilage and bone black (make black) by way of colouring Von Kossa (Romeis Century, Mikroskopische Technik, ed.P.; Urban and Schwarzenberg;, Baltimore, Wien/1989/). When painting with tramacastilla (according Masson-Coldner (Romeis Century; Mikroskopische Technik, ed.,P.; Urban and Schwarzenberg;, Baltimore, Wien /1989/) mineralized bone tissue and collagen turn slightly green, osteoid is red and the cytoplasm has a reddish-brown color. The implants of both rats used both methods of staining. Using both methods of staining in the cases of both experimental animals can prove distinct cartilage and bone formation in implants that contain Mr 52. Appropriate implants with a control protein did not show any cartilage and bone formation. Share prestudy cartilage with chondrocytes and cartilaginous areas from the beginning of the formation of extracellular matrix and its mineralization in concentric circles in the implant with Mr 52 18 days later is higher than in the se after 26 days. However, also in the implant after 18 days already detected Mature bone tissue with vectorially the formation of osteoid, as well as individual osteocytes in bone. Next, recognizable snapped the bone (Ossikel) from the beginning of the formation of bone marrow. In the case of the implant after 26 days also found the cartilaginous area from the beginning of the formation matrix and calcification, the share of green-colored mineralized bone with osteocytes and osteogram edges, however, clearly increased. Also in this implant is detected the formation of bone marrow with a single (individual) cases of fat cells.

Experience shows that recombinante received MP-52, alone, in combination with the matrix, able to induce enchondral bone formation.

2.2.

To confirm the results provide another test of ectopic bone formation during the application of the transformants due to Mr 52 L-cells. Producing Mr 52 (transfetsirovannyh using Hind III-MP52/pABWN) and neproducyruth Mr 52 (transfetsirovannyh using pABWN) L-cells (1×106cells) is administered by injection on both sides of the thigh muscles, taken three males naked mice. After 3 weeks all animals killed, thigh muscles separate and examine them as using x-rays with low energy, and also histopathology.

As shown in table 3, the analysis by x-ray shows a dense material in the injection in the muscle tissue of all producing Mr 52 L-cells. Using histological studies you can install a simple cartilage is education and calcinate jradiobutton in mice. Also, these results confirm that Mr 52 may induce enchondral bone formation.

Table 3
 Producing Mr 52 cells (Hind III-MP52/pABWN)Control cells (pABWN)
Dense material in the case of x-ray analysis3/30/3
The chondrocytes in the case of histology3/30/3
Calcification3/30/3
Jradiobutton if histology  

Specified in the description of the cell lines and plasmids are attached materials, confirming the data.

1. The protein TGF-β-collection, containing the amino acid sequence of SEQ ID NO2, or the Mature part of the protein TGF-β-collection, shown in Fig. 1, having the property to induce angiogenesis.

2. Pharmaceutical composition having the ability to induce angiogenesis, characterized in that it contains a protein according to claim 1 as an active substance in an effective amount, if necessary, together with pharmaceutically acceptable carriers, excipients and, diluents or fillers.

3. The pharmaceutical composition according to claim 2, characterized in that the active substance applied on natural or synthetic matrix material and/or integrated into it.

4. The pharmaceutical composition according to one of claim 2 and 3, characterized in that the matrix material is a biocompatible, biologically erodible in vivo porous material.

Priority items:

10.08.1993 on all items.



 

Same patents:

The invention relates to biotechnology, genetic engineering, medicine and can be used to treat coronary artery disease
The invention relates to the dairy industry and can be used for separation of protein fractions enriched angiogenin

The invention relates to biotechnology and medicine
The invention relates to dairy, meat industry, veterinary medicine, medicine, biology, namely the quantification of proteins

The invention relates to dairy, meat industries, veterinary medicine, medical industry, namely the quantification of proteins
The invention relates to dairy, biotechnology, medical and pharmaceutical industries, and in particular to methods of isolating biologically active compounds

FIELD: medicine, thoracic surgery, anesthesiology.

SUBSTANCE: as non-narcotic medicinal preparation one should apply heparin to be introduced intratracheally at the dosage of 300-500 IU/kg, moreover, heparin should be introduced during the first 30 min after the operation is over. The present innovation enables to create prolonged anesthetizing effect in combination with prophylaxis of postoperational thrombohemorrhagic complications due to heparin capacity to be kept in the body due to its accumulation by mast cells at blockade of their fermentative activity followed by its gradual release into the blood.

EFFECT: higher efficiency.

1 cl, 1 ex, 3 tbl

FIELD: veterinary science.

SUBSTANCE: one should introduce mineral additives into the diet of animals in postoperational period for 15-17 d at 4.0-5.0 g, zinc sulfate 0.75-1.5 g, cobalt chloride 30-35 mg, manganese sulfate 40-45 mg, potassium iodide 10-15 mg, monopotassium phosphate 80-100 per 100 kg body weight, moreover, elemental sulfur and monocalcium phosphate should be introduced in combination with concentrates, and zinc sulfate, cobalt chloride, manganese sulfate and potassium iodide should be introduced in dissolved form in the mixture with feedstuffs. The present method enables to decrease the terms for wounds healing.

EFFECT: higher efficiency.

3 tbl

FIELD: medicine, obstetrics, gynecology.

SUBSTANCE: rehabilitation should be carried out in the third trimester of pregnancy based upon dispensary situated in ecologically safe region, as an enterosorbent one should apply "Carbopect" preparation per 0.5-0.6 g once daily for 3 wk; as an iodine preparation it is necessary to prescribe "Potassium iodide" 200 mcg once daily till the end of pregnancy period and during the whole period of lactation; as adaptogens one should additionally prescribe "Revit" per 2 lozenges thrice daily for 2 wk; vitamin-containing tea; one should, also, apply aerotherapy named "mountain air" per 15-40 min, 15 procedures, totally. The present innovation enables to improve anthropometric parameters in neonatals, decrease the percentage of complications in babies in early neonatal period, among them those that require antibioticotherapy.

EFFECT: higher efficiency of rehabilitation.

2 ex

FIELD: organic chemistry, medicine, pharmacy.

SUBSTANCE: invention describes compound of the formula (I):

as a free form or salt wherein Ar means group of the formula (II):

wherein R1 means hydrogen atom or hydroxy-group; R2 and R3 each means independently of one another hydrogen atom or (C1-C4)-alkyl; R4, R5, R6 and R7 each means independently of one another hydrogen atom, (C1-C4)-alkoxy-group, (C1-C4)-alkyl or (C1-C4)-alkyl substituted with (C1-C4)-alkoxy-group; or R5 and R6 in common with carbon atoms to which they are joined mean 6-membered cycloaliphatic ring or 6-membered heterocyclic ring comprising two oxygen atoms; R8 means -NHR13 wherein R13 means hydrogen atom, (C1-C4)-alkyl or -COR14 wherein R14 means hydrogen atom; or R13 means -SO2R17 wherein R17 means (C1-C4)-alkyl; R9 means hydrogen atom; or R8 means -NHR18 wherein -NHR18 and R9 in common with carbon atoms to which they are joined mean 6-membered heterocycle; R10 means -OH; X means (C1-C4)-alkyl; Y means carbon atom; n = 1 or 2; p = 1; q = 1; r = 0 or 1. Also, invention describes pharmaceutical composition based on compound of the formula (I), a method for preparing compound of the formula (I) and intermediate compound that is used in the method for preparing. Compounds elicit the positive stimulating effect of β2-adrenoceptor.

EFFECT: improved preparing method, valuable medicinal properties of compounds.

13 cl, 3 tbl, 35 ex

The invention relates to new imidazole compounds of the formula I:

where R1represents hydrogen, hydroxy, protected hydroxy, or aryl, optionally substituted with a suitable(and) substituent(s) selected from the group consisting of halogen(lower)alkyl, halogen, hydroxy, protected carboxy, carbamoyl, lower alkylenedioxy, lower alkoxy, optionally substituted aryl, and lower alkyl, optionally substituted by hydroxy or protected carboxy; R2represents hydrogen or lower alkyl; R3is hydroxy or protected hydroxy; R4represents cyano, (hydroxy)minamino(lower)alkyl, carboxy, protected carboxy, N-containing heterocyclic group, optionally substituted amino, or carbarnoyl, optionally substituted with a suitable(s) of the substituent(s) selected from the group consisting of amino, hydroxy, lower alkyl, lower alkylsulfonyl, amidoamine(lower)alkyl, optionally substituted by hydroxy; and-And - is-Q -, or-O-Q-, where Q is a single bond or lower alkylene, or its salt, provided when R2is the lowest Ala the substituent(s), the above, and also provided that the compound of formula I is not 1-(hydroxyethyl)-4-(etoxycarbonyl)imidazole or anilide 1-(2-hydroxyethyl)imidazole-4-carboxylic acid

The invention relates to medicine, in particular to cancer, and can be used in radiation therapy of malignant tumors of the pelvic organs

The invention relates to medicine and concerns of Pediatrics and treatment of infectious diseases, namely infectious mononucleosis in children

The invention relates to the objects of the invention characterized in the claims, i.e

The invention relates to medicine, endocrinology, anesthesiology and critical care medicine and can be used as infusion therapy when ketoacidotic coma in patients with diabetes mellitus
The invention relates to medicine, operative gynecology, anesthesiology and can be used for anesthesia in cosmetic surgery for vulva in women

Thrombopoietin // 2245365

FIELD: medicine, molecular biology, polypeptides.

SUBSTANCE: invention describes homogenous polypeptide ligand mpI representing polypeptide fragment of the formula: X-hTPO-Y wherein hTPO has amino acid sequence of human fragments TPO (hML); X means a amino-terminal amino-group or amino acid(s) residue(s); Y means carboxy-terminal carboxy-group or amino acid(s) residue(s), or chimeric polypeptide, or polypeptide fragment comprising N-terminal residues of amino acid sequence hML. Also, invention relates to nucleic acid encoding polypeptide and expressing vector comprising nucleic acid. Invention describes methods for preparing the polypeptide using cell-host transformed with vector, and antibodies raised against to polypeptide. Invention describes methods and agents using active agents of this invention. The polypeptide ligand mpI effects on replication, differentiation or maturation of blood cells being especially on megacaryocytes and progenitor megacaryocyte cells that allows using polypeptides for treatment of thrombocytopenia.

EFFECT: valuable medicinal properties of polypeptide.

21 cl, 92 dwg, 14 tbl, 24 ex

The invention relates to medicine, namely to neurology for the treatment of cerebral ischemia, as well as treatment for cerebral ischemia
Up!